DOCSLIB.ORG

Rubiaceae-Rubieae Inferred from the Sequence of a Cpdna Intergene Region

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rubiaceae-Rubieae Inferred from the Sequence of a Cpdna Intergene Region Plant . P1. Syst. Evol. 190:195-211 (1994) Systematlcs and Evolution © Springer-Verlag 1994 Printed in Austria Phylogeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region JEAN-FRAN,COIS MANEN, ALESSANDRO NATALI, and FRIEDRICH EHRENDORFER Received May 10, 1993; in revised version November 30, 1993 Key words: Rubiaceae, Rubieae.- CpDNA, atp B-rbc L intergene region, phylogeny. Abstract: A phylogenetic analysis of 25 species, representing eight genera of the Rubieae tribe (Rubiaceae), has been made using the DNA sequence of the chloroplast atp B-rbc L intergene region. Six tropical genera from other tribes of Rubiaceae have been used as outgroups. Whatever the method of analysis (distance, parsimony or maximum likelihood), five groups are clearly separated and described as informal clades. Their relative relation- ships are not clearly resolved by the parsimony analysis, resulting in eight equally parsi- monious trees, 327 steps long, with a consistency index (CI) of 0.749 (excluding uninform- ative sites). The Rubieae tribe appears monophyletic from the data available. Some new and partly unexpected phylogenetic relationships are suggested. The genus Rubia forms a separate clade and appears to be the relatively advanced sister group of the remaining taxa. The Sherardia clade also includes the genera Crucianella and Phuopsis. Galium sect. Aparin- oides appears closely attached to the Asperula sect. Glabella clade. The remaining taxa of Galium are paraphyletic: Galium sect. Platygalium (in the Cruciata clade) is linked to the advanced genera Cruciata and Valantia; the more apomorphic groups of Galium form the Galium sect. Galium clade, including the perennial sections Galium, Leiogalium, and Lep- togalium as well as the annual (and possibly polyphyletic) sect. Kolgyda. We present a phylogenetic study based on DNA sequence comparisons of the intergene region, between the ATP synthetase J3-subunit (atp B) gene and the ri- bulose-l,5-biphosphate carboxylase large subunit (rbc L) gene of the chloroplast DNA (Fig. 1). We choose this non-coding region with the hope that it would allow analysis of low level intergeneric and even interspecific differentiation. A collection of oligonucleotide primers has been designed for the amplification and the se- quencing of this region (see Fig. 1). We expose here our first results obtained from the Rubieae tribe of the Rubiaceae. We also have analysed six other genera belonging to different tropical tribes, that were used as outgroups. The interesting relationships among these taxa will be discussed in another article (EHRENDORFER& al. 1994). The Rubiaceae are one of the largest of all angiosperm families, with 637 genera and 10,700 species (MABBERLEY1987). In older classifications (DE CANDOLLE 1830, SCHUMANN 1891) tWO large subfamilies, Cinchonoideae and Coffeoideae, were rec- ognized. More recently, VERI~COURT (1958) has recognized two large and one small 196 J.-F. MANEN ¢% al.: ~-~ rbcL 5' 3' sT~ I NTER'GEN E START 3' 5' atpB z-~ s--~ Oligo 2: 5'GAAGTAGTAGGATTGATTCTC3' Oligo 5: 5'TACAGTTGTCCATGTACCAG3' Oligo 7: 5'CCCTACAACTCATGAATTAAG3' Oligo 8: 5'GACATGAGAGGTAACAAC3' Fig. 1. The cpDNA region used in the phylogenetic reconstruction. The DNA matrix used in this study comprises the fragment amplified by the oligonucleotide primers 2 and 5. It contains most of the non-coding intergene region between the atp B and the rbc L genes, and the first 56 codons of rbc L. The coding sequences are represented by heavy lines. The arrows represent the approximate positions of the oligonucleotide primers used in ampli- fication and sequencing. Their sequences are given below the map subfamilies, while BREMEKAMP (1966) distinguished eight subfamilies. ROBBRECHT (1988) proposed a modified classification with four subfamilies and 44 tribes. The Rubiaceae are an essentially tropical, woody family, mostly