DOCSLIB.ORG

Sequence Analysis of 515 Kinase Genes in Chronic Lymphocytic Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sequence Analysis of 515 Kinase Genes in Chronic Lymphocytic Leukemia Letters to the Editor 1908 Haematopoietic and Lymphoid Tissue, 4th edn, vol. 2. World 13 Zenz T, Vollmer D, Trbusek M, Smardova J, Benner A, Soussi T Health Organization: Lyon, France, 2008, pp 229–232. et al. TP53 mutation profile in chronic lymphocytic leukemia: 7 Zainuddin N, Murray F, Kanduri M, Gunnarsson R, Smedby KE, evidence for a disease specific profile from a comprehensive Enblad G et al. TP53 Mutations are infrequent in newly diagnosed chronic lymphocytic leukemia. Leuk Res 2011; 35: 272–274. analysis of 268 mutations. Leukemia 2010; 24: 2072–2079. 8 Flordal Thelander E, Ichimura K, Collins VP, Walsh SH, Barbany G, 14 Bea S, Ribas M, Hernandez JM, Bosch F, Pinyol M, Hernandez L Hagberg A et al. Detailed assessment of copy number alterations et al. Increased number of chromosomal imbalances and high- revealing homozygous deletions in 1p and 13q in mantle cell level DNA amplifications in mantle cell lymphoma are associated lymphoma. Leuk Res 2007; 31: 1219–1230. with blastoid variants. Blood 1999; 93: 4365–4374. 9 Hartmann EM, Campo E, Wright G, Lenz G, Salaverria I, Jares P 15 Salaverria I, Zettl A, Bea S, Moreno V, Valls J, Hartmann E et al. et al. Pathway discovery in mantle cell lymphoma by integrated Specific secondary genetic alterations in mantle cell lymphoma analysis of high-resolution gene expression and copy number provide prognostic information independent of the gene expression- profiling. Blood 2010; 116: 953–961. 10 Greiner TC, Moynihan MJ, Chan WC, Lytle DM, Pedersen A, based proliferation signature. JClinOncol2007; 25: 1216–1222. Anderson JR et al. p53 mutations in mantle cell lymphoma are 16 Zenz T, Krober A, Scherer K, Habe S, Buhler A, Benner A et al. associated with variant cytology and predict a poor prognosis. Monoallelic TP53 inactivation is associated with poor prognosis in Blood 1996; 87: 4302–4310. chronic lymphocytic leukemia: results from a detailed genetic 11 Hernandez L, Fest T, Cazorla M, Teruya-Feldstein J, Bosch F, characterization with long-term follow-up. Blood 2008; 112: Peinado MA et al. p53 gene mutations and protein overexpression 3322–3329. are associated with aggressive variants of mantle cell lymphomas. 17 Young KH, Leroy K, Moller MB, Colleoni GW, Sanchez-Beato M, Blood 1996; 87: 3351–3359. 12 Olivier M, Hollstein M, Hainaut P. TP53 mutations in human Kerbauy FR et al. Structural profiles of TP53 gene mutations predict cancers: origins, consequences, and clinical use. Cold Spring Harb clinical outcome in diffuse large B-cell lymphoma: an interna- Perspect Biol 2010; 2: a001008. tional collaborative study. Blood 2008; 112: 3088–3098. Sequence analysis of 515 kinase genes in chronic lymphocytic leukemia Leukemia (2011) 25, 1908–1910; doi:10.1038/leu.2011.163; sequenced unidirectionally. All mutations were confirmed in published online 24 June 2011 independently generated amplicons. A total of 9003 amplicons were considered to be of high enough quality to be scored for The pathogenesis of chronic lymphocytic leukemia (CLL) mutations. To be considered eligible for scoring at least 50% of remains incompletely understood.1 Although acquired chromo- the bases in 50% of the samples for a given amplicon had to somal aberrations have been demonstrated to influence CLL have a Phred score of 20 and it further had to be judged to be of biology and clinical behavior, it remains unclear what single good quality by visual inspection. A total of 8798 (97.7%) gene defects other than p53 or ATM mutations cause or amplicons of the 9003 reported in this study had 20 or more contribute to the CLL phenotype.2 In particular, recurrent gene samples that were scored for mutations. Mutations were scored mutations that are increasingly found in other hematological in all 24 samples for 6763 (75%) of the amplicons, and only malignancies have not yet been identified in CLL. One recent 12 