Plant . P1. Syst. Evol. 190:195-211 (1994) Systematlcs and Evolution © Springer-Verlag 1994 Printed in Austria Phylogeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region JEAN-FRAN,COIS MANEN, ALESSANDRO NATALI, and FRIEDRICH EHRENDORFER Received May 10, 1993; in revised version November 30, 1993 Key words: Rubiaceae, Rubieae.- CpDNA, atp B-rbc L intergene region, phylogeny. Abstract: A phylogenetic analysis of 25 species, representing eight genera of the Rubieae tribe (Rubiaceae), has been made using the DNA sequence of the chloroplast atp B-rbc L intergene region. Six tropical genera from other tribes of Rubiaceae have been used as outgroups. Whatever the method of analysis (distance, parsimony or maximum likelihood), five groups are clearly separated and described as informal clades. Their relative relation- ships are not clearly resolved by the parsimony analysis, resulting in eight equally parsi- monious trees, 327 steps long, with a consistency index (CI) of 0.749 (excluding uninform- ative sites). The Rubieae tribe appears monophyletic from the data available. Some new and partly unexpected phylogenetic relationships are suggested. The genus Rubia forms a separate clade and appears to be the relatively advanced sister group of the remaining taxa. The Sherardia clade also includes the genera Crucianella and Phuopsis. Galium sect. Aparin- oides appears closely attached to the Asperula sect. Glabella clade. The remaining taxa of Galium are paraphyletic: Galium sect. Platygalium (in the Cruciata clade) is linked to the advanced genera Cruciata and Valantia; the more apomorphic groups of Galium form the Galium sect. Galium clade, including the perennial sections Galium, Leiogalium, and Lep- togalium as well as the annual (and possibly polyphyletic) sect. Kolgyda. We present a phylogenetic study based on DNA sequence comparisons of the intergene region, between the ATP synthetase J3-subunit (atp B) gene and the ri- bulose-l,5-biphosphate carboxylase large subunit (rbc L) gene of the chloroplast DNA (Fig. 1). We choose this non-coding region with the hope that it would allow analysis of low level intergeneric and even interspecific differentiation. A collection of oligonucleotide primers has been designed for the amplification and the se- quencing of this region (see Fig. 1). We expose here our first results obtained from the Rubieae tribe of the Rubiaceae. We also have analysed six other genera belonging to different tropical tribes, that were used as outgroups. The interesting relationships among these taxa will be discussed in another article (EHRENDORFER& al. 1994). The Rubiaceae are one of the largest of all angiosperm families, with 637 genera and 10,700 species (MABBERLEY1987). In older classifications (DE CANDOLLE 1830, SCHUMANN 1891) tWO large subfamilies, Cinchonoideae and Coffeoideae, were rec- ognized. More recently, VERI~COURT (1958) has recognized two large and one small 196 J.-F. MANEN ¢% al.: ~-~ rbcL 5' 3' sT~ I NTER'GEN E START 3' 5' atpB z-~ s--~ Oligo 2: 5'GAAGTAGTAGGATTGATTCTC3' Oligo 5: 5'TACAGTTGTCCATGTACCAG3' Oligo 7: 5'CCCTACAACTCATGAATTAAG3' Oligo 8: 5'GACATGAGAGGTAACAAC3' Fig. 1. The cpDNA region used in the phylogenetic reconstruction. The DNA matrix used in this study comprises the fragment amplified by the oligonucleotide primers 2 and 5. It contains most of the non-coding intergene region between the atp B and the rbc L genes, and the first 56 codons of rbc L. The coding sequences are represented by heavy lines. The arrows represent the approximate positions of the oligonucleotide primers used in ampli- fication and sequencing. Their sequences are given below the map subfamilies, while BREMEKAMP (1966) distinguished eight subfamilies. ROBBRECHT (1988) proposed a modified classification with four subfamilies and 44 tribes. The Rubiaceae are an essentially tropical, woody family, mostly trees and shrubs with decussate leaves and interpetiolar stipules. Only the tribe Rubieae (subfam. Rubioideae) is centred in temperate regions. It contains predominantly perennial to annual herbs with pseudo-whorls of leaves and leaf-like stipules. Following ROBBRECHT (1988) the Rubieae include the fol- lowing 15 genera: Asperula, Bataprine, Callipeltis, Crucianella, Cruciata, Didymaea, Galium, Mericarpea, Microphysa, Phuopsis, Relbunium, Rubia, Sherardia, Valantia, Warburgina. However, Didymaea is obviously not a member of Rubieae, while Bataprine must probably be included in Galium, and Warburgina in Callipeltis (EHRENDORFER, unpubl.) The only global revision of this tribe was carried out by SCHUMANN (1891, 1897). Afterwards a complete taxonomic treatment of European Rubieae has been presented for Flora Europaea (EHRENDORFER• KRENDL 1976). Some evolutionary comments are found in EHRENDORFER (1971). During the last years, restriction site variation and structural changes of chlo- roplast DNA (cpDNA) have proved to be very useful in plant systematics (PALMER 1987, PALMER ~; al. 1988). The systematic utility of this technique has been dem- onstrated for higher (JANSEN& PALMER 1987, 1988) as well as for intergeneric and infraspecific