trees and shrubs with decussate leaves and interpetiolar stipules. Only the tribe Rubieae (subfam. Rubioideae) is centred in temperate regions. It contains predominantly perennial to annual herbs with pseudo-whorls of leaves and leaf-like stipules. Following ROBBRECHT (1988) the Rubieae include the fol- lowing 15 genera: Asperula, Bataprine, Callipeltis, Crucianella, Cruciata, Didymaea, Galium, Mericarpea, Microphysa, Phuopsis, Relbunium, Rubia, Sherardia, Valantia, Warburgina. However, Didymaea is obviously not a member of Rubieae, while Bataprine must probably be included in Galium, and Warburgina in Callipeltis (EHRENDORFER, unpubl.) The only global revision of this tribe was carried out by SCHUMANN (1891, 1897). Afterwards a complete taxonomic treatment of European Rubieae has been presented for Flora Europaea (EHRENDORFER• KRENDL 1976). Some evolutionary comments are found in EHRENDORFER (1971). During the last years, restriction site variation and structural changes of chlo- roplast DNA (cpDNA) have proved to be very useful in plant systematics (PALMER 1987, PALMER ~; al. 1988). The systematic utility of this technique has been dem- onstrated for higher (JANSEN& PALMER 1987, 1988) as well as for intergeneric and infraspecific levels (ERICKSON & al. 1983; SYTSMA & GOTTLIEB, 1986a, b). Re- garding rbc L sequences, an enormous amount of work has been done in plants (see CHASE & al. 1993) during the short time since the gene was first suggested for use in phylogenetic studies (ZuRAWSKI& CLEGG 1987). Concerning the Rubiaceae, a phylogenetic analysis of 33 genera of the family has been recently made using chloroplast DNA restriction site mutations (BREMER & JANSEN 1991), indicating several new phylogenetic relationships. The Rubieae tribe was represented by only one taxon (Galium odoratum) in their study, but subsequent cpDNA restriction mapping in other members failed to give enough variations for a phylogenetic analysis of the tribe (B. BREMER,pets. comm.). Thus, regarding the Rubieae tribe, a true phylogenetic approach has not yet been proposed. There is no evidence of its monophyly, and many taxonomical Phylogeny of Rubieae 197 problems at intergeneric, interspecific, and infraspecific level still need to be elu- cidated. Consequently, our ongoing studies have several goals: 1) to test the mono- phyly of the Rubieae; 2) to evaluate generic circumscriptions; 3) to analyse rela- tionships among genera and species; 4) to provide a basis for interpreting plesio- morphic and apomorphic character states for this tribe; 5) to provide a phylogenetic reconstruction of the Rubieae based on molecular data and to compare this re- construction with the morphological data and the accepted classifications. Material and methods Plant material was either field-collected or obtained as seed that we grew in the greenhouses of the Geneva Botanical Garden. The list of the Rubiaceae genera and species studied is shown in Table 1. It represents 8 genera, 25 species, and 35 samples for the Rubieae tribe. From several species different populations coming from various regions have been studied to evaluate possible infraspecific variations. For each sample a voucher specimen is available and has been deposited in the Geneva herbarium. For the constitution of a Rubieae outgroup, six additional tropical Rubiaceae species have been incorporated in the study (which thus comprises 41 samples). Samples (around 500 rag) of fresh leaves were collected and stored at - 80 °C. DNA extraction was carried out using the modified CTAB method of WEBB & KNAPP (1990), starting with about 50 mg of liquid nitrogen ground tissue, rapidly mixed in an Eppendorf tube containing 700 ~tl of hot extraction buffer, which is incubated at 60 °C for 1 h. At the end of the extraction, the DNA pellet is suspended in 20 gl of TE 8 (10 mM Tris-C1, 1 mM EDTA, pH 8). One ~tl is amplified by the standard method using oligonucleotides 2 and 5 as primers (see Fig. 1). After the amplification checking (2 gl in a mini-agarose gel), the 100 gl amplification mixture are loaded on a preparative 