amplicons had as few as 12 samples that were scored. The CLL gene re-sequencing study reported the analysis of selected average Phred score for all of the bases in all of samples in all of exons of 70 tyrosine kinase genes in 95 CLL patients and amplicons reported in this study was 54.3. reported no somatically acquired mutations.3 Given the frequent Six somatically acquired mutations were identified, each identification of stereotypical immunoglobulin receptor genes in occurring once in the kinases WEE1, NEK1, BRAF, KDR, CLL, it has been suggested that antigen engagement of the B-cell MAP4K3 and TRPM6 (Table 1). Because clinically approved receptor on CLL cells serves a critical role in CLL cell survival therapeutics that target BRAF are available, we subsequently and CLL disease etiology. Further, the reduced expression of analyzed all BRAF coding exons in 120 CLL cases and exons del(13q)(14)-resident microRNAs has been implicated in early 11 and 15 selectively in an additional 130 cases (the sites for the CLL pathogenesis in a subset of cases.4 It is unknown whether vast majority of BRAF mutations affect amino acid residue 6008). CLL is driven by high-frequency recurrent gene mutations in one Primers to amplify and sequence all coding exons of BRAF and or a few genes. adjacent intronic sequences, including splice junctions, were To address this question for phosphokinases, we sequenced designed using the primer 3 program (http://frodo.wi.mit. the coding regions of 515 kinases (for a listing of kinase genes edu/primer3/) and sequence information was generated as sequenced and kinase family classification see Supplementary described.6 Somatic mutations were confirmed using paired Table S1) in DNA from CD19 þ sorted cells from 23 CLL cases.5 patient CD3 þ /buccal DNA as templates. In total, four BRAF This research was approved by the University of Michigan mutations were found, none involving BRAF amino acid residue Institutional Review Board (IRBMED #2004-0962), and written 600 (Table 1 and Supplementary Table 2). informed consent was obtained from all patients before Amino acid substitutions in WEE1, NEK1, BRAF, KDR, enrollment. CD19 þ and CD3 þ cells were purified from CLL MAP4K3 and TRPM6 were also analyzed using the CHASM samples using FACS as described.6 Clinical and molecular algorithm9,10 to estimate the probability that they impact protein characteristics of the CLL cases studied are summarized in activity in a manner relevant to oncogenicity. We trained an Supplementary Table S2. Primers used for sequence analysis of ensemble of decision trees11,12 (Random Forest) with 3285 8308 distinct coding exons from 515 kinase genes were derived likely oncogenic somatic missense mutations from the COSMIC from prior sequencing projects.7 A summary of kinase gene database13 and 3300 ‘passenger’ mutations synthetically gener- reference sequences, primer sequences and exon coverage can ated by a computer algorithm to mimic the cancer mutation be found in Supplementary Table S3. Amplicons were spectrum. To ensure an unbiased score, 13 unique BRAF amino Leukemia Letters to the Editor 1909 Table 1 Listing of kinase gene names, transcript accession ID and mutations for the six mutated kinase genes in CLL Gene Transcript accession Coding Tumor Nucleotide (genomic) Nucleotide (cDNA) Amino acid ID exon (protein) BRAF CCDS5863.1 15 CLL-19 g.chr7: 139906318A4AG c.1801A4AG p.K601KE BRAF CCDS5863.1 15 CLL-32 g.chr7: 139906318A4AG c.1801A4AG p.K601KE BRAF CCDS5863.1 15 CLL-50 g.chr7: 139906333G4GC c.1786G4GC p.G596GR BRAF CCDS5863.1 11 CLL-192 g.chr7: 139934586G4GC c.1406G4GC p.G469GA WEE1 CCDS7800.1 11 CLL-10 g.chr11: 9566645A4AG c.1861A4AG p.R621RG NEK1 NM_012224 9 CLL-29 g.chr4: 170876731C4CA c.860C4CA p.P287PH KDR CCDS3497.1 30 CLL-52 g.chr4: 55787080C4CG c.4027C4CG p.L1343LV MAP4K3 CCDS1803.1 30 CLL-58 g.chr2: 39397320T4TA c.2368T4TA p.C790CS TRPM6 CCDS6647.1 22 CLL-80 g.chr9: 74627268G4GA c.2975G4GA p.G992GE Abbreviations: cDNA, complementary DNA; CLL, chronic lymphocytic leukemia. acid residue substitution mutations were