Wnt10b Participates in Regulating Fatty Acid Synthesis in the Muscle of Zebraﬁsh

cells

Article Wnt10b Participates in Regulating Fatty Acid Synthesis in the Muscle of Zebraﬁsh

Dongwu Liu 1,2,*, Qiuxiang Pang 2,*, Qiang Han 3, Qilong Shi 1, Qin Zhang 4,* and Hairui Yu 5 1 School of Agricultural Engineering and Food Science, Shandong University of Technology, Zibo 255049, China 2 Anti-Aging & Regenerative Medicine Research Institution, School of Life Sciences, Shandong University of Technology, Zibo 255049, China 3 Sunwin Biotech Shandong Co., Ltd., Weifang 262737, China 4 Guangxi Key Laboratory for Polysaccharide Materials and Modiﬁcations, Guangxi Colleges and Universities Key Laboratory of Utilization of Microbial and Botanical Resources, School of Marine Science and Biotechnology, Guangxi University for Nationalities, Nanning 530008, China 5 College of Biological and Agricultural Engineering, Weifang Bioengineering Technology Research Center, Weifang University, Weifang 261061, China * Correspondence: [email protected] (D.L.); [email protected] (Q.P.); [email protected] (Q.Z.)

Received: 16 June 2019; Accepted: 27 August 2019; Published: 30 August 2019

Abstract: There are 19 Wnt genes in mammals that belong to 12 subfamilies. Wnt signaling pathways participate in regulating numerous homeostatic and developmental processes in animals. However, the function of Wnt10b in fatty acid synthesis remains unclear in fish species. In the present study, we uncovered the role of the Wnt10b signaling pathway in the regulation of fatty acid synthesis in the muscle of zebrafish. The gene of Wnt10b was overexpressed in the muscle of zebrafish using pEGFP-N1-Wnt10b vector injection, which significantly decreased the expression of glycogen synthase kinase 3β (GSK-3β), but increased the expression of β-catenin, peroxisome proliferators-activated receptor γ (PPARγ), and CCAAT/enhancer binding protein α (C/EBPα). Moreover, the activity and mRNA expression of key lipogenic enzymes ATP-citrate lyase (ACL), acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FAS), and the content of non-esterified fatty acids (NEFA), total cholesterol (TC), and triglyceride (TG) were also significantly decreased. Furthermore, interference of the Wnt10b gene significantly inhibited the expression of β-catenin, PPARγ, and C/EBPα, but significantly induced the expression of GSK-3β, FAS, ACC, and ACL. The content of NEFA, TC, and TG as well as the activity of FAS, ACC, and ACL significantly increased. Thus, our results showed that Wnt10b participates in regulating fatty acid synthesis via β-catenin, C/EBPα and PPARγ in the muscle of zebrafish.

Keywords: Wnt10b; GSK-3β; β-catenin; lipid deposition; zebraﬁsh

1. Introduction Wnts have been extensively studied in vertebrate model organisms. The human and mouse genomes contain 19 diﬀerent Wnt genes, which have been assigned to 12 subclasses (Wnt1 through Wnt11 and Wnt16) based on peptide sequence identity [1,2]. The subfamilies of Wnt genes are involved in the early stages of evolution. Indeed, it has been reported that 11 subfamilies of Wnts are identiﬁed in Cnidaria, a group splitting from the last common ancestor of Bilaterians [3]. In addition, Wnts participate in regulating a variety of key developmental and homeostatic processes in animals. Over the last two decades, the implication of Wnts in a wide array of signaling pathways has made Wnts the subject of intense investigation in the studies of cell biology.

Cells 2019, 8, 1011; doi:10.3390/cells8091011 www.mdpi.com/journal/cells Cells 2019, 8, 1011 2 of 13

In the canonical Wnt signaling, Wnts play a significant role and the defining event is the accumulation of β-catenin. When Wnt ligands are deficient, glycogen synthase kinase 3β (GSK-3β) phosphorylates β-catenin, which is further degraded by a destruction complex, including GSK-3β, adenomatous polyposis coli (APC), and Axin [4,5]. In contrast, the binding of Wnts to a receptor on the cell membrane promotes the depolymerization of the destruction complex, thus leading to the accumulation of β-catenin. Then β-catenin moves to the nucleus and regulates the target gene expression [4,5]. The function of Wnt signaling in metabolic diseases has been illustrated in various genetic research. It was found that obesity was associated with Wnt10b polymorphisms [6,7], and Wnt5b variants induced type 2 diabetes [8]. In addition, Wnts play a key role in regulating lipid accumulation and adipogenesis in the liver [9]. The signaling of Wnts is associated with liver metabolism and the development of fatty liver. As a central molecule, β-catenin is critical in regulating the oxidation of fatty acid, lipogenesis, and ketogenesis in lipid metabolism of liver [10]. As a model organism, zebrafish are widely used in the study of molecular biology. In the muscle of fish, lipid is easily stored up for energy utilization. Moreover, the role of the Wnt10b signaling pathway in the fatty acid synthesis process is still unknown in fish species. Thus, in the present study we detected whether Wnt10b was involved in regulating fatty acid synthesis in the muscle of zebrafish by overexpressing and interfering with the Wnt10b gene.

