Conserv Genet DOI 10.1007/s10592-011-0287-9

RESEARCH ARTICLE

Microsatellite evidence for high clonality and limited genetic diversity in Ziziphus celata (Rhamnaceae), an endangered, self-incompatible shrub endemic to the Lake Wales Ridge, Florida, USA

Matthew A. Gitzendanner • Carl W. Weekley • Charlotte C. Germain-Aubrey • Douglas E. Soltis • Pamela S. Soltis

Received: 23 November 2010 / Accepted: 20 October 2011 Ó Springer Science+Business Media B.V. 2011

Abstract Genetic data are often crucial for designing plants differing from a surrounding genotype by a single management strategies for rare and endangered species. microsatellite repeat insertion/deletion mutation, consistent Ziziphus celata is an endangered sandhill shrub endemic to with these having arisen via somatic mutations. Our data the Lake Wales Ridge of central Florida. This self- will enable managers to incorporate extant diversity from incompatible clonal species is known from only 14 wild wild populations into ex situ collections. Additionally, our populations, most of which are small (under 100 plants). research demonstrates the utility of microsatellites for Focusing on the five populations discovered in 2007, we conservation of imperiled species, identifying genotypes of evaluate the level of genetic diversity and identify clonal high priority for preservation. lineages within the wild populations of the species with a set of microsatellite loci. To account for somatic mutations Keywords Clonality Conservation genetics Genetic and genotyping errors, we identified clonal lineages using a diversity Lake Wales Ridge, Florida Rare species threshold cutoff for pair-wise genetic distances among conservation samples. The microsatellites had up to 18 alleles/locus, and, consistent with outcrossing, samples were highly heterozygous (average population level Ho = 0.69). Most Introduction populations of Z. celata consist of a single clone, and the most diverse population has only 10 clones. Overall Genetic information is a valuable resource in designing Z. celata comprises 41 multi-locus genotypes, and 30 management strategies for rare and endangered species clonal lineages. With nearly 1,000 recorded plants (595 (e.g., Avise and Hamrick 1996; Ouborg 2010). These data genotyped) and only 30 clonal lineages, Ziziphus celata is become especially important in species with few and/or highly clonal: clonal richness, R = 0.049. The pair-wise small populations or with breeding systems that complicate distance method facilitates identification of clonal lineages, management. Clonally reproducing, self-incompatible avoiding overestimation of clonal diversity. In most cases, species are particularly prone to extinction as low genetic the samples that grouped into a lineage were one to four diversity and low mate availability may become critical factors well before population census numbers raise con- cern (Gle´min et al. 2008; Hoebee et al. 2008; Honnay and M. A. Gitzendanner (&) C. C. Germain-Aubrey D. E. Soltis Bossuyt 2005; Kwak and Bekker 2006). Populations that Department of Biology, University of Florida, Gainesville, FL appear large and healthy may comprise a single clone, 32611, USA neighboring clones may have incompatible mating types, e-mail: magitz@ufl.edu and without careful management the long-term potential of M. A. Gitzendanner P. S. Soltis a species may be severely compromised by low levels of Florida Museum of Natural History, University of Florida, genetic variation and the absence of sexual reproduction Gainesville, FL 32611, USA (e.g., Scobie and Wilcock 2009; Warburton et al. 2000). C. W. Weekley With their high variability and allelic diversity, micro- Archbold Biological Station, Lake Placid, FL 33862, USA satellites are particularly effective molecular markers for 123 Conserv Genet population genetic studies (Chistiakov et al. 2006). They 2007 each comprise a single clone. In the current study our are well suited to traditional genetic diversity studies, clone goal was to survey genetic diversity in the more recently identification, and paternity analysis (Chistiakov et al. discovered populations, and to bolster the recovery pro- 2006; Halkett et al. 2005). Additionally, recent advances gram by providing detailed knowledge of the extent of have greatly facilitated the technical details of developing genetic diversity encompassed by Z. celata. Specifically, in microsatellite resources in new study species (Castoe et al. this study we genotyped samples from all known wild 2010; Kijas et al. 1994). populations, confirming previous genetic data from the pre- However, as molecular markers have become more sen- 2007 populations (based on limited sampling) and pro- sitive, the risk of overestimating clonal diversity has become viding the first genetic survey of the newly discovered more problematic (Arnaud-Haond et al. 2007; Douhovnik- populations. With these genotypic data, we then identified off and Dodd 2003; Rozenfeld et al. 2007; Schnittler and unique multi-locus genotypes (MLGs) and assigned closely Eusemann 2010). With high mutation rates and large num- related MLGs to clonal lineages. We discuss the implica- ber of alleles, somatic mutants are more readily detected tions of these findings for the continued management of (Arnaud-Haond et al. 2007). Arnaud-Haond et al. argue that Z. celata as well as address the issue of estimating clonal discriminating among collections of somatic mutants over- diversity in the context of conservation. estimates clonal diversity, and that highly similar genotypes should be considered clonal lineages, rather than distinct clones. While overestimating diversity may waste conser- Materials and methods vation effort, failing to identify diversity or grossly under- estimating diversity may result in failure to preserve extant Species description variation. Douhovnikoff and Dodd (2003) and Arnaud-Ha- ond et al. (2007) suggest that clonal or multi-locus lineages Ziziphus celata, a single or multi-stemmed clonal shrub to can be identified by comparing genetic distances among 2 m in height, is narrowly endemic to a 50-km stretch of samples, thereby establishing a threshold under which central Florida’s Lake Wales Ridge in Polk and Highlands genotypes can be considered to belong to the same clonal Counties (Fig. 1). It is both state (Coile and Garland 2003) lineage, or multi-locus lineage (MLL). and federally (USFWS 1999) listed as endangered. At the The Lake Wales Ridge of central Florida is an ancient time of its description in 1984 from a 37-year-old herbar- dune system with an exceptionally high level of endemism ium specimen (Judd and Hall 1984), Z. celata was thought (Christman and Judd 1990; Estill and Cruzen 2001) and to be extinct (DeLaney et al. 1989). However, between which has been increasingly affected by habitat destruction 1987 and 2002, nine populations were discovered in the (Turner et al. 2006; Weekley et al. 2008). Over 30 plant, wild (Table 1). Clones from these populations were used to lichen and animal species are endemic or nearly endemic to establish a captive population in the Center for Plant the scrub and sandhill habitats common to the Ridge Conservation National Collection at Bok Tower Gardens in (Turner et al. 2006). With about 85% of the natural habitats Lake Wales, FL. In 2007, five new populations were dis- lost, management of these species is increasingly complex, covered, including two large, privately owned pasture and plans must incorporate ecological (e.g., Abrahamson populations. All 14 wild populations occur on yellow sands et al. 1984; Menges et al. 2007), life history (e.g., Ellis (Tavares, Astatula and Candler) that historically supported et al. 2007) and genetic data (e.g., Menges et al. 2001) for longleaf pine (Pinus palustris)/wiregrass (Aristida stricta the best outcomes. var. beyrichiana) sandhills or similar pyrogenic commu- Florida ziziphus (Ziziphus celata Judd and D. Hall nities (Myers and Ewel 1990). Seven wild populations now (Rhamnaceae)) is one of Florida’s rarest and most imper- occupy sites that have been converted to cattle pastures iled species (Ward et al. 2003). This self-incompatible (Table 1). Only five wild populations are publicly pro- shrub (Weekley and Race 2001; Weekley et al. 2002), tected. However, three multi-genotype populations have narrowly endemic to fragmented xeric uplands on the Lake been established on publicly protected land. Wales Ridge, was known from only nine wild populations As a member of a pyrogenic plant community, Z. celata until the discovery in 2007 of five new populations. The is adapted to fire. Plants, defined as clusters of ramets within five new populations more than doubled the number of 25 cm of one another (Ellis et al. 2007), resprout following plants known from the wild. All but two wild populations fire or mowing (a standard practice in pastures). Mowing in are quite small, with as few as a single individual and most particular promotes the multi-stemmed habit, but unmowed having fewer than 100 plants. Previous genetic research plants may also develop multiple stems. In the absence of with isozymes (Godt et al. 1997), RAPDs (Weekley et al. fire or mowing, plants may die back and resprout after a few 2002) and AFLPs (Gitzendanner et al. unpublished data) years, either at the base of the old plant or up to 2 m away concurred in finding that most populations known prior to from it. Wild populations vary in size from one plant to 123 Conserv Genet

