Rubiaceae-Rubieae Inferred from the Sequence of a Cpdna Intergene Region

Home , Asperula, Callipeltis, Crucianella, Cruciata, Cruciata laevipes, Didymaea

Plant . P1. Syst. Evol. 190:195-211 (1994) Systematlcs and Evolution © Springer-Verlag 1994 Printed in Austria

Phylogeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region

JEAN-FRAN,COIS MANEN, ALESSANDRO NATALI, and FRIEDRICH EHRENDORFER

Received May 10, 1993; in revised version November 30, 1993

Key words: Rubiaceae, Rubieae.- CpDNA, atp B-rbc L intergene region, phylogeny. Abstract: A phylogenetic analysis of 25 species, representing eight genera of the Rubieae tribe (Rubiaceae), has been made using the DNA sequence of the chloroplast atp B-rbc L intergene region. Six tropical genera from other tribes of Rubiaceae have been used as outgroups. Whatever the method of analysis (distance, parsimony or maximum likelihood), five groups are clearly separated and described as informal clades. Their relative relationships are not clearly resolved by the parsimony analysis, resulting in eight equally parsimonious trees, 327 steps long, with a consistency index (CI) of 0.749 (excluding uninformative sites). The Rubieae tribe appears monophyletic from the data available. Some new and partly unexpected phylogenetic relationships are suggested. The genus Rubia forms a separate clade and appears to be the relatively advanced sister group of the remaining taxa. The Sherardia clade also includes the genera Crucianella and Phuopsis. Galium sect. Aparin- oides appears closely attached to the Asperula sect. Glabella clade. The remaining taxa of Galium are paraphyletic: Galium sect. Platygalium (in the Cruciata clade) is linked to the advanced genera Cruciata and Valantia; the more apomorphic groups of Galium form the Galium sect. Galium clade, including the perennial sections Galium, Leiogalium, and Lep- togalium as well as the annual (and possibly polyphyletic) sect. Kolgyda.

We present a phylogenetic study based on DNA sequence comparisons of the intergene region, between the ATP synthetase J3-subunit (atp B) gene and the ri- bulose-l,5-biphosphate carboxylase large subunit (rbc L) gene of the chloroplast DNA (Fig. 1). We choose this non-coding region with the hope that it would allow analysis of low level intergeneric and even interspecific differentiation. A collection of oligonucleotide primers has been designed for the amplification and the sequencing of this region (see Fig. 1). We expose here our first results obtained from the Rubieae tribe of the Rubiaceae. We also have analysed six other genera belonging to different tropical tribes, that were used as outgroups. The interesting relationships among these taxa will be discussed in another article (EHRENDORFER& al. 1994). The Rubiaceae are one of the largest of all angiosperm families, with 637 genera and 10,700 species (MABBERLEY1987). In older classifications (DE CANDOLLE 1830, SCHUMANN 1891) tWO large subfamilies, Cinchonoideae and Coffeoideae, were recognized. More recently, VERI~COURT (1958) has recognized two large and one small 196 J.-F. MANEN ¢% al.:

~-~ rbcL 5' 3' sT~ I NTER'GEN E START 3' 5' atpB z-~ s--~

Oligo 2: 5'GAAGTAGTAGGATTGATTCTC3' Oligo 5: 5'TACAGTTGTCCATGTACCAG3' Oligo 7: 5'CCCTACAACTCATGAATTAAG3' Oligo 8: 5'GACATGAGAGGTAACAAC3'

Fig. 1. The cpDNA region used in the phylogenetic reconstruction. The DNA matrix used in this study comprises the fragment amplified by the oligonucleotide primers 2 and 5. It contains most of the non-coding intergene region between the atp B and the rbc L genes, and the first 56 codons of rbc L. The coding sequences are represented by heavy lines. The arrows represent the approximate positions of the oligonucleotide primers used in amplification and sequencing. Their sequences are given below the map subfamilies, while BREMEKAMP (1966) distinguished eight subfamilies. ROBBRECHT (1988) proposed a modified classification with four subfamilies and 44 tribes. The Rubiaceae are an essentially tropical, woody family, mostly trees and shrubs with decussate leaves and interpetiolar stipules. Only the tribe Rubieae (subfam. Rubioideae) is centred in temperate regions. It contains predominantly perennial to annual herbs with pseudo-whorls of leaves and leaf-like stipules. Following ROBBRECHT (1988) the Rubieae include the following 15 genera: Asperula, Bataprine, Callipeltis, Crucianella, Cruciata, Didymaea, Galium, Mericarpea, Microphysa, Phuopsis, Relbunium, Rubia, Sherardia, Valantia, Warburgina. However, Didymaea is obviously not a member of Rubieae, while Bataprine must probably be included in Galium, and Warburgina in Callipeltis (EHRENDORFER, unpubl.) The only global revision of this tribe was carried out by SCHUMANN (1891, 1897). Afterwards a complete taxonomic treatment of European Rubieae has been presented for Flora Europaea (EHRENDORFER• KRENDL 1976). Some evolutionary comments are found in EHRENDORFER (1971). During the last years, restriction site variation and structural changes of chloroplast DNA (cpDNA) have proved to be very useful in plant systematics (PALMER 1987, PALMER ~; al. 1988). The systematic utility of this technique has been demonstrated for higher (JANSEN& PALMER 1987, 1988) as well as for intergeneric and infraspecific levels (ERICKSON & al. 1983; SYTSMA & GOTTLIEB, 1986a, b). Re- garding rbc L sequences, an enormous amount of work has been done in plants (see CHASE & al. 1993) during the short time since the gene was first suggested for use in phylogenetic studies (ZuRAWSKI& CLEGG 1987). Concerning the Rubiaceae, a phylogenetic analysis of 33 genera of the family has been recently made using chloroplast DNA restriction site mutations (BREMER & JANSEN 1991), indicating several new phylogenetic relationships. The Rubieae tribe was represented by only one taxon (Galium odoratum) in their study, but subsequent cpDNA restriction mapping in other members failed to give enough variations for a phylogenetic analysis of the tribe (B. BREMER,pets. comm.). Thus, regarding the Rubieae tribe, a true phylogenetic approach has not yet been proposed. There is no evidence of its monophyly, and many taxonomical Phylogeny of Rubieae 197 problems at intergeneric, interspecific, and infraspecific level still need to be elu- cidated. Consequently, our ongoing studies have several goals: 1) to test the monophyly of the Rubieae; 2) to evaluate generic circumscriptions; 3) to analyse relationships among genera and species; 4) to provide a basis for interpreting plesiomorphic and apomorphic character states for this tribe; 5) to provide a phylogenetic reconstruction of the Rubieae based on molecular data and to compare this reconstruction with the morphological data and the accepted classifications.