levels (ERICKSON & al. 1983; SYTSMA & GOTTLIEB, 1986a, b). Re- garding rbc L sequences, an enormous amount of work has been done in plants (see CHASE & al. 1993) during the short time since the gene was first suggested for use in phylogenetic studies (ZuRAWSKI& CLEGG 1987). Concerning the Rubiaceae, a phylogenetic analysis of 33 genera of the family has been recently made using chloroplast DNA restriction site mutations (BREMER & JANSEN 1991), indicating several new phylogenetic relationships. The Rubieae tribe was represented by only one taxon (Galium odoratum) in their study, but subsequent cpDNA restriction mapping in other members failed to give enough variations for a phylogenetic analysis of the tribe (B. BREMER,pets. comm.). Thus, regarding the Rubieae tribe, a true phylogenetic approach has not yet been proposed. There is no evidence of its monophyly, and many taxonomical Phylogeny of Rubieae 197 problems at intergeneric, interspecific, and infraspecific level still need to be elu- cidated. Consequently, our ongoing studies have several goals: 1) to test the mono- phyly of the Rubieae; 2) to evaluate generic circumscriptions; 3) to analyse rela- tionships among genera and species; 4) to provide a basis for interpreting plesio- morphic and apomorphic character states for this tribe; 5) to provide a phylogenetic reconstruction of the Rubieae based on molecular data and to compare this re- construction with the morphological data and the accepted classifications. Material and methods Plant material was either field-collected or obtained as seed that we grew in the greenhouses of the Geneva Botanical Garden. The list of the Rubiaceae genera and species studied is shown in Table 1. It represents 8 genera, 25 species, and 35 samples for the Rubieae tribe. From several species different populations coming from various regions have been studied to evaluate possible infraspecific variations. For each sample a voucher specimen is available and has been deposited in the Geneva herbarium. For the constitution of a Rubieae outgroup, six additional tropical Rubiaceae species have been incorporated in the study (which thus comprises 41 samples). Samples (around 500 rag) of fresh leaves were collected and stored at - 80 °C. DNA extraction was carried out using the modified CTAB method of WEBB & KNAPP (1990), starting with about 50 mg of liquid nitrogen ground tissue, rapidly mixed in an Eppendorf tube containing 700 ~tl of hot extraction buffer, which is incubated at 60 °C for 1 h. At the end of the extraction, the DNA pellet is suspended in 20 gl of TE 8 (10 mM Tris-C1, 1 mM EDTA, pH 8). One ~tl is amplified by the standard method using oligonucleotides 2 and 5 as primers (see Fig. 1). After the amplification checking (2 gl in a mini-agarose gel), the 100 gl amplification mixture are loaded on a preparative 1% agarose gel and the DNA band is cut off. The DNA is then extracted from the gel using Prep-A-gene (Biorad) in a volume of 20 ~tl. Three gl of the double-stranded DNA (around 200 ng) are directly se- quenced using the snap-co oling method of KUSUKAWA& al. (1990), and the oligonucleotides 2, 5, 7, and 8 as primers (see Fig. 1). A crude alignment of the sequences is obtained with the program ALIGN of HEIN (1990). The DNA matrix is then improved by hand. The sequences have been registred in the EMBL data base under accession numbers X76457 to X76481. Phylogenetic analysis of the matrix was done using different methods (FELsENSTEIN 1988) with programs incorporated in PHYLIP, vers. 3.42 (FELSENSTEIN !989) and PAUP, vers. 3.0 (SWOEFORO 1991). 1) Distance matrix method. The distance matrix was calculated with the Kimura 2-parameter formula (DNADIST program in PHYLIP) and distance trees were obtained by the neighbour-joining method (NEIGHBOR program in PHYLIP). 2) Parsimony method. We used the DNAPARS, CONSENSE, and DNABOOT programs in PHYLIP, and the heuristic search with branch swapping TBR, mulpars option of PAUP. 3) Li k eli h o o d m e t h o d. We used the DNAML program incorporated in PHYLIP. Results Table 2 shows the informative sites of the DNA matrix excluding the gaps (gap- missing option of the PAUP program). It comprises 118 positions and represents 28 sequences (out of the 41 studied) which have been found to be different. The total DNA-matrix is available on request from the senior author. Generally, dif- ferent individuals of the same species, but also some closely related species, have 198 J.-F. MANEN & al.: Table 1. Sources of cpDNA (fresh leaves) from Rubiaceae: 41 populations belonging to 31 different taxa. *The numbers relate to the numbers which appear in the phylogenetic trees (see Fig. 3). **Infrageneric references: Asperula sect. Glabella = 01, 19; GaIium sect. Leio- galium = 03, 08, 12, 13, 18, 21, 25, 26, 30, 31, sect. Galium = 23; sect. LetogaIium = 09; sect. Platygalium = 07, 16, 17, 20; sect. Aparinoides = 06, 14; sect. Kolgyda = 04, 10, 15, 24, 27, 28. ***Collectors: JEA JEANMONOD,DANIEL; MAN MANEN,JEAN-FRANCOIS; NAT NATALI, ALESSANDRO; PAL PALESE, RAOUL; ROG ROGUET, DIDIER; THI THIEBAUD, MARC-ANDRe; ZEL ZELLWEGER, CATHERINE.