Intracellular Activation of Complement C3 Leads to PD-L1 Antibody

Published OnlineFirst December 4, 2018; DOI: 10.1158/2326-6066.CIR-18-0272

Research Article Cancer Immunology Research Intracellular Activation of Complement C3 Leads to PD-L1 Antibody Treatment Resistance by Modulating Tumor-Associated Macrophages Haoran Zha1,2,3, Xinxin Wang1,2, Ying Zhu1,2, Diangang Chen1,2, Xiao Han1,2, Fei Yang4, Jianbao Gao1,2, Chunyan Hu1,2, Chi Shu1,2, Yi Feng1,2, Yulong Tan5, Jinyu Zhang4, Yongsheng Li6, Yisong Y. Wan7, Bo Guo8, and Bo Zhu1,2

Abstract

Complement aids in the construction of an immunosup- modulated tumor-associated macrophages via C3a-C3aR- pressive tumor microenvironment. Tumor cell–derived C3 has PI3Kg signaling, thereby repressing antitumor immunity. been previously reported, but whether and how it acts on Deletion of C3 in tumor cells that had high C3 expression antitumor immunity remains to be elucidated. Here, we enhanced efﬁcacy of anti–PD-L1 treatment. Collectively, our describe a mechanism for tumor cell–derived C3 in suppres- results suggest tumor cell–derived C3 may be a useful target for sing antitumor immunity. Tumor cell–derived C3 was acti- cancer immunotherapy and that targeting C3 in tumor cells vated intracellularly, which results in generation of C3a. C3a may enhance antitumor immunity.

Introduction laboratory and others demonstrated that blocking C5a signaling could enhance the efficacy of PD-1/PD-L1 antibody treatment The complement system of the innate immune system acts to (7, 8). In addition, He and colleagues demonstrated that C3a and remove pathogens and trigger release of inflammatory cytokines þ C5a could dampen the actions of tumor-infiltrating CD8 T cells (1). Although the role of the complement system as an effector through inhibiting autocrine IL10 production (9). These results system to kill cancer cells is known, evidence suggests that various illustrate that the complement system alters the TME and tumor complement molecules are enriched in the tumor microenviron- immunity. ment (TME) and they facilitate tumor progression through mod- Complement C3 acts as the component of complement ulating angiogenesis and altering the function of cancer cells or activation. Under physiologic conditions, the main source of immune cells. For example, C1q (2) and C5a (3) are angiogenic, systemic C3 is hepatocytes. However, almost all cell types can C7 enhances the stemness of cancer stem cells (4), and C5a express C3 locally, including myeloid, lymphocytic, fibroblas- enhances the growth of tumors by promoting chronic inflamma- tic, and epithelial cells (10). Evidence suggests that locally tion (3). Lambris and colleagues found that C5a inhibits the produced C3 is involved in tissue regeneration (11), differen- antitumor immune response by recruiting myeloid-derived sup- tiation of MDSCs (12), graft-versus-host disease (13), survival pressor cells (MDSCs; refs. 5, 6). Inspired by their findings, our þ maintenance of na€ve CD4 T cells (14), and intestinal tissue damage during mesenteric ischemia (15). Although some evidence suggests C3 found in the TME was generated systemically 1Institute of Cancer, Xinqiao Hospital, Third Military Medical University, Chongqing, P.R. China. 2Chongqing Key Laboratory of Immunotherapy, Chongq- (16), other evidence shows that C3 produced by tumor- fi þ ing, P.R. China. 3Department of Oncology, The General Hospital of the PLA in ltrating CD8 T cells could repress the antitumor response Rocket Force, Beijing, P.R. China. 4Department of Immunology, Third Military (9). Comparable C3 deposition was observed when ID8-VEGF Medical University, Chongqing, P.R. China. 5Institute of Tropical Medicine, Third cells were implanted into C3 / or wild-type (WT) recipient 6 Military Medical University, Chongqing, P.R. China. Clinical Medicine Research mice (16). Moreover, tumor cell–derived C3 was reported to Center and Institute of Cancer, Xinqiao Hospital, Third Military Medical Univer- promote cancer cell proliferation (17) and the leptomeningeal sity, Chongqing, P.R. China. 7Department of Microbiology and Immunology, Lineberger Comprehensive Cancer Centre, University of North Carolina at metastasis of lung cancer (18). These results indicate that tumor fi Chapel Hill, Chapel Hill, North California. 8Maternal and Child Health Research cells might produce suf cient functional C3 protein for TME Institute, Baoan Women's and Children's Hospital, Jinan University, Shenzhen, construction. Nevertheless, the role of tumor cell–derived C3 China. in antitumor immune suppression remains to be explored. Note: Supplementary data for this article are available at Cancer Immunology In this study, we demonstrated that intracellular activation of þ Research Online (http://cancerimmunolres.aacrjournals.org/). complement C3 suppressed the infiltration and function of CD8 Corresponding Authors: Bo Zhu, Third Military Medical University, Xinqiao T cells by promoting the accumulation and immune-suppressive Street No. 2, Shapingba District, Chongqing 400037, P.R. China. Phone: activity of tumor-associated macrophages (TAMs) in a C3aR- 8613594611534; Fax: 86-23-68755626; E-mail: [email protected]; and Bo dependent, but C5aR-independent, manner. The binding of Guo, Maternal and Child Health Research Institute, Baoan Women's and C3a with its receptor, C3aR, in TAMs activates PI3Kg signaling Children's Hospital, Jinan University, Shenzhen 518101, P.R. China. Phone: and thus promotes TAM immunosuppressive activity. Our data 8613996280346; E-mail: [email protected] showed that blocking tumor-derived complement C3 is sufficient doi: 10.1158/2326-6066.CIR-18-0272 to remove obstacles that could prevent antitumor efficacy in 2018 American Association for Cancer Research. checkpoint blockade of treatment-resistant tumor models.

www.aacrjournals.org OF1

Zha et al.

phosphate-buffered saline) were injected subcutaneously into Materials and Methods þ þ the flank of mice at day 0. For depletion of CD4 T or CD8 T Cell lines and cell culture cells, mice were injected intraperitoneally with anti-CD4 (200 mg; CT26 cells (2012), B16F10 cells (2012), 4T1 cells (2014), clone GK1.5; Bio X Cell) or anti-CD8a (200 mg; clone 2.43; Bio X RAW264.7 (2009), LLC cells (2012), EL4 cells (2012), A549 Cell) on days 5 and 9 after the tumor challenge. For macrophage (2008), CaCO2 (2008), and 3T3 (2009) cells were obtained from depletion, 200 mL PBS-liposomes or clodronate liposomes were the American Type Culture Collection. MC38 was kindly provided injected intraperitoneally on days 7, 10, and 13 after the tumor by Liufu Deng (Shanghai Jiao Tong University, 2015). All cell lines challenge. For PD-L1 blockade, anti–PD-L1 (200 mg; clone were examined and authenticated by short tandem repeat profil- 10F.9G2; Bio X Cell) or control IgG2b (200 mg; clone LTF-2; Bio ing in September 2015. All cell lines were Mycoplasma negative and X Cell) was injected intraperitoneally on days 4, 7, 10, and 13 after used within 10 passages. All cells were cultured as indicated the tumor challenge. For the pharmacologic blockade of C3aR previously (8). To collect cell supernatants, cells were seeded in or C5aR signaling, the C3aR antagonist (C3aRa; SB290157, 6-well plates at a density of 1 106 cells/mL in complete DMEM Cayman; 1 mg/kg daily) or the C5aR antagonist (C5aRa; PMX53, medium. The cell supernatant was collected 24 hours later, filtered GL Biochem; 1 mg/kg daily) was injected intraperitoneally through a 0.22-mm filter and stored at 80 C. into C57BL/6 mice from day 1 to day 14. The tumor volume was Mice measured with an electronic caliper every 2 to 3 days in two Six- to 8-week-old female C57BL/6, BALB/c, and NU/NU mice dimensions (length and width). Excised tumors were weighed were purchased from the Chinese Academy of Medical Sciences and processed for flow cytometry, histology, or isolation of RNA (Beijing, China). C3 / mice were purchased from The Jackson and proteins as indicated. Laboratory. C3a receptor–deficient (C3aR / ) mice on a C57BL/6 background were kindly provided by Dr. Rick A. Wetsel (The Coinjection of LLC with tumor-associated macrophage into University of Texas). C5aR / mice on a C57BL/6 background mice 5 were obtained from Dr. Craig Gerard (Harvard Medical School). LLC cells (5 10 in 100 mL phosphate-buffered saline) were / The animal studies have been conducted in accordance with the injected subcutaneously into the flanks of WT or C3aR mice at guidelines of the Institutional Animal Care and Use Committee of day 0. On day 21 after tumor challenge, mice were sacrificed. / the Third Military Medical University. TAMs from WT or C3aR mice were enriched by magnetic isolation using EasySep Mouse CD11b Positive Selection Kit II ELISA (STEMCELL) according to its manufacturer. Then, TAMs were The C3 concentration in cell supernatants was measured using a isolated by FACS. Then, LLC cells (5 105) were coinjected with mouse complement C3 ELISA kit (Abcam, ab157711) according or without WT or C3aR / TAMs (5 105) subcutaneously into to its instructions. the flanks of WT mice. Tumor growth was monitored every 3 to 4 days. Generation of C3-deficient stable cell lines A pHBAd-U6-gRNA-CMV-Cas9-T2A-zsgreen plasmid was C3a-mediated Akt phosphorylation obtained from Hanbio Biotechnology (China). A Cas9 guide 0 0 CT26 tumors were removed and digested into single-cell sus- þ þ sequence for mouse C3 (5 GGATGTCACCCTGAGCATCG 3 ) pension. CD11b cells were enriched by using a CD11b cell was designed using the online program (http://chopchop.cbu. isolation kit (Stemcells). Cells (2 105) were then treated with uib.no/), and oligos were synthesized by Hanbio Biotechnology 1 mg/mL rmC3a. Then, cells were fixed and permeabilized using (China). The pHBAd-U6-gRNA-CMV-Cas9-T2A-zsgreen was Transcription Factor Phospho Buffer Set (BD) according to its digested with BbsI, and the annealed oligos were cloned into instructions, followed by staining with CD11b (clone M1/70; this plasmid. To make the adenovirus, the pHBAd-U6-gRNA- BioLegend), F4/80 (clone BM8; BioLegend), and phospho-Akt CMV-Cas9-T2A-zsgreen (with cloned sgRNA) was cotransfected (Ser473; D9E; CST). into HEK293 cells with the packaging plasmids h-SNCA and pHBAd-BHG. For C3 silencing, CRISPR control or CRISPR sgRNA IPI-549 treatment targeting C3 viruses were transduced into CT26 or LLC cells. Single CT26 cells (5 105 in 100 mL phosphate-buffered saline) were clones were generated by the limited-dilution method, and injected subcutaneously into the flank of mice at day 0. IPI-549 knockout clones were selected by ELISA analysis for the lack of (PI3Kg inhibitor) was dissolved at 5% 1-methyl-2-pyrrolidinone C3 in the cell supernatant. in polyethylene glycol 400 as described before (19). Mice were Generation of C3-overexpression cell lines treated with IPI-549 (15 mg/kg body weight, 100 mL in volume, Synergistic activation mediator (SAM) technology was applied daily) or vehicles (100 mL in volume, daily) were treated by oral to overexpress C3. Briefly, we first generated B16F10 cell lines with gavage from day 7 to day 17. stable CAS9-VP64 expression by lentivirus transfection and then screened with media containing puromycin. B16F10- CAS9-VP64 Flow cytometry cells were transfected with a lentivirus coding a Cas9 guide To obtain single-cell suspensions, tumors were harvested at the sequence for mouse C3 (50 AGCAGGTACTTTCAAGCTCC 30). indicated time points and then cut into pieces and digested with 1 mg/mL collagenase I (Gibco) and 1 mg/mL Dispase II (Roche) The cells were selected by G418. All lentivirus used were purchased from Shanghai GeneChem (China). for 45 minutes at 37 C. Cells were blocked with anti-FcR (clone 93; BioLegend) and then stained with antibodies from BioLegend Tumor challenge and treatment experiments to PD-L1 (clone 10F.9G2), CD45 (clone 30-F11), CD11b (clone Tumor cells (for CT26, LLC, and 4T1: 5 105 in 100 mL M1/70), Gr-1 (clone RB6-8C5), F4/80 (clone BM8), CD11c phosphate-buffered saline; for B16F10: 3 104 in 100 mL (clone N418), CD206 (clone C068C2), I-A/I-E (clone M5/