Material and methods Plant material was either field-collected or obtained as seed that we grew in the greenhouses of the Geneva Botanical Garden. The list of the Rubiaceae genera and species studied is shown in Table 1. It represents 8 genera, 25 species, and 35 samples for the Rubieae tribe. From several species different populations coming from various regions have been studied to evaluate possible infraspecific variations. For each sample a voucher specimen is available and has been deposited in the Geneva herbarium. For the constitution of a Rubieae outgroup, six additional tropical Rubiaceae species have been incorporated in the study (which thus comprises 41 samples). Samples (around 500 rag) of fresh leaves were collected and stored at - 80 °C. DNA extraction was carried out using the modified CTAB method of WEBB & KNAPP (1990), starting with about 50 mg of liquid nitrogen ground tissue, rapidly mixed in an Eppendorf tube containing 700 ~tl of hot extraction buffer, which is incubated at 60 °C for 1 h. At the end of the extraction, the DNA pellet is suspended in 20 gl of TE 8 (10 mM Tris-C1, 1 mM EDTA, pH 8). One ~tl is amplified by the standard method using oligonucleotides 2 and 5 as primers (see Fig. 1). After the amplification checking (2 gl in a mini-agarose gel), the 100 gl amplification mixture are loaded on a preparative 1% agarose gel and the DNA band is cut off. The DNA is then extracted from the gel using Prep-A-gene (Biorad) in a volume of 20 ~tl. Three gl of the double-stranded DNA (around 200 ng) are directly se- quenced using the snap-co oling method of KUSUKAWA& al. (1990), and the oligonucleotides 2, 5, 7, and 8 as primers (see Fig. 1). A crude alignment of the sequences is obtained with the program ALIGN of HEIN (1990). The DNA matrix is then improved by hand. The sequences have been registred in the EMBL data base under accession numbers X76457 to X76481. Phylogenetic analysis of the matrix was done using different methods (FELsENSTEIN 1988) with programs incorporated in PHYLIP, vers. 3.42 (FELSENSTEIN !989) and PAUP, vers. 3.0 (SWOEFORO 1991). 1) Distance matrix method. The distance matrix was calculated with the Kimura 2-parameter formula (DNADIST program in PHYLIP) and distance trees were obtained by the neighbour-joining method (NEIGHBOR program in PHYLIP). 2) Parsimony method. We used the DNAPARS, CONSENSE, and DNABOOT programs in PHYLIP, and the heuristic search with branch swapping TBR, mulpars option of PAUP. 3) Li k eli h o o d m e t h o d. We used the DNAML program incorporated in PHYLIP.

Results Table 2 shows the informative sites of the DNA matrix excluding the gaps (gap- missing option of the PAUP program). It comprises 118 positions and represents 28 sequences (out of the 41 studied) which have been found to be different. The total DNA-matrix is available on request from the senior author. Generally, different individuals of the same species, but also some closely related species, have 198 J.-F. MANEN & al.:

Table 1. Sources of cpDNA (fresh leaves) from Rubiaceae: 41 populations belonging to 31 different taxa. *The numbers relate to the numbers which appear in the phylogenetic trees (see Fig. 3). **Infrageneric references: Asperula sect. Glabella = 01, 19; GaIium sect. Leio- galium = 03, 08, 12, 13, 18, 21, 25, 26, 30, 31, sect. Galium = 23; sect. LetogaIium = 09; sect. Platygalium = 07, 16, 17, 20; sect. Aparinoides = 06, 14; sect. Kolgyda = 04, 10, 15, 24, 27, 28. ***Collectors: JEA JEANMONOD,DANIEL; MAN MANEN,JEAN-FRANCOIS; NAT NATALI, ALESSANDRO; PAL PALESE, RAOUL; ROG ROGUET, DIDIER; THI THIEBAUD, MARC-ANDRe; ZEL ZELLWEGER, CATHERINE. The number is the collector number. JBG + number stands for the number of living collections in the Botanical Garden of Geneva

