DOCSLIB.ORG

Α Are Regulated by Heat Shock Protein 90

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Α Are Regulated by Heat Shock Protein 90 The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90- α Tomoh Matsumiya, Tadaatsu Imaizumi, Hidemi Yoshida, Kei Satoh, Matthew K. Topham and Diana M. Stafforini This information is current as of September 24, 2021. J Immunol 2009; 182:2717-2725; ; doi: 10.4049/jimmunol.0802933 http://www.jimmunol.org/content/182/5/2717 Downloaded from References This article cites 44 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/182/5/2717.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 24, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90-␣1 Tomoh Matsumiya,*‡ Tadaatsu Imaizumi,‡ Hidemi Yoshida,‡ Kei Satoh,‡ Matthew K. Topham,*† and Diana M. Stafforini2*† Retinoic acid-inducible gene I (RIG-I) is an intracellular pattern recognition receptor that plays important roles during innate immune responses to viral dsRNAs. The mechanisms and signaling molecules that participate in the downstream events that follow activation of RIG-I are incompletely characterized. In addition, the factors that define intracellular availability of RIG-I and determine its steady-state levels are only partially understood but are likely to play a major role during innate immune responses. It was recently reported that the antiviral activity of RIG-I is negatively regulated by specific E3 ubiquitin ligases, suggesting participation of the proteasome in the regulation of RIG-I levels. In this study, we used immunoprecipitation combined with mass spectrometry to identify RIG-I-interacting proteins and found that RIG-I Downloaded from forms part of a protein complex that includes heat shock protein 90-␣ (HSP90-␣), a molecular chaperone. Biochemical studies using purified systems demonstrated that the association between RIG-I and HSP90-␣ is direct but does not involve participation of the CARD domain. Inhibition of HSP90 activity leads to the dissociation of the RIG-I-HSP90 complex, followed by ubiquitination and proteasomal degradation of RIG-I. In contrast, the levels of RIG-I mRNA are unaffected. Our studies also show that the ability of RIG-I to respond to stimulation with polyinosinic:polycytidylic acid is abolished when its interaction with HSP90 is inhibited. These novel findings point to HSP90-␣ as a chaperone that shields RIG-I from http://www.jimmunol.org/ proteasomal degradation and modulates its activity. These studies identify a new mechanism whose dysregulation may seriously compromise innate antiviral responses in mammals. The Journal of Immunology, 2009, 182: 2717–2725. iral infection leads to the initiation of complex innate IPS-1/MAVS/VISA/Cardif, resulting in the induction of IFNs and immune responses that result from recognition of the the activation of antiviral responses (6–9). In previous work, we V viral nucleic acid by cellular receptors including TLRs reported that, aside from its recognized role as a viral sensor, (1), followed by host cell secretion of antiviral factors such as RIG-I has additional functions. We found that RIG-I is a transcrip- cytokines (2, 3). Additional mechanisms are responsible for the tional activator of the cyclooxygenase 2 gene and that its expres- by guest on September 24, 2021 activation of the IFN response during viral infections (4). We re- sion is enhanced following stimulation of endothelial cells with cently reported that a cytoplasmic RNA helicase, retinoic acid- inflammatory agents (10). inducible gene I (RIG-I),3 is an essential regulator of dsRNA-in- RIG-I is the subject of active investigations aimed at dissecting duced signaling (5). RIG-I is also known as Ddx58 owing to the its precise function and mechanism of action in viral immunity. fact that this protein belongs to the DExH box-containing helicase Factors likely to play a key role in these responses include those family; it harbors two caspase recruitment domains (CARD) at the that affect expression levels, location, stability, and posttransla- amino-terminal end and an RNA helicase motif at the carboxyl tional modifications, all of which can potentially modulate the abil- terminus (5). The CARD domains are responsible for activating ity of RIG-I to affect cellular functions. Zhao et al. (11) recently subsequent downstream signaling events through interactions with reported that RIG-I becomes conjugated to IFN-regulated gene 15 (ISG15)/ubiquitin cross-reacting protein, a 15-kDa ubiquitin-like protein expressed following cellular stimulation with