2. Materials and Methods

2.1. Animals and Experimental Conditions The zebrafish (AB strain) were, on average, ~3.6 cm in length and approximately six months of age. Zebrafish were cultured at a light:dark photoperiod (12 h:12 h) in dechlorinated water (28 ◦C) in flow-through tanks. Zebrafish were fed twice daily with a commercial diet (Sanyou Beautification Feed Tech Co., Ltd.,Beijing, China) and acclimated for two weeks. All animal experiments were approved by Shandong University of Technology’s Institutional Animal Care Committee in accordance with the Guidelines for Proper Conduct of Animal Experiments (Science Council of China).

2.2. Construction of pEGFP-N1-Wnt10b Vector Firstly, the transmembrane domain of the Wnt10b protein was analyzed with TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM/). The extracellular domain of Wnt10b (GenBank: AY182171.1) was cloned with the primers Wnt10b-F1 and Wnt10b-R1 (Table1). Then, the extracellular domain of Wnt10b with the restriction enzyme sites was cloned with the primers Wnt10b-F2 and Wnt10b-R2 (with Hind III and Kpn I restriction enzyme sites) (Table1). Finally, the fragment of Wnt10b was inserted into the plasmid pEGFP-N1 (Beijing TransGen Biotech Co. Ltd., Beijing, China). The construction of the pEGFP-N1-Wnt10b vector is shown in the Supplementary Material (Figure S1). This vector was designated as pEGFP-N1-Wnt10b and transformed into E. coli DH5a for plasmid ampliﬁcation.

Table 1. Sequence of the primers used in this study.

Primer Sequence (50-30) Direction Wnt10b-F1 CAATGACATCCTCGGCCTGAAG Forward Wnt10b-R1 TCACTTGCACACATTAACCCACTC Reverse Wnt10b-F2 CCCAAGCTTGCCACCATGAAGGTGGCAGGAGAGCCAGTGC Forward Wnt10b-R2 CGGGGTACCCCCTTGCACACATTAACCCACTCTG Reverse Wnt10b-F3 GATCACTAATACGACTCACTATAGGGGAGACCAGCGCTGGAACTGCTC Forward Wnt10b-R3 GATCACTAATACGACTCACTATAGGGCCACTCTGTT ATTACGAATCC Reverse Restriction enzyme sites (Hind III and Kpn I) are underlined. Cells 2019, 8, 1011 3 of 13

2.3. Injection of the pEGFP-N1-Wnt10b Vector Forty-eight male zebrafish were randomly distributed into eight glass tanks. For the experimental group (4 tanks), according to the method of Hansen et al. [11], the vector of pEGFP-N1-Wnt10b (500 ng dissolved in 10 µL PBS) was injected into the dorsum muscle of each fish, and fish received one injection at day one. The same volume of PBS was injected into the muscle of each fish in the control group (4 tanks). Six days later, four independent muscle samples (each sample collected from three fish) were sampled from the experimental groups, which were used for molecular biology analysis. In addition, the other four muscle samples were collected for biochemical analysis. For the control group, the fish were sampled as the experimental group.

2.4. Wnt10b RNA Interference The double-stranded RNA (dsRNA) was synthesized with the primers Wnt10b-F3 and Wnt10b-R3 according to the method of Arockiaraj et al. [12] (Table1). Forty-eight male zebrafish were randomly distributed into eight glass tanks. For the experimental group (4 tanks), 200 ng dsRNA diluted in PBS (10 µL) was injected into the dorsum muscle of the fish. Fish received one injection at day one. The fish of the control group (4 tanks) received 10 µL PBS. Six days later, the muscles were sampled as the experiment of pEGFP-N1-Wnt10b vector treatment.

2.5. Real-Time Quantitative Polymerase Chain Reaction Total RNA was extracted and transcribed to cDNA by using PrimeScript™ RT Reagent Kit (Takara, Japan). To detect the gene expression level, SYBR® Premix Ex Taq™ II (Takara, Japan) was used. The primer sequences for Wnt10b, β-catenin, GSK-3β,C/EBPα, PPARγ, acetyl-CoA carboxylase (ACC), ATP-citrate lyase (ACL), fatty acid synthetase (FAS), HMG-CoA reductase (HMGCR), and reference gene (β-actin) were designed (Table2). Roche LightCycler480 ® II (Switzerland) was used to perform ∆∆CT real-time PCR. The 2− method was used to analyze the level of gene expression, and β-actin as the reference gene [13].

Table 2. Real-time quantitative Polymerase Chain Reaction primers for genes of zebraﬁsh.