No* Species** Locality Voucher informations***

Rubieae 11 Rubia peregrina L. Elba Island NAT & THI/N56965 33 R. tinctorum L. Geneva, Bot. Garden JBG 916690 02 Sherardia arvensis L. Corsica, St Petrone JEA & NAT/J5048 05 S. arvensis L. Geneva NAT & MAN/s.n. 29 Crucianella angustifolia L. Corsica, Francardo JEA & NAT/J5044 35 Phuopsis stylosa (TRIN.) Geneva, Bot. Garden JBG 916798 JACKSON 19 Asperula laevigata L. Elba Island NAT & THI/s.n. 01 A. tinctoria L. Geneva, Bot. Garden JBG 780680 34 Cruciata laevipes OvIz Corsica, Radicale JEA, NAT, PAL/J4198 22 C. glabra (L.) EHREND. vat. Elba Island NAT & THI/N57761 hirticaule (BECK) So6 32 Vatantia muralis L. Corsica, Pigno JEA & NAT/s.n. 12 GaIiummollugo L. Corsica, Calvi JEA, NAT, ZEL/s.n. 03 G. album L. subsp, album Corsica, Solenzara JEA, NAT, PAL/s.n. 25 G. album L. subsp, album Corsica, S. Michelle JEA & NAT/J4969 13 G. album L. subsp, album Geneva NAT & MAN/s.n. 30 G. album L. subsp, album Corsica, Miomo JEA & NAT/J4935 26 G. album L. subsp, album Corsica, St Florent JEA & NAT/4963 31 G. corrudifolium VILL. Elba Island NAT & THI/N56941 23 G. verum L. Geneva NAT & MAN/s.n. 18 G. lucidum ALL. Elba Island NAT & THI/N56959 08 G. lucidum ALL. Corsica, Strette JEA & NAT/J4964 21 G. aetnicum BIV. Capraia Island NAT & THI/N57944 09 G. corsicum SVRENG. Corsica, Col St Jean JEA & NAT/J4931 07 G. scabrum L. Corsica, Porto JEA & ROG/J4961 20 G. scabrum L. Elba Island NAT & THI/N56964 16 G. scabrum L. Elba Island NAT & THI/N57753 17 G, rotundifolium L. Corsica, L. di Casinca JEA & Nat/J4979 06 G. elongatum C. PRESL Corsica, St Florent JEA & NAT/J4966 14 G. palustre L. Geneva NAT & MAN/s.n. 04 G. divaricatum LAM. Corsica, Ajaccio JEA, NAT, ZEL/J3394 10 G. parisiense L. Corsica, Radicale JEA, NAT, PAL/J4186 24 G. verrucosum HUDSON Corsica, Bonifacio JEA, PAL, ROG/J3980 15 G. aparine L. Corsica, Pietrabugno JEA & NAT/s.n. 27 G. aparine L. Corsica, St Petrone JEA & NAT/J5017 28 G. aparine L. Corsica, Ponte Leccia JEA & NAT/s.n. Phylogeny of Rubieae 199

Table 1 (continued)

No* Species** Locality Voucher informations***

Psychotrieae 42 Hydnophytum formicarum JACK Geneva, Bot. Garden NAT & MAN/s.n. 44 Psychotria bacteriophila Geneva, Bot. Garden NAT & MAN/s.n. VALET, Hedyotideae 41 Bouvardia glaberrima ENGELM. Geneva, Bot. Garden NAT & MAN/s.n. 47 Pentas lanceolata (FoRssK.) Geneva, Bot. Garden NAT & MAN/s.n. DEFLERS Coffeeae 37 Coffea arabica L. Geneva, Bot. Garden NAT & MAN/s.n. Pavetteae 38 Ixora parviflora VAHL Geneva, Bot. Garden NAT & MAN/s.n.

identical sequences. A horizontal line separates the outgroup species from the ingroup Rubieae species. Two large deletions (position 218-280 and 424-575) have occurred between the outgroup and the ingroup. Some light problems of alignment arise in the outgroup, while in the ingroup alignment problems, often encountered with such a non-coding intergene region, are absent. The atp B start codon is around 20 bases upstream the first position of the matrix. The start codon of the rbc L gene is at position 849-851. The matrix also contains the first 56 codons of rbcL. The types of changes observed in the nucleotide sequences of the various Ru- biaceae studied are transitions, transversions (low transition/transversion ratio: 1.26), two large block deletions in the Rubieae, insertions, deletions, and dupli- cations. The DNA matrix shows that some substitution events are obviously not independent, as the intramolecular recombination GTGA or TCAC (position 743- 746) and GC or CG at position 1005-1006. These two positions have been computed as unique events in the subsequent analysis. The total matrix (the outgroups and Rubieae ingroup) comprises 1019 positions. Due to the large deletions between the outgroups and the ingroup, the Rubieae species matrix allows only 718 positions. In the Rubieae ingroup there are 98 base substitutions, 58 of them phylogenetically informative, and 10 insertion/deletion events, 4 of them phylogenetically informative. Thus, the ingroup matrix comprises 718 sites, 108 variable sites (15.0%) and 62 informative sites (8.6%). Comparison of these ratios with other studies demonstrates that his cpDNA non-coding region shows comparable amounts of variability at intergeneric and interspecific levels, as the rbc L sequence at interorder, interfamily, and intertribe levels. Here, 57 species of the Asteridae show 46.8% variable sites and 31.8% informative sites (OLMSTEAD & al. 1992); 25 Asteraceae species have 24.1% variable and 11.9% informative sites (KIM & al. 1992), and 12 Dipsacales taxa exhibit 16.5% variable and 7.5% informative sites (DoNo~I-IUE & al. 1992). By restriction sites (N ~ c~l

L~L~

,---~ oo '~"