OF2 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

114.15.2), CD8a (clone 53-6.7), CD4 (clone GK1.5), CD3 (clone (clone bh6; Hycult Biotech), this antibody was used. FITC goat 17A2), CD140a (clone APA5), and CD45 (clone 30-F11). For anti-Mouse IgG (H þ L; 1:1,000; Abcam) was used as a secondary IFNg, TNFa, and IL10 staining, cells were stimulated in vitro with a antibody. For the staining of human/mouse a-tubulin, a-Tubulin cell stimulation cocktail (plus protein transport inhibitors) Rabbit Polyclonal Antibody (Beyotime) was used. FITC goat anti- (eBioscience) for 4 hours. Cells were then processed using a Rabbit IgG (H þ L; 1:1,000; Abcam) was used as a secondary fixation and permeabilization kit (BD Bioscience) and stained antibody. Nuclei were stained with DAPI for 5 minutes. Stained with antibodies from eBiosciences to IFNg (clone XMG1.2), TNFa sections were photographed using an Olympus fluorescence (clone MP6-XT22), and IL10 (clone JES5-16E3). For intracellular microscope. Ki67 or Foxp3 staining, cells were processed using a fixation and permeabilization kit (eBioscience) and stained with antibodies T-cell macrophage coculture proliferation assay against Ki67 (clone B56; BD) or Foxp3 (clone MF-14; BD). This experiment was conducted as described previously (22, þ Incorporation of 5-ethynyl-2’-deoxyuridine (EdU) was measured 23). Briefly, TAMs were isolated by FACS. CD8 T cells were using the Click-iT EdU flow cytometry assay kit according to the isolated from a tumor-free spleen of BALB/C mouse using the þ manufacturer's instructions (Invitrogen). For the in vivo experi- CD8a T-Cell Isolation kit (Stemcells). Then, isolated T cells were ments, tumor-bearing mice (day 10 PI) were injected i.p. with 50 labeled with 5 mmol/L carboxyfluorescein diacetate succinimidyl mg/g body weight EdU and sacrificed 30 hours later. For the in vitro ester (CFSE; Invitrogen). CFSE-labeled T cells (105) were cultured experiment model, 10 mmol/L EdU was added into the cell in a 96-well plate, precoated with anti-CD3e (3.5 mg/mL, clone culture media. Two hours later, cells were processed and analyzed. 145-2C11; BioLegend), and soluble anti-CD28 (1.5 mg/mL, clone All samples were acquired with a CantoII flow cytometer (BD) and 37.51; BioLegend) was added to the medium to induce T-cell analyzed with FlowJo software (TreeStar). An Aria II flow cyt- proliferation either with or without TAMs at the indicated ratios. ometer (BD) was used for cell sorting. Three days (72 hours) later, cells were collected and analyzed by flow cytometry. Quantitative reverse-transcription PCR and RNA sequencing Total RNA was prepared from murine cancer cell lines or Statistical analysis tumors using TRIzol reagent according to the manufacturer's All data were expressed as the means SEM and were analyzed instructions, and then reverse transcribed using random hexamers using either two-tailed unpaired Student t test or other statistical to generate cDNA (Takara). qPCR was performed with SYBR methods indicated in the text with GraphPad Prism 7.0 software. Premix Ex Taq II (Takara) to quantify the relative expression of For each parameter of all data, , P < 0.05; , P < 0.01; , P < mRNA. Primers for real-time PCR are listed in Supplementary 0.005. Table S1. For RNA sequencing, libraries were prepared using an MGIEasy mRNA kit and sequenced by a BGISEQ-500 instrument. Data availability Upon sequencing, raw FASTQ files were aligned using a HISAT RNA-sequencing data have been deposited to NCBI (GEO: aligner with default parameters. Aligned fragments were then GSE120274). counted and annotated using the Bowtie2 transcript database. Normalized RSEM were obtained. All P values were adjusted for multiple testing using the Benjamini and Hochberg FDR Results algorithm. Intracellular activation of complement C3 in cancer cells aids tumor growth Analysis of the 2012 Cancer Genome Atlas (TCGA) data set To dissect the contribution of individual cell types to C3 pro- A normalized mRNA expression data set for human colon duction in the TME, we first fractionated a CT26 tumor mass into adenocarcinoma was downloaded from the cBioPortal for cancer four populations by flow cytometry (FACS). These four popula- genomics and used to evaluate the correlation between C3 and tions comprise implanted tumor cells (CD45 PDGFRa ), can- þ immunosuppressive cell marker and immunosuppressive cyto- cer-associated fibroblasts (CAF, CD45 PDGFRa ), myeloid cells þ þ þ kine transcript levels (20, 21). This data set includes mRNA (CD45 CD11b ), and lymphocytes (CD45 CD11b ; Fig. 1A). profiles for 270 colon tumor samples and was downloaded in For each population, C3 mRNA expression was measured by December 2016. Spearman correlation analyses were conducted. quantitative PCR. The results indicated that CAFs and infiltrated Differences were considered significant at P < 0.05. lymphocytes expressed little C3, whereas tumor cells and myeloid cells expressed more C3. Although myeloid cells expressed more Immunofluorescence C3 (1.5-fold) than tumor cells (Fig. 1B), in the tumor mass, the Tumor cells were seeded in a glass bottom cell culture dish number of myeloid cells was less than 1/5 of the number of tumor (NEST) and cultured overnight. Cells were fixed in 4% parafor- cells (Fig. 1A), suggesting that tumor cells are the main source of maldehyde for 20 minutes at room temperature, followed by intratumoral C3. To determine whether CT26 tumor cells are permeabilization with 0.3% Triton X-100 and blocked with 1% unique, we surveyed a series of widely used murine tumor cell BSA for 30 minutes at room temperature. For detection of C3a, a lines for C3 production. We found that MC38 colon cancer cells primary antibody against C3a (clone I87-1162; BD) was used. For produced little C3, whereas B16F10 melanoma and EL4 T lym- the detection of mouse C3b/iC3b/C3c (clone 2/11; Hycult phoma cells, as well as other cell lines, including 4T1 breast cancer Biotech), Brefeldin A (1:1,000; BioLegend) was added into cul- cells, CT26 colon cancer, and LLC lung cancer cells, produced ture media for 6 hours before staining, and then the sections were more C3 (Fig. 1C). A previous report suggested that the intracel- þ incubated with primary antibodies at 4C overnight. FITC goat lular activation of complement C3 in human CD4 T cells anti-Rat IgG (H þ L; 1:1,000; Abcam) was then applied as a sustains T-cell homeostasis (10). To determine whether the intra- secondary antibody. For the detection of human C3b/iC3b/C3c cellular activation of complement C3 also occurs in cancer cells,

www.aacrjournals.org Cancer Immunol Res; 2018 OF3

Zha et al.