Target Gene Forward (50-30) Reverse (50-30) GenBank Wnt10b TCCTGAAACAGGCTCGAAGT GCTGCTCACTTGCACACATT AY182171.1 GSK-3β TCTGCTCACCGTTTCCTTTC CTCCGACCCACTTAACTCCA NM_131381.1 β-catenin GGAGCTCACCAGCTCTCTGT TAGCTTGGGTCGTCCTGTCT NM_001001889.1 C/EBPα CACAACAGCTCCAAGCAAGA AATCCATGTAGCCGTTCAGG BC063934.1 PPARγ CTGGACATCAAGCCCTTCTC AGCTGTACATGTGCGTCAGG NM_131467.1 FAS ACAATGCTGGTGACAGTGGA TACGTGTGGGCAGTCTCAAG XM_009306806.2 ACC AGGTGGTACGGATGGCTGCTC GACGGTGCTGGACGCTGTTG NM_001271308.1 ACL AGACCTGATCTCCAGCCTCACATC ATGCCACTGTCGAATGCCTTACTG BC076484.1 HMGCR ACGTCATCGGTTACATGCCAGTTC GCCTTCAGTTGTCGCCATCGG NM_001079977.2 β-actin CCGTGACATCAAGGAGAAGC TACCGCAAGATTCCATACCC AF057040.1

2.6. Western-Blot Analysis A protein Extraction Kit (Beyotime Biotechnology, Wuhan, China) was used to extract protein from muscle samples. After gel electrophoresis and blocking, the membranes were probed with the primary antibodies. Antibodies directed against GSK-3β (Cat. No. 12456, 1:1000), C/EBPα (Cat. No. 8178, 1:1000), β-catenin (Cat. No. 8480, 1:1000), and PPARγ (Cat. No. 2435, 1:1000) were obtained from Cell Signaling Technology Inc. Antibodies against Wnt10b (sc-7432, 1:500) and β-actin (sc-1615, 1:10,000) was purchased from Santa-Cruz Inc. Then the secondary HRP-conjugated antibody was used. Image J software (USA) was used to perform the densitometry analyses. Cells 2019,, 8,, x 1011 4 4of of 14 13

2.7. Biochemical Index Analysis 2.7. Biochemical Index Analysis Cell lysates were homogenized and collected for biochemical analysis. The content of non- esterifiedCell lysatesfatty acids were (NEFA), homogenized total andcholesterol collected (TC), for biochemical and triglyceride analysis. (TG) The as content well as of the non-esterified activity of FAS,fatty acidsACC, (NEFA),and ACL total were cholesterol assayed (TC),according and triglycerideto the instructions (TG) as of well the as TG the and activity TC kits of FAS, (Nanjing ACC, Jianchengand ACL Bioengineering were assayed according Institute, Nanjing, to the instructions China), and of FAS, the ACC, TG and and TC ACL kits activity (Nanjing kitsJiancheng (Zhuocai biologyBioengineering Co., Ltd., Institute, Shanghai, Nanjing, China). China), Finally, and FAS,to determine ACC, and the ACL protein activity concentration, kits (Zhuocai biologycoomassie Co., brilliantLtd., Shanghai, blue G250 China). staining Finally, was toused. determine the protein concentration, coomassie brilliant blue G250 staining was used. 2.8. Statistical Analysis 2.8. Statistical Analysis Data were presented as mean values ± standard error of mean (s.e.m), and SPSS 16.0 (SPSS Inc., Data were presented as mean values standard error of mean (s.e.m), and SPSS 16.0 (SPSS Inc., 2005, USA) was used to perform the statistical± analyses. The differences were analyzed using a student’s2005, USA) t-test was analysis usedto of performindependent the statisticalsamples at analyses. p < 0.05. The differences were analyzed using a student’s t-test analysis of independent samples at p < 0.05. 3. Results 3. Results 3.1. Effect of Wnt10b Gene Overexpression on the Gene Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, 3.1. Effect of Wnt10b Gene Overexpression on the Gene Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, andand PPAR γ The overexpression of Wnt10b gene significantl significantlyy induced the mRNA expression of Wnt10b and β-catenin-catenin (Figure 1 1A,C),A,C),but but significantly significantly decreased decreased the the mRNA mRNA expression expression of of GSK-3 GSK-3β βin in the the muscle muscle of ofzebrafish zebrafish (Figure (Figure1B). 1B). Moreover, Moreover, the overexpression the overexpres ofsion Wnt10b of Wnt10b gene significantly gene significantly increased increased the mRNA the mRNAexpression expression of C/EBP ofα C/EBPand PPARα andγ PPAR(Figureγ1 (FigureD,E). 1D,E).

Figure 1. Effect of Wnt10b gene overexpression on the mRNA expression of Wnt10b, GSK-3β , β-catenin, FigureC/EBP α1., andEffect PPAR of γWnt10bin the musclegene overexpression of zebrafish. ( Aon)Wnt10b; the mRNA (B) GSK-3expressionβ;(C )ofβ -catenin;Wnt10b, (GSK-3D)C/EBPβ, βα-; catenin,(E) PPAR C/EBPγ. Valuesα, and are PPAR expressedγ in the as muscle means of zebrafish.s.e.m. (n = (A4).) Wnt10b; Statistically (B) GSK-3 significantβ; (C) diβ-catenin;fferences ( areD) ± C/EBPdenotedα; ( byE) anPPAR asteriskγ. Values (* p < are0.05). expressed as means ± s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk (* p < 0.05).