Fig. 1 Map showing the 14 known wild populations of Ziziphus celata along the Lake Wales Ridge in central Florida, USA

several hundred and in areal extent from a few to several each demonstrated to have multiple genotypes, have been thousand square meters (Table 1). In 2010, the largest wild observed to produce fruits in the past 23 years, but the population included 412 plants (over 1,500 stems) and multi-genotype Bok Tower collection, a managed collec- occupied a section of pasture comprising *35,000 m2. tion of genotypes from many populations, produces a Ziziphus celata has a gametophytic self-incompatibility substantial fruit crop annually, and genetic studies have system (Weekley and Race 2001; Weekley et al. 2002), confirmed that several seedlings have established in the whereby plants sharing the same two S-alleles are cross- garden (Gitzendanner et al. unpublished data). Based on incompatible (Richards 1997). Most wild populations RAPDs genotyping of the pre-2007 wild populations and flower profusely, with large plants producing tens of the results of breeding system experiments, S-locus mating thousands of small (0.5 mm diameter) fragrant flowers that types were assigned to most known genotypes (Weekley attract a wide variety of insects, including flies and bees et al. 2002). These data suggest that the pre-2007 wild (Weekley and Race 2001). Only four wild populations, populations comprised as few as two S-locus mating types.

123 Conserv Genet

Table 1 Site characteristics of 14 wild populations of Ziziphus celata Population Year Discovered Soil Habitat # records # samples Areal extent (# live plants) genotyped (m2)

LWRSF 1 1987 Tavares Turkey oak sandhill 21 (5)a 5 800 Mitigation Site 1988 Tavares Pasture undergoing restoration 6 (1)a 13 Avon Pines 1 1988 Astatula Pasture 311b (40) 43 335 Avon Pines 2 1988 Astatula Pasture 135b (17) 8 60 Avon Pines 3 1988 Astatula Pasture 243b (47) 12 20 Avon Pines 4 1988 Astatula Pasture 74b (18) 32 700 Mt. Lake 1 1995 Candler Sandhill 71b (18) 6 200 Friedlanders 1995 Tavares Pasture 341b (156) 25 500 Mt. Lake 2 2002 Candler Disturbed 25b (6) 5 125 Masterpiece N 2007 Astatula Pasture 275b (236) 131 13,700 Masterpiece S 2007 Astatula Pasture 431 (412) 294 35,000 LWRSF 2 2007 Uncertain Oak-hickory scrub 5 (4) 5 325 CCN 1 2007 Astatula Sandhill 23 (22) 21 1,000 CCN 2 2007 Astatula Oak-hickory scrub 7 (7) 7 400 Shown for each population are the year of its discovery, the soil type and habitat, the number of records in the demography database (and the number of live plants in the 2010 census), and the areal extent of the population. Populations in this and other tables are arranged in order of their date of discovery a Does not include transplants introduced to the site in an experimental augmentation b Number of records inflated because of need to retag plants after tags were displaced by mowing, cattle, wildlife or vandalism