1% agarose gel and the DNA band is cut off. The DNA is then extracted from the gel using Prep-A-gene (Biorad) in a volume of 20 ~tl. Three gl of the double-stranded DNA (around 200 ng) are directly se- quenced using the snap-co oling method of KUSUKAWA& al. (1990), and the oligonucleotides 2, 5, 7, and 8 as primers (see Fig. 1). A crude alignment of the sequences is obtained with the program ALIGN of HEIN (1990). The DNA matrix is then improved by hand. The sequences have been registred in the EMBL data base under accession numbers X76457 to X76481. Phylogenetic analysis of the matrix was done using different methods (FELsENSTEIN 1988) with programs incorporated in PHYLIP, vers. 3.42 (FELSENSTEIN !989) and PAUP, vers. 3.0 (SWOEFORO 1991). 1) Distance matrix method. The distance matrix was calculated with the Kimura 2-parameter formula (DNADIST program in PHYLIP) and distance trees were obtained by the neighbour-joining method (NEIGHBOR program in PHYLIP). 2) Parsimony method. We used the DNAPARS, CONSENSE, and DNABOOT programs in PHYLIP, and the heuristic search with branch swapping TBR, mulpars option of PAUP. 3) Li k eli h o o d m e t h o d. We used the DNAML program incorporated in PHYLIP. Results Table 2 shows the informative sites of the DNA matrix excluding the gaps (gap- missing option of the PAUP program). It comprises 118 positions and represents 28 sequences (out of the 41 studied) which have been found to be different. The total DNA-matrix is available on request from the senior author. Generally, dif- ferent individuals of the same species, but also some closely related species, have 198 J.-F. MANEN & al.: Table 1. Sources of cpDNA (fresh leaves) from Rubiaceae: 41 populations belonging to 31 different taxa. *The numbers relate to the numbers which appear in the phylogenetic trees (see Fig. 3). **Infrageneric references: Asperula sect. Glabella = 01, 19; GaIium sect. Leio- galium = 03, 08, 12, 13, 18, 21, 25, 26, 30, 31, sect. Galium = 23; sect. LetogaIium = 09; sect. Platygalium = 07, 16, 17, 20; sect. Aparinoides = 06, 14; sect. Kolgyda = 04, 10, 15, 24, 27, 28. ***Collectors: JEA JEANMONOD,DANIEL; MAN MANEN,JEAN-FRANCOIS; NAT NATALI, ALESSANDRO; PAL PALESE, RAOUL; ROG ROGUET, DIDIER; THI THIEBAUD, MARC-ANDRe; ZEL ZELLWEGER, CATHERINE.
Load more

Recommended publications
  • Glamorgan Botany Group 2017 Excursion Report
    Glamorgan Botany Group 2017 Excursion Report With the end of the BSBI’s date-class inching closer, our six excursions this year all focused on 1km squares with precisely zero post-2000 records in the BSBI’s database, and over the course of our visits we recorded plants in 24 of these squares. As always, it is difficult to pick highlights, but April’s Ceratochloa carinata (California Brome) and September’s Juncus foliosus (Leafy Rush) certainly rank among the most significant discoveries... although those preferring plants with less ‘specialist appeal’ may have chosen the fine display of Dactylorhiza praetermissa (Southern Marsh Orchid) in June or the array of bog plants in July and September! Of course, we’re always sharing tips on plant identification, and this year provided plenty of opportunities to do that too – so if you want to get to know Glamorgan’s plants better, then keep an eye out for our 2018 excursion plan, which we’ll send round in February. David Barden, Karen Wilkinson and Julian Woodman Barry – Saturday 22 April On a bright, sunny, warm day, 10 botanists met to explore the open spaces in and around the old villages of Cadoxton and Merthyr Dyfan, now well within the urban area of Barry. Starting in a small area of grassland next to our meeting point, we found a few species of interest including Medicago arabica (Spotted Medick), Lactuca virosa (Great Lettuce), and Papaver lecoqii (Yellow-juiced Poppy, identified by its yellow sap). Moving into Victoria Park (shown on old maps as Cadoxton Common), we found a good range of species of short grassland, with pale- flowered Geranium molle (Dove’s-foot Cranesbill) resulting in an examination of the characteristics separating it from G.