,---~ ~ oo L~ L~ L~ L~L~

,--~ u'h oo

L~ L~ L~

L~ L~ L~ L~ L~ L~

• ,-~ (o ~NN

,.-- Cxl [~ L~ L~ L~ L~L~

,...~ t-~q Cxl L~L~ L~ L~ L~

L~ L~ L~

oo D-~

oo ko

oo cq

~cq L~L~ L~L~ F- L~ L~

u-] O~ L~ L~ L~

o'] O~ ~.~~

C'q on

cq c~l z~ cxl

oL~ 6 ~..~ tN

CN F-F~

n~ o Z ~ tt~ O0 II~

~P~ ~m~ O0

~o~o~~o~o~o~~o~o~o

© © Z J.-F. MANEN & al.: Phylogeny of Rubieae 203 mapping ofcpDNA (representing 1278 bp) BREMER & JANSEN (1991) found 17.8% variable sites and 12.5% informative sites in 33 species of the Rubiaeeae. The DNAML program automatically treats the gaps as missing data. To be able to compare the different programs, the input data matrix was either a) the total matrix where gaps are treated as additional character-states (subsequently called the "total data matrix"), or b) the matrix where gaps are treated as missing data (subsequently called the "reduced data matrix"). Using one or the other input data matrix for the Rubieae taxa studied, the three different methods gave always a dear separation into the following five groups (designated here by informal names; Fig. 2). 1) Rubia clade (RU), including only Rubia. 2) Sherardia clade (SH), including Sherardia, Crucianella, and Phuopsis. 3) Asperula sect. Glabella clade (AG), including Asperula sect. Glabella and Galium sect. Aparinoides.

[Reduced matrixl I Total matrix ]

CT CT GG FF~AG SH OT SH OT GG F•AGRU .... RU DISTANCE TREES

FFF'CAG GG f SH OT SH OT GG RU RU

PARSIMONY TREES

SH GG CT OT AG F~RU MAXIMUM LIKELIHOOD TREE Fig. 2. General Rubieae tree topologies obtained by different methods from the total and the reduced matrix (see the text). Distance trees: obtained with DNADIST and NEIGHBOR of PHYLIP. Parsimony trees: consensus trees (majority rule) of the eight most parsimonious trees obtained with DNAPARS and CONSENSE of PHYLIP. Likelihood tree: maximum likelihood tree obtained with DNAML of PHYLIP. - The ancestor nodes of the five main groups (RU, SH, GG, CT, and AG) only are represented, as well as the outgroup node (OT). R U Rubia; SH Sherardia, Crucianella, Phuopsis; GG Galium sect. Galium, Leiogalium, Leptogalium, and Kolgyda; CT Cruciata, Valantia, Galium sect. Platygalium; AG Asperula sect. Glabella, Galium sect. Aparinoides 204 J.-F. MANEN & al.:

4) Cruciata clade (CT), including Cruciata, Valantia, and Galium sect. Platy- galium. 5) Galium sect. Galium clade (GG), including Galium sectt. Galiurn, LeiogaIium, Leptogalium, and Kolgyda. The use of any of the three methods and any of the two input data matrices only changes the phylogenetic relationships between the five main groups. Inside these groups, the relationships are always similar to that represented in the parsimony tree (Fig. 3). Figure 2 schematically shows distance trees, parsimony trees, and a maximum likelihood tree, obtained with either the total data matrix, or the reduced data matrix as input. In this figure only the ancestor nodes of the main five groups are represented, as well as the outgroup node. Except for the relative positions of the two groups GG and SH (see below), the fact that the two data matrices generally give a similar tree topology means that the deletion/insertion events do not have strong phylogenetic relevance. This is the reason why we did not incorporate an additional deletion/insertion matrix into our data matrix. Another reason was the difficulty to construct a rigorous and strict deletion/insertion matrix, particularly in the outgroup species. The use of the total data matrix artificially increases the branch length of the trees because a simple evolutionary event (an insertion/deletion event) is treated as several independent events, depending of the length of the gaps. Thus, for the detailed phylogenetic analysis of the Rubieae tribe, the reduced data matrix (gaps missing) was used. Figure 3 shows one of the eight most parsimonious trees, produced by the heuristic option of the PAUP program. This tree is identical to the consensus tree (majority rule), is 327 steps long and has a consistency index (CI) of 0.749 (excluding uninformative sites). The most parsimonious trees produced with a matrix containing only the Rubieae tribe ingroup, are 135 steps long and have a CI of 0.682 (excluding uninformative sites). These CI values are reasonably high for a data set of 28 taxa (KIM & al. 1992). One-hundred bootstrap parsimony analyses (DNABOOT of PHYLIP) of the reduced matrix support some of the five groups, but show the unreliability of the relationships between them.