Seedlings are unknown from the wild, and population in silica gel and stored at room temperature until DNA was growth occurs exclusively through clonal recruitment via extracted in the laboratory. root shoots. Demographic models based on two uniclonal populations indicate that populations are subject to slow Microsatellite isolation declines with extinction risks as high as 20% within 50 years (Ellis et al. 2007). Microsatellite loci were isolated from repeat-enriched The pre-2007 populations have been extensively geno- libraries generally following the protocol of Kijas et al. typed with isozymes (Godt et al. 1997), RAPDs (Weekley (1994). Briefly, genomic DNA was digested, compatible et al. 2002) and AFLPs (Gitzendanner et al. unpublished adapters were ligated to cut ends, and biotinylated repeat data), as well as an initial screen with four of the micro- probes and magnetic beads were used to enrich libraries. satellites reported here (MS003, MS004, MS005 and This protocol was conducted twice, once with genomic MS013) (Gitzendanner et al. unpublished data). Each of DNA and once with genomic DNA amplified with the these markers has been consistent in finding that all but one illustra GenomiPhi V2 DNA Amplification Kit (GE of these nine populations each consists of a single clone Healthcare, Piscataway, NJ). Four different repeat probes and that each population is distinct. With this background, were used to generate libraries enriched for fragments our sampling of these nine populations for this study was containing GA, CA, AAG or AAC repeats. Clones were much less intense; our main goal in these nine populations screened for repeats with a PCR check and then sequenced. was to identify the microsatellite genotype for each popu- PCR primers were developed from repeat-containing lation, rather than to further test clonality. sequences either manually or with Batch-Primer3 (You et al. 2008). Forward primers had a M13-tailing sequence Sample collection added for use in labeling PCR products (Schuelke 2000).

Leaves were collected from plants in all 14 wild popula- tions. Sampling was especially concentrated on the newly Microsatellite genotyping discovered wild populations which had not been previously genotyped. In these populations almost all plants were DNA was extracted from samples of Ziziphus celata using genotyped. In pre-2007 populations, for which previous either the Invitrogen Charge Switch CS DNA Extraction studies had already shown high levels of clonality, fewer Kit (Invitrogen, Carlsbad, CA) or a modified CTAB pro- samples were genotyped in this study. Leaves were placed tocol (Doyle and Doyle 1987; Cullings 1992). Most DNAs 123 Conserv Genet were diluted 1:10 prior to PCR. PCR reactions were 10 ll GeneClone2 (Arnaud-Haond et al. 2007) was used to in volume and contained the following: 19 Promega PCR test the statistical power of the loci to resolve genotypes

Flexi Buffer (Promega Corp., Madison, WI), 2 mM MgCl2, using 1,000 permutations. In addition, the Parks and Werth 50 lM dNTPs, 450 lM reverse and M13-primer labeled (1993) method, implemented in GeneClone2, of round with either 6-FAM, VIC, NED, or PET (Applied Biosys- robin allele frequency estimation to calculate the proba- tems, Inc., Foster City, CA), 20 lM of the forward primer bility that identical genotypes were the result of different and 0.5 unit of Taq DNA polymerase produced in our lab. sexual reproductive events (Psex) was used. Following PCR, the eight loci were pooled with 1.5 llof the 6-FAM- and VIC-labeled products and 3.0 ll of the Clonal lineage composition NED- and PET-labeled products along with 41 ll of water. Samples were submitted to the UF ICBR Genetics Analysis To account for somatic mutations and genotyping error, core where they were mixed with the GS-600-Liz size GenoDive was used to estimate clonal lineage or MLL standard and run on an ABI 3730XL (Applied Biosystems, composition. Pairwise genetic distances, based on muta- Inc., Foster City, CA). tional steps under the stepwise mutational model, were Trace files were analyzed with GeneMarker 4.6 (Soft- calculated for all samples and plotted as a histogram using Genetics, State College, PA) using an initial pass of auto- GenoDive. Based on the shape of the histogram and rec- mated peak scoring followed by manual verification and ommendations from other researchers (Arnaud-Haond correction. Where required for data analyses, data were et al. 2007; Douhovnikoff and Dodd 2003; Meirmans and transformed to repeat unit numbers based on the genotypes Van Tienderen 2004; Rozenfeld et al. 2007), two thresh- of the samples used to develop the microsatellite loci and olds are discussed here, one mutational step and four steps. the number of repeats estimated from the sequence traces. The distance matrix was also transformed into a UPGMA phenogram using PAUP* 4.0b10 (Swofford 2003). Multi-locus genotype assignment and statistical analysis

MLGs were identified manually and with the aid of two Results software packages: GenoDive 2.0b20 (Meirmans and Van Tienderen 2004) and GenAlEx 6.41 (Peakal and Smouse Microsatellite isolation 2006). When assigning genotypes manually, samples with missing data were assigned to a MLG only when all other We developed and tested 34 primer sets, nine of which known MLGs could be eliminated as possible genotypes. amplified consistently in Ziziphus celata (Table 2). These Missing data present a challenge to automated MLG primers were screened for polymorphism using samples assignment. Samples with missing data are generally from known genotypes. One primer set was dropped assigned unique genotypes by the software. For this reason, because its product was too large (*700 bp) for screening samples with missing data were eliminated from the data on the ABI sequencer. Of the other eight loci all but one set for analysis with the software except in the three cases (Zice130) were polymorphic. Both genomic DNA and where all of the samples for a MLG had some missing data. GenomiPhi-amplified DNA gave equally good results in Standard population genetic statistics were calculated identifying loci with microsatellite repeats. For many with GenAlEx 6.41 (Peakal and Smouse 2006) following species, obtaining the approximately 5–10 lg of genomic the removal of duplicate samples with the same multi-locus DNA required to construct a microsatellite library can be genotype. We report the average number of alleles per difficult; these results indicate that GenomiPhi amplifica- locus as well as the average effective number of alleles per tion is a viable option in these cases. locus, calculated as Neff = 1/(1 - He) for each locus and averaged across loci. The effective number of alleles per Microsatellite genotyping locus accounts for varying allele frequency distributions across loci and populations (Peakal and Smouse 2006). We We genotyped 595 plants at the eight microsatellite loci also report observed and expected heterozygosities and the (Table 3). The number of alleles per locus at the species fixation index. Finally, clonal richness was estimated as level ranged from 1 to 18 (Table 2). Two of the eight loci R = (G - 1)(N - 1) where G is the best estimate of the were excluded from further analysis: despite initial tests number of clonal lineages in a population (see ‘‘Results’’) showing polymorphism, locus MS130 was found to be and N is the number of plants genotyped. Note that this monomorphic, and locus MS005 did not amplify (had null number is heavily influenced by sample size and should be alleles) in many individuals. Where MS005 did amplify, interpreted with caution. other loci could be used to identify the same genotypes. 123 Conserv Genet