removed from the CLL32 (BRAF mutants K601E) compared with the majority of training set because they occurred at the same position as cases with wild-type BRAF,18 see Supplementary Figure 2. Of mutations of interest. For each mutation, the CHASM score is note, BRAF mutant K601E has previously been demonstrated to the fraction of trees that assign it to the passenger class; the have increased catalytic activity ex vivo, and it therefore P-value measures the statistical significance of the score and is remains unsettled from this data what effects BRAF K601E corrected for multiple testing (false discovery rate). For CLL, we mutants may have on CLL cells. did not have sufficient data to estimate its spectrum, and we thus In summary, our data provide practical information about the used the better-characterized spectrum of colorectal cancer. mutational state of the CLL kinome with implications for CLL Using this algorithm, mutations in BRAF and a mutation in biology/pathogenesis. Given the substantial interest in the TRPM6 were found to be statistically significant as likely CLL research community to identify drivers and modifiers of driver mutations (Supplementary Table S4). Only the BRAF CLL pathogenesis, these data provide important albeit largely mutations occurred within the catalytic kinase domain and in negative information about the mutational state of the kinome in codons previously reported as sites of recurrent mutations in CLL, extending prior negative findings in 70 tyrosine kinase solid tumors and lymphomas (COSMIC database cite genes in CLL.3 We also identify a small subset of CLL that PMID:20952405); they may have biological roles in the affected harbors an activated RAS–BRAF pathway that could be targeted CLL cells. Mutations in the remaining kinases did not receive therapeutically. This data should motivate future genome-wide statistically significant driver scores but mutations in all these pathogenetic CLL gene discovery efforts to determine whether genes except NEK1 have previously been identified in other other, potentially targetable genetic alterations can be found in tumors (breast, colorectum, pancreas and glioblastoma multi- this disease.
Load more

Recommended publications
  • Discovery of Driver Non-Coding Splice-Site-Creating Mutations in Cancer
    ARTICLE https://doi.org/10.1038/s41467-020-19307-6 OPEN Discovery of driver non-coding splice-site-creating mutations in cancer Song Cao1,2, Daniel Cui Zhou 1,2, Clara Oh1,2, Reyka G. Jayasinghe1,2, Yanyan Zhao1, Christopher J. Yoon1,2, Matthew A. Wyczalkowski 1,2, Matthew H. Bailey 1,2, Terrence Tsou 1,2, Qingsong Gao1,2, ✉ ✉ Andrew Malone 1, Sheila Reynolds3, Ilya Shmulevich3, Michael C. Wendl2,4,5, Feng Chen1,6 & Li Ding1,2,4,6 Non-coding mutations can create splice sites, however the true extent of how such somatic 1234567890():,; non-coding mutations affect RNA splicing are largely unexplored. Here we use the MiSplice pipeline to analyze 783 cancer cases with WGS data and 9494 cases with WES data, discovering 562 non-coding mutations that lead to splicing alterations. Notably, most of these mutations create new exons. Introns associated with new exon creation are significantly larger than the genome-wide average intron size. We find that some mutation-induced splicing alterations are located in genes important in tumorigenesis (ATRX, BCOR, CDKN2B, MAP3K1, MAP3K4, MDM2, SMAD4, STK11, TP53 etc.), often leading to truncated proteins and affecting gene expression. The pattern emerging from these exon-creating mutations sug- gests that splice sites created by non-coding mutations interact with pre-existing potential splice sites that originally lacked a suitable splicing pair to induce new exon formation. Our study suggests the importance of investigating biological and clinical consequences of noncoding splice-inducing mutations that were previously neglected by conventional anno- tation pipelines. MiSplice will be useful for automatically annotating the splicing impact of coding and non-coding mutations in future large-scale analyses.