Discussion Our results show that the Rubieae tribe apparently is monophyletic. The representative taxa studied so far constitute five main groups, well separated by all the different methods used for the phylogenetic analysis of the available cpDNA matrix. There are strong differences in the tree topologies produced with the parsimony and the likelihood method, except for the Rubia clade which always maintains the same position (see Fig. 2). Although these methods are very different, cladistics and statistics, respectively, the fact that they produce different trees would suggest a weakness of the input data matrix in inferring the phylogenetic relationships of the five groups. We have analysed the obtained parsimony tree by the maximum likelihood method (user tree option), and conversely, the maximum likelihood tree by the parsimony method (user tree option). The observed differences in the log likelihood, or in the number of tree steps are always very low. This shows that, although topologically different, these trees are in fact very close, and that their differences are determined by very few characters. Phylogeny of Rubieae 205

Coffea 37 | ....Ixora 38 ,oo I Hydnophytum 42 L Psychotria 44 Pentas 47 Bouvardia 41

Val. muralis 32 5,' Gal. scabrum 07; 16; 20; ~4 Gal. rotundifolium 17 CT ~-- Cru. glabra 22 41-.. Cru. laevipes 34 1 37

9~Gal. elongatum 06 Gal. palustre 14 AG 96 Asp. laevigata 19 Asp. tinctoria 01 l Cla. angustifolia 29 Phu. stylosa 35 8! SH She. arvensis 02 She. arvensis 05

al. aparine 15,27,28 Gal. verrucosum 24 100 ~ al. parisiense I0 ~ Gal. divaricatum 04 N GG 1 ~- Gal. corsicum 09 5" _~.~al. album 03

I t 5 steps Gal. lucidum 18

Rub. peregrina 11 ] I00• Rub. tinctorum 33 RU

Gal. album 26,13,25,30; Gal. corrudifolium 31; Gal. verum 23; Gal lucidum 08; Gal. aetnicum 21; Gal. mollugo 12 Fig. 3. One of the eight most parsimonious (327 steps, C1 = 0.749) trees obtained with PAUP (heuristic option) with the reduced matrix. It has the same topology as the consensus tree. The length of the branches is proportional to the number of steps constituting the branches. The numbers indicated above the internal branches represent the number of times that monophyletic group have occurred in 100 bootstraps replicates. Abbreviations as in Table 2

Thus, there is no argument to choose either one or the other tree. As the five groups are well supported, this means that, on the one hand, several characters 206 J.-F. MANEN & al.:

(mutations) are shared by each taxon of the five different groups, and that, on the other hand, there are very few characters (mutations) shared by two or more of the five different groups, which would produce a hierarchy between them. An explanation for this phenomenon could be a very intensive differentiation of the Rubieae tribe at its evolutionary start, resulting in a number of clades having about the same phylogenetic distance and difficult to bring into a phylogenetic sequence. This is in line with the large differentiation often observed when tropical taxa colonize warm and xeric subtropical or temperate aereas during the Upper Tertiary. The Rubieae certainly had their major evolutionary differentiation phase at that time. In the following paragraphs we propose to discuss in detail the five main clades separated by our molecular analysis together with some systematic, taxonomic, and phylogenetic implications. 1) Rubia clade. It seems clear from the phylogenetic analysis that the genus Rubia is a sister group of all remaining Rubieae. In fact, the separation from the other clades is clear whatever method and matrix we used (Fig. 2), and it is supported by a relatively strong bootstrap value: 81% (Fig. 3). This result seems to be in conflict with earlier concepts (e.g., SCHUMANN 1891), according to which the genus Rubia has been considered to be very closely linked to Galium. RICHARI~S(1829) even said: "Ces deux genres nous paraissent tellement rapproch& que nous avons balanc~ si nous les r~unirions pas en un seul et m~me genre". This opinion had resulted from the erroneous inclusion of (mostly Amer- ican) fleshy-fruited representatives of Galium and of the neotropical genus Rel- bunium into Rubia. In order to characterize that genus, fleshy fruits have to be used together with the much more important differential feature of the 5-lobed corolla (mostly rotate). When these and other characters (e.g., presence of alizarin glucosides in stolons and roots) are used to circumscribe Rubia (e.g., EHe,E~DORFEI~ & Ke,E~I~I. 1976), the genus becomes a very well separable taxon limited to the Old World, ranging from Macaronesia and most of Africa to E Asia. 2) Sherardia clade. The grouping of Crucianella and Phuopsis by five characters (bootstrap value of 84%) is not surprising. In fact many ancient authors have considered the Phuopsis species as belonging to the genus Crucianella (as Crucianella stylosa). However, the available data support the maintenance of the two genera. The position of Sherardia arvensis in the same clade as Crucianella and Phuopsis could be rather surprising since Sherardia has been traditionally considered close to Asperula (RIcHARDS 1829). However, this monospecific genus also exhibits many morphological features similar to Crucianella. Furthermore, a broader sampling of the very heterogeneous genus Asperula (see below) may close the present intergene cpDNA gap between it and the Sherardia clade. 3) Asperula sect. Glabella clade. The genus Asperula morphologically occupies a very central position within the Rubieae tribe. It evidently is paraphyletic, exhibits a great diversity of plesiomorphic (and apomorphic) character states, and has to be differentiated into a number of sections [e.g., the perennial Cruciana, Oppositi- foliae, Cynanchicae, Hexaphylla, Glabella, Thliphtisa, and Dioiceae (Australia to New Zealand), the annual Asperula, Crucianelloides, Trichodes (= genus Leptunis)]. Our study includes only two members of sect. Glabella (= sect. Galioideae p.p.), the rather different A. laevigata and A. tinctoria. This section takes a rather marginal Phylogeny of Rubieae 207 position within Asperula and morphologically approaches the genus Galium in several respects. Our sample, therefore, is not representative of the whole genus Asperula and justifies the restrictive name of the present clade. Generally, the separation of Asperula from Galium is critical, and a number of species evidently were misplaced in Asperula sect. Galioideae and sect. Brachyanthae, and have already been transferred to Galium (e.g., Galium odoraturn, G. glaucum, or G. humifusum). It is one of the most interesting results of our study that, in a reverse way, the closely related species G. palustre and G. elongatum, evidently exhibit much stronger cpDNA affinities with Asperula sect. Glabella than with the other Galiurn species studied. These two perennial species of swamps and marsh habitats belong to the small sect. Aparinoides, which usually has been linked to Galium sect. Trachygaliurn (including, i.a.G, uliginosum). This concept has become more and more dubious in view of the strong isolation of sect. Aparinoides, characterized by several aberrant features, e.g., plants usually turning blackish when dry, obtuse (and not acute) leaves, slightly campanulate flowers, globose (and not ovoid) mericarps, and the chromosome base number x = 12 (and not 11 as in nearly all other members of Galium). All this has made the systematic position of sect. Aparinoides uncertain, and prompted one of us (F.E.) already long ago to suspect (but never publish) an affinity with AsperuIa sect. GIabella where several of the differential characters mentioned reappear. This suspicion now is remarkably supported by the present molecular data and should lead us to reconsider the taxonomic position of sect. Aparinoides. 4) Cruciata clade. The position in the same clade of the three species of Valantia and Cruciata that we have analysed is not surprising at all and our results confirm that Cruciata, formerly a simple section of the genus Galium, must be considered as a separate genus from the other Galium, as indicated by EHRENDORFER (1962). Moreover, the strong relationship between Valantia and Cruciata, small genera from the Near East, the Mediterranean, and temperate western Eurasia, has already been demonstrated. For both genera, the xeric environments have triggered the origin of annual from ancestral perennial species. In both cases this has been accompanied by remarkable specialisation in their fruit dispersal mechanism and by a descending dysploidy, down to x = 9 and x = 5 in Cruciata and to x = 10 and x = 9 in Valantia (EHRENDORFER1971). In the same clade of Valantia and Cruciata we find the two closely related species Galium rotundifolium and G. scabrum, European and Mediterranean representatives from sect. Platygalium. This is not surprising in view of several morphological similarities. All more or less plesiomorphic members of Galium sect. Platygalium, Valanth~, and Cruciata are perennials and have pseudo-whorls of only two leaves and two leaf-like stipules, each often with one additional pair of veins running parallel to the main vein. In their reproductive region the members of sect. Platy- galium exhibit more ancestral traits because their main inflorescence axis ends in a terminal flower with bracts and lateral cymes, whereas the main inflorescence axis has become vegetative in Valantia and Cruciata, with the lateral cymes de- veloping in the axils of more or less normal leaves. Relative to these genera, Galium appears as a paraphyletic taxon. Galium sect. Platygalium is a large and very diverse group with a world-wide distribution and with many plesiomorphic traits, and with apparent morphological 208 J.-F. MANEN & al.:

links towards some basic members of Rubia, Asperula, Cruciata, and Valantia. Furthermore, it exhibits very close ties with the American sections Lophogalium and "Baccogalium", with the few taxa of the very problematic genera Bataprine (North America) and Microphysa (Central Asia), and the heterogeneous neotropical genus Relbunium, all characterized by their predominantly four leaf-like elements per pseudo-whorl. Furthermore, there are obvious morphological affinities between sect. Platygalium and other Galium sections with more than four elements in their pseudo-whorls. This applies to the southwestern Asiatic/eastern Mediterranean centred sect. Jubogalium, and particularly to those groups assembled in our study under the Galium sect. Galium clade. Such possible links are, i.a., the Eurasiatic sect. Hylaea (i.a., with G. odoratum), and the Northern Hemisphere sect. Trachy- galium. 5) GMium sect. GMium clade. This clade, represented in our study by the perennial sections Galium, Leiogalium, Leptogalium, and the annual Kolgyda, is monophyletic from the available data, rather advanced in its intergene cpDNA sequence and well separated from Galium sect. Platygalium (in the Cruciata clade) and sect. Aparinoides (in the Asperula sect. Glabella clade). As already suggested, links towards these two clades are expected to become clearer on the basis of more intensive sampling. Very little change in the intergene cpDNA region has occurred in the perennials studied from sectt. Galium: G. verum (2x, 4x, Eurasian) and Leiogalium: a poly- morphic Mediterranean-European polyploid complex with G. mollugo (2x), G. album (4x), G. corrudifolium (2x), G. lucidum (4x), and G. aetnicum (4x). Their sequences are identical with the exception of position 77 in one of the five accessions of G. album and the block 407-413 in one of the two accessions of G. lucidum. This close affinity is not surprising because hybridization is common between G. verum (4x) and G. album (4x), and also occurs between other members of sectt. Galium and Leiogalium. Within sect. Leiogalium reticulate relationships and affinities linked to hybridization, polyploidy, and very active recent evolutionary differentiation are even more obvious, as suggested by several authors (e.g., EHREN- DORVER 1988). Since cpDNA is only maternally inherited, data on nuclear DNA should give indications on the phylogeny of this group. No cpDNA data are yet available on the SW Asiatic-centred sect. Orientigalium which is expected to connect sect. Leiogalium and the Mediterranean-montane/ European sect. Leptogalium, represented here by G. corsieum, an endemic of Corsica and Sardinia. The available data suggest relatively close affinities of G. corsicum with the G. parisiense-G, divaricatum group of the Mediterranean/SW Asiatic centred annual sect. Kolgyda (= Aparine), but also a possible independent origin of the G. aparine- G. verrucosum group of sect. Kolgyda, which then would be polyphyletic. More data are necessary for deciding this question and verifying the assumption that the aberrant annual Callipeltis (incl. Warburgina) and Mericarpaea in SW Asia are offshoots from Galium sect. Kolgyda.