A B C D 3.6% DAPI α-Tubulin C3a Merged C3 C3 (supernatant) 2.5 150 13.1% 2.0 LLC 100 1.5 1.0 19.0% ng/mL 50 64.0%

0.5 CT26 0.0 0

Relative expression DAPI α-TubulinAct C3 Merged - + + - 6 1 8 0 4 a a b b C 3 L R 11 64.7 T2 LL 4T E F FR 11 2 C 6F1 G D D MC 1 Tumor cells CAFs G + C + C W B - D D A P - P R LLC Lymphocytes 5 45 45 45 4 D D Myloid cells D D C C C C

E DAPI α-Tubulin Act C3 Merged CT26

ISO F 80 C3 (supernatant) A549 60 Act-C3 40

ng/mL 20

ISO 0 3 n 3 on C o C C g- C g- CaCo2 g- S g- S - S - -S - C C 26 T26 L LL Act-C3 T C L C

K LLC Sg-Con **** G H WT ** ) ) 3 1,000 3 600 LLC-Sg-Con LLC Sg-C3

CT26-Sg-Con ns LLC Sg-Con 800 CT26-Sg-C3 LLC-Sg-C3 400 C3-KO 600 LLC Sg-C3 ) 400 3 800 200 *** 200 *** *** 600 0 0 Tumor volume (mm 0510 15 20 Tumor volume (mm 0 5 10 15 20 25 400 Days after tumor inoculation Days after tumor inoculation 200 0

IJ Tumor volume (mm 0 102030 Nude mice Nude mice )

) Days after tumor inoculation 3 2,000 3 400 CT26-Sg-Con LLC-Sg-Con 1,500 CT26-Sg-C3 300 LLC-Sg-C3 1,000 200

500 100

0 0 Tumor volume (mm 0 5 10 15 20 Tumor volume (mm 0510 15 20 25 Days after tumor inoculation Days after tumor inoculation

Figure 1. Intracellular activation of complement C3 in cancer cells contributes to tumor growth. A and B, Four types of cells (tumor cells, CD45PDGFRa; CAFs, CD45PDGFRaþ; myeloid cells, CD45þCD11bþ; and lymphocytes, CD45þCD11b) were isolated from CT26 tumors (100 mm2) by FACS, and mRNA was extracted. C3 expression in these four cell types was determined by RT-qPCR (n ¼ 3 mice per group). C, C3 concentration in the supernatants of various mouse cancer cell lines was quantified by ELISA. D, Immunofluorescence staining of C3a and C3b/iC3b/C3c in CT26 and LLC cells. E, Immunofluorescence staining of activated C3 (C3b/iC3b/C3c)/isotype control in A549 or CaCO2 cancer cells. F, C3 concentration in cell supernatant of CT26-Sg-Con, CT26-Sg-C3, LLC-Sg-Con, and LLC-Sg-C3 was determined by ELISA, respectively. G, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into immunocompetent mice (BALB/ c), and tumor growth was monitored (n ¼ 10 mice per group). H, LLC-Sg-Con or LLC-Sg-C3 cells were injected subcutaneously into immunocompetent (C57BL/ 6) mice, and tumor growth was monitored (n ¼ 5 mice per group). I, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into NU/NU mice, and tumor growth was monitored (n ¼ 5 mice per group). J, LLC-Sg-Con or LLC-Sg-C3 cells were injected subcutaneously into NU/NU mice, and tumor growth was monitored (n ¼ 5 mice per group). K, LLC-Sg-Con or LLC-Sg-C3 cells were injected subcutaneously into C57BL/6 mice or C3 knockout mice, and tumor growth was monitored (n ¼ 6–8 mice per group). A two-way ANOVA (G, H, I, J,andK) was used to evaluate statistical significance (, P < 0.01; , P < 0.0001). Data are representative of at least three independent experiments.

OF4 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

þ we assessed the presence of intracellular C3a and C3b/iC3b/C3c cells (Fig. 2A) and CD3 T cells in CT26-Sg-C3 tumors (Fig. 2B). þ þ in cultured CT26 and LLC cancer cells. We used two antibodies The percentage of CD8 T cells in CD3 T cells increased by about þ that recognize a C3a or a C3b/iC3b/C3c neoepitope on the 10% (Fig. 2C), whereas the absolute number of CD8 T cells and þ cleaved fragment. We found that both C3a and C3b/iC3b/C3c CD4 T cells was greatly elevated in CT26-Sg-C3 (Fig. 2D). þ were present in cultured CT26 and LLC cancer cells (Fig. 1D). We Moreover, the IFNg (Fig. 2E) and TNFa (Fig. 2F) producing CD8 also detected intracellular C3b/iC3b/C3c in cultured human T cells were increased in CT26-Sg-C3 tumors compared with in þ A549 and CaCO2 cancer cells (Fig. 1E). This suggests that tumor CT26-Sg-Con tumors. The proliferation potential of CD8 T cells þ cell–derived C3 is functional as it is activated intracellularly. (Fig. 2G) and CD4 cells (Fig. 2H) was also increased, as deter- To determine the contribution of tumor cell–derived C3 to mined by Ki-67 staining. þ tumor growth, we engineered C3-deficient CT26 (CT26-Sg-C3) C3 produced by CD8 T cells suppresses their antitumor and LLC cells (LLC-Sg-C3) using CRISPR-Cas9 technology. After immunity by inhibiting their IL10 production (9). However, IL10 þ validating the efficiency of C3 deletion by ELISA (Fig. 1F), we production was not detected in CD8 T cells, which is consistent transplanted CT26 cells subcutaneously into C3-sufficient immu- with previous findings (ref. 9; Supplementary Fig. S2A). More- nocompetent syngeneic BALB/c mice. Deletion of C3 in CT26 cells over, we noticed that the addition of exogenous C3a or C5a did þ delayed tumor growth to a great extent (Fig. 1G). Similarly, not affect the proliferation of CD8 T cells in vitro (Supplementary þ retardation of tumor growth in syngeneic C57BL/6J hosts was Fig. S2B), indicating that tumor-derived C3 functions on CD8 þ observed in LLC-Sg-C3 cells, a tumor model that produces high T cells in an indirect manner. To discriminate whether CD8 or þ levels of C3 (Fig. 1H). Previously, silencing C3 expression was CD4 T-cell lineage mediated tumor inhibition caused by C3 reported to impair ovarian cancer cell proliferation by its cleaved deletion, we used monoclonal antibodies (anti-CD4, clone products C3a and C5a, two potent effectors of the complement GK1.5; anti-CD8a, clone 2.43, respectively) to deplete the corre- system (17). Therefore, the reduced growth of CT26-Sg-C3 and sponding population in tumor-bearing mice (Supplementary LLC-Sg-C3 tumors observed could reflect the effect of C3 on tumor Fig. S3). Our data suggest that control of Sg-con CT26 tumor þ cell proliferation and survival. We found that C3-deficient and C3- growth was somewhat dependent on CD8 T cells, as depleting þ sufficient cell lines had the same proliferation rate (Supplemen- CD8 T cells in Sg-con CT26 tumors only slightly promoted þ tary Fig. S1A–S1C). Furthermore, we used EdU incorporation tumor growth. Depleting CD4 T cells in Sg-con CT26 tumors þ assays to examine the proliferative capacity of C3a and/or C5a delayed tumor growth (Fig. 2I). Although the loss of CD4 T cells þ on tumor cells. Consistent with loss-of-function experiments, the had no effect on CT26-Sg-C3 tumor growth, depletion of CD8 addition of exogenous C3a and/or C5a did not affect proliferation T cells abrogated the tumor growth delay effect caused by C3 (Supplementary Fig. S1D). These data indicate that the impact of deficiency in tumor cells (Fig. 2I). Collectively, these results þ C3 on tumor growth in immunocompetent mice was not intrinsic suggest that, unlike autocrine complement produced by CD8 to tumor cells. Our result was consistent with reports (18, 24) that T cells, C3 generated by tumor cells might serve as a TME regulator þ exogenous C3a does not promote the proliferation of LLC tumor to promote CD8 T-cell dysfunction. cells, at least not in an anchorage-dependent manner. One pos- sible extrinsic mechanism to explain this is that complement Immunosuppressive effects of tumor cell–produced C3 via could regulate T-cell immunity, which consequently affects tumor modulating TAMs growth (9, 25). To examine this, we performed similar tumor Previous studies have suggested that complement C5a can transplantation experiments in nude mice that lack T cells. The shape the TME by recruiting MDSCs and enhancing their inhib- absence of T cells in recipient mice completely abolished the itory functions in a murine cervical cancer model (5). We difference in growth between C3-deficient and C3-sufficient explored this potential mechanism in our study but found that þ þ tumors (Fig.1I and J). Taken together, these results suggest that the percentage and function of CD11b Gr-1 MDSCs in CT26- C3 complement produced by tumor cells is a component of the Sg-C3 and CT26-Sg-Con tumors were comparable (Supplemen- immunosuppressive TME, and its immunosuppressive mecha- tary Fig. S4A). In addition, the percentages of the MDSC sub- nism acts upon T cells. populations, both polymorphonuclear MDSCs (PMN-MDSCs, þ To determine whether systemic C3 could compensate for tumor CD11b Gr-1high) and mononuclear MDSCs (MO-MDSCs, þ cell–derived C3, we injected LLC-Sg-C3 or LLC-Sg-Con cells into CD11b Gr-1int), were comparable between the two groups C3 knockout (C3-KO) or WT mice. Consistent with previous (Supplementary Fig. S4B). Effector molecule analysis of MDSCs findings, systemic C3 deficiency reduced tumor growth by about revealed that the expression of ARG1 was comparable between 25% (Fig. 1K). We found that there was no difference in tumor the two groups, whereas expression of NOS2 was about 2-fold growth when LLC-Sg-C3 cells were implanted in WT and C3-KO higher in MDSCs from CT26-Sg-C3 (Supplementary Fig. S4C). mice, suggesting that systemic C3 could not compensate for the Conversely, a higher percentage of regulatory T cells (Treg; þ þ deficiency of C3 in tumor cells (Fig. 1K). Taken together, these CD4 Foxp3 ) was present in CT26-Sg-C3 tumors, when com- results suggest that although C3 is present in tumor cells at lower pared with control tumors (Supplementary Fig. S4D). The concentrations than found in sera, tumor-derived C3 is more increased infiltration of Tregs in CT26-Sg-C3 tumors may have important for function as it is activated intracellularly. resulted from excessive inflammation. TAMs were reduced by around 50% within CT26-Sg-C3 tumors þ Tumor cell–produced C3 blunts tumor-infiltrating CD8 T-cell compared with that in CT26-Sg-Con tumors (Fig. 3A). TAMs exist activity as two functionally distinct subtypes: type 1–polarized macro- þ þ þ The above data suggest that tumor cell–derived C3 acts upon T phages (M1, CD11b F4/80 MHCIIhigh/CD11c ), which are clas- cells to promote tumor growth. Therefore, we determined the sically activated and possess potent tumoricidal capacities, and þ þ þ impact of C3 deletion in CT26 cells on T-cell populations in the type 2 macrophages (M2, CD11b F4/80 CD206 ), which are þ TME. We observed increased infiltration of CD45 inflammatory alternatively activated and specialize in suppressing antitumor

www.aacrjournals.org Cancer Immunol Res; 2018 OF5

Zha et al.