    [Show full text]
  • Identification of Six Autophagy-Related-Lncrna Prognostic Biomarkers in Uveal Melanoma
    Hindawi Disease Markers Volume 2021, Article ID 2401617, 12 pages https://doi.org/10.1155/2021/2401617 Research Article Identification of Six Autophagy-Related-lncRNA Prognostic Biomarkers in Uveal Melanoma Yao Chen , Lu Chen , Jinwei Wang , Jia Tan, and Sha Wang Hunan Key Laboratory of Ophthalmology, Eye Center of Xiangya Hospital, Central South University, China Correspondence should be addressed to Sha Wang; [email protected] Received 7 June 2021; Revised 16 July 2021; Accepted 23 July 2021; Published 13 August 2021 Academic Editor: Ting Su Copyright © 2021 Yao Chen et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Currently, no autophagy-related long noncoding RNA (lncRNA) has been reported to predict the prognosis of uveal melanoma patients. Our study screened for autophagy-related lncRNAs in 80 samples downloaded from The Cancer Genome Atlas (TCGA) database through lncRNA-mRNA coexpression. We used univariate Cox to further filter the lncRNAs. Multivariate Cox regression and LASSO regression were applied to construct an autophagy-associated lncRNA predictive model and calculate the risk score. Clinical risk factors were validated using Cox regression to determine whether they were independent prognostic indicators. Functional enrichment was performed using Gene Ontology and Kyoto Encyclopedia of Genes and Genomes. The model was built with six predictive autophagy-associated lncRNAs and clustered uveal melanoma patients into high- and low-risk groups. The risk score of our model was a significant independent prognostic factor (hazard ratio = 1:0; p <0:001).
    [Show full text]
  • Identification and Validation of Novel Candidate Risk Genes in Endocytic Vesicular Trafficking Associated with Esophageal Atresia and Tracheoesophageal Fistulas
    medRxiv preprint doi: https://doi.org/10.1101/2021.07.18.21260699; this version posted July 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification and validation of novel candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas Guojie Zhong1, 2, *, Priyanka Ahimaz3, *, Nicole A. Edwards4, *, Jacob J. Hagen1, 3, Christophe Faure5, Paul Kingma6, William Middlesworth7, Julie Khlevner8, Mahmoud El Fiky9, David Schindel10, Elizabeth Fialkowski11, Adhish Kashyap4, Sophia Forlenza6, 12, Alan P. Kenny6, 12, Aaron M. Zorn4, #, Yufeng Shen1, 13, #, Wendy K. Chung3, 14, # 1Department of Systems Biology, Columbia University Irving Medical Center, New York, NY, USA 2Integrated Program in Cellular, Molecular, and Biomedical Studies, Columbia University, New York, NY, USA 3Department of Pediatrics, Columbia University Irving Medical Center, New York, NY, USA 4Center for Stem Cell & Organoid Medicine (CuSTOM), Division of Developmental Biology, Cincinnati Children’s Hospital Medical Center, Department of Pediatrics, University of Cincinnati, College of Medicine, Cincinnati, OH, USA 5Division of Pediatric Gastroenterology, CHU Sainte-Justine, Montreal, Quebec, Canada 6Division of Neonatology, Cincinnati Children’s Hospital Medical Center, Department of Pediatrics, University of Cincinnati
    [Show full text]
  • Dual Function of C/D Box Small Nucleolar Rnas in Rrna PNAS PLUS Modification and Alternative Pre-Mrna Splicing
    Dual function of C/D box small nucleolar RNAs in rRNA PNAS PLUS modification and alternative pre-mRNA splicing Marina Falaleevaa, Amadis Pagesb, Zaneta Matuszeka, Sana Hidmic, Lily Agranat-Tamirc, Konstantin Korotkova, Yuval Nevod, Eduardo Eyrasb,e, Ruth Sperlingc, and Stefan Stamma,1 aDepartment of Molecular and Cellular Biochemistry, University of Kentucky, Lexington, KY 40536; bDepartment of Experimental and Health Sciences, Universitat Pompeu Fabra, E08003 Barcelona, Spain; cDepartment of Genetics, Hebrew University of Jerusalem, 91904 Jerusalem, Israel; dDepartment of Microbiology and Molecular Genetics, Computation Center at the Hebrew University and Hadassah Medical Center, 91904 Jerusalem, Israel; and eCatalan Institution for Research and Advanced Studies, E08010 Barcelona, Spain Edited by James E. Dahlberg, University of Wisconsin Medical School, Madison, WI, and approved February 5, 2016 (received for review October 1, 2015) C/D box small nucleolar RNAs (SNORDs) are small noncoding RNAs, SNORD fragments are not microRNAs, which have an average and their best-understood function is to target the methyltrans- length of 21–22 nt (13–16), and suggests that these fragments may ferase fibrillarin to rRNA (for example, SNORD27 performs 2′-O- have additional functions. methylation of A27 in 18S rRNA). Unexpectedly, we found a subset The association of some SNORDs with specific diseases sug- of SNORDs, including SNORD27, in soluble nuclear extract made gests that they may possess functions in addition to directing the under native conditions, where fibrillarin was not detected, indi- 2′-O-methylation of rRNA. For example, the loss of SNORD116 cating that a fraction of the SNORD27 RNA likely forms a protein expression is a decisive factor in Prader–Willi syndrome, the most complex different from canonical snoRNAs found in the insoluble common genetic cause for hyperphagia and obesity (17, 18).