Table 2 Primer sequence information, repeat motif with number of repeats in reference allele, and number of alleles found in Ziziphus celata samples for the microsatellite loci used in this study Primer name Repeat motif Primer sequence (50–30)a # of alleles

MS003_F (GA)23 CAGATGAAGAAACATCAACTGAAA 18 MS003_R CCATGTTAACCACCGTTCCT

MS004_F (GA)11 CAGCACGAATGCCATTTTAG 8 MS004_R TCGGTGAAGACACACTCAGC b MS005_F (GA)9 TGACGTTATAAGAATAGCGAGTCA 6 MS005_R AGCCGGGAAGGCTTATTTT

MS013_F (GA)14 GCTGCCTGTTTGTGAATGAG 5 MS013_R TTTGCAGGTCATGCTGAGAC

MS121_F (AAG)12 GCTGTCAACATTCATCCTAGT 5 MS121_R TCTTATTAAGGCAGTCCAGAA

MS125_F (AAG)7 ATCGTTTCTGTCTGTATGGTG 7 MS125_R TTCCACAACAAGTTGAAGAGT

MS130_F (AAG)6 AAGGTTGGCTTTGTTCTTC 1 MS130_R CAGTGAATCCACTAGCATTTT

MS134_F (CA)10 GAAGCTTGGGATGGTAGTAAT Too big to genotype MS134_R AGACAAGATTAAAGTGGTTGCT

MS139_F (CA)13 CCCACTTATCTAATGCAACAC 10 MS139_R CCCTTCTTTTGGAAATTTAAC a The M13 tailing sequence (CACGACGTTGTAAAACGAC) was added to the 50 end of all forward primers b MS005 has null alleles (does not amplify) in many genotypes

Table 3 Number of multi-locus Population Multi-locus Clonal lineages Clonal lineages Best estimate Clonal Richness R genotypes and clonal lineages genotypes (1 step) (4 steps) of number (Best estimate) identified in each population of clones using different threshold values for number of mutational steps LWRSF 1 1 1 1 1 0 differentiating unique lineages. The best estimate of clone Mitigation Site 1 1 1 1 0 number column is an ad-hoc Avon Pines 1 1 1 1 1 0 estimate based on MLGs that Avon Pines 2 1 1 1 1 0 seem unreasonable to combine Avon Pines 3 1 1 1 1 0 into MLLs (see text) Avon Pines 4 4 1 1 4 0.097 Mt. Lake 1 1 1 1 1 0 Freidlanders 1 1 1 1 0 Mt. Lake 2 1 1 1 1 0 Masterpiece N 5 3 2 3 0.015 Masterpiece S 19 9 3 10 0.031 LWRSF 2 1 1 1 1 0 CCN 1 2 2 2 2 0.05 CCN 2 2 2 2 2 0.167 Total 41 26 19 30 0.049

For the eight loci, at the population level, alleles per locus samples. No MLGs were found in more than one population. ranged from 1 to 9. A test of genotypic resolution showed that A histogram of genetic distances (calculated as mutational four loci were statistically sufficient to identify the genotypes steps assuming a stepwise mutation model for microsatel- inferred using the six informative loci, providing evidence lites) among MLGs showed a distribution with peaks at one that our power to discriminate genotypes was sufficient. and four mutational steps followed by a gap and an increase Forty-one multi-locus genotypes were identified from the after additional peaks at nine and 11 steps (Fig. 2).

123 Conserv Genet

Following removal of clonemates (based on MLGs), for psex(FIS), the probability that the same genotype found the six informative loci, the average number of alleles per multiple times originated from sexual reproduction, are locus at the population level ranged from 1.33 to 5.5, with a below 0.001, indicating that multiple occurrences of species-wide average of 2.23 (Table 4). Consistent with the genotypes are most likely due to clonal, asexual repro- established obligate outcrossing nature of the species duction rather than sexual reproduction among close rela- (Weekley and Race 2001; Weekley et al. 2002), observed tives. This is consistent with the observed reproduction via heterozygosities were high (average of 0.69) and consis- root shoots and the self-incompatibility in the species. tently higher than expected heterozygosities (average of 0.39). The high heterozygosities may also be due to the Clonal lineage composition clonal nature of the species (e.g., Balloux et al. 2003). Fixation indices were negative (average of -0.77), again Following Arnaud-Haond et al. (2007) and others, geno- consistent with outcrossing. types differing by either one or four steps were lumped into Based on GenClone2 estimates, for all genotypes, clonal lineages or MLLs, with the differences attributed to pgen(FIS), the probability of a genotype occurring, and somatic mutations or genotyping errors. The 1-step

Fig. 2 Histogram of pair-wise 45 12000 genetic distance frequencies (bars) and number of multi- 40 locus lineages recognized at a 10000 given distance threshold (solid 35 line). The vertical dashed lines 30 8000 are at the 1-step and 4-step threshold values 25 6000 20

15 4000 threshold value Number of pairs 10 2000 Number of MLLs at given 5

0 0 0 2 4 6 8 101214161820222426283032343638404244464850 Pairwise genetic distance (SMM mutations)

Table 4 Genetic diversity indices for populations of Ziziphus celata number of alleles per locus, Ho observed heterozygosity, He expected calculated after removing samples with identical multi-locus geno- heterozygosity, F fixation index. Standard errors are given in types. Na average number of alleles per locus, Neff average effective parentheses