IFN. ISG15 *Huntsman Cancer Institute and †Department of Internal Medicine, University of becomes conjugated to a wide array of cellular proteins. Several of Utah, Salt Lake City, UT 84112; and ‡Department of Vascular Biology, Institute of ␣ ␤ Brain Sciences, Hirosaki University Graduate School of Medicine, Hirosaki City, the targets, including RIG-I, are IFN- / -induced antiviral pro- Japan teins, but most are constitutively expressed proteins that function Received for publication September 4, 2008. Accepted for publication December in diverse cellular pathways, including RNA splicing, chromatin 29, 2008. remodeling/polymerase II transcription, cytoskeletal organization The costs of publication of this article were defrayed in part by the payment of page and regulation, stress responses, and translation (11). The precise charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. functional consequences of ISG15 modification remain to be es- tablished but, unlike ubiquitin, ISG15 does not appear to target 1 This work was supported by the Huntsman Cancer Foundation, by a grant from the National Institutes of Health (P01-CA73992) to D.M.S., and by Cancer Center Sup- proteins for proteasomal degradation (12, 13). In addition to port Grant P30 CA042014-20. ISG15-mediated derivatization, RIG-I has been shown to undergo 2 Address correspondence and reprint requests to Dr. Diana M. Stafforini, Huntsman two types of ubiquitin-dependent modifications that result in re- Cancer Institute, 2000 Circle of Hope, Suite 3364, University of Utah, Salt Lake City, UT 84112. E-mail address: [email protected] markably different effects on functional properties. Gack et al. (14) recently showed that RIG-I is robustly ubiquitinated at its amino- 3 Abbreviations used in this paper: RIG-I, retinoic acid-inducible gene I; CARD, caspase recruitment domain; HSP, heat shock protein 70; ISG15, IFN-regulated gene terminal CARD domains by interacting with the E3 ubiquitin li- 15; IPS-1, IFN-␤ promoter stimulator 1; poly(I:C), polyinosinic:polycytidylic acid; gase TRIM, a member of the tripartite motif protein family, and HMG-1, high-mobility group protein 1. that this process is necessary for RIG-I-mediated IFN-␤ produc- Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 tion and antiviral activity in response to infection. This finding www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802933 2718 HSP90 PROTECTS RIG-I FROM PROTEASOMAL DEGRADATION indicates that ubiquitination is a RIG-I modification that can modulate site (shown in lowercase font) or a SalI site (shown in lowercase font), the its signaling properties. Conversely, Arimoto et al. (15) reported that sequences of which were: 5Ј-GAC AAG CTT gcg gcc gcG ATG ACC Ј Ј conjugation of RIG-I with ubiquitin targets RIG-I for degradation by ACC GAG CAG CGA CGC-3 (RIG-FL-F (sense)) and 5 -TCC TCT AGA gtc gac TCA TTT GGA CAT TTC TGC TGG-3Ј (RIG-FL-R (anti- the proteasome, thus effectively acting as a negative regulator of sense)). The products were purified, digested with NotI and SalI, and then RIG-I. These combined observations point to the existence of at least cloned into a p3XFLAG-CMV7.1 expression vector. Positive clones were three tightly regulated protein conjugation mechanisms that control subjected to automated DNA-sequencing analyses. We next generated var- both the stability and signaling functions of RIG-I. ious RIG-I deletion mutants by amplification of full-length RIG-I with the following primers pairs: ⌬3(1–640), RIG-FL-F (sense) and 5Ј-AGA gtc The goal of the present study was to obtain additional insights gac CAC AAG TGC TCT GGT TTT CAC-3Ј (antisense); RIG-CARD(1– on the mechanisms that contribute to the regulation of RIG-I func- 238), RIG-FL-F (sense) and 5Ј-AGA gtc gac GTA CAA GTT TGT ATC tion and expression levels. We found that in resting cells RIG-I is AGA CAC-3Ј (antisense); and ⌬CARD(239–925), 5Ј-CTT gcg gcc gcG a component of a protein complex that also includes the molecular AGC CCA TTT AAA CCA AGA AAT-3Ј (sense) and RIG-FL-R (anti- ⌬ Ј chaperone heat shock protein (HSP) 90-␣. In addition, our studies sense); 10(452–925), 5 -CTT gcg gcc gcG GTT TAT AAG CCC CAG AAG TTT-3Ј (sense) and RIG-I-FL-R (antisense). The PCR products were showed that the association between RIG-I and HSP90 is direct purified by electrophoresis on agarose gels, digested with NotI and SalI, and that inhibiting the interaction between these proteins leads to cloned into the p3XFLAG-CMV7.1 expression vector, and analyzed by ubiquitination and proteasomal degradation of RIG-I.