Conclusions The results of our phylogenetic study on the Rubiaceae-Rubieae, based on a cpDNA intergene region, are often in agreement with the classical taxonomic views [-i.e., Phylogeny of Rubieae 209

Valantia and Cruciata in the same clade (and close to Galium sect. Platygalium), Phuopsis and Crucianella very closel. In some cases, the molecular results show their great taxonomic potential, as they support some suspected affinities among earlier distantly placed taxa: Galium sect. Aparinoides near to Asperula sect. Glabella. These results should have taxonomic implications. In other cases, the molecular results open up new taxonomic perspectives (e.g., the position of Sherardia arvensis in the same clade as Crucianella, the suggested close affinity of Galium corsicum with the G. parisiense-G, divaricatum group), while in a few other cases our results are more difficult to match with the classical taxonomic views. The first example is the Rubia clade. In our phylogenetic reconstruction this taxon appears to be relatively old as a sister group to all other Rubieae studied. Classical views based on morphological data would rate this genus as quite advanced. The second case is Galium sect. Platygalium, traditionally considered to maintain a very central position with many plesiomorphic traits. Our molecular data rate it as more recent and place it in the same clade as the two advanced genera Valantia and Cruciata. These two latter examples dramatically show the problems often arising when classical (or "narrative") and cladistic reconstructions are compared, whatever characters have been used. The discrepancies between the morphological data and our molecular data could be caused by equating overall similarity with phylogenetic relationships (SYTSMA 1990). Rapid morphological (as well as molecular) changes in one lineage could have obscured close phylogenetic relationships. For instance, due to rapid changes, Rubia appears to have retained few ancestral morphological (and in some respect also molecular) characters, while Galium sect. Platygalium, slowly evolving, obviously has retained a high proportion of ancestral characters. On the other hand, we have to be aware that the reconstruction of the mutational differentiation and phylogeny of our cpDNA sequence is not necessarily the same as the reconstruction of the germ-line phylogeny from nuclear data, particularly in a tribe like Rubieae, where phenomena of hybridization, introgression, and polyploidy have probably been frequent. In this respect, the sequencing of the variable 500bp region between the 18S and 25S nuclear DNA from Rubieae is currently in progress. The comparison of the "chloroplast tree" and the "nuclear tree" certainly should give new suggestions for the phylogeny and the evolution of this tribe. This phylogenetic study based on a cpDNA intergene region is obviously pre- liminary. We believe that molecular and morphological approaches should be combined in order to arrive at a widely accepted phylogenetic reconstruction. In this aim, the study of the cpDNA sequence of several other important taxa from in- and outside the tribe is in progress and, conversely, the unexpected relationships suggested by our molecular study should lead us to investigate more deeply some possibly neglected biosystematic characters of this interesting world-wide tribe.

We would like to thank RI~GINE STRAESSLEfor the amplification and sequencing of this DNA fragment. This work was supported by the Fonds National Suisse de la Recherche 210 J.-F. MANEN & al.:

Scientifique (contracts nos. 31-28757.90 and 3.111.0.88) and the Fonds zur F6rderung der wissenschaftlichen Forschung in 0sterreich (project P 6189).

References BREMEKAMP, C. E. B., 1966: Remarks on the position, the delimitation, and the subdivision of the Rubiaceae. - Acta Bot. Neerl. 15: 1-33. BREMER, B., JANSEN, R. K., 1991: Comparative restriction site mapping of chloroplast DNA implies new phylogenetic relationships within Rubiaceae. - Amer. J. Bot. 78: 198-213. CHASE, M. W., SOLTIS, D. E., OLMSTEAD, R. G., MORGAN, D., LES, D. H., MISHLER, B. D., DUVALL, M. R., PRICE, R. A., HILLS, H. G., QIu, Y.-L., KRON, K. A., RETTIG, J. H., CONTI, E., PALMER, J. D., MANHART, J. R., SYTSMA, K. J., MICHAELS, H. J., KRESS, W. J., KAROL, K. G., CLARK, W. D., HEDRI~N, M., GAUT, B. S., JANSEN, R. K., KIM, K.-J., WIMPEE, C. F., SMITH, J. F., FURNIER, G. R., STRAUSS, S. H., XIANG, Q. Y., PLUNKETT, G. M., SOLTIS, P. S., SWENSEN, S., WILLIAMS, S. E., GADEK, P. A., QUINN, C. J., EGUIARTE, L. E., GOLDENBERG, E., LEARN, G. H. J., GRAHAM, S. W., BARRETT, S. C. H., DAYANANDAN, S., ALBERT, V. A., 1993: DNA sequence phylogenetics of seed plants: an analysis of the plastid gene rbc L. - Ann. Missouri Bot. Gard. 80: 528-586. DE CANDOLLE, A. P., 1830: Prodromus systematis naturalis regni vegetabilis, IV. - Paris: Treuttel et Wfirtz. DONOGHUE, M. J., OLMSTEAD, R. G., SMITH, J. F., PALMER, J. D., 1992: Phylogenetic relationship of Dipsacales based on rbc L sequences. - Ann. Missouri Bot. Gard. 79: 333-345. EHRENDORFER, F., 1962: Notizen zur Systematik und Phylogenie von Cruciata MILL. und verwandten Gattungen der Rubiaceae. - Ann. Naturhist. Mus. Wien 65:11-20. - 1971: Evolution and eco-geographical differentiation in some South-West Asiatic Ru- biaceae. - In DAVIS, P. H., & al. (Eds): Plant Life in South-West Asia, pp. 195-215. - Edinburgh: Bot. Soc. - 1988: Stability versus change, or how to explain evolution. - In GREUTER, W., ZIMMER, B., (Eds): Proceedings of the XIV International Botanical Congress, pp. 317-333. - K6nigstein/Taunus: Koeltz. -- KRENDL, F., 1976: Rubiaceae. - In TUTIN, T. G., & al. (Eds): Flora Europaea 4, pp. 3- 38. - Cambridge: Cambridge University Press. -- MANEN, J.-F., NATALI, A., 1994: cpDNA intergene sequences corroborate restriction site data for reconstructing Rubiaceae phylogeny. - P1. Syst. Evol. 190: 245-248. ERICKSON, L. R., STRAUS, N. A., BEVERSDORF, W. D., 1983: Restriction patterns reveal origins of chloroplast genomes in Brassica amphiploids. - Theor. Appl. Genet. 65: 201-206. FELSENSTEIN, J., 1988: Phylogenies from molecular sequences: inference and reliability. - Annu. Rev. Genet. 22: 521-565. - 1989: PHYLIP: Phylogeny interference package, version 3.2. - Cladistics 5: 164-166. HEIN, J., 1990: Unifed approach to alignment and phylogenies. - Methods Enzymol. 183: 626-645. JANSEN, K. R., PALMER, J. D., 1987: A chloroplast DNA inversion marks an ancient evolutionary split in the sunflower family (Asteraceae). - Proc. Natl. Acad. Sci. USA 84: 5818-5822. 1988: Phylogenetic implications of chloroplast DNA restriction site variation in the Mutisieae (Asteraceae). - Amer. J. Bot. 75: 753-766. KIM, K.-J., JANSEN, R. K., WALLACE, R. S., MICHAELS, H. J., PALMER, J. D., 1992: Phylogenetic implications of rbc L sequence variation in the Asteraceae. - Ann. Mis- souri Bot. Gard. 79: 428445. Phylogeny of Rubieae 211