Population Na Neff Ho He F

LWRSF 1 1.50 (0.22) 1.50 (0.22) 0.50 (0.22) 0.25 (0.11) -1.00 (0) Mitigation Site 2.00 (0.00) 2.00 (0.00) 1.00 (0) 0.42 (0.08) -1.00 (0) Avon Pines 1 1.67 (0.21) 1.67 (0.21) 0.67 (.21) 0.33 (0.10) -1.00 (0) Avon Pines 2 1.33 (0.21) 1.33 (0.21) 0.33 (0.21) 0.17 (0.10) -1.00 (0) Avon Pines 3 1.50 (0.22) 1.50 (0.22) 0.50 (0.22) 0.25 (0.11) -1.00 (0) Avon Pines 4 2.33 (0.42) 2.06 (0.26) 0.83 (0.17) 0.46 (0.09) -0.84 (0.09) Mt. Lake 1 1.83 (0.17) 1.83 (0.17) 0.83 (0.17) 0.42 (0.08) -1.00 (0) Freidlanders 1.67 (0.21) 1.67 (0.21) 0.67 (0.21) 0.33 (0.10) -1.00 (0) Mt. Lake 2 1.67 (0.21) 1.67 (0.21) 0.67 (0.21) 0.33 (0.11) -1.00 (0) Masterpiece N 3.67 (0.49) 2.75 (0.36) 0.83 (0.10) 0.59 (0.07) -0.44 (0.12) Masterpiece S 5.50 (1.76) 2.70 (0.48) 0.67 (0.16) 0.55 (0.09) -0.06 (0.22) LWRSF 2 1.83 (0.17) 1.83 (0.17) 0.83 (0.17) 0.42 (0.08) -1.00 (0) CCN 1 2.67 (0.42) 2.53 (0.47) 0.83 (0.10) 0.54 (0.07) -0.56 (0.14) CCN 2 2.00 (0.45) 1.87 (0.46) 0.50 (0.18) 0.35 (0.12) -0.50 (0.14) Pop-level average 2.23 (0.18) 1.92 (0.09) 0.69 (0.05) 0.39 (0.03) -0.77 (0.04)

123 Conserv Genet threshold resulted in 26 clonal lineages, while the 4-step threshold is also consistent with the recommendations of threshold resulted in 19 clonal lineages. A UPGMA phy- Schnittler and Eusemann (2010). logram was generated showing the MLGs as well as 1- and Eight of the nine populations known prior to 2007 were 4-step MLLs (Fig. 3). In general, while some MLGs group each confirmed to consist of a single, distinct clone. The within populations, there is little association between one genetically variable population of those known prior to genetic similarity and geographic distance. 2007, Avon Pines #4, has four MLGs that differ from each The lineages identified by the 1-step MLLs correspond other by single mutational steps, and the four MLGs form a well to geographic distribution and MLG prevalence, single clonal lineage. However, unlike other cases where mostly identifying one to four samples surrounded by, and there is a dominant MLG surrounding a few plants dif- differing by one or two mutational steps from, a much fering by a single mutation, the four MLGs in this popu- more common MLG. However, the 4-step MLLs group lation are each somewhat distinct, multi-stemmed clumps. plants from opposite ends of the species’ distribution. With Of the newly discovered populations, each Carter Creek the exception of the two cases noted below, we adopt the North population had two MLGs, and the most diverse 1-step MLLs for identifying clonal lineages. The 1-step populations, Masterpiece North and South, had five and 19

Fig. 3 UPGMA phenogram of Ziziphus celata multi-locus genotypes separated by 20–50 m. *** indicates the Masterpiece S sample that is (tips), 1-step multi-locus lineages (light shading) and 4-step multi- grouped in a MLL with plants that are about 30 m away (see locus lineages (dark shading). Masterpiece North and South (MPN, ‘‘Results’’) MPS) groups are groupings of plants within the sites and are generally 123 Conserv Genet

MLGs, respectively. Accounting for somatic mutations and balancing the effects of over- versus underestimating clonal genotyping errors, the numbers of clonal lineages in the diversity. For an imperiled species, where the line is drawn Masterpiece North and South populations were three and will have direct implications for conservation management nine, respectively (Table 3). However, one of the lineages and for the future genetic diversity of the species. groups a sample that is about 30 m from the rest of the While overestimating the number of clones may lead to clone (indicated with *** in Fig. 3). increased management expense, underestimating clone In addition to the 1- and 4-step clonal lineages, we number may result in the loss of genetic diversity by report a ‘‘best estimate’’ of the numbers of clones. This mistakenly lumping genetically distinct individuals. How estimate accounts for the particular circumstances raised important are plants harboring somatic mutations at rapidly above in the Avon Pines #4 population and the Masterpiece evolving microsatellite loci for the continued survival of South sample that is 30 m from the rest of the clonal the species? Although it is tempting to dismiss MLGs with lineage. In these cases we conservatively retain these small differences as contributing little to the genetic MLGs as distinct clones rather than lump them into MLLs. diversity of the species, it is important to take into con- sideration Z. celata’s extremely low levels of genetic diversity. Additionally, any indication of genetic differen- Discussion tiation that the microsatellites detect can clue researchers into samples for evaluation of differentiation at other loci, Microsatellite genotyping confirms that most wild popu- such as the rapidly evolving S-RNase locus that mediates lations of Ziziphus celata are uniclonal and that even the the self-incompatibility reaction (Kao and Tsukamoto largest and most diverse populations contain limited 2004), or in evaluating ecological traits (McKay and Latta genetic diversity. This information provides crucial 2002). Our approach attempts to strike a balance between guidelines for managing extant wild populations, for over- and underestimating clonal diversity in the species. expanding the ex situ population at Bok Tower Gardens, Of the 14 wild populations of Z. celata, nine are estimated and for designing new introductions. to each comprise a single clonal linage (MLL), and four other While sampling was limited for the nine populations populations have two to four lineages. The Masterpiece known prior to 2007, our results are consistent with previous South population, with 10 MLLs, is the most diverse extant analyses (Gitzendanner et al. unpublished data; Godt et al. population, and even this population is dominated by a single 1997; Weekley et al. 2002) indicating that, with one excep- clonal lineage, with over 60% of the genotyped plants tion, each of these populations comprises a single unique assigned to the same MLG. Despite this dominance of a clone per population. The five newly discovered populations, single genotype, one patch of plants within the Masterpiece as well as one of the pre-2007 populations, do have limited South population has nine MLGs and five clonal lineages genetic variation, with the largest and most diverse popula- (Fig. 4). Within this patch, three MLGs are found as single tion containing 19 MLGs. However, many of these MLGs plants, while others are more frequent. Similarly, one clonal differ by a single microsatellite insertion/deletion event, and lineage appears to be represented by a single plant and this population contains only 10 clonal lineages. another by only two, while others are more widespread. To account for somatic mutations and genotyping errors Mate availability is a critical factor in self-incompatible and thus avoid overestimating clonal diversity, we set a species, and the effects of reduced mate availability have threshold value of genetic distance based on a stepwise been linked to lower genetic diversity, especially when mutational model (e.g., Arnaud-Haond et al. 2007; Dou- combined with clonal reproduction (Honnay and Jacque- hovnikoff and Dodd 2003; Meirmans and Van Tienderen myn 2008). The ability of self-incompatible species to 2004; Rozenfeld et al. 2007). The appropriate setting of the maintain mating-allele diversity is limited in small popu- threshold value is dataset-dependent, based on the location of lations, and genome-wide diversity falls even more rapidly the left-hand peak in a histogram of pair-wise genetic dis- (Byers and Meagher 1992; Navascues et al. 2010). Byers tances (Arnaud-Haond et al. 2007). It is not always clear, and Meager (1992) noted that populations smaller than 50 however, where to draw the threshold; indeed Meirmans and individuals rapidly lost mating-alleles. While the census Van Tienderen (2004, p. 793) state, ‘‘Clearly, choosing the size of the largest Ziziphus celata population is over 400, appropriate threshold is crucial, although no objective many are below 50, and, taking clonality into consider- guidelines are available for choosing a suitable threshold.’’ ation, the entire species consists of only 41 MLGs and an Our data do not have a single, clear peak (Fig. 2), though estimated 30 clonal lineages. Thus, careful management of there are peaks at one and four mutational changes. The genetic diversity and mating-alleles will be critical to the 1-step threshold is also consistent with the recommendation continued survival of the species. of Schnittler and Eusemann (2010) as effectively compen- There is a growing body of literature showing the sating for genotyping errors and somatic mutations, decline of sexual reproduction in rare, self-incompatible 123 Conserv Genet