Load more

Recommended publications
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Yichen – Structure and Allostery of the Chaperonin Groel. Allosteric
    Literature Lunch 5-1-13 Yichen – J Mol Biol. 2013 May 13;425(9):1476-87. doi: 10.1016/j.jmb.2012.11.028. Epub 2012 Nov 24. Structure and Allostery of the Chaperonin GroEL. Saibil HR, Fenton WA, Clare DK, Horwich AL. Source Crystallography and Institute of Structural and Molecular Biology, Birkbeck College London, Malet Street, London WC1E 7HX, UK. Abstract Chaperonins are intricate allosteric machines formed of two back-to-back, stacked rings of subunits presenting end cavities lined with hydrophobic binding sites for nonnative polypeptides. Once bound, substrates are subjected to forceful, concerted movements that result in their ejection from the binding surface and simultaneous encapsulation inside a hydrophilic chamber that favors their folding. Here, we review the allosteric machine movements that are choreographed by ATP binding, which triggers concerted tilting and twisting of subunit domains. These movements distort the ring of hydrophobic binding sites and split it apart, potentially unfolding the multiply bound substrate. Then, GroES binding is accompanied by a 100° twist of the binding domains that removes the hydrophobic sites from the cavity lining and forms the folding chamber. ATP hydrolysis is not needed for a single round of binding and encapsulation but is necessary to allow the next round of ATP binding in the opposite ring. It is this remote ATP binding that triggers dismantling of the folding chamber and release of the encapsulated substrate, whether folded or not. The basis for these ordered actions is an elegant system of nested cooperativity of the ATPase machinery. ATP binds to a ring with positive cooperativity, and movements of the interlinked subunit domains are concerted.
    [Show full text]
  • Α Are Regulated by Heat Shock Protein 90
    The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90- α Tomoh Matsumiya, Tadaatsu Imaizumi, Hidemi Yoshida, Kei Satoh, Matthew K. Topham and Diana M. Stafforini This information is current as of October 2, 2021. J Immunol 2009; 182:2717-2725; ; doi: 10.4049/jimmunol.0802933 http://www.jimmunol.org/content/182/5/2717 Downloaded from References This article cites 44 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/182/5/2717.full#ref-list-1 Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on October 2, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology The Levels of Retinoic Acid-Inducible Gene I Are Regulated by Heat Shock Protein 90-␣1 Tomoh Matsumiya,*‡ Tadaatsu Imaizumi,‡ Hidemi Yoshida,‡ Kei Satoh,‡ Matthew K. Topham,*† and Diana M. Stafforini2*† Retinoic acid-inducible gene I (RIG-I) is an intracellular pattern recognition receptor that plays important roles during innate immune responses to viral dsRNAs.
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec
    USOO8609416B2 (12) United States Patent (10) Patent No.: US 8,609,416 B2 Barnett (45) Date of Patent: Dec. 17, 2013 (54) METHODS AND COMPOSITIONS OTHER PUBLICATIONS COMPRISING HEAT SHOCKPROTEINS Novoselova et al., “Treatment with extracellular HSP70/HSC70 pro (75) Inventor: Michael E. Barnett, Manhattan, KS tein can reduce polyglutamine toxicity and aggregation.” J (US) Neurochem 94:597-606, 2005.* Johnson et al., (1993) Exogenous HSP70 becomes cell associated but (73) Assignee: Ventria Bioscience, Fort Collins, CO not internalized, by stressed arterial Smooth muscle cell. In vitro (US) Cellular and Developmental Biology—Animal, vol. 29A. No. 10, pp. 807-821. (*) Notice: Subject to any disclaimer, the term of this Bethke et al., (2002) Different efficiency of heat shock proteins patent is extended or adjusted under 35 (HSP) to activate human monocytes and dendritic cells; Superiority of U.S.C. 154(b) by 244 days. HSP60, The Journal of Immunology, vol. 169, pp. 6141-6148. Khan et al., (2008) Toll-like receptor 4-mediated growth of (21) Appl. No.: 12/972,112 endometriosis by human heat-shock protein 70, Human Reproduc tion, vol. 23, No. 10, pp. 2210-2219. (22) Filed: Dec. 17, 2010 Lasunskaia E.B., et al., (2003) Transfection of NSO myeloma fusion partner cells with HSP70 gene results in higher hybridoma yield by (65) Prior Publication Data improving cellular resistance to apoptosis, Biotechnology and Bioengineering 81 (4):496-504. US 2011 FO189751A1 Aug. 4, 2011 * cited by examiner Related U.S. Application Data (60) Provisional application No. 61/288,234, filed on Dec. Primary Examiner — Rosanne Kosson 18, 2009.