    [Show full text]
  • Coumarins and Iridoids from Crucianella Graeca, Cruciata Glabra, Cruciata Laevipes and Cruciata Pedemontana (Rubiaceae) Maya Iv
    Coumarins and Iridoids from Crucianella graeca, Cruciata glabra, Cruciata laevipes and Cruciata pedemontana (Rubiaceae) Maya Iv. Mitova3, Mincho E. Anchevb, Stefan G. Panev3, Nedjalka V. Handjieva3 and Simeon S. Popov3 a Institute of Organic Chemistry with Centre of Phytochemistry, Bulgarian Academy of Sciences, Sofia 1113, Bulgaria h Institute of Botany, Bulgarian Academy of Sciences, Sofia 1113, Bulgaria Z. Naturforsch. 51c, 631-634 (1996); received May 23/July8 , 1996 Rubiaceae, Crucianella, Cruciata, Coumarins, Iridoids The coumarin and iridoid composition of Crucianella graeca, Cruciata glabra, Cruciata laevipes and Cruciata pedemontana has been studied. Daphnin and daphnetin glucoside do­ minated in C. glabra along with low concentrations of daphnetin, deacetylasperulosidic acid and scandoside. In C. laevipes and C. pedemontana were found the same coumarin glucosides along with six iridoid glucosides. In Crucianella graeca were found ten iridoid glucosides. Introduction Thirteen pure compounds (Fig. 1) were isolated and identified by 'H and 13C NMR spectra (Ta­ Crucianella L. and Cruciata Mill. (Rubiaceae) ble I) and comparisons with authentic samples as are represented each by three species in the Bul­ the coumarins, daphnin (1), daphnetin glucoside garian flora (Ancev, 1976, 1979). They are mor­ (2) and daphnetin (3) (Jevers et al., 1978) and the phologically well differentiated and all except iridoids, deacetylasperulosidic acid (4), scandoside Cruciata glabra (L.) Ehrend., do not suggest seri­ (5), asperuloside (6), asperulosidic acid (7), methyl ous taxonomic problems. The coumarins, scopo- ester of deacetylasperulosidic acid (8), daphyllo­ letin, umbelliferone and cruciatin and the iridoid side (9), geniposidic acid (10), 10-hydroxyloganin glucosides monotropein, asperuloside and au- (11), deacetylasperuloside (12) and iridoid V3 (13) cubin, were found in some Cruciata species (Bo­ (Boros and Stermitz, 1990; El-Naggar & Beal, risov, 1967, 1974; Borisov and Borisyuk, 1965; Bo­ 1980).
    [Show full text]
  • Redalyc.LECTOTYPIFICATION of DIDYMAEA MEXICANA HOOK. F
    Acta Botánica Mexicana ISSN: 0187-7151 [email protected] Instituto de Ecología, A.C. México Lorence, David LECTOTYPIFICATION OF DIDYMAEA MEXICANA HOOK. F. (RUBIACEAE, RUBIEAE) AND THE IDENTITY OF D. ALSINOIDES (SCHLTDL. & CHAM.) STANDL Acta Botánica Mexicana, núm. 88, julio, 2009, pp. 73-79 Instituto de Ecología, A.C. Pátzcuaro, México Available in: http://www.redalyc.org/articulo.oa?id=57411548006 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Acta Botanica Mexicana 88: 73-79 (2009) LECTOTYPIFICATION OF DIDYmaEA MEXICANA HOOK. F. (RUBIACEAE, RUBIEAE) AND THE IDENTITY OF D. ALSINOIDES (SChlTDL. & ChAM.) STANDL. DAVI D LORENCE National Tropical Botanical Garden, 3530 Papalina Road, Kalaheo, HI 96741 USA. [email protected] ABSTRACT The name Didymaea alsinoides (Schltdl. & Cham.) Standl. has been incorrectly applied to a common and wide-ranging Mexican and Central American species whose correct identity is Didymaea mexicana Hook. f. In this paper a lectotype is selected and designated for D. mexicana. The characters separating these two frequently confused species are discussed. Further systematic studies of the genus Didymaea are suggested. Key words: Central America, Didymaea, Mexico, Rubiaceae, typification. RESUMEN El nombre Didymaea alsinoides (Schltdl. & Cham). Standl. ha sido aplicado incorrectamente a una especie común y de amplia distribución en Mexico y América Central, cuya identidad correcta es Didymaea mexicana Hook. f. Se selecciona y designa un lectotipo para D. mexicana. Se discuten los caracteres que separan estos dos taxa.