Recovery of most federally listed Lake Wales Ridge endemic plants centers on appropriate management of publicly protected sites—primarily restoration of the nat- ural fire regime. For the genetically depauperate and self- incompatible Z. celata, however, most populations— including the most genetically diverse populations—occur on privately owned sites unlikely to be acquired for con- servation. Consequently, recovery of Z. celata requires the establishment of new, multi-genotype populations on appropriate habitat in publicly protected sites (US Fish and Wildlife Service 1999, 2009). Incorporating the genetic diversity of the remaining wild populations of Z. celata is a key recovery task in implementing the recovery program (USFWS 2009). Since 1994 the ex situ Bok population has produced hundreds of seedlings that have been used in experimental augmentations and introductions (Weekley and Menges 2008). In addition, a few dozen seedlings propagated from the multi-clonal wild populations have also been used in introductions. Although many of these seedlings are sib- lings or half-siblings, they nonetheless represent novel genotypes that have been introduced into wildland sites as the basis of new populations. 10 m The distribution of clones on the UPGMA phylogram is largely unrelated to geography. While some of the clones Fig. 4 Map of the MLGs (each different symbol is a unique MLG) and 1-step clonal lineages (all symbols of the same shape are the same within the larger Masterpiece populations group together, lineage, lineages are also outlined and shaded) in the most diverse clones from many miles away are interspersed in the phen- patch of the Masterpiece South population (all samples shown are in a ogram. For example, a Masterpiece South and a CCN1 single 4-step lineage) genotype, from the far extremes of the geographic distribu- tion, are clustered together. This is an indication that the clones remaining in populations are not descendants of each plants. This can range from reduced seed set in populations other, but probably chance remnants of once larger pools of with fewer clones, as in Dithyrea maritima (Aigner 2004), genotypes. Looking at the alleles found in clones that group to apparent complete loss of sexual reproduction. Several together, there are no cases where it is clear that clones arose rare Australian species persist as a single clone per popu- through sexual reproduction among existing adjacent clones. lation with no known sexual reproduction: Santalum In fact, in most cases the alleles exclude the possibility that lanceolatum (Warburton et al. 2000), Grevillea infecunda clones grouping together in the UPGMA phenogram share a (Kimpton et al. 2002), Borya mirabilis (Coates et al. 2002) parent. Again, this implies that the extant clones are rem- and Acanthocladium dockeri (Jusaitis and Adams 2005). nants of a once more diverse and wide-ranging species with While Ziziphus celata has not reached these extremes, fruit many genotypes having already been lost. Despite these set in the wild is extremely limited even in multiclonal indications of a historically larger range, early twentieth populations, and seedlings have never been recorded century botanists, such as J.K. Small and R.M. Harper, who despite yearly monitoring (Ellis et al. 2007; Weekley collected extensively on the Lake Wales Ridge, made no unpublished data). Identifying clonal lineages is the first record of this large and conspicuous shrub. Little is known step to identifying samples that may be cross-compatible about long-term historical population sizes or geographic and incorporating their genetic diversity into the breeding distribution of the species, or how these factors may have program. The ex situ Z. celata population at Bok Tower shaped the current genetic variation. Gardens, which comprises nine of the 12 genotypes known Ziziphus celata is not the only endangered plant on central prior to the present study, constitutes a captive breeding Florida’s Lake Wales Ridge, a biodiversity hotspot (Dobson program for the species. The microsatellite genotypes et al. 1997; Estill and Cruzen 2001). Due to habitat identified here will expedite the expansion of the ex situ destruction and altered fire regimes, two dozen species, most population and facilitate the incorporation of additional narrowly endemic to the Ridge, are federally listed as genetic diversity into the recovery program. threatened or endangered (UWFWS 1999). Several studies 123 Conserv Genet have evaluated the genetic diversity of these species (e.g., Christman SP, Judd WS (1990) Notes on plants endemic to Florida Branch et al. 2003; Dolan et al. 1999; Lewis and Crawford scrub. Fla Sci 53:52–73 Coates F, Walsh NG, James EA (2002) Threats to the survival of the 1995; McDonald and Hamrick 1996; Menges et al. 2010). Grampians pincushion lily (Borya mirabillis, Lilliaceae)—a While many species have relatively low levels of genetic short-range endemic from western Victoria. Aust Syst Bot diversity, some maintain levels comparable to more wide- 15:477–485 spread species (e.g., Lewis and Crawford 1995). Although Coile NC, Garland MA (2003) Notes on Florida’s endangered and threatened plants, 4th edn (PDF Version). Florida Department of several species have ranges comparable to or smaller than Agriculture and Consumer Services, Division of Plant Industry, Z. celata, none are as genetically depauperate. Gainesville