    [Show full text]
  • The Plasma Peptides of Alzheimer's Disease
    Florentinus‑Mefailoski et al. Clin Proteom (2021) 18:17 https://doi.org/10.1186/s12014‑021‑09320‑2 Clinical Proteomics RESEARCH Open Access The plasma peptides of Alzheimer’s disease Angelique Florentinus‑Mefailoski1, Peter Bowden1, Philip Scheltens2, Joep Killestein3, Charlotte Teunissen4 and John G. Marshall1,5* Abstract Background: A practical strategy to discover proteins specifc to Alzheimer’s dementia (AD) may be to compare the plasma peptides and proteins from patients with dementia to normal controls and patients with neurological condi‑ tions like multiple sclerosis or other diseases. The aim was a proof of principle for a method to discover proteins and/ or peptides of plasma that show greater observation frequency and/or precursor intensity in AD. The endogenous tryptic peptides of Alzheimer’s were compared to normals, multiple sclerosis, ovarian cancer, breast cancer, female normal, sepsis, ICU Control, heart attack, along with their institution‑matched controls, and normal samples collected directly onto ice. Methods: Endogenous tryptic peptides were extracted from blinded, individual AD and control EDTA plasma sam‑ ples in a step gradient of acetonitrile for random and independent sampling by LC–ESI–MS/MS with a set of robust and sensitive linear quadrupole ion traps. The MS/MS spectra were ft to fully tryptic peptides within proteins identi‑ fed using the X!TANDEM algorithm. Observation frequency of the identifed proteins was counted using SEQUEST algorithm. The proteins with apparently increased observation frequency in AD versus AD Control were revealed graphically and subsequently tested by Chi Square analysis. The proteins specifc to AD plasma by Chi Square with FDR correction were analyzed by the STRING algorithm.
    [Show full text]
  • Functional and Physical Interaction Between Yeast Hsp90 and Hsp70
    Functional and physical interaction between yeast PNAS PLUS Hsp90 and Hsp70 Andrea N. Kravatsa, Joel R. Hoskinsa, Michael Reidyb, Jill L. Johnsonc, Shannon M. Doylea, Olivier Genesta,1, Daniel C. Masisonb, and Sue Wicknera,2 aLaboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; bLaboratory of Biochemistry and Genetics, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and cDepartment of Biological Sciences, University of Idaho, Moscow, ID 83844 Contributed by Sue Wickner, January 25, 2018 (sent for review November 17, 2017; reviewed by Daniel N. A. Bolon and Jeffrey L. Brodsky) Heat shock protein 90 (Hsp90) is a highly conserved ATP-dependent changes in response to ATP binding, hydrolysis, and ADP release molecular chaperone that is essential in eukaryotes. It is required for (1,3,6,14–16). In the absence of ATP, the Hsp90 dimer acquires the activation and stabilization of more than 200 client proteins, an open, V-shaped structure such that the protomers interact via including many kinases and steroid hormone receptors involved in the C-terminal dimerization domain (16). When ATP is bound, the cell-signaling pathways. Hsp90 chaperone activity requires collabo- protein takes on a closed conformation with the two N-domains of ration with a subset of the many Hsp90 cochaperones, including the the dimer interacting and a portion of the N-domain, the “lid,” Hsp70 chaperone. In higher eukaryotes, the collaboration between closing over the nucleotide in each protomer (16, 17). Additional Hsp90 and Hsp70 is indirect and involves Hop, a cochaperone that conformational changes occur upon ATP hydrolysis, resulting in a interacts with both Hsp90 and Hsp70.
    [Show full text]
  • Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective
    International Journal of Molecular Sciences Review Heat Shock Proteins in Vascular Diabetic Complications: Review and Future Perspective Stefania Bellini 1,†, Federica Barutta 1,†, Raffaella Mastrocola 2 ID , Luigi Imperatore 1, Graziella Bruno 1 and Gabriella Gruden 1,* 1 Laboratory of Diabetic Nephropathy, Department of Medical Sciences, University of Turin, Corso Dogliotti 14, 10126 Turin, Italy; [email protected] (S.B.); [email protected] (F.B.); [email protected] (L.I.); [email protected] (G.B.) 2 Department of Clinical and Biological Sciences, University of Turin, Corso Raffaello 30, 10125 Turin, Italy; [email protected] * Correspondence: [email protected]; Tel.: +39-011-633-6035 † These authors contribute equally to this work. Received: 27 November 2017; Accepted: 11 December 2017; Published: 14 December 2017 Abstract: Heat shock proteins (HSPs) are a large family of proteins highly conserved throughout evolution because of their unique cytoprotective properties. Besides assisting protein refolding and regulating proteostasis under stressful conditions, HSPs also play an important role in protecting cells from oxidative stress, inflammation, and apoptosis. Therefore, HSPs are crucial in counteracting the deleterious effects of hyperglycemia in target organs of diabetes vascular complications. Changes in HSP expression have been demonstrated in diabetic complications and functionally related to hyperglycemia-induced cell injury. Moreover, associations between diabetic complications and altered circulating levels of both HSPs and anti-HSPs have been shown in clinical studies. HSPs thus represent an exciting therapeutic opportunity and might also be valuable as clinical biomarkers. However, this field of research is still in its infancy and further studies in both experimental diabetes and humans are required to gain a full understanding of HSP relevance.