CellsCells 20192019, ,88, ,x 1011 5 5of of 14 13

3.2. Effect of Wnt10b Gene Overexpression on the Protein Expression of Wnt10b, GSK-3β, β-catenin, C/EBP3.2. Effαect, and of Wnt10bPPARγ Gene Overexpression on the Protein Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, and PPARγ The overexpression of Wnt10b gene significantly increased the protein expression of Wnt10b The overexpression of Wnt10b gene significantly increased the protein expression of Wnt10b and and β-catenin (Figure 2A,B,D), however, significantly inhibited the protein expression of GSK-3β in β-catenin (Figure2A,B,D), however, significantly inhibited the protein expression of GSK-3 β in the the muscle of zebrafish (Figure 2A,C). Nevertheless, the protein expression of C/EBPα and PPARγ muscle of zebrafish (Figure2A,C). Nevertheless, the protein expression of C /EBPα and PPARγ was was significantly induced by Wnt10b gene overexpression in the muscle of zebrafish (Figure 2A,E,F). significantly induced by Wnt10b gene overexpression in the muscle of zebrafish (Figure2A,E,F).

Figure 2. Effect of Wnt10b gene overexpression on the protein expression of Wnt10b, GSK-3β, β-catenin, FigureC/EBP α2., andEffect PPAR of Wnt10bγ in the gene muscle overexpression of zebrafish. on (A the) The protein protein expression bands; ( Bof) Wnt10b;Wnt10b, (GSK-3C) GSK-3β, ββ- ; (D) β-catenin; (E)C/EBPα;(F) PPARγ. Values are expressed as means s.e.m. (n = 4). Statistically catenin, C/EBPα, and PPARγ in the muscle of zebrafish. (A) The protein bands;± (B) Wnt10b; (C) GSK- 3significantβ; (D) β-catenin; differences (E) C/EBP are denotedα; (F) PPAR by anγ. asterisk Values (*arep expressed< 0.05). as means ± s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk (* p < 0.05). 3.3. Effect of Wnt10b Gene Overexpression on the Gene Expression and Activity of Fatty Acid Synthetase (FAS), Acetyl-CoA Carboxylase (ACC) and ATP-Citrate Lyase (ACL), 3.3. Effect of Wnt10b Gene Overexpression on the Gene Expression and Activity of Fatty Acid Synthetase (FAS),As Acetyl-CoA shown on Carboxylase Figure3, Wnt10b (ACC) gene and overexpressionATP-Citrate Lyase significantly (ACL), decreased the mRNA expression of FAS, ACC, and ACL (Figure3A–C). Moreover, the activity of FAS, ACC, and ACL was also As shown on Figure 3, Wnt10b gene overexpression significantly decreased the mRNA significantly decreased by Wnt10b gene overexpression in the muscle of zebrafish (Figure3D–F). expression of FAS, ACC, and ACL (Figure 3A–C). Moreover, the activity of FAS, ACC, and ACL was also significantly decreased by Wnt10b gene overexpression in the muscle of zebrafish (Figure 3D– F).

Cells 2019, 8, 1011 6 of 13 Cells 2019, 8, x 6 of 14

Figure 3. Effect of Wnt10b gene overexpression on the mRNA expression and activity of Fatty Acid FigureSynthetase 3. Effect (FAS), of Wnt10b Acetyl-CoA gene Carboxylaseoverexpression (ACC), on the and mRNA ATP-Citrate expression Lyase and (ACL) activity in theof Fatty muscle Acid of Synthetasezebrafish. ((FAS),A) The Acetyl-CoA mRNA expression Carboxylase of FAS; (ACC), (B) Theand mRNAATP-Citrat expressione Lyase of(ACL) ACC; in ( Cthe) The muscle mRNA of zebrafish.expression (A of) ACL;The mRNA (D) The expression activity of FAS;of FAS; (E) The(B) activityThe mRNA of ACC; expression (F) The activityof ACC; of ( ACL.C) The Values mRNA are expressed as means s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk expression of ACL; (D±) The activity of FAS; (E) The activity of ACC; (F) The activity of ACL. Values are(* p expressed< 0.05). as means ± s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk 3.4. E(*ff pect < 0.05). of Wnt10b Gene Overexpression on the Biochemical Index in the Muscle

3.4. EffectThe contentof Wnt10b of TG Gene and Overexpression TC was signiﬁcantly on the Biochemical decreased by Index Wnt10b in the gene Muscle overexpression (Figure4A,B). In addition, Wnt10b gene overexpression signiﬁcantly decreased the content of NEFA in the muscle The content of TG and TC was significantly decreased by Wnt10b gene overexpression (Figure (Figure4C). 4A,B). In addition, Wnt10b gene overexpression significantly decreased the content of NEFA in the muscle (Figure 4C).

Cells 2019, 8, 1011 7 of 13 Cells 2019, 8, x 7 of 14

Figure 4. Effect of Wnt10b gene overexpression on the content of triglyceride (TG), total cholesterol (TC), Figure 4. Effect of Wnt10b gene overexpression on the content of triglyceride (TG), total cholesterol and non-esterified(TC), fattyand non-esterified acids (NEFA) fatty acids in the (NEFA) muscle. in the muscle. (A) TG; (A) ( BTG;) TC;(B) TC; (C ()C NEFA.) NEFA. Values Values are are expressed as means s.e.m.expressed (n = 4). as Statisticallymeans ± s.e.m. (n significant = 4). Statistically di significantfferences differenc are denotedes are denoted by by an an asterisk asterisk (* p (* p < 0.05). ± < 0.05). 3.5. Effect of Wnt10b Gene Interference on the Gene Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, 3.5. Effect of Wnt10b Gene Interference on the Gene Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, and and PPARγ PPARγ The interferenceThe interference of Wnt10b of Wnt10b gene gene significantly significantly decreased decreased the mRNA the mRNAexpression expressionof Wnt10b and of Wnt10b and β-catenin (Figure 5A,C), but significantly increased the expression of GSK-3β in the muscle (Figure β-catenin (Figure5B).5 Moreover,A,C), but silencing significantly Wnt10b gene increased significantly the decreased expression the mRNA of expression GSK-3 β of inC/EBP theα muscleand (Figure5B). Moreover, silencingPPARγ Wnt10b(Figure 5D,E). gene significantly decreased the mRNA expression of C/EBPα and PPARγ