The long-term survival of Ziziphus celata depends on Cullings K (1992) Design and testing of a plant-specific PCR primer careful management of its limited genetic diversity. Loss of for ecological and evolutionary studies. Mol Ecol 1(4):233–240 DeLaney KR, Wunderlin RP, Hansen BF (1989) Re-discovery of clonal lineages will erode the reproductive potential of the Zizipus celata (Rhamnaceae). Sida 13:325–330 species (Frankham 2005). The microsatellite loci presented Dobson AP, Rodrigues JP, Roberts WM, Wilcove DS (1997) here will facilitate management. Current research projects Geographic distribution of endangered species in the United are focusing on identification of the loci controlling self- States. Science 275:550–553 Dolan RW, Yahr R, Menges ES, Halfhill MD (1999) Conservation incompatibility and on development of genetic tools to implications of genetic variation in three rare species endemic to identify compatible mates. Incorporating the clones iden- Florida rosemary scrub. Am J Bot 86(11):1556–1562 tified by microsatellite genotyping into the ex situ Bok Douhovnikoff V, Dodd RS (2003) Intra-clonal variation and a collection and the introduced populations will greatly similarity threshold for identification of clones: application to Salix exigua using AFLP molecular markers. Theor Appl Genet enhance the pool of genetic diversity available for man- 106(7):1307–1315 agement of this critically imperiled species. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15 Acknowledgments The authors thank S. Anak and P. Soria for Ellis MM, Weekley CW, Menges ES (2007) Evaluating stability in assistance in the lab; funding was provided by the US Fish and Ziziphus celata, a highly endangered clonal shrub endemic to Wildlife Service, the Plant Conservation Program of the Florida Lake Wales Ridge, central Florida. Endanger Species Res Division of Forestry, and Archbold Biological Station. We thank E.S. 3(2):125–132 Menges and three anonymous reviewers for helpful comments on the Estill JC, Cruzen MB (2001) Phytogeography of rare plant species manuscript. endemic to the southeastern United States. Castanea 66:3–23 Frankham R (2005) Genetics and extinction. Biol Conserv 126:131–140 Gle´min S, Petit C, Maurice S, Mignot A (2008) Consequences of low References mate availability in the rare self-incompatible species Brassica insularis. Conserv Biol 22(1):216–221 Abrahamson WG, Johnson AF, Layne JN, Peroni PA (1984) Godt MJW, Race T, Hamrick JL (1997) A population genetic analysis Vegetation of the Archbold Biological Station, Florida: an of Ziziphus celata, an endangered Florida shrub. J Hered example of the southern Lake Wales Ridge. Fla Sci 47:209–250 88(6):531–533 Aigner PA (2004) Ecological and genetic effects on demographic Halkett F, Simon J-C, Balloux F (2005) Tackling the population processes: pollination, clonality and seed production in Dithyrea genetics of clonal and partially clonal organisms. Trends Ecol maritima. Biol Conserv 116:27–34. doi:10.1016/S0006-3207(03) Evol 20:194–201. doi:10.1016/j.tree.2005.01.001 00170-8 Hoebee S, Thrall P, Young A (2008) Integrating population Arnaud-Haond S, Duarte CM, Alberto F, Serra˜o EA (2007) demography, genetics and self-incompatibility in a viability Standardizing methods to address clonality in population studies. assessment of the Wee Jasper Grevillea (Grevillea iaspicula Mol Ecol 16(24):5115–5139 McGill., Proteaceae). Conserv Genet 9(3):515–529 Avise JC, Hamrick JL (1996) Conservation genetics: case histories Honnay O, Bossuyt B (2005) Prolonged clonal growth: escape route from nature. Kluwer Academic Publishers, Norwell or route to extinction? Oikos 108(2):427–432 Balloux F, Lehmann L, De Meeuˆs T (2003) The population genetics Honnay O, Jacquemyn H (2008) A meta-analysis of the relation of clonal and partially clonal diploids. Genetics 164:1635 between mating system, growth form and genotypic diversity in Branch LC, Clark AM, Moler PE, Bowen BW (2003) Fragmented clonal plant species. Evol Ecol 22:299–312. doi:10.1007/ landscapes, habitat specificity, and conservation genetics of three s10682-007-9202-8 lizards in Florida scrub. Conserv Genet 4(2):199–212 Judd WS, Hall DW (1984) A new species of Ziziphus (Rhamnaceae) Byers DL, Meagher TR (1992) Mate availability in small populations from Florida. Rhodora 86:381–387 of plant species with homomorphic sporophytic self-incompat- Jusaitis M, Adams M (2005) Conservation implications of ibility. Heredity 68:353–359 clonality and limited sexual reproduction in the endangered Castoe TA, Poole AW, Gu W, Jason de Koning AP, Daza JM, Smith shrub Acanthocladium dockeri (Asteraceae). Aust J Bot 53: EN, Pollock DD (2010) Rapid identification of thousands of 535–544 copperhead snake (Agkistrodon contortrix) microsatellite loci Kao T, Tsukamoto T (2004) The molecular and genetic bases from modest amounts of 454 shotgun genome sequence. Mol of S-RNase-based self-incompatibility. Plant Cell Online Ecol Res 10(2):341–347 16(90001):72–83 Chistiakov DA, Hellemans B, Volckaert FA (2006) Microsatellites Kijas JMH, Fowler JCS, Garbett CA, Thomas MR (1994) Enrichment and their genomic distribution, evolution, function and applica- of microsatellites from the citrus genome using biotinylated tions: a review with special reference to fish genetics. Aquacul- oligonucleotide sequences bound to streptavidin-coated mag- ture 255(1–4):1–29 netic particles. BioTechniques 16:657–660