    [Show full text]
  • FLORA from FĂRĂGĂU AREA (MUREŞ COUNTY) AS POTENTIAL SOURCE of MEDICINAL PLANTS Silvia OROIAN1*, Mihaela SĂMĂRGHIŢAN2
    ISSN: 2601 – 6141, ISSN-L: 2601 – 6141 Acta Biologica Marisiensis 2018, 1(1): 60-70 ORIGINAL PAPER FLORA FROM FĂRĂGĂU AREA (MUREŞ COUNTY) AS POTENTIAL SOURCE OF MEDICINAL PLANTS Silvia OROIAN1*, Mihaela SĂMĂRGHIŢAN2 1Department of Pharmaceutical Botany, University of Medicine and Pharmacy of Tîrgu Mureş, Romania 2Mureş County Museum, Department of Natural Sciences, Tîrgu Mureş, Romania *Correspondence: Silvia OROIAN [email protected] Received: 2 July 2018; Accepted: 9 July 2018; Published: 15 July 2018 Abstract The aim of this study was to identify a potential source of medicinal plant from Transylvanian Plain. Also, the paper provides information about the hayfields floral richness, a great scientific value for Romania and Europe. The study of the flora was carried out in several stages: 2005-2008, 2013, 2017-2018. In the studied area, 397 taxa were identified, distributed in 82 families with therapeutic potential, represented by 164 medical taxa, 37 of them being in the European Pharmacopoeia 8.5. The study reveals that most plants contain: volatile oils (13.41%), tannins (12.19%), flavonoids (9.75%), mucilages (8.53%) etc. This plants can be used in the treatment of various human disorders: disorders of the digestive system, respiratory system, skin disorders, muscular and skeletal systems, genitourinary system, in gynaecological disorders, cardiovascular, and central nervous sistem disorders. In the study plants protected by law at European and national level were identified: Echium maculatum, Cephalaria radiata, Crambe tataria, Narcissus poeticus ssp. radiiflorus, Salvia nutans, Iris aphylla, Orchis morio, Orchis tridentata, Adonis vernalis, Dictamnus albus, Hammarbya paludosa etc. Keywords: Fărăgău, medicinal plants, human disease, Mureş County 1.
    [Show full text]
  • 28. GALIUM Linnaeus, Sp. Pl. 1: 105. 1753
    Fl. China 19: 104–141. 2011. 28. GALIUM Linnaeus, Sp. Pl. 1: 105. 1753. 拉拉藤属 la la teng shu Chen Tao (陈涛); Friedrich Ehrendorfer Subshrubs to perennial or annual herbs. Stems often weak and clambering, often notably prickly or “sticky” (i.e., retrorsely aculeolate, “velcro-like”). Raphides present. Leaves opposite, mostly with leaflike stipules in whorls of 4, 6, or more, usually sessile or occasionally petiolate, without domatia, abaxial epidermis sometimes punctate- to striate-glandular, mostly with 1 main nerve, occasionally triplinerved or palmately veined; stipules interpetiolar and usually leaflike, sometimes reduced. Inflorescences mostly terminal and axillary (sometimes only axillary), thyrsoid to paniculiform or subcapitate, cymes several to many flowered or in- frequently reduced to 1 flower, pedunculate to sessile, bracteate or bracts reduced especially on higher order axes [or bracts some- times leaflike and involucral], bracteoles at pedicels lacking. Flowers mostly bisexual and monomorphic, hermaphroditic, sometimes unisexual, andromonoecious, occasionally polygamo-dioecious or dioecious, pedicellate to sessile, usually quite small. Calyx with limb nearly always reduced to absent; hypanthium portion fused with ovary. Corolla white, yellow, yellow-green, green, more rarely pink, red, dark red, or purple, rotate to occasionally campanulate or broadly funnelform; tube sometimes so reduced as to give appearance of free petals, glabrous inside; lobes (3 or)4(or occasionally 5), valvate in bud. Stamens (3 or)4(or occasionally 5), inserted on corolla tube near base, exserted; filaments developed to ± reduced; anthers dorsifixed. Inferior ovary 2-celled, ± didymous, ovoid, ellipsoid, or globose, smooth, papillose, tuberculate, or with hooked or rarely straight trichomes, 1 erect and axile ovule in each cell; stigmas 2-lobed, exserted.