KUSUKAWA, N., UEMORI, T., ASADA, K., KATO, I., 1990: Rapid and reliable protocol for direct sequencing of material amplified by the polymerase chain reaction. - Biotech- niques 9: 66-72. MABBERLEY, D. J., 1987: A portable dictionary of the higher plants. - Cambridge: Cam- bridge University Press. OLMSTEAD, R. G., MICHAELS, U. J., SCOTT, K. M., PALMER, J. D., 1992: Monophyly of the Asteridae and identification of their major lineages inferred from DNA sequences of rbc L. - Ann. Missouri Bot. Gard. 79: 249-265. PALMER, J. D., 1987: Chloroplast DNA evolution and biosystematic uses of chloroplast DNA variation. - Amer. Naturalist 130: S 6-S 29.

- JANSEN, R. K., MICHAELS, H. J., CHASE, M. W., MANHART, J. A., 1988: Chloroplast DNA variation and plant phylogeny. - Ann. Missouri Bot. Gard. 75:1180-1206. RICHARDS, A., 1829: M6moire sur la famille des Rubiacdes. - Paris: J. Tastu. ROBBRECHT, E., 1988: Tropical woody Rubiaceae. - Opera Bot. Belgica 1: 1-271. SCHUMANN, K., 1891: Rubiaceae. - In ENGLER, A., PRANTL, K., (Eds): Die natfirlichen Pfianzenfamilien 4 (4), pp. 1-156. - Leipzig: Engelmann. - 1897: Rubiaceae. - In ENGLER, A., PRANTL, K., (Eds): Die natfirlichen Pflanzenfamilien. Nachtr. (1) zu 2-4, pp. 309-316. - Leipzig: Engelmann. SWOFFORD, D. L., 1991: PAUP: phylogenetic analysis using parsimony, version 3.0. - Computer program distributed by Illinois Natural History Survey, Champaign, Illinois. SYTSMA, K. J., 1990: DNA and morphology: inference of plant phylogeny. - TREE 5: 104-110. -- GOTTLIEB, L. D., 1986 a: Chloroplast DNA evidence for the derivation of the genus Heterogaura from Clarkia (Onagraceae). - Proc. Natl. Acad. Sci. USA 83: 5554-5557. 1986 b: Chloroplast DNA evolution and phylogenetic relationship in Clarkia sect. Peripetasrna (Onagraceae). - Evolution 40: 1248-1262. VERDCOURT, B., 1958: Remarks on the classification of the Rubiaceeae. - Bull. Rijksplan- tentuin Bruss. 28: 209-281. WEBB, D. M., KNAPP, S. J., 1990: DNA extraction from a previously recalcitrant plant genus. - P1. Mol. Biol. Rep. 8: 180-185. ZURAWSKI, G., CLEGG, M. T., 1987: Evolution of higher-plant chloroplast DNA-encoded genes: implications for structure-function and phylogenetic studies. - Annu. Rev. P1. Physiol. 38: 391-418. Addresses of the authors: JEAN-FRANCOIS MANEN and ALESSANDRO NATALI, Conser- vatoire et Jardin Botaniques de Gen6ve, 1, Ch. de l'Imp6ratrice, 1292 Chamb6sy/Genhve, Switzerland. - FRIEDRICH EHRENDORFER, Institut ffir Botanik und Botanischer Garten der Universit/it Wien, Rennweg 14, A-1030 Wien, Austria.

Accepted November 30, 1993 by F. EHRENDORFER