    [Show full text]
  • The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia
    cancers Article The Clinical Utility of Optical Genome Mapping for the Assessment of Genomic Aberrations in Acute Lymphoblastic Leukemia Jonathan Lukas Lühmann 1,† , Marie Stelter 1,†, Marie Wolter 1, Josephine Kater 1, Jana Lentes 1, Anke Katharina Bergmann 1, Maximilian Schieck 1 , Gudrun Göhring 1, Anja Möricke 2, Gunnar Cario 2, Markéta Žaliová 3 , Martin Schrappe 2, Brigitte Schlegelberger 1, Martin Stanulla 4 and Doris Steinemann 1,* 1 Department of Human Genetics, Hannover Medical School, 30625 Hannover, Germany; [email protected] (J.L.L.); [email protected] (M.S.); [email protected] (M.W.); [email protected] (J.K.); [email protected] (J.L.); [email protected] (A.K.B.); [email protected] (M.S.); [email protected] (G.G.); [email protected] (B.S.) 2 Department of Pediatrics I, ALL-BFM Study Group, Christian-Albrechts University Kiel and University Medical Center Schleswig-Holstein, 24105 Kiel, Germany; [email protected] (A.M.); [email protected] (G.C.); [email protected] (M.S.) 3 Department of Paediatric Haematology and Oncology, 2nd Faculty of Medicine, Charles University and University Hospital Motol, CZ-15006 Prague, Czech Republic; [email protected] 4 Pediatric Hematology and Oncology, Hannover Medical School, 30625 Hannover, Germany; [email protected] * Correspondence: [email protected] † These authors equally contributed to this work. Citation: Lühmann, J.L.; Stelter, M.; Wolter, M.; Kater, J.; Lentes, J.; Bergmann, A.K.; Schieck, M.; Simple Summary: The stratification of childhood ALL is currently based on various diagnostic Göhring, G.; Möricke, A.; Cario, G.; assays.