    [Show full text]
  • Download (592Kb)
    This is an Open Access document downloaded from ORCA, Cardiff University's institutional repository: http://orca.cf.ac.uk/134581/ This is the author’s version of a work that was submitted to / accepted for publication. Citation for final published version: Raye, Lee 2020. The wild plants of Scotia Illustrata (1684). British & Irish Botany 2 (3) , pp. 240- 258. 10.33928/bib.2020.02.240 file Publishers page: http://dx.doi.org/10.33928/bib.2020.02.240 <http://dx.doi.org/10.33928/bib.2020.02.240> Please note: Changes made as a result of publishing processes such as copy-editing, formatting and page numbers may not be reflected in this version. For the definitive version of this publication, please refer to the published source. You are advised to consult the publisher’s version if you wish to cite this paper. This version is being made available in accordance with publisher policies. See http://orca.cf.ac.uk/policies.html for usage policies. Copyright and moral rights for publications made available in ORCA are retained by the copyright holders. British & Irish Botany 2(3): 240-258, 2020 The wild plants of Scotia Illustrata (1684) Lee Raye Cardiff University, Wales, UK Corresponding author: Lee Raye: [email protected] This pdf constitutes the Version of Record published on 31st August 2020 Abstract Scotia Illustrata was published in 1684 and contains a section (II:1) describing 662 ‘naturally occurring plants of Scotland’. This paper sets out to identify and discuss the species in the text. It was possible to identify 652 species from the text and 396 could be securely identified.
    [Show full text]
  • Etude Sur L'origine Et L'évolution Des Variations Florales Chez Delphinium L. (Ranunculaceae) À Travers La Morphologie, L'anatomie Et La Tératologie
    Etude sur l'origine et l'évolution des variations florales chez Delphinium L. (Ranunculaceae) à travers la morphologie, l'anatomie et la tératologie : 2019SACLS126 : NNT Thèse de doctorat de l'Université Paris-Saclay préparée à l'Université Paris-Sud ED n°567 : Sciences du végétal : du gène à l'écosystème (SDV) Spécialité de doctorat : Biologie Thèse présentée et soutenue à Paris, le 29/05/2019, par Felipe Espinosa Moreno Composition du Jury : Bernard Riera Chargé de Recherche, CNRS (MECADEV) Rapporteur Julien Bachelier Professeur, Freie Universität Berlin (DCPS) Rapporteur Catherine Damerval Directrice de Recherche, CNRS (Génétique Quantitative et Evolution Le Moulon) Présidente Dario De Franceschi Maître de Conférences, Muséum national d'Histoire naturelle (CR2P) Examinateur Sophie Nadot Professeure, Université Paris-Sud (ESE) Directrice de thèse Florian Jabbour Maître de conférences, Muséum national d'Histoire naturelle (ISYEB) Invité Etude sur l'origine et l'évolution des variations florales chez Delphinium L. (Ranunculaceae) à travers la morphologie, l'anatomie et la tératologie Remerciements Ce manuscrit présente le travail de doctorat que j'ai réalisé entre les années 2016 et 2019 au sein de l'Ecole doctorale Sciences du végétale: du gène à l'écosystème, à l'Université Paris-Saclay Paris-Sud et au Muséum national d'Histoire naturelle de Paris. Même si sa réalisation a impliqué un investissement personnel énorme, celui-ci a eu tout son sens uniquement et grâce à l'encadrement, le soutien et l'accompagnement de nombreuses personnes que je remercie de la façon la plus sincère. Je remercie très spécialement Florian Jabbour et Sophie Nadot, mes directeurs de thèse.
    [Show full text]
  • Understory Plant Species Diversity of Asalem's Forests, Northern Iran
    Forestry Research and Engineering: International Journal Research Article Open Access Understory plant species diversity of Asalem’s forests, northern Iran Abstract Volume 3 Issue 2 - 2019 The diversity of plants in forests understory is important from different perspectives. Habib Yazdanshenas,1 Mehdi Kalagar,2 Mehdi Thus, present research was carried out to find the chorology, origin and diversity of 3 the understory plants species in Asalem’s forests, northern Iran. Basic studies were Moradipour Toularoud 1Faculty of Natural Resources, University of Tehran, Iran conducted on the geographic characteristics of the region. The direct visiting forests 2Research and Innovation Center of ETKA Organization, Iran method were selected for investigation of tree and understory plants species (herbs) 3Shafarood Forest Company’s Director of Research and which lasted of the year 2017 to 2018. Sampling of understory vegetation were done, Innovation, Iran recorded and identified based on available scientific references. The results showed that there are more than 152 species belonging to 124 genera and 61 families existed Correspondence: Habib Yazdanshenas, Faculty of Natural in forest understory. The largest families were Asteraceae, Rosaceae, Poaceae and Resources, University of Tehran, Iran +98137546924, Apiaceae with 17, 13, 11 and 10 species, respectively. Investigation of the geographical Email distribution of plant species indicated that there is a composition of Europe–Siberian, Iran-Turan, Mediterranean (and Polyregional and cosmo) plant elements. Plant life Received: January 01, 2019 | Published: March 27, 2019 forms by Raunkiaer method showed that phanerophytes with 28 % and Chameophytes = Therophytes with 26 % are the most frequent life forms in this area. Also, plant diversity was higher in areas with sparse tree cover, but in degraded areas or areas with high tree vegetation understory plants diversity was low.