(Figure5D,E). Cells 2019, 8, x 8 of 14

Figure 5. Effect of Wnt10b gene interference on the mRNA expression of Wnt10b, GSK-3 β, β-catenin, C/EBPα, and PPARFigureγ 5. inEffect the of Wnt10b muscle gene of interference zebrafish. on the (A mRNA) Wnt10b; expression (B )of GSK-3 Wnt10b,β GSK-3;(C)β,β β-catenin,-catenin; (D)C/EBPα; C/EBPα, and PPARγ in the muscle of zebrafish. (A) Wnt10b; (B) GSK-3β; (C) β-catenin; (D) C/EBPα; (E) PPARγ. Values(E) PPAR areγ. Values expressed are expressed as means as means ±s.e.m. s.e.m. (n (=n 4).= Statistically4). Statistically significant significantdifferences are differences are ± denoted by andenoted asterisk by an (* asteriskp < 0.05). (* p < 0.05). 3.6. Effect of Wnt10b Gene Interference on the Protein Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, and PPARγ The protein expression of Wnt10b and β-catenin was significantly decreased by Wnt10b gene interference in the muscle (Figure 6A,B,D). However, Wnt10b gene interference significantly increased the protein expression of GSK-3β (Figure 6A,C). Nevertheless, the protein expression of C/EBPα and PPARγ was significantly inhibited by Wnt10b gene interference in the muscle of zebrafish (Figure 6A,E,F).

Cells 2019, 8, 1011 8 of 13

3.6. Effect of Wnt10b Gene Interference on the Protein Expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, and PPARγ The protein expression of Wnt10b and β-catenin was significantly decreased by Wnt10b gene interference in the muscle (Figure6A,B,D). However, Wnt10b gene interference significantly increased the protein expression of GSK-3β (Figure6A,C). Nevertheless, the protein expression of C /EBPα and PPARγ was significantly inhibited by Wnt10b gene interference in the muscle of zebrafish Cells 2019, 8, x 9 of 14 (Figure6A,E,F).

Figure 6. Effect of Wnt10b gene interference on the protein expression of Wnt10b, GSK-3β, β-catenin, C/EBPα, and PPARγ in the muscle of zebrafish. (A) The protein bands; (B) Wnt10b; Figure 6. Effect of Wnt10b gene interference on the protein expression of Wnt10b, GSK-3β, β-catenin, (C) GSK-3β;(D) β-catenin; (E)C/EBPα;(F) PPARγ. Values are expressed as means s.e.m. (n = 4). C/EBPα, and PPARγ in the muscle of zebrafish. (A) The protein bands; (B) Wnt10b; (±C) GSK-3β; (D) Statistically significant differences are denoted by an asterisk (* p < 0.05). β-catenin; (E) C/EBPα; (F) PPARγ. Values are expressed as means ± s.e.m. (n = 4). Statistically 3.7. Esignificantffect of Wnt10b differences Gene are Interference denoted by on an the asterisk Gene Expression (* p < 0.05). and Activity of FAS, ACC, and ACL

3.7. EffectWnt10b of Wnt10b gene interference Gene Interference significantly on the Ge increasedne Expression the mRNAand Activity expression of FAS,of ACC, FAS, and ACC, ACL and ACL (Figure7A–C). The activity of FAS, ACC, and ACL was also significantly increased by Wnt10b gene interferenceWnt10b ingene the interference muscle of zebrafish significantly (Figure increase7D–F).d the mRNA expression of FAS, ACC, and ACL (Figure 7A–C). The activity of FAS, ACC, and ACL was also significantly increased by Wnt10b gene interference in the muscle of zebrafish (Figure 7D–F).

CellsCells 20192019, ,88, ,x 1011 10 9of of 14 13

Figure 7. Effect of Wnt10b gene interference on the mRNA expression and activity of Fatty Acid Synthetase (FAS), Acetyl-CoA Carboxylase (ACC), and ATP-Citrate Lyase (ACL) in the muscle of Figure 7. Effect of Wnt10b gene interference on the mRNA expression and activity of Fatty Acid zebrafish. (A) The mRNA expression of FAS; (B) The mRNA expression of ACC; (C) The mRNA Synthetase (FAS), Acetyl-CoA Carboxylase (ACC), and ATP-Citrate Lyase (ACL) in the muscle of expression of ACL; (D) The activity of FAS; (E) The activity of ACC; (F) The activity of ACL. Values are zebrafish. (A) The mRNA expression of FAS; (B) The mRNA expression of ACC; (C) The mRNA expressed as means s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk expression of ACL; (D±) The activity of FAS; (E) The activity of ACC; (F) The activity of ACL. Values (* p < 0.05). are expressed as means ± s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk 3.8. E(*ff pect < 0.05). of Wnt10b Gene Interference on the Biochemical Index in the Muscle

3.8. EffectThe contentof Wnt10b of Gene TG and Interference TC was signiﬁcantlyon the Biochemical increased Index by in Wnt10bthe Muscle gene interference (Figure8A,B). In addition, Wnt10b gene interference signiﬁcantly increased the content of NEFA in the muscle (FigureThe8 C).content of TG and TC was significantly increased by Wnt10b gene interference (Figure 8A,B). In addition, Wnt10b gene interference significantly increased the content of NEFA in the muscle (Figure 8C).