AB+ CD45 CD3+ 80 * 40 ** cells

60 + 30 5 40 20

20 CD4 10 0 0 % of 3 % of total living cells n 3 on -C o -C -C g -C g g S g S S S

CD+ +

s CD8 T cells CD4 T cells l lls l e e s l 80 ns 60,000 ** 60,000 ***

cel 60 * + 40,000 40,000 living c living c 6

40 6 0 CD3 20,000 20,000

20 /1 l ell/10 el c

0 c % of 0 0 3 3 on C on C n 3 n 3 C - C - o o # of - g - g # of -C -C g S g S -C g -C g S S g S g S S S CD4+ CD8a+

EF+ +

IFNγ s TNFα 40 l 50 ***

ells ***

c 40

30 Tcel T

+ 30 + 20 20 CD8 CD8 10 10 0 0 % of

% of n 3 n 3 o C o -C C - -C g - g g S g S S S G H + +

s Ki-67

Ki-67 l 100 l 50 *** *** 80 ce 40 T Tcells + + 60 30 20 40 D4 C CD8 20 10 0 0 % of % of 3 3 on on -C -C -C g -C g g S g S S S I ) 3 1,500 CT26-Sg-Con *

CT26-Sg-Con + anti CD4 * 1,000 ** CT26-Sg-Con + anti CD8 500

CT26-Sg-C3 ns

0 CT26-Sg-C3 + anti CD4 ** * Tumor volume (mm 0 5 10 15 20 CT26-Sg-C3 + anti CD8 Days after tumor inoculation

Figure 2. Tumor cell–produced C3 blunts tumor-infiltrating CD8þ T-cell activity. A–F, CT26-Sg-Con or CT26-Sg-C3 tumors from immunocompetent mice were harvested 15 days after tumor inoculation and analyzed by flow cytometry and immunofluorescence (n ¼ 10 mice per group). A, Percentage of CD45þ cells in total living cells. B, Percentage of CD3þ T cells in CD45þ cell populations. C, Percentage of CD4þ or CD8þ T cells in the CD3þ T-cell population. D, Absolute number of CD4þ þ þ or CD8 T cells in 1,000,000 living cells. E and F, Production of IFNg or TNFa by CD8 T cells was determined by intracellular cytokine staining. G and H, Ki-67 expression in CD4þ or CD8þ T cells was determined by intracellular cytokine staining. I, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into immunocompetent (BALB/c) mice. Mice that were injected with CT26-Sg-C3 cells received either PBS, anti-CD4 (clone GK1.5; Bio X Cell), or anti-CD8a (clone 2.43; Bio X Cell) at 200 mg/mouse on days 5 and 9 after tumor inoculation. Tumor growth was monitored (n ¼ 5 mice per group). An unpaired Student t tests (A–H) or a two-way ANOVA (I) was used to evaluate statistical significance (, P < 0.05; , P < 0.01; , P < 0.001). Data are representative of at least three independent experiments.

OF6 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

AB CD11b+F4/80+ I-A/I-E+ 50 150 20,000 *** 40 *** cells 15,000

+ 100 30 10,000 ** 20 50 5,000 10 I/A-I/EMFI % of TAMs

%ofCD45 0 0 0 3 3 on 3 -C on -C on -C -C g -C g -C g g S g S g S S S S C D CD11c+ CD206+ 60 80 2,000 * *** *** * 1,000 60 1,500

40 Ms A 40 1,000 500 20 20 500 CD11c MFI CD206 MFI %ofTAMs %ofT 0 0 0 0 3 3 3 3 on on -C -C on -C on -C -C g -C g -C g -C g g S g S g S g S S S S S

EIG CT26 TAMs Volcano plot for Control−VS−C3KO.DEseq2_Method Sg-Con Sg-C3

Sg-Con + PBS * Ciita H2-Eb1 Sg-C3 + PBS H2-Aa H2-Ab1 Sg-Con + clodronate ns Up: 1055 Cd74 Sg-C3 + clodronate Cd40 Cd80 Down: 591 Cd86

Antigen Macrophage depletion − log10(Padj) Tap1

no−DEGs: 17268 presentation Tap2 )

Aif1 3 800 Il12a Il12b Il1a 600

e Il1b log2(fold change) ion n Il27 at l Cxcl10 400 u Cxcl9 im F Immu Ccl5 st Rasgrp1 200 15 Ifng Sg-Con Arg1 0 Ccl2 10 e

n Ccl6 0 5 10 15 20 Sg-C3 Ccl7 Tumor volume (mm 5 Ccl9 Days after tumor inoculation

Immu Enpp1

chemokines Cfh Pf4 2 suppression and 1 0

Relative expression -4 -2 0 2 2 g l9 1 r1 1 1 ax fn c 2a 2b rg s c b m1 tg os I x l1 l1 A ta Y I N C I I M Mr S

H TAMs ratio Sg-Con Sg-C3 80 *** 60 cells ***

low 40 *** 20 CFSE 0

:0 :1 1 1 1:2 1:4

Figure 3. Tumor cell–produced C3 exerts immunosuppressive effects via modulating TAMs. A, CT26-Sg-Con or CT26-Sg-C3 tumors from immunocompetent mice were harvested 15 days after tumor inoculation and analyzed for TAMs by flow cytometry (n ¼ 8 mice per group). B–D, Staining of I-A/I-E, CD11c, and CD206 on the surface of TAMs (each dot represents one mouse). E–G, RNA-sequencing data of TAMs isolated from C3-deficient tumors or C3-sufficient tumors. E, Differential expression genes were displayed by a volcano plot. F, Genes associated with TAM polarization were presented. G, Genes associated with antigen presentation, immune stimulation, immune suppression, and chemoattraction were analyzed. H, Suppression of CD8aþ cell proliferation by TAMs from C3-deficient tumors or C3-sufficient tumors was determined by analysis of CFSE dilution. I, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into immunocompetent mice. Mice were injected with 200 mL of either PBS-liposomes or clondrate-liposomes on days 7, 10, and 13 after tumor injection. Tumor growth was monitored (n ¼ 5–6 mice per group). The size of the tumor volume was monitored every 2–3 days. Unpaired Student t test (A, B, C, D,andF) and two-way ANOVA (I) were used to evaluate statistical significance (, P < 0.05; , P < 0.001). Data are representative of at least three independent experiments (the TAMs RNA- sequencing was conducted once).

www.aacrjournals.org Cancer Immunol Res; 2018 OF7

Zha et al.