    [Show full text]
  • Bonpland and Humboldt Specimens, Field Notes, and Herbaria; New Insights from a Study of the Monocotyledons Collected in Venezuela
    Bonpland and Humboldt specimens, field notes, and herbaria; new insights from a study of the monocotyledons collected in Venezuela Fred W. Stauffer, Johann Stauffer & Laurence J. Dorr Abstract Résumé STAUFFER, F. W., J. STAUFFER & L. J. DORR (2012). Bonpland and STAUFFER, F. W., J. STAUFFER & L. J. DORR (2012). Echantillons de Humboldt specimens, field notes, and herbaria; new insights from a study Bonpland et Humboldt, carnets de terrain et herbiers; nouvelles perspectives of the monocotyledons collected in Venezuela. Candollea 67: 75-130. tirées d’une étude des monocotylédones récoltées au Venezuela. Candollea In English, English and French abstracts. 67: 75-130. En anglais, résumés anglais et français. The monocotyledon collections emanating from Humboldt and Les collections de Monocotylédones provenant des expéditions Bonpland’s expedition are used to trace the complicated ways de Humboldt et Bonpland sont utilisées ici pour retracer les in which botanical specimens collected by the expedition were cheminements complexes des spécimens collectés lors returned to Europe, to describe the present location and to de leur retour en Europe. Ces collections sont utilisées pour explore the relationship between specimens, field notes, and établir la localisation actuelle et la composition d’importants descriptions published in the multi-volume “Nova Genera et jeux de matériel associés à ce voyage, ainsi que pour explorer Species Plantarum” (1816-1825). Collections in five European les relations existantes entre les spécimens, les notes de terrain herbaria were searched for monocotyledons collected by et les descriptions parues dans les divers volumes de «Nova the explorers. In Paris, a search of the Bonpland Herbarium Genera et Species Plantarum» (1816-1825).
    [Show full text]
  • Flora Mediterranea 26
    FLORA MEDITERRANEA 26 Published under the auspices of OPTIMA by the Herbarium Mediterraneum Panormitanum Palermo – 2016 FLORA MEDITERRANEA Edited on behalf of the International Foundation pro Herbario Mediterraneo by Francesco M. Raimondo, Werner Greuter & Gianniantonio Domina Editorial board G. Domina (Palermo), F. Garbari (Pisa), W. Greuter (Berlin), S. L. Jury (Reading), G. Kamari (Patras), P. Mazzola (Palermo), S. Pignatti (Roma), F. M. Raimondo (Palermo), C. Salmeri (Palermo), B. Valdés (Sevilla), G. Venturella (Palermo). Advisory Committee P. V. Arrigoni (Firenze) P. Küpfer (Neuchatel) H. M. Burdet (Genève) J. Mathez (Montpellier) A. Carapezza (Palermo) G. Moggi (Firenze) C. D. K. Cook (Zurich) E. Nardi (Firenze) R. Courtecuisse (Lille) P. L. Nimis (Trieste) V. Demoulin (Liège) D. Phitos (Patras) F. Ehrendorfer (Wien) L. Poldini (Trieste) M. Erben (Munchen) R. M. Ros Espín (Murcia) G. Giaccone (Catania) A. Strid (Copenhagen) V. H. Heywood (Reading) B. Zimmer (Berlin) Editorial Office Editorial assistance: A. M. Mannino Editorial secretariat: V. Spadaro & P. Campisi Layout & Tecnical editing: E. Di Gristina & F. La Sorte Design: V. Magro & L. C. Raimondo Redazione di "Flora Mediterranea" Herbarium Mediterraneum Panormitanum, Università di Palermo Via Lincoln, 2 I-90133 Palermo, Italy [email protected] Printed by Luxograph s.r.l., Piazza Bartolomeo da Messina, 2/E - Palermo Registration at Tribunale di Palermo, no. 27 of 12 July 1991 ISSN: 1120-4052 printed, 2240-4538 online DOI: 10.7320/FlMedit26.001 Copyright © by International Foundation pro Herbario Mediterraneo, Palermo Contents V. Hugonnot & L. Chavoutier: A modern record of one of the rarest European mosses, Ptychomitrium incurvum (Ptychomitriaceae), in Eastern Pyrenees, France . 5 P. Chène, M.