Cells 2019, 8, x 11 of 14

CellsCells 20192019, ,88, ,x 1011 1110 of of 14 13

Figure 8. Effect of Wnt10b gene interference on the content of triglyceride (TG), total cholesterol (TC), andFigure non-esterified 8. Effect of fatty Wnt10b acids gene (NEFA) interference in the muscle. on the content(A) TG; of (B triglyceride) TC; (C) NEFA. (TG), Values total cholesterol are expressed (TC), asFigureand means non-esterified 8. Effect± s.e.m. of (Wnt10bn fatty = 4). acidsStatistically gene (NEFA) interference significant in the muscle.on the differenc cont (A)ent TG;es of are ( Btriglyceride) denoted TC; (C) NEFA. by (TG), an asterisk Valuestotal cholesterol are (* p expressed < 0.05). (TC), as means s.e.m. (n = 4). Statistically significant differences are denoted by an asterisk (* p < 0.05). and non-esterified± fatty acids (NEFA) in the muscle. (A) TG; (B) TC; (C) NEFA. Values are expressed 3.9. Effect of Wnt10b Gene Overexpression and Interference on the mRNA Expression of HMGCR in the 3.9.as Eff meansect of Wnt10b ± s.e.m. Gene(n = 4). Overexpression Statistically significant and Interference differenc ones are the denoted mRNA Expressionby an asterisk of HMGCR (* p < 0.05). in the MuscleMuscle of of Zebrafish Zebrafish 3.9. EffectWnt10b of Wnt10b gene interferenceGene Overexpression significantly and Inte indurferenceced onthe the mRNA mRNA Expressionexpression of of HMGCR HMGCR, in the while MuscleWnt10b of Zebrafish gene interference significantly induced the mRNA expression of HMGCR, while Wnt10b Wnt10bgene overexpression gene overexpression significantly significantly decreased decr theeased expression the expression of HMGCR of HMGCR (Figure9 (FigureA,B). 9A,B). Wnt10b gene interference significantly induced the mRNA expression of HMGCR, while Wnt10b gene overexpression significantly decreased the expression of HMGCR (Figure 9A,B).

Figure 9. Effect of Wnt10b gene interference and overexpression on the mRNA expression of HMG-CoA Figurereductase 9. Effect (HMGCR) of Wnt10b in the gene muscle interference of zebrafish. and (overA)Eexpressionffect of Wnt10b on the gene mRNA interference expression on theof HMG- mRNA CoAexpression reductase of HMGCR; (HMGCR) (B )Ein fftheect muscle of Wnt10b of zebrafish. gene overexpression (A) Effect of on Wnt10b the mRNA gene expression interference of HMGCR. on the Values are expressed as means s.e.m. (n = 4). Statistically significant differences are denoted by an FiguremRNA 9.expression Effect of Wnt10bof HMGCR; gene ( ±Binterference) Effect of Wnt10b and over geneexpression overexpre onssion the mRNA on the mRNAexpression expression of HMG- of asterisk (* p < 0.05). CoAHMGCR. reductase Values (HMGCR) are expres in sedthe muscleas means of zebrafish.± s.e.m. (n ( A=) 4).Effect Statistically of Wnt10b sign geneificant interference differences on theare denoted by an asterisk (* p < 0.05). 4. DiscussionmRNA expression of HMGCR; (B) Effect of Wnt10b gene overexpression on the mRNA expression of HMGCR. Values are expressed as means ± s.e.m. (n = 4). Statistically significant differences are 4. DiscussiondenotedWnts exerts by an functionsasterisk (* p through < 0.05). multiple effectors, among which β-catenin is the most important one [4,5,14,15]. As Wnt ligands bound to receptors on the cell membrane, GSK-3β activity was impeded