immunity (19, 26). We analyzed the composition of TAMs by the esized that tumor cell–derived C3 promotes M2 polarization by established macrophage polarization markers, MHCIIhigh/ activating PI3Kg signaling. Among TAMs stimulated with murine þ CD11c for M1 and CD206 for M2. The results showed that recombinant C3a, we observed increased percentages of phos- deletion of C3 in tumor cells promoted macrophage M1 polar- phorylated-akt (p-akt) positive TAMs along with an increased MFI þ ization and inhibited M2 polarization (Fig. 3B–D). To explore the of p-AKT in p-AKT TAMs (Fig. 5B and C). To test whether C3a- changes of TAMs following C3 deficiency in tumor cells, we mediated Akt phosphorylation is C3aR-dependent, we treated applied RNA sequencing to profile the gene expression of TAMs, cells with C3aR antibody or C3aR antagonist. C3aR antagonist both from CT26-Sg-C3 and CT26-Sg-Con. RNA-sequencing data treatment abolished C3a-mediated Akt phosphorylation and revealed that TAMs isolated from CT26-Sg-C3 tumors display a C3aR antibody inhibited C3a-mediated Akt phosphorylation different gene-expression profile than that of CT26-Sg-Con (Fig. 5B and C). To test whether C3a-mediated Akt phosphory- tumors (Fig. 3E). Consistent with phenotype data from FACS lation is PI3Kg-dependent, we used IPI-549 (a PI3Kg inhibitor) to analysis (Fig. 3B–D), TAMs from CT26-Sg-C3 tumors presented as treat the cells. Our data showed that IPI-549 treatment abrogated an M1-polarized state compared with CT26-Sg-Con tumors (Fig. C3a-promoted Akt phosphorylation in TAMs (Fig. 5D and E). 3F). Furthermore, genes associated with antigen presentation and These results show that C3a could activate PI3Kg signaling by immune stimulation were upregulated in TAMs from C3-deficient binding to its receptor C3aR. For in vivo confirmation, we treated tumors, whereas genes associated with immune suppression and CT26-Sg-C3 or CT26-Sg-Con tumor-bearing mice with the PI3Kg chemoattraction were inhibited (Fig. 3G). inhibitor, IPI-549, or a vehicle. Consistent with previous reports Functionally, TAMs isolated from CT26-Sg-Con tumors were (19, 28), tumors in CT26-Sg-Con tumor-bearing mice treated more suppressive than their counterparts isolated from CT26-Sg- with IPI-549 grew more slowly than tumors in mice treated with þ C3 tumors, as determined by the in vitro CD8 T-cell proliferation the vehicle. However, C3-deficient tumor-bearing mice did not inhibition assay (Fig. 3H). To further validate the contribution of respond to IPI-549 treatment (Fig. 5F). These results validate a TAMs on C3-mediated immunosuppression in vivo, we adminis- C3a/C3aR/PI3Kg signaling axis that regulates M2 polarization in tered the macrophage depletion agent, clodronate-liposome, to the TME. mice bearing CT26-Sg-C3 and CT26-Sg-Con tumors. Although tumor growth from both experimental groups was inhibited by Intratumoral C3 production correlates with M2 enrichment and the treatment, macrophage depletion abrogated the difference T-cell exhaustion between the two groups (Fig. 3I). Our data from the mouse colon cancer model suggested that local C3 production by tumor cells expanded TAM cells and þ Tumor cell–derived C3 promotes immunosuppression through exhausted CD8 T cells. To validate its clinical relevance, we C3aR, not C5aR explored a TCGA data set composed of tumor transcriptomes The activation of C3 results in the generation of C3a and C5a, from 270 colorectal carcinoma patients (30). We found that C3 two effectors of the complement system (27). To determine which mRNA expression was correlated with a set of TAM surface active component facilitates tumor growth, we blocked C3a and markers such as CD68, CD163, and MRC1 (Fig. 6A–C). In addi- C5a receptors individually in hosts by genetic depletion and tion, a series of immunosuppressive cytokines that are produced pharmaceutical inhibition. C3AR1 / recipient mice were resis- byM2 TAMs, such as TGFB1, TGFB3, and IL10, were also correlated tant to tumor growth, regardless of C3 sufficiency or deficiency in with local C3 expression (Fig. 6D–F). The local C3 mRNA pro- LLC tumor cells (Fig. 4A). The presence of the C5AR1 deletion in duction was also associated with markers indicating T-cell exhaus- recipient mice did not abrogate the antitumor effects elicited by tion: PD-1, CTLA4, and TIM3 (Fig. 6G–I). Taken together, we C3 deletion in LLC tumor cells (Fig. 4B). The same phenotypes concluded that the local production of C3 complement might aid were also seen with C3aR and C5R antagonist treatments (Fig. establishment of an immunosuppressive TME and suppress infil- 4C). To validate whether C3 is directly acting on TAMs, we trating T cells in human colon cancers. þ þ coinjected LLC with or without C3aR / TAMs or C3aR / TAMs þ þ subcutaneously into C57BL/6 mice. The addition of C3aR / Blocking tumor-derived C3 facilitates therapeutic efficacy of TAMs accelerated tumor growth as compared with tumors checkpoint blockade injected with LLC alone. C3aR / TAM coinjection significantly Clinical trials investigating the PD-1 pathway blockade have delayed LLC growth when compared with other two groups shown a durable response in subsets of patients with a variety of (Fig. 4D and E). These results demonstrate C3 acts on TAMs in cancer types (31–34). Unfortunately, when delivered as a mono- a C3aR-dependent manner. therapy, only a minority of patients benefit from PD-1 pathway blockade (35). One hypothesis for these failures is that additional Tumor cell–derived C3 promotes M2 polarization via activating TAMs accumulate and provide a mechanism of resistance to PD-1 PI3Kg signaling signaling blockade (19, 28). Our data from animal models and To investigate the mechanism of M2 polarization by tumor clinical samples indicated that C3 promotes TAM accumulation cell–derived C3, we conducted signaling pathway analysis based and enhances its inhibitory potential. Therefore, we hypothesized on the above-mentioned RNA-sequencing data. Our data revealed that tumor cell–derived C3 might represent a resistant factor. In that various pathways changed in TAMs isolated from CT26-Sg- published work (36) and our data using PD-L1 antibody treat- C3 tumors. Among them, we found that PI3K/AKT/mTOR sig- ment, cell lines with high C3 expression (LLC and 4T1) did not naling was significantly downregulated in TAMs isolated from respond to anti–PD-L1 treatment, whereas cell lines (B16F10, CT26-Sg-C3 tumors (Fig. 5A). PI3Kg is expressed in TAMs, and EL4, and MC38) with little to no C3 expression tumors responded inhibition of PI3Kg activity by using IPI-549 promotes M1 polar- well (Fig. 1C). We applied SAM technology to activate C3 expres- ization (19, 28). PI3Kg signaling is also activated by C3a/C3aR sion in B16F10 cells (37) and validated the expression of C3 in the signaling (29). On the basis of the above knowledge, we hypoth- B16-C3 cell supernatant by C3 ELISA (Fig. 7A). To understand the

OF8 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

A B *** C57BL/6 + LLC-Sg-Con C57BL/6 + LLC-Sg-Con * * * C57BL/6 + LLC-Sg-C3 C57BL/6 + LLC-Sg-C3 -/- -/- C3AR1 + LLC-Sg-Con ** ns C5AR1 + LLC-Sg-Con

-/- * C3AR1 + LLC-Sg-C3 C5AR1-/- + LLC-Sg-C3 ) 3 800 ) 600 3 600 (mm 400 a 400 are

r 200 200

0 Tumo 0 Tumor volume (mm 0 5 10 15 20 0 5 10 15 20 Days after tumor inoculation Days after tumor inoculation C5aRa C PBS C3aRa ) 3 ) ) CT26-Sg-Con 800 3 3 800 800 CT26-Sg-C3 (mm 600 600 600 ea e(mm e(mm

ar 400

400 um 400 ns *** ol ***

v 200 200 200 mor Tu 0 0 0 0 5 10 15 20 Tumor Tumor volum 0 5 10 15 20 0 5 10 15 20 Days after tumor inoculation Days after tumor inoculation Days after tumor inoculation D E ) 3 500 LLC 0.6 *

400 * LLC+C3aR+/+ TAMs 300 * 0.4 200 LLC+C3aR-/- TAMs 100 0.2

0 Tumor weight (g) 0.0

Tumor volume (mm 0 5 10 15 20 25 C Ms Ms Days after tumor inoculation LL A A /+ T -/- T + R R a 3 3a C C + + C C LL LL

Figure 4. Tumor cell–derived C3 promotes immunosuppression through C3aR, not C5aR. A, LLC-Sg-Con or LLC-Sg-C3 cells were injected subcutaneously into C57BL/6 (n ¼ 6 mice per group) or C3AR1/ (n ¼ 5 mice per group) mice. Tumor growth was monitored. B, LLC-Sg-Con or LLC-Sg-C3 cells were injected subcutaneously into C57BL/6 or C5AR1/ mice. Tumor growth was monitored (n ¼ 6 mice per group). C, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into BALB/c mice. PBS, SB290157 (C3aR antagonist; 1 mg/kg body weight), or PMX53 (C5aR antagonist; 1 mg/kg body weight) was administered daily from day 1 to day 14 (n ¼ 5 mice per group). Tumor growth was monitored. D and E, LLCs mixed with or without C3aRþ/þ TAMs or C3aR/ TAMs were subcutaneously injected into C57BL/6 mice (n ¼ 6 mice per group). D, Tumor growth was monitored every 3–4 days. E, Tumors were removed on day 23 after tumor challenge and weighted. A two-way ANOVA (A, B, C,andD) and a one-way ANOVA (E) was used to evaluate statistical signiﬁcance (, P < 0.05; , P < 0.001). Data are representative of at least three independent experiments.

association between tumor C3 expression and resistance to PD-L1 responsive to PD-L1 antibody treatment and beneﬁt from a longer antibody treatment, we compared multiple mouse tumor models survival (Fig. 7B, middle). However, mice bearing B16F10-C3 treated with the PD-L1 antibody. Our results show that mice tumors lose sensitivity to PD-L1 antibody treatment compared bearing 4T1 tumors, which express large amounts of C3, are with B16F10 controls (Fig. 7B, right). To test whether combina- resistant to PD-L1 antibody treatment (Fig. 7B, left). By contrast, torial targeting of these two pathways could overcome the resis- mice bearing B16F10 tumors, which express little C3, are more tance to PD-L1 antibody treatment, we performed checkpoint

www.aacrjournals.org Cancer Immunol Res; 2018 OF9

Zha et al.

A B

pre-gate 1 p-akt + TAMs HALLMARK_FATTY_ACID_METABOLISM 0.8 6,000 HALLMARK_OXIDATIVE_PHOSPHORYLATION ns * HALLMARK_MYC_TARGETS_V1 0.6 HALLMARK_MYC_TARGETS_V2 4,000 ** HALLMARK_MTORC1_SIGNALING 0.4 HALLMARK_PI3K_AKT_MTOR_SIGNALING◄ HALLMARK_GLYCOLYSIS 2,000 HALLMARK_TGF_BETA_SIGNALING 0.2

HALLMARK_HYPOXIA MFI of p-akt 0 HALLMARK_APOPTOSIS HALLMARK_EPITHELIAL_MESENCHYMAL_TRANSITION 0 HALLMARK_IL2_STAT5_SIGNALING l o a r 3a R HALLMARK_WNT_BETA_CATENIN_SIGNALING t C HALLMARK_TNFA_SIGNALING_VIA_NFKB on 3a Rmab C + C HALLMARK_IL6_JAK_STAT3_SIGNALING a 3a HALLMARK_INTERFERON_ALPHA_RESPONSE 3 + C HALLMARK_INTERFERON_GAMMA_RESPONSE C a 3 Sg-C3 Sg-Con C p-akt+ C 40 ns * 30 ** 20 10 %of TAMs 0 l o a r 3a R t C mab on 3a R C + C a 3a 3 + C C a 3 C D p-akt+ 40 * 30 * 20 10 %of TAMs 0

ol 9 tr 3a n C I54 o IP C + 3a C E F pre-gate p-akt + TAMs )