    [Show full text]
  • Mouse Map4k3 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Map4k3 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Map4k3 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Map4k3 gene (NCBI Reference Sequence: NM_001290345 ; Ensembl: ENSMUSG00000024242 ) is located on Mouse chromosome 17. 34 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 34 (Transcript: ENSMUST00000025089). Exon 4~6 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Map4k3 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-187J7 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. Exon 4 starts from about 9.17% of the coding region. The knockout of Exon 4~6 will result in frameshift of the gene. The size of intron 3 for 5'-loxP site insertion: 8070 bp, and the size of intron 6 for 3'-loxP site insertion: 2734 bp. The size of effective cKO region: ~2560 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 4 5 6 34 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Map4k3 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Functional Splicing Network Reveals Extensive Regulatory Potential of the Core Spliceosomal Machinery
    Functional Splicing Network Reveals Extensive Regulatory Potential of the Core Spliceosomal Machinery Panagiotis Papasaikas,1,2,4 J. Ramo´ n Tejedor,1,2,4 Luisa Vigevani,1,2 and Juan Valca´ rcel1,2,3,* 1Centre de Regulacio´ Geno` mica, Dr. Aiguader 88, 08003 Barcelona, Spain 2Universitat Pompeu Fabra, Dr. Aiguader 88, 08003 Barcelona, Spain 3Institucio´ Catalana de Recerca i Estudis Avanc¸ ats, Passeig Lluis Companys 23, 08010 Barcelona, Spain 4Co-first authors SUMMARY quent binding of preassembled U4/5/6 tri-snRNP forms complex B, which after a series of conformational changes forms com- Pre-mRNA splicing relies on the poorly plexes Bact and C, concomitant with the activation of the two understood dynamic interplay between >150 catalytic steps that generate splicing intermediates and prod- protein compo- nents of the spliceosome. The ucts. Transition between spliceosomal subcomplexes involves steps at which splicing can be regulated remain profound dynamic changes in protein composition as well as largely unknown. We sys- tematically analyzed extensive rearrangements of base-pairing interactions between the effect of knocking down the components of snRNAs and between snRNAs and splice site sequences (Wahl the splicing machinery on alterna- tive splicing et al., 2009). RNA structures contributed by base-pairing interac- events relevant for cell proliferation and apoptosis tions between U2 and U6 snRNAs serve to coordinate metal ions and used this information to reconstruct a critical for splicing catalysis (Fica et al., 2013), implying that the network of functional interactions. The network spliceosome is an RNA enzyme whose catalytic center is only accurately captures known physical and established upon assembly of its individual components.
    [Show full text]
  • Promoterless Transposon Mutagenesis Drives Solid Cancers Via Tumor Suppressor Inactivation
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.17.254565; this version posted August 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Promoterless Transposon Mutagenesis Drives Solid Cancers via Tumor Suppressor Inactivation 2 Aziz Aiderus1, Ana M. Contreras-Sandoval1, Amanda L. Meshey1, Justin Y. Newberg1,2, Jerrold M. Ward3, 3 Deborah Swing4, Neal G. Copeland2,3,4, Nancy A. Jenkins2,3,4, Karen M. Mann1,2,3,4,5,6,7, and Michael B. 4 Mann1,2,3,4,6,7,8,9 5 1Department of Molecular Oncology, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 6 2Cancer Research Program, Houston Methodist Research Institute, Houston, Texas, USA 7 3Institute of Molecular and Cell Biology, Agency for Science, Technology and Research (A*STAR), 8 Singapore, Republic of Singapore 9 4Mouse Cancer Genetics Program, Center for Cancer Research, National Cancer Institute, Frederick, 10 Maryland, USA 11 5Departments of Gastrointestinal Oncology & Malignant Hematology, Moffitt Cancer Center & Research 12 Institute, Tampa, FL, USA 13 6Cancer Biology and Evolution Program, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 14 7Department of Oncologic Sciences, Morsani College of Medicine, University of South Florida, Tampa, FL, 15 USA. 16 8Donald A. Adam Melanoma and Skin Cancer Research Center of Excellence, Moffitt Cancer Center, Tampa, 17 FL, USA 18 9Department of Cutaneous Oncology, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 19 These authors contributed equally: Aziz Aiderus, Ana M.