    [Show full text]
  • Identification and Characterization of Three Heat Shock Protein 90
    G C A T T A C G G C A T genes Article Identification and Characterization of Three Heat Shock Protein 90 (Hsp90) Homologs in the Brown Planthopper Xuan Chen 1,2, Ze-Dong Li 1, Yi-Ting Dai 1, Ming-Xing Jiang 1,* and Chuan-Xi Zhang 1,2,* 1 State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute of Insect Science, Zhejiang University, Hangzhou 310058, China; [email protected] (X.C.); [email protected] (Z.-D.L.); [email protected] (Y.-T.D.) 2 State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Key Laboratory of Biotechnology in Plant Protection of MOA of China and Zhejiang Province, Institute of Plant Virology, Ningbo University, Ningbo 315211, China * Correspondence: [email protected] (M.-X.J.); [email protected] (C.-X.Z.) Received: 9 August 2020; Accepted: 10 September 2020; Published: 12 September 2020 Abstract: Hsp90 (heat shock protein 90) chaperone machinery is considered to be a key regulator of proteostasis under both physiological and stress growth conditions in eukaryotic cells. The high conservation of both the sequence and function of Hsp90 allows for the utilization of various species to explore new phenotypes and mechanisms. In this study, three Hsp90 homologs were identified in the brown planthopper (BPH), Nilaparvata lugens: cytosolic NlHsp90, endoplasmic reticulum (ER) NlGRP94 and mitochondrial NlTRAP1. Sequence analysis and phylogenetic construction showed that these proteins belonged to distinct classes consistent with the predicted localization and suggested an evolutionary relationship between NlTRAP1 and bacterial HtpG (high-temperature protein G).
    [Show full text]
  • Downloaded 18 July 2014 with a 1% False Discovery Rate (FDR)
    UC Berkeley UC Berkeley Electronic Theses and Dissertations Title Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer Permalink https://escholarship.org/uc/item/0t47b9ws Author Spiciarich, David Publication Date 2017 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Chemistry in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Professor Matthew B. Francis Professor Amy E. Herr Fall 2017 Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer © 2017 by David Spiciarich Abstract Chemical glycoproteomics for identification and discovery of glycoprotein alterations in human cancer by David Spiciarich Doctor of Philosophy in Chemistry University of California, Berkeley Professor Carolyn R. Bertozzi, Co-Chair Professor David E. Wemmer, Co-Chair Changes in glycosylation have long been appreciated to be part of the cancer phenotype; sialylated glycans are found at elevated levels on many types of cancer and have been implicated in disease progression. However, the specific glycoproteins that contribute to cell surface sialylation are not well characterized, specifically in bona fide human cancer. Metabolic and bioorthogonal labeling methods have previously enabled enrichment and identification of sialoglycoproteins from cultured cells and model organisms. The goal of this work was to develop technologies that can be used for detecting changes in glycoproteins in clinical models of human cancer.
    [Show full text]
  • A Master Autoantigen-Ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. A Master Autoantigen-ome Links Alternative Splicing, Female Predilection, and COVID-19 to Autoimmune Diseases Julia Y. Wang1*, Michael W. Roehrl1, Victor B. Roehrl1, and Michael H. Roehrl2* 1 Curandis, New York, USA 2 Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA * Correspondence: [email protected] or [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.30.454526; this version posted August 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Chronic and debilitating autoimmune sequelae pose a grave concern for the post-COVID-19 pandemic era. Based on our discovery that the glycosaminoglycan dermatan sulfate (DS) displays peculiar affinity to apoptotic cells and autoantigens (autoAgs) and that DS-autoAg complexes cooperatively stimulate autoreactive B1 cell responses, we compiled a database of 751 candidate autoAgs from six human cell types. At least 657 of these have been found to be affected by SARS-CoV-2 infection based on currently available multi-omic COVID data, and at least 400 are confirmed targets of autoantibodies in a wide array of autoimmune diseases and cancer.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]