* 3 * 4,000 1,000

CT26-Sg-Con + vehicle * *

2,000 * 500 CT26-Sg-Con + IPI549 MFI of p-akt rvolume(mm n o CT26-Sg-C3 + vehicle 0 .s

l 9 um 0 CT26-Sg-C3 + IPI549 o T tr 3a n C I54 0 5 10 15 20 o IP C + Days after tumor inoculation 3a C

Figure 5. Tumor cell–derived C3 promotes M2 polarization via activating PI3Kg signaling. A, RNA-sequencing data of TAMs isolated from C3-deficient tumors or C3- sufficient tumors. Signaling pathway analysis was conducted. B and C, CD11bþ cells were isolated magnetically from CT26 tumors, and then stimulated with/ without C3a along with C3aR antagonist or C3aR antibody (n ¼ 3). B, Percentage of p-aktþ cells within TAMs was determined by flow cytometry. C, MFI of p-akt þ þ in p-akt TAMs. D and E, CD11b cells were isolated magnetically from CT26 tumors, and then stimulated with/without C3a along with IPI549 (a PI3Kg inhibitor, n ¼ 3). D, Percentage of p-aktþ cells within TAMs was determined by flow cytometry. E, MFI of p-akt in p-aktþ TAMs. F, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into BALB/c mice. IPI-549 (PI3Kg antagonist; 15 mg/kg body weight) or vehicle control was administered daily by oral gavage from day 7 until day 17 (n ¼ 5 mice per group). Tumor growth was monitored. A two-way ANOVA (F) and a one-way ANOVA (B, C, D, E) were used to evaluate statistical significance (, P < 0.05; , P < 0.01; , P < 0.001). Data are representative of at least three independent experiments.

OF10 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

AB C 10 10 Pearson r = 0.51 Pearson r = 0.50 Pearson r = 0.37 ) 9 ) ) 2 2 2 P P P < 0.0001 < 0.0001 seq < 0.0001 5 5 A-seq Log N Log Log 6 M,

S 0 0 K (R (RKSM, (RKSM, 3 D163, R CD68, RNA-seq MRC1, RNA-

C -5 -5 0246810 0246810 0246810 C3, RNA-seq C3, RNA-seq C3, RNA-seq (RKSM, Log2) (RKSM, Log2) (RKSM, Log2) DE F 10 Pearson r = 0.61 Pearson r = 0.50 Pearson r = 0.19 ) ) ) 2 2 seq P P < 0.0001 2 P < 0.0001 5 5 = 0.0014 A- Log N Log 5 Log 0 RNA-seq B3, R 0 10, F (RKSM, (RKSM, (RKSM, IL TG TGFB1, RNA-seq 0 0246810 0246810 0246810 C3, RNA-seq C3, RNA-seq C3, RNA-seq (RKSM, Log ) (RKSM, Log2) 2 (RKSM, Log2) GH I Pearson r = 0.44 Pearson r = 0.48 Pearson r = 0.52 ) ) ) 2 2 P 2 P 5 < 0.0001 seq 5 P < 0.0001 5 < 0.0001 A- Log Log Log N , 0 R 0 0 4, LA RKSM (RKSM, ( (RKSM, T TIM3, RNAseq PDCD1, RNA-seq -5 C -5 -5 0246810 0246810 0246810 C3, RNA-seq C3, RNA-seq C3, RNA-seq (RKSM, Log2) (RKSM, Log2) (RKSM, Log2)

Figure 6. C3 expression correlates with an immune-suppressive TME and T-cell dysfunction in human colorectal carcinomas. The relationship between the mRNA transcripts for C3 and TAM markers (A, CD68; B, CD163; C, MRC1), immunosuppressive cytokines (D, TGFB1; E, TGFB3; F, IL10) and immune-checkpoint genes (G, PDCD1; H, CTLA4; I, TIM3) were determined by Pearson correlation analyses. Expression data for these genes were downloaded from the colorectal cancer database (n ¼ 270). Data were analyzed two times. therapy against C3-deleted CT26 tumors with anti–PD-L1. As a IFNg-associated gene signatures have been suggested to predict monotherapy, anti–PD-L1 slightly inhibited the growth of C3- clinical response to PD-1 blockade (38), we assessed the expres- sufficient CT26 tumors (Fig. 7C and D). However, sensitivity to sion of IFNg-associated genes in CT26-Sg-Con or CT26-Sg-C3 anti–PD-L1 was enhanced in mice bearing C3-deficient tumors tumors, including B2M, CD8A, CD27, CD274, CXCL9, CLCL10, (Fig. 7C and D). With anti–PD-L1 treatment, 75% (15/20) of C3- CXCR6, H2EB1, IDO1, IFNG, LAG3, NKG7, PDCD1LG2, PDL1, deficient CT26 tumors disappeared; these mice achieved long- and RSMB10. We found that the expression of IFNg-associated term survival (Fig. 7E). genes was increased in CT26 upon C3 deletion (Supplementary To test whether anti–PD-L1 treatment in C3-deficient tumor- Fig. S5C). bearing mice mediated antitumor responses result in prolonged protective T-cell immunity, we rechallenged mice that underwent complete tumor regression after treatment with 4T1 or CT26 Discussion tumor cells. All the mice from the complete tumor regression Evidence showing that complement activation functions as an group rechallenged with CT26 rejected the tumor, whereas mice immune suppressor in the TME has inspired interest in regulating rechallenged with 4T1 failed to reject the tumor (Fig. 7F and G). the complement system for cancer therapy (5, 7–9, 18). Although These results suggest that anti–PD-L1 treatment in C3-deficient the role of systemic complement activation in tumor develop- tumors promoted the generation of tumor-specific long-term ment has been studied, whether and how tumor cell–derived protective immunity. Mechanically, we observed increased complements could act on antitumor immunity remain to be – þ expression of PD-L1 in both CD45 tumor cells and CD11b explored. Here, we describe a role of tumor cell–derived C3 in myeloid cells from C3-deficient CT26 tumors (Supplementary tumor immunity. We also suggest a strategy against complement Fig. S5A and S5B). Furthermore, as previous report suggested that to enhance checkpoint inhibitor therapies. Intracellular activation

www.aacrjournals.org Cancer Immunol Res; 2018 OF11

Zha et al.

A B 4T1 B16 B16-C3 ) ) ) 3 3 400 2,000 3 2,000 2,000 Iso ns * Iso Iso ns *

300 1,500 1,500 * 1,500

e(mm aPD-L1 aPD-L1 aPD-L1 200 1,000 1,000 1,000 olum 100 500 500 500 C3 (ng/mL)

0 mor v 0 0 0 Tu Tumor volume (mm 0 3 0102030Tumor volume (mm 0 102030 0102030 1 F C Days after tumor inoculation Days after tumor inoculation Days after tumor inoculation 6 0- 1 1 B F 6 l 1 100 al 100 B v 100 va vi vi r r su su t 50 50 t 50 ** rcen ercen Percent survival P 0 0 Pe 0 010203040 0 1020304050 010203040 Days after tumor inoculation Days after tumor inoculation Days after tumor inoculation C D ) ) ) 3 3 0/10 1/10 3 3,000 3,000 3,000 Sg-Con+Iso 2,000 2,000 2,000 Sg-Con+a PD-L1 ***

1,000 1,000 1,000 Sg-C3+Iso ***

or volume (mm Sg-C3+a PD-L1 0 0 m 0 Tumor volume (mm Tumor volume (mm 0204060 0204060 Tu 010203040 Days after Days after Days after tumor inoculation tumor challenge tumor challenge ) ) 3

3 E 0/8 15/20

3,000 m 3,000 100

(m Sg-Con+Iso

2,000 e 2,000 Sg-Con+a PD-L1 lum

50 ***

1,000 vo 1,000 Sg-C3+Iso *** or

0 0 Percent survival 0

um Sg-C3+a PD-L1 Tumor volume (mm 0204060 T 0204060 0255075100 Days after Days after Days after tumor challenge tumor challenge tumor challenge FG Naϊve mice+CT26 4T1 rechallenge CT26 rechallenge ) ) ) 3 3 3 1,000 1,000 1,000 100

0/7 0/7 mm 7/7 800 800 800 600 600 e( 600 um 50

400 400 ol 400 v 200 200 200 or 0 0 0 0 Tumor volume (mm Tum Tumor volume (mm 01020 01020 01020 0 5 10 15 20

Days after Days after Days after % Tumor-bearing mice Days after tumor challenge tumor challenge tumor challenge tumor challenge

Figure 7. Blocking tumor cell–derived complement C3 enables the therapeutic efficacy of checkpoint blockade. A, C3 protein in the supernatant of B16 and B16-C3 was quantified by ELISA. B, 4T1, B16, or B16-C3 cells were injected subcutaneously into immunocompetent mice. Either PBS or 200 mg rat anti-mouse anti–PD-L1 was administered on days 4, 7, 10, and 13. Tumor growth and mice survival were monitored. C–E, CT26-Sg-Con or CT26-Sg-C3 cells were injected subcutaneously into immunocompetent mice. Either 200 mg isotype control or 200 mg rat anti-mouse anti–PD-L1 was administered on days 4, 7, 10, and 13. Tumor growth (C and D) and mouse survival (E) were monitored. F and G, Na€ve mice or mice from combined therapy group that underwent complete tumor regression were challenged with CT26 or 4T1 tumor cells. Tumor growth (F) and tumor-bearing rate (G) were monitored. Two-way ANOVA (B, D) and Kaplan–Meier analysis followed by a log-rank test (B, E) were used to evaluate statistical significance (, P < 0.001). Data are representative of at least three independent experiments.