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mitogen-activated protein kinase kinase kinase kinase 3 Gene Symbol MAP4K3 Organism Human Gene Summary This gene encodes a member of the Ste20 family of serine/threonine protein kinases. The protein belongs to the subfamily that consists of members such as germinal center kinase (GCK) that are characterized by an N-terminal catalytic domain and C-terminal regulatory domain. The kinase activity of the encoded protein can be stimulated by UV radiation and tumor necrosis factor-alpha. The protein specifically activates the c-Jun N-terminal kinase (JNK) signaling pathway. Evidence suggests that it functions upstream of mitogen-activated protein kinase kinase kinase 1 (MEKK1). This gene previously was referred to as RAB8-interacting protein-like 1 (RAB8IPL1) but it has been renamed mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3). Gene Aliases GLK, MAPKKKK3, MEKKK 3, RAB8IPL1 RefSeq Accession No. NC_000002.11, NG_028007.1, NT_022184.15 UniGene ID Hs.655750 Ensembl Gene ID ENSG00000011566 Entrez Gene ID 8491 Assay Information Unique Assay ID qHsaCIP0031811 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000542094, ENST00000536018, ENST00000263881, ENST00000437545, ENST00000341681 Amplicon Context Sequence AGTCCAAGCATACAAGGATGGTATCTCTCTCCAGTTGGGTTACATGAGTAACATT TGTCTGTGGGGTATCTGATTCTGTAAACCATGAAGAGGTAGAATTTGGATTGACC GTCTCAAATCGAACCACTTGGTTGAAGTCTCTACCTC Amplicon Length (bp) 117 Chromosome
    [Show full text]
  • A Network Inference Approach to Understanding Musculoskeletal
    A NETWORK INFERENCE APPROACH TO UNDERSTANDING MUSCULOSKELETAL DISORDERS by NIL TURAN A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham June 2013 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Musculoskeletal disorders are among the most important health problem affecting the quality of life and contributing to a high burden on healthcare systems worldwide. Understanding the molecular mechanisms underlying these disorders is crucial for the development of efficient treatments. In this thesis, musculoskeletal disorders including muscle wasting, bone loss and cartilage deformation have been studied using systems biology approaches. Muscle wasting occurring as a systemic effect in COPD patients has been investigated with an integrative network inference approach. This work has lead to a model describing the relationship between muscle molecular and physiological response to training and systemic inflammatory mediators. This model has shown for the first time that oxygen dependent changes in the expression of epigenetic modifiers and not chronic inflammation may be causally linked to muscle dysfunction.
    [Show full text]
  • Mouse Map4k3 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Map4k3 Knockout Project (CRISPR/Cas9) Objective: To create a Map4k3 knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Map4k3 gene (NCBI Reference Sequence: NM_001290345 ; Ensembl: ENSMUSG00000024242 ) is located on Mouse chromosome 17. 34 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 34 (Transcript: ENSMUST00000025089). Exon 3~5 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. Exon 3 starts from about 5.78% of the coding region. Exon 3~5 covers 7.9% of the coding region. The size of effective KO region: ~9671 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 34 Legends Exon of mouse Map4k3 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis.
    [Show full text]
  • Sheet1 Page 1 Gene Symbol Gene Description Entrez Gene ID
    Sheet1 RefSeq ID ProbeSets Gene Symbol Gene Description Entrez Gene ID Sequence annotation Seed matches location(s) Ago-2 binding specific enrichment (replicate 1) Ago-2 binding specific enrichment (replicate 2) OE lysate log2 fold change (replicate 1) OE lysate log2 fold change (replicate 2) Probability Pulled down in Karginov? NM_005646 202813_at TARBP1 Homo sapiens TAR (HIV-1) RNA binding protein 1 (TARBP1), mRNA. 6894 TR(1..5130)CDS(1..4866) 4868..4874,5006..5013 3.73 2.53 -1.54 -0.44 1 Yes NM_001665 203175_at RHOG Homo sapiens ras homolog gene family, member G (rho G) (RHOG), mRNA. 391 TR(1..1332)CDS(159..734) 810..817,782..788,790..796,873..879 3.56 2.78 -1.62 -1 1 Yes NM_002742 205880_at PRKD1 Homo sapiens protein kinase D1 (PRKD1), mRNA. 5587 TR(1..3679)CDS(182..2920) 3538..3544,3202..3208 4.15 1.83 -2.55 -0.42 1 Yes NM_003068 213139_at SNAI2 Homo sapiens snail homolog 2 (Drosophila) (SNAI2), mRNA. 6591 TR(1..2101)CDS(165..971) 1410..1417,1814..1820,1610..1616 3.5 2.79 -1.38 -0.31 1 Yes NM_006270 212647_at RRAS Homo sapiens related RAS viral (r-ras) oncogene homolog (RRAS), mRNA. 6237 TR(1..1013)CDS(46..702) 871..877 3.82 2.27 -1.54 -0.55 1 Yes NM_025188 219923_at,242056_at TRIM45 Homo sapiens tripartite motif-containing 45 (TRIM45), mRNA. 80263 TR(1..3584)CDS(589..2331) 3408..3414,2437..2444,3425..3431,2781..2787 3.87 1.89 -0.62 -0.09 1 Yes NM_024684 221600_s_at,221599_at C11orf67 Homo sapiens chromosome 11 open reading frame 67 (C11orf67), mRNA.
    [Show full text]