4. Discussion

Cells 2019, 8, 1011 11 of 13 and β-catenin accumulated [4,16,17]. In addition, GSK-3β can phosphorylate β-catenin, which leads to the degradation of β-catenin [18,19]. In the present study, the overexpression of Wnt10b gene decreased GSK-3β expression and increased β-catenin expression in the muscle, whereas the interference of Wnt10b gene exhibited a negative effect on the expression of GSK-3β and β-catenin. Thus, the results indicated that Wnt10b induced β-catenin signaling by inhibiting GSK-3β expression. In the muscle of fish, lipid is easily stored up for energy utilization [20–22]. As main lipogenic enzymes, FAS, ACC, and ACL play a key role in lipid deposition in the muscle of fish. In the present study, the activity and mRNA expression of ACC, FAS, and ACL in muscle were significantly decreased by Wnt10b gene overexpression, but significantly induced by Wnt10b gene interference. These results indicate that Wnt signaling may inhibit the synthesis of fatty acid through decreasing FAS, ACC, and ACL activity. In addition, the content of NEFA, TC, and TG was significantly decreased by Wnt10b gene overexpression in the muscle of zebrafish, but significantly increased by Wnt10b gene interference. In the process of lipid homeostasis, a balance between the synthesis and hydrolysis of fatty acid is present in the normal physiological status of a cell. Since the biochemical indexes were significantly affected by Wnt10b, Wnt10b signaling may have regulated the levels of NEFA, TC, and TG through regulating ACC, FAS, and ACL activity in the muscle of the zebrafish. As a rate-limiting enzyme in the process of cholesterol synthesis, the activity and expression of HMGCR is regulated by various small molecular metabolites. The expression level of HMGCR is closely related to the content of TC. In this study, the overexpression of the Wnt10b gene significantly inhibited the mRNA expression of HMGCR, but Wnt10b gene interference significantly induced HMGCR expression. The decrease of HMGCR expression induced by Wnt10b gene overexpression may result in the decrease of TC content in the muscle of zebrafish. The development of adipose tissue comprises the proliferation of new adipocytes as well as the hypertrophy of existing adipocytes. It has been observed that PPARγ and C/EBPα participate in regulating the expression of genes related to the adipocyte proliferation [23]. In the process of adipocyte differentiation, a variety of proteins and enzymes on the lipid synthesis were regulated by PPARγ and C/EBPα [24,25]. Furthermore, Wnt/β-catenin signaling regulates the expression level of PPARγ and C/EBPα [26,27], which is closely related to the process of lipid deposition [27]. Therefore, the expression levels of PPARγ and C/EBPα were investigated in the present study. Our data showed that the expression of C/EBPα and PPARγ was induced by Wnt10b gene overexpression and inhibited by silencing of the Wnt10b gene. This shows that C/EBPα and PPARγ are involved in the process of fatty acid synthesis. However, whether Wnt10b gene participates in regulating PPARβ and PPARδ needs to be researched in the future. In summary, we explored a novel mechanism that Wnt10b participates in regulating fatty acid synthesis in the muscle of zebrafish. We modulated innate Wnt10b levels by gene overexpression or interference, and our results revealed that Wnt10b induced GSK-3β/β-catenin signaling, which further inhibited fatty acid synthesis in the muscle of zebrafish.

Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/8/9/1011/s1, Figure S1: The construction of pEGFP-N1-Wnt10b. Author Contributions: Conceptualization, D.L.; methodology, Q.H.; software, Q.S.; validation, Q.Z. and H.Y.; formal analysis, Q.Z.; investigation, D.L. and Q.S.; resources, Q.P.; data curation, Q.H.; writing—original draft preparation, D.L.; writing—review and editing, D.L. and Q.Z.; visualization, Q.P.; supervision, D.L. and Q.P.; project administration, D.L. and Q.Z.; funding acquisition, D.L., Q.Z. and H.Y. Funding: This study was supported by the Natural Science Foundation of Shandong Province (Grant No. ZR2016CM18), Innovation Team Fund Project of Young Xiangsi Lake Scholars of Guangxi University for Nationalities (2018RSCXSHQN02), Scientific Research Foundation for the Introduced Talents of Guangxi University for Nationalities (2018KJQD14), Key Technology Innovation Project of Shandong Province (Grant No. 2018CXGC0102), and Science and Technology Fund Planning Project of Weifang (Grant No. 2018ZJ1076). Conflicts of Interest: The authors declare no conflict of interest. Cells 2019, 8, 1011 12 of 13