OF12 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

of complement C3 in the tumor cells plays a role in antitumor caused by C3 deletion in tumor cells, which was inconsistent with þ immunity, independent of systemic complement activation and a previous report (24). We noted that in this work, CD4 T-cell T-cell–producing C3. Mechanically, tumor cell–derived C3a depletion antibody was used for a total of 8 times in 4 weeks. In þ þ could modulate TAMs via C3a-C3aR-PI3Kg signaling, thereby this case, we doubt that CD8 T cells would also be affected. CD4 repressing antitumor immunity. Deletion of C3 in the tumor T-cell deletion by antibody has been reported to delay tumor cells with high C3 expression is sufficient to enhance the efficacy of growth in various studies (47), whereas conflicted results were anti–PD-L1 treatment, whereas transactivation of C3 in tumor reported in this study (24). Nevertheless, in our present study with cells with low C3 expression could dampen anti–PD-L1 treatment CT26 and LLC tumor models, we found that C3-deficient tumors response. had reduced TAM accumulation and that TAMs exhibited an M1- Previous reports with C3 / mice have generated variable polarized state, which was consistent with a previous report (44). results for different tumor models: the growth of TC-1 and EO771 In this case, why was intracellular and systemic C3 activation in breast tumors was retarded (5, 9), there was no difference in ID8- tumor cells immunosuppressive by different mechanisms (TAM VEGF levels (17), and data from B16F10 melanoma were con- vs. MDSC)? First, MDSC recruitment and enhanced functions are tradictory (2, 9). These discrepancies might be explained by our C5aR signaling–dependent. However, intracellular C3-activating findings that different tumor cells produced different amounts of protease does not cleave C5 (10). Accordingly, tumor cell intra- C3: B16F10 cells produced no C3, whereas CT26 and LLC pro- cellular C3 activation could not affect MDSC. Second, þ þ duced high levels of C3. Therefore, any benefit to tumor immunity CD11b F4/80 macrophages highly express C3aR (48), whereas þ þ by deleting host C3 could be tumor-type specific. For robust C3 CD11b Gr1 cells (namely, MDSCs in tumor) express no C3aR producers, such as CT26 and LLC, the major source of C3 is the (48). Therefore, tumor cell intracellular C3 activation may mod- tumor cell (17, 39), but for tumors without C3 expression, such as ulate TAMs. The above scenario was further supported by these þ B16F10, C3 may instead derive from host cells, including CD8 T data: (i) tumor cell–derived C3 promoted immunosuppression cells. Accordingly, our results showed that although C3 deficiency through C3aR but not C5aR; (ii) TAMs derived from CT26-Sg-C3 in the host slows tumor growth, C3 deletion in cancer cells tumor exhibited the characteristics of M1, whereas CT26-Sg-Con delayed tumor growth to a greater degree. On the other hand, tumor were M2 polarized; (iii) macrophage depletion abrogated when looking at C3 activation, tumor cell–derived, local C3 the tumor growth difference between CT26-Sg-C3 and CT26-Sg- activation might be more important than systemic C3 activation. Con; (iv) C3aR antagonist inhibited C3a-induced PI3Kg activa- Systemic C3 is primarily activated via classic, alternative, and tion, needed for M2 polarization, and also abolished the differ- lectin pathways (40). However, due to the potential harmful ence in tumor growth between CT26-Sg-C3 and CT26-Sg-Con. consequences of its cytolytic properties by membrane attack Targeting complement as a tumor immunotherapy has been complex, activation of systemic C3 is controlled by soluble and reported (7–9). We and others showed that systemic blockade membrane-bound complement regulatory proteins (CRP; of C5aR and C3aR could enhance the efficacy of anti–PD-L1/ ref. 41). Evidence suggests tumor cells express CRPs (42) to avoid PD-L1 (7–9). However, there are clinical limitations to this potential self-harm, which makes activation of systemic C3 dif- strategy. As both C3aR and C5aR provide protection against ficult in the extracellular space in the TAM. In contrast, tumor cell– acute infections, systemic blockade of C3aR and C5aR may derived C3 avoids the interaction with these extracellular CRPs by cause serious infection in the patients, as suggested by experi- intracellular activation. In the present study, both C3a and C3b/ ments using a mouse model (49, 50). For tumors with robust iC3b/C3c were found in cultured CT26 and LLC cancer cells. C3 production, our data showed that blocking tumor cell– Consistent with our results, intracellular activation of C3 in derived C3 is sufficient to overcome the resistance to PD-1 intestinal epithelial cells has been illustrated in mesenteric ische- signaling blockade. We reasoned that for these types of tumor, mia model (15). We found both CT26 and LLC express high CTSL blocking C3 via tumor cell–targeted gene-editing techniques and CTSG, two molecules reported to cleave C3 in human T cells may be a safer choice to avoid serious adverse events caused by (10, 43). How intracellular activation of C3 in tumor cells occurs systemic blockade of both C3aR and C5aR. remains to be addressed. Our study suggested two strategies to advance current cancer Several mechanisms have been proposed for the protumori- immunotherapy. First, our data showed that deleting C3 in genic function of complement (5, 9, 17, 18, 24, 44). To analyze tumor cells is sufficient to remodel the TME and enhance our model in the context of these mechanisms, we conducted a antitumor immunity. Therefore, strategies such as linking a series of experiments. First, with two independent assays we found C3aR antagonist to antibodies against tumor-associated anti- that deletion of the C3 gene had no effect on the proliferation of gens (51) may deliver safe and robust therapeutic effects. tumor cells or in nude mice. This is supported by other groups' Second, by depleting or antagonizing C3, we may bias the findings that epithelial cells express little C3aR or C5aR (45, 46), remaining immune-suppressive mechanism of the TME toward and exogenous C3a does not promote proliferation of LLC cells the PD-1–PD-L1 axis. (18, 24). These results from nude mice also excluded the possi- bility that tumor-derived C3 promoted tumor growth by affecting Disclosure of Potential Conflicts of Interest the vascular system. Second, our results showed that deletion of No potential conflicts of interest were disclosed. C3 in tumor cells did not alter MDSC composition in the TME, consistent with a previous report (9). Third, we failed to detect any Authors' Contributions þ IL10 production by CD8 T cells in the CT26 model. To explain Conception and design: H. Zha, B. Guo, B. Zhu Development of methodology: H. Zha, X. Wang, Y. Zhu, C. Hu, Y.Y. Wan, this discrepancy, we speculate that autocrine C3 production by þ B. Guo CD8 cells inhibits its own IL10 production, as suggested by Acquisition of data (provided animals, acquired and managed patients, Wang and colleagues (9). Fourth, our results showed that deletion provided facilities, etc.): H. Zha, Y. Zhu, D. Chen, X. Han, F. Yang, J. Gao, þ of CD4 T cells did not abrogate the tumor growth delay effect Y. Feng, Y. Li, B. Guo

www.aacrjournals.org Cancer Immunol Res; 2018 OF13

Zha et al.

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, 31870875 to B. Guo). We thank Rick A. Wetsel (The University of Texas) for computational analysis): H. Zha, X. Wang, X. Han, B. Guo, B. Zhu kindly providing C3aR knockout mice; Craig Gerard (Harvard Medical School) Writing, review, and/or revision of the manuscript: H. Zha, Y. Li, Y.Y. Wan, for kindly providing C5aR knockout mice. B. Guo, B. Zhu Administrative, technical, or material support (i.e., reporting or organizing The costs of publication of this article were defrayed in part by the data, constructing databases): H. Zha, C. Shu, Y. Tan, J. Zhang, Y. Li, B. Guo, payment of page charges. This article must therefore be hereby marked B. Zhu advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate Study supervision: B. Guo, B. Zhu this fact. Acknowledgments This work was supported by the National Nature Science Foundation of Received April 23, 2018; revised August 27, 2018; accepted November 29, China (No. 81472648 and No. 81620108023 to B. Zhu; No. 31570866 and No. 2018; published ﬁrst December 4, 2018.