123 Conserv Genet

Kimpton SK, James EA, Drinnan AN (2002) Reproductive biology Oliv. (Salicaceae). Evol Ecol 24:1417–1432. doi: and genetic marker diversity in Grevillea infecunda (Protea- 10.1007/s10682-010-9389-y ceae), a rare plant with no known seed production. Aust Syst Bot Schuelke M (2000) An economic method for the fluorescent labeling 15:485–492 of PCR fragments. Nat Biotechnol 18(2):233–234 Kwak MM, Bekker RM (2006) Ecology of plant reproduction: Scobie AR, Wilcock CC (2009) Limited mate availability decreases extinction risks and restoration perspectives or rare plant species. reproductive success of fragmented populations of Linnaea In: Waser NM, Ollerton J (eds) Plant–pollinator interactions: borealis, a rare, clonal self-incompatible plant. Ann Bot, mcp007 from specialization to generalization. The University of Chicago Swofford DL (2003) PAUP* Phylogenetic analysis using parsimony Press, Chicago, pp 362–386 (* and other methods), version 4. Sinauer, Sunderland Lewis PO, Crawford DJ (1995) Pleistocene refugium endemics Turner WR, Wilcove DS, Swain HM (2006) Assessing the effective- exhibit greater allozymic diversity than widespread congeners in ness of reserve acquisition programs in protecting rare and the genus Polygonella (Polygonaceae). Am J Bot 82(2):141–149 threatened species. Conserv Biol 20:1657–1669 McDonald DB, Hamrick JL (1996) Genetic variation in some plants US Fish and Wildlife Service (1999) Florida Ziziphus. In: Multi- of Florida Scrub. Am J Bot 83(1):21–27 species recovery plan for the threatened and endangered species McKay JK, Latta RG (2002) Adaptive population divergence: of South Florida. US Fish and Wildlife Service, Atlanta, markers, QTL and traits. Trends Ecol Evol 17(6):285–291 pp. 1986–1999 Meirmans PG, Van Tienderen PH (2004) Genotype and genodive: US Fish and Wildlife Service (2009) Florida ziziphus (Ziziphus two programs for the analysis of genetic diversity of asexual celata) 5-year status review: summary and evaluation, 23 pp. US organisms. Mol Ecol Notes 4(4):792–794 Fish and Wildlife Service, Atlanta Menges ES, Dolan RW, Yahr R, Gordon DR (2001) Comparative Warburton CL, James EA, Fripp YJ, Trueman SJ, Wallace HM genetics of seven plants endemic to Florida’s Lake Wales Ridge. (2000) Clonality and sexual reproductive failure in remnant Castanea 66(1/2):98–114 populations of Santalum lanceolatum (Santalaceae). Biol Con- Menges ES, Dolan RW, Pickert R, Yahr R, Gordon DR (2010) serv 96(1):45–54 Genetic variation in past and current landscapes: conservation Ward DB, Austin DF, Coile NC (2003) Endangered and threatened implications based on six endemic Florida scrub plants. Int J plants of Florida, ranked in order of rarity. Castanea 68(2): Ecol 2010:12pp. doi:10.1155/2010/503759 160–174 Menges ES, Weekley CW, Hamze´ SI, Pickert RL (2007) Soil Weekley CW, Menges ES (2008) Experimental introductions of preferences for listed plants on the Lake Wales Ridge in Florida Ziziphus on Florida’s Lake Wales Ridge, USA. In: Highlands Country, Florida. Fla Sci 70:24–39 Soorae PS (ed) Global re-introduction perspectives: re-introduc- Myers RL, Ewel JJ (1990) Ecosystems of Florida. University Press of tion studies from around the Globe. IUCN/SSC Re-introduction Florida, Gainesville Specialist Group, Abu Dhabi, pp 256–261. http://www.archbold- Navascues M, Stoeckel S, Mariette S (2010) Genetic diversity and station.org/abs/publicationsPDF/WeekleyMenges-2008-Ziziphus fitness in small populations of partially asexual, self-incompat- Chapter-IUCN.pdf ible plants. Heredity 104:482–492 Weekley CW, Race T (2001) The breeding system of Ziziphus celata Ouborg NJ (2010) Integrating population genetics and conservation Judd and D.W. Hall (Rhamnaceae), a rare endemic plant of the biology in the era of genomics. Biol Lett 6(1):3–6 Lake Wales Ridge, Florida, USA: implications for recovery. Biol Parks JC, Werth CR (1993) A study of spatial features of clones in a Conserv 100(2):207–213 population of Bracken Fern, Pteridium aquilinum (Dennstaedti- Weekley CW, Kubisiak TL, Race T (2002) Genetic impoverishment aceae). Am J Bot 80:537–544 and cross-incompatibility in remnant genotypes of Ziziphus Peakal R, Smouse PE (2006) Genalex 6: genetic analysis in Excel. celata (Rhamnaceae), a rare shrub endemic to the Lake Wales Population genetic software for teaching and research. Mol Ecol Ridge. Florida Biodivers Conserv 11(11):2027–2046 Notes 6(1):288–295 Weekley CW, Menges ES, Pickert RL (2008). An ecological map of Richards AJ (1997) Plant breeding systems, 2nd edn. Chapman & Florida’s Lake Wales Ridge: a new boundary delineation and an Hall, London assessment of post-Columbian habitat loss. Fla Sci 71: 45–64. Rozenfeld AF, Arnaud-Haond S, Herna´ndez-Garcı´a E, Eguı´luz VM, http://www.archbold-station.org/abs/publicationsPDF/Weekley, Matı´as MA, Serra˜o E, Duarte CM (2007) Spectrum of genetic etal.-2008-FlaSci-LWRboundary.pdf diversity and networks of clonal organisms. J R Soc Interface You F, Huo N, Gu Y, Luo M, Ma Y, Hane D, Lazo G, Dvorak J, 4(17):1093–1102 Anderson O (2008) BatchPrimer3: a high throughput web Schnittler M, Eusemann P (2010) Consequences of genotyping errors application for PCR and sequencing primer design. BMC for estimation of clonality: a case study on Populus euphratica Bioinform 9:253

123