References

1. Prud’homme, B.; Lartillot, N.; Balavoine, G.; Adoutte, A.; Vervoort, M. Phylogenetic Analysis of the Wnt Gene Family: Insights from Lophotrochozoan Members. Curr. Biol. 2002, 12, 1395–1400. [CrossRef] 2. Nusse, R. An ancient cluster of Wnt paralogues. Trends Genet. 2001, 17, 443. [CrossRef] 3. Kusserow, A.; Pang, K.; Sturm, C.; Hrouda, M.; Lentfer, J.; Schmidt, H.A.; Technau, U.; von Haeseler, A.; Hobmayer, B.; Martindale, M.Q.; et al. Unexpected complexity of the Wnt gene family in a sea anemone. Nature 2005, 433, 156–160. [CrossRef][PubMed] 4. Taelman, V.F.; Dobrowolski, R.; Plouhinec, J.L.; Fuentealba, L.C.; Vorwald, P.P.; Gumper, I.; Sabatini, D.D.; De Robertis, E.M. Wnt signaling requires sequestration of glycogen synthase kinase 3 inside multivesicular endosomes. Cell 2010, 143, 1136–1148. [CrossRef][PubMed] 5. Valenta, T.; Hausmann, G.; Basler, K. The many faces and functions of β-catenin. EMBO J. 2012, 31, 2714–2736. [CrossRef][PubMed] 6. Christodoulides, C.; Scarda, A.; Granzotto, M.; Milan, G.; Dalla Nora, E.; Keogh, J.; De Pergola, G.; Stirling, H.; Pannacciulli, N.; Sethi, J.K.; et al. WNT10B mutations in human obesity. Diabetologia 2006, 49, 678–684. [CrossRef][PubMed] 7. Guo, Y.F.; Xiong, D.H.; Shen, H.; Zhao, L.J.; Xiao, P.; Guo, Y.; Wang, W.; Yang, T.L.; Recker, R.R.; Deng, H.W. Polymorphisms of the lowdensity lipoprotein receptor-related protein 5 (LRP5) gene are associated with obesity phenotypes in a large family-based association study. J. Med. Genet. 2006, 43, 798–803. [CrossRef] 8. Kanazawa, A.; Tsukada, S.; Sekine, A.; Tsunoda, T.; Takahashi, A.; Kashiwagi, A.; Tanaka, Y.; Babazono, T.; Matsuda, M.; Kaku, K.; et al. Association of the gene encoding wingless-type mammary tumor virus integration-site family member 5B (WNT5B) with type 2 diabetes. Am. J. Hum. Genet. 2004, 75, 832–843. [CrossRef] 9. Prestwich, T.C.; Macdougald, O.A. Wnt/beta-catenin signaling in adipogenesis and metabolism. Curr. Opin. Cell Biol. 2007, 19, 612–617. [CrossRef] 10. Behari, J.; Li, H.; Liu, S.; Stefanovic-Racic, M.; Alonso, L.; O’Donnell, C.P.; Shiva, S.; Singamsetty, S.; Watanabe, Y.; Singh, V.P.; et al. β-catenin links hepatic metabolic zonation with lipid metabolism and diet-induced obesity in mice. Am. J. Pathol. 2014, 184, 3284–3298. [CrossRef] 11. Hansen, E.; Fernandes, K.; Goldspink, G.; Butterworth, P.; Umeda, P.K.; Chang, K.C. Strong expression of foreign genes following direct injection into fish muscle. FEBS Lett. 1991, 290, 73–76. [CrossRef] 12. Arockiaraj, J.; Palanisamy, R.; Bhatt, P.; Kumaresan, V.; Gnanam, A.J.; Pasupuleti, M.; Kasi, M. A novel murrel Channa striatus mitochondrial manganese superoxide dismutase: Gene silencing, SOD activity, superoxide anion production and expression. Fish Physiol. Biochem. 2014, 40, 1937–1955. [CrossRef][PubMed] 13. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and ∆∆CT the 2− method. Methods 2001, 25, 402–408. [CrossRef][PubMed] 14. Cossu, G.; Borello, U. Wnt signaling and the activation of myogenesis in mammals. EMBO J. 1999, 18, 6867–6872. [CrossRef][PubMed] 15. Ridgeway, A.G.; Petropoulos, H.; Wilton, S.; Skerjanc, I.S. Wnt signaling regulates the function of MyoD and myogenin. J. Biol. Chem. 2000, 275, 32398–32405. [CrossRef][PubMed] 16. Doble, B.W.; Woodgett, J.R. GSK-3: Tricks of the trade for a multitasking kinase. J. Cell Sci. 2003, 116, 1175–1186. [CrossRef][PubMed] 17. Luo, J. Glycogen synthase kinase 3beta (GSK3beta) in tumorigenesis and cancer chemotherapy. Cancer Lett. 2009, 273, 194–200. [CrossRef] 18. Aberle, H.; Bauer, A.; Stappert, J.; Kispert, A.; Kemler, R. Beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 1997, 16, 3797–3804. [CrossRef] 19. Huelsken, J.; Behrens, J. The Wnt signalling pathway. J. Cell Sci. 2002, 115, 3977–3978. [CrossRef] 20. Sheridan, M.A. Lipid dynamics in fish: Aspects of absorption, transportation, deposition and mobilization. Comp. Biochem. Physiol. B 1988, 90, 679–690. [CrossRef] 21. Robinson, J.S.; Mead, J.F. Lipid absorption and deposition in rainbow trout (Salmo gairdnerii). Can. J. Biochem. 1973, 51, 1050–1058. [CrossRef][PubMed] 22. Richard, N.; Kaushik, S.; Larroquet, L.; Panserat, S.; Corraze, G. Replacing dietary fish oil by vegetable oils has little effect on lipogenesis, lipid transport and tissue lipid uptake in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 2006, 96, 299–309. [CrossRef][PubMed] Cells 2019, 8, 1011 13 of 13

23. Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [CrossRef] [PubMed] 24. Shao, D.; Lazar, M.A. Peroxisome proliferator activated receptor gamma, CCAAT/enhancer-binding protein alpha, and cell cycle status regulate the commitment to adipocyte diﬀerentiation. J. Biol. Chem. 1997, 272, 21473–21478. [CrossRef] 25. Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte diﬀerentiation. Physiol. Rev. 1998, 78, 783–809. [CrossRef][PubMed] 26. Kawai, M.; Mushiake, S.; Bessho, K.; Murakami, M.; Namba, N.; Kokubu, C.; Michigami, T.; Ozono, K. Wnt/Lrp/beta-catenin signaling suppresses adipogenesis by inhibiting mutual activation of PPARgamma and C/EBPalpha. Biochem. Biophys. Res. Commun. 2007, 363, 276–282. [CrossRef][PubMed] 27. MacDougald, O.A.; Mandrup, S. Adipogenesis: Forces that tip the scales. Trends Endocrinol. Metab. 2002, 13, 5–11. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).