References 1. Reis ES, Mastellos DC, Ricklin D, Mantovani A, Lambris JD. Complement 20. Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. in cancer: untangling an intricate relationship. Nat Rev Immunol Integrative analysis of complex cancer genomics and clinical profiles using 2017;18:5–18. the cBioPortal. Sci Signal 2013;6:pl1. 2. Bulla R, Tripodo C, Rami D, Ling GS, Agostinis C, Guarnotta C, et al. C1q 21. Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio acts in the tumour microenvironment as a cancer-promoting factor inde- cancer genomics portal: an open platform for exploring multidimensional pendently of complement activation. Nat Commun 2016;7:10346. cancer genomics data. Cancer Discov 2012;2:401–4. 3. Corrales L, Ajona D, Rafail S, Lasarte JJ, Riezu-Boj JI, Lambris JD, et al. 22. Doedens AL, Stockmann C, Rubinstein MP, Liao D, Zhang N, DeNardo Anaphylatoxin C5a creates a favorable microenvironment for lung cancer DG, et al. Macrophage expression of hypoxia-inducible factor-1 alpha progression. J Immunol 2012;189:4674–83. suppresses T-cell function and promotes tumor progression. Cancer Res 4. Seol HS, Lee SE, Song JS, Rhee JK, Singh SR, Chang S, et al. Complement 2010;70:7465–75. proteins C7 and CFH control the stemness of liver cancer cells via LSF-1. 23. Ruffell B, Chang-Strachan D, Chan V, Rosenbusch A, Ho CM, Pryer N, et al. Cancer Lett 2016;372:24–35. Macrophage IL-10 blocks CD8þ T cell-dependent responses to chemo- 5. Markiewski MM, DeAngelis RA, Benencia F, Ricklin-Lichtsteiner SK, Kou- therapy by suppressing IL-12 expression in intratumoral dendritic cells. toulaki A, Gerard C, et al. Modulation of the antitumor immune response Cancer Cell 2014;26:623–37. by complement. Nat Immunol 2008;9:1225–35. 24. Kwak JW, Laskowski J, Li HY, McSharry MV, Sippel TR, Bullock BL, et al. 6. Vadrevu SK, Chintala NK, Sharma SK, Sharma P, Cleveland C, Riediger L, Complement activation via a C3a receptor pathway alters CD4(þ)T et al. Complement C5a receptor facilitates cancer metastasis by altering T lymphocytes and mediates lung cancer progression. Cancer Res cell responses in the metastatic niche. Cancer Res 2014;74:3454–65. 2018;78:143–56. 7. Ajona D, Ortiz-Espinosa S, Moreno H, Lozano T, Pajares MJ, Agorreta J, 25. Strainic MG, Shevach EM, An F, Lin F, Medof ME. Absence of signaling into et al. A combined PD-1/C5a blockade synergistically protects against lung CD4(þ) cells via C3aR and C5aR enables autoinductive TGF-beta1 sig- cancer growth and metastasis. Cancer Discov 2017;7:694–703. naling and induction of Foxp3(þ) regulatory T cells. Nat Immunol 8. Zha H, Han X, Zhu Y, Yang F, Li Y, Li Q, et al. Blocking C5aR signaling 2013;14:162–71. promotes the anti-tumor efficacy of PD-1/PD-L1 blockade. Oncoimmu- 26. Baer C, Squadrito ML, Laoui D, Thompson D, Hansen SK, Kiialainen A, nology 2017;6:e1349587. et al. Suppression of microRNA activity amplifies IFN-gamma-induced 9. Wang Y, Sun SN, Liu Q, Yu YY, Guo J, Wang K, et al. Autocrine complement macrophage activation and promotes anti-tumour immunity. Nat Cell Biol inhibits IL10-dependent T-cell mediated antitumor immunity to promote 2016;18:790–802. tumor progression. Cancer Discov 2016;6:1022–35. 27. Hess C, Kemper C. Complement-mediated regulation of metabolism and 10. Liszewski MK, Kolev M, Le Friec G, Leung M, Bertram PG, Fara AF, et al. basic cellular processes. Immunity 2016;45:240–54. Intracellular complement activation sustains T cell homeostasis and med- 28. Kaneda MM, Messer KS, Ralainirina N, Li H, Leem CJ, Gorjestani S, et al. iates effector differentiation. Immunity 2013;39:1143–57. PI3Kgamma is a molecular switch that controls immune suppression. 11. Chmilewsky F, Jeanneau C, Laurent P, About I. Pulp fibroblasts synthesize Nature 2016;539:437–42. functional complement proteins involved in initiating dentin-pulp regen- 29. Li K, Fazekasova H, Wang N, Peng Q, Sacks SH, Lombardi G, et al. eration. Am J Pathol 2014;184:1991–2000. Functional modulation of human monocytes derived DCs by anaphyla- 12. Hsieh CC, Chou HS, Yang HR, Lin F, Bhatt S, Qin J, et al. The role of toxins C3a and C5a. Immunobiology 2012;217:65–73. complement component 3 (C3) in differentiation of myeloid-derived 30. Cancer Genome Atlas Network. Comprehensive molecular characteriza- suppressor cells. Blood 2013;121:1760–8. tion of human colon and rectal cancer. Nature 2012;487:330–7. 13. Kwan WH, Hashimoto D, Paz-Artal E, Ostrow K, Greter M, Raedler H, et al. 31. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, Antigen-presenting cell-derived complement modulates graft-versus-host et al. Safety, activity, and immune correlates of anti-PD-1 antibody in disease. J Clin Invest 2012;122:2234–8. cancer. N Engl J Med 2012;366:2443–54. 14. Strainic MG, Liu J, Huang D, An F, Lalli PN, Muqim N, et al. Locally 32. GaronEB,RizviNA,HuiR,LeighlN,BalmanoukianAS,EderJP,etal. produced complement fragments C5a and C3a provide both costimulatory Pembrolizumab for the treatment of non-small-cell lung cancer. and survival signals to naive CD4þ T cells. Immunity 2008;28:425–35. N Engl J Med 2015;372:2018–28. 15. Satyam A, Kannan L, Matsumoto N, Geha M, Lapchak PH, Bosse R, et al. 33. Brahmer J, Reckamp KL, Baas P, Crino L, Eberhardt WE, Poddubskaya E, Intracellular activation of complement 3 is responsible for intestinal tissue et al. Nivolumab versus docetaxel in advanced squamous-cell non-small- damage during mesenteric ischemia. J Immunol 2017;198:788–97. cell lung cancer. N Engl J Med 2015;373:123–35. 16. Pio R, Corrales L, Lambris JD. The role of complement in tumor growth. 34. Borghaei H, Paz-Ares L, Horn L, Spigel DR, Steins M, Ready NE, et al. Adv Exp Med Biol 2014;772:229–62. Nivolumab versus docetaxel in advanced nonsquamous non-small-cell 17. Cho MS, Vasquez HG, Rupaimoole R, Pradeep S, Wu S, Zand B, et al. lung cancer. N Engl J Med 2015;373:1627–39. Autocrine effects of tumor-derived complement. Cell Rep 2014;6:1085–95. 35. Pitt JM, Vetizou M, Daillere R, Roberti MP, Yamazaki T, Routy B, 18. Boire A, Zou Y, Shieh J, Macalinao DG, Pentsova E, Massague J. Comple- et al. Resistance mechanisms to immune-checkpoint blockade in ment component 3 adapts the cerebrospinal fluid for leptomeningeal cancer: tumor-intrinsic and -extrinsic factors. Immunity 2016;44: metastasis. Cell 2017;168:1101–13.e13. 1255–69. 19. De Henau O, Rausch M, Winkler D, Campesato LF, Liu C, Cymerman DH, 36. Tang H, Wang Y, Chlewicki LK, Zhang Y, Guo J, Liang W, et al. Facilitating T et al. Overcoming resistance to checkpoint blockade therapy by targeting cell infiltration in tumor microenvironment overcomes resistance to PD-L1 PI3Kgamma in myeloid cells. Nature 2016;539:443–7. blockade. Cancer Cell 2016;29:285–96.

OF14 Cancer Immunol Res; 2018 Cancer Immunology Research

Tumor Cell–Derived C3 Dampens Antitumor Immunity

37. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena 45. Dunkelberger J, Zhou L, Miwa T, Song WC. C5aR expression in a novel GFP C, et al. Genome-scale transcriptional activation by an engineered CRISPR- reporter gene knockin mouse: implications for the mechanism of action of Cas9 complex. Nature 2015;517:583–8. C5aR signaling in T cell immunity. J Immunol 2012;188:4032–42. 38. Ayers M, Lunceford J, Nebozhyn M, Murphy E, Loboda A, Kaufman DR, 46. Karsten CM, Laumonnier Y, Eurich B, Ender F, Broker K, Roy S, et al. et al. IFN-gamma-related mRNA profile predicts clinical response to PD-1 Monitoring and cell-specific deletion of C5aR1 using a novel floxed GFP- blockade. J Clin Invest 2017;127:2930–40. C5aR1 reporter knock-in mouse. J Immunol 2015;194:1841–55. 39. Li Y, Guo B, Xie Q, Ye D, Zhang D, Zhu Y, et al. STIM1 mediates hypoxia- 47. Ueha S, Yokochi S, Ishiwata Y, Ogiwara H, Chand K, Nakajima T, et al. driven hepatocarcinogenesis via interaction with HIF-1. Cell Rep Robust antitumor effects of combined anti-CD4-depleting antibody and 2015;12:388–95. anti-PD-1/PD-L1 immune checkpoint antibody treatment in mice. Cancer 40. Kolev M, Kemper C. Keeping it all going-complement meets metabolism. Immunol Res 2015;3:631–40. Front Immunol 2017;8:1. 48. Quell KM, Karsten CM, Kordowski A, Almeida LN, Briukhovetska D, Wiese 41. Kolev M, Markiewski MM. Targeting complement-mediated immunoreg- AV, et al. Monitoring C3aR expression using a floxed tdTomato-C3aR ulation for cancer immunotherapy. Semin Immunol 2018;37:85–97. reporter knock-in mouse. J Immunol 2017;199:688–706. 42. Kesselring R, Thiel A, Pries R, Fichtner-Feigl S, Brunner S, Seidel P, et al. The 49. Mueller-Ortiz SL, Morales JE, Wetsel RA. The receptor for the complement complement receptors CD46, CD55 and CD59 are regulated by the tumour C3a anaphylatoxin (C3aR) provides host protection against Listeria mono- microenvironment of head and neck cancer to facilitate escape of com- cytogenes-induced apoptosis. J Immunol 2014;193:1278–89. plement attack. Eur J Cancer 2014;50:2152–61. 50. Kandasamy M, Ying PC, Ho AW, Sumatoh HR, Schlitzer A, Hughes TR, et al. 43. Matsuda T, Nagasawa S, Koide T, Koyama J. Limited proteolysis of a Complement mediated signaling on pulmonary CD103(þ) dendritic cells chemically modified third component of human complement, C3, by is critical for their migratory function in response to influenza infection. cathepsin G of human leukocytes. J Biochem 1985;98:229–36. PLoS Pathog 2013;9:e1003115. 44. Bonavita E, Gentile S, Rubino M, Maina V, Papait R, Kunderfranco P, et al. 51. Yang X, Zhang X, Fu ML, Weichselbaum RR, Gajewski TF, Guo Y, et al. PTX3 is an extrinsic oncosuppressor regulating complement-dependent Targeting the tumor microenvironment with interferon-beta bridges innate inflammation in cancer. Cell 2015;160:700–14. and adaptive immune responses. Cancer Cell 2014;25:37–48.

www.aacrjournals.org Cancer Immunol Res; 2018 OF15

Intracellular Activation of Complement C3 Leads to PD-L1 Antibody Treatment Resistance by Modulating Tumor-Associated Macrophages

Haoran Zha, Xinxin Wang, Ying Zhu, et al.

Cancer Immunol Res Published OnlineFirst December 4, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/2326-6066.CIR-18-0272

Supplementary Access the most recent supplemental material at: Material http://cancerimmunolres.aacrjournals.org/content/suppl/2018/12/04/2326-6066.CIR-18-0272 .DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerimmunolres.aacrjournals.org/content/early/2019/01/08/2326-6066.CIR-18-0272. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.