    [Show full text]
  • Connaissance De La Flore Rare Ou Menacée De Franche-Comté C Asperula Tinctoria L
    Connaissance de la flore rare ou menacée de Franche-Comté C Asperula tinctoria L. B F C ASSOCI A TION LOI 1901 PORTE RIVOTTE 25000 BESANÇON TE L /F A X : 03 81 83 03 58 E-MA I L : [email protected] Décembre 2006 Conservatoire Botanique de Franche-Comté FERREZ Y., 2004. Connaissance de la flore rare ou menacée de Franche-Comté, Asperula tinctoria L., Conservatoire Botanique de Franche-Comté, 26 p. Cliché de couverture : Asperula tinctoria L., FERREZ Y., 2006 2 Connaissance de la flore rare ou menacée de Franche-Comté, Asperula tinctoria L. CONSERVATOIRE BOTANIQUE DE FRAN C HE -COMTÉ Connaissance de la flore rare ou menacée de Franche-Comté Asperula tinctoria L. Décembre 2006 Etude réalisée par le Conservatoire Inventaires de terrain : YORICK FERREZ , Botanique de Franche-Comté. CHRISTOPHE HENNEQUIN pour le compte de la Direction Régionale de Analyse des données : YORICK FERREZ l’Environnement de Franche-Comté et du Conseil Régional de Franche-Comté. Rédaction et mise en page : YORICK FERREZ Relecture : FRANÇOIS DEHON D T , PASCALE NUSSBAUM Connaissance de la flore rare ou menacée de Franche-Comté, Asperula tinctoria L. Sommaire 1 - Données générales sur l’espèce 3 1.1 - Nomenclature 3 1.2 - Traits distinctifs 3 1.3 - Biologie et particularité du taxon 4 1.4 - Répartition générale et menaces 4 1.5 - Statut de protection et de menace 4 2 - Statut du taxon et situation actuelle en Franche-Comté 4 2.1 - Données historiques (antérieures à 1964) 4 2.2 - Données anciennes (antérieures à 1984) 5 2.3 - Données récentes (postérieures à 1985) 5
    [Show full text]
  • D. Gargano, L. Peruzzi, KF Caparelli & G. Cesca Preliminary Observations
    D. Gargano, L. Peruzzi, K. F. Caparelli & G. Cesca Preliminary observations on the reproductive strategies in five early- flowering species of Gagea Salisb. (Liliaceae) Abstract Gargano, D., Peruzzi L., Caparelli, K. F. & Cesca, G.: Preliminary observations on the repro- dutctive strategies in five early-flowering species of Gagea Salisb. (Liliaceae). — Bocconea 21: 349-358. 2007. — ISSN 1120-4060. The field and laboratory studies about Gagea bohemica (Zauschn.) Schult. & Schult. f., G. chrysantha Schult. & Schult. f. s. l., G. granatellii (Parl.) Parl., G. lutea (L.) Ker-Gawl., G. fra- gifera (Vill.) Ehr. Bayer & G. Lòpez are carried on community structure, phenology and repro- ductive biology. The studied species show differences in terms of community characteristics (species composition, structure), time and duration of flowering, and seed production. The species of rocky environment (G. granatellii and G. bohemica) show the highest number of veg- etative individuals with respect to the flowering ones, the shortest duration of flowering and the lowest seed-set. It appears as a consequence of the low resource availability. The species of meadows (G. chrysantha, G. fragifera and G. lutea) appear instead to suffer overall the biologi- cal competition for resources and pollinators. Gross morphological analysis of the pollen grains revealed that deformed pollen is more abundant in triploid (G. chrysantha, G. granatellii) and heptaploid (G. fragifera) species, compared to the tetraploid (G. bohemica) and the hexaploid (G. lutea) ones. Seed production was very low. There is a positive correlation between amount of morphologically regular pollen and number of produced seeds. In most of the studied species we observed a trend to increase the seed production in individuals with many flowers; probably this is the result of a strategy aimed diminishing the effects of pollen- and pollinator-limitation.
    [Show full text]