COMBINATIONS of MUTATIONS WITHIN PATHWAY PROVIDE for COMBINED TRAIT PHENOTYPES in LINES with SACPD MUTATIONS in SOYBEAN Erik Lewis Gaskin Purdue University

Purdue University Purdue e-Pubs

Open Access Theses Theses and Dissertations

January 2016 COMBINATIONS OF MUTATIONS WITHIN PATHWAY PROVIDE FOR COMBINED TRAIT PHENOTYPES IN LINES WITH SACPD MUTATIONS IN SOYBEAN Erik Lewis Gaskin Purdue University

Follow this and additional works at: https://docs.lib.purdue.edu/open_access_theses

Recommended Citation Gaskin, Erik Lewis, "COMBINATIONS OF MUTATIONS WITHIN PATHWAY PROVIDE FOR COMBINED TRAIT PHENOTYPES IN LINES WITH SACPD MUTATIONS IN SOYBEAN" (2016). Open Access Theses. 1115. https://docs.lib.purdue.edu/open_access_theses/1115

This document has been made available through Purdue e-Pubs, a service of the Purdue University Libraries. Please contact [email protected] for additional information. Graduate School Form 30 Updated 12/26/2015

PURDUE UNIVERSITY GRADUATE SCHOOL Thesis/Dissertation Acceptance

This is to certify that the thesis/dissertation prepared

By Erik Lewis Gaskin

Entitled COMBINATIONS OF MUTATIONS WITHIN PATHWAY PROVIDE FOR COMBINED TRAIT PHENOTYPES IN LINES WITH SACPD MUTATIONS IN SOYBEAN

For the degree of Master of Science

Is approved by the final examining committee:

Karen Hudson Chair Katy Rainey

David Rhodes

To the best of my knowledge and as understood by the student in the Thesis/Dissertation Agreement, Publication Delay, and Certification Disclaimer (Graduate School Form 32), this thesis/dissertation adheres to the provisions of Purdue University’s “Policy of Integrity in Research” and the use of copyright material.

Approved by Major Professor(s): Karen Hudson, Katy Rainey

Joseph Anderson 11/18/2016 Approved by: Head of the Departmental Graduate Program Date

COMBINATIONS OF MUTATIONS WITHIN PATHWAY PROVIDE FOR

COMBINED TRAIT PHENOTYPES IN LINES WITH SACPD MUTATIONS IN

SOYBEAN

A Thesis

Submitted to the Faculty

Purdue University

Erik L. Gaskin

In Partial Fulfillment of the

Requirements for the Degree

Master of Science

December 2016

Purdue University

West Lafayette, Indiana ii

For cleaner veins.

iii

ACKNOWLEDGEMENTS

I would like to thank everyone that assisted me in accomplishing this goal of achieving my degree. Without Karen Hudson, I would not have even had this opportunity. Her knowledge in both the theoretical and technical applications of my studies was the foundation for my own development in understanding. It was her guidance that kept me on track to finish this project. My praise goes out to Militza Carrero-Colón, our laboratory technician. She not only taught me most of my laboratory skills, but also pushed me to develop my independence. An excellent role model, I could fill this page and more with positive remarks just about her. David Schlueter, our 'go-to-field guy,' was always a huge help in any task that needed done. Never one to turn way from a job of any difficulty, he has surely helped my studies progress further than I could have without him.

A special thank you to everyone else that assisted to me in my studies. From our various undergraduate students that collected and process samples, to everyone that helped me through my personal struggles at home, everyone has been beautifully amazing. I am grateful to have had them as not only part of my scholarly career, but my life in general. With every ounce of sincerity, I thank everyone who has helped me in accomplishing this end.

TABLE OF CONTENTS

Page LIST OF TABLES ...... v LIST OF FIGURES ...... vi LIST OF ABBREVIATIONS ...... vii ABSTRACT ...... viii CHAPTER 1. INTRODUCTION ...... 1 CHAPTER 2. RESULTS ...... 20 CHAPTER 3. DISCUSSION ...... 47 CHAPTER 4. MATERIALS AND METHODS ...... 52 REFERENCES ...... 59

LIST OF TABLES

Table ...... Page 1.1 SACPD-C Mutant Lines ...... 15 2.1Mutant SNP Markers and Specifications ...... 25 * 2.2 FAD2-1AW194STOP x SACPD-CA218E Fatty Acid Composition ...... 26 * 2.3 FAD2-1AW194STOP x SACPD-CA218E Protein and Oil Composition ...... 27 * 2.4 FAD2-1AP284S x SACPD-CA218E Fatty Acid Composition ...... 28 * 2.5 FAD2-1AP284S x SACPD-CA218E Protein and Oil Composition ...... 29 * 2.6 FAD2-1AL41F x SACPD-CA218E Fatty Acid Composition ...... 30 * 2.7 FAD2-1AL41F x SACPD-CA218E Protein and Oil Composition ...... 31

2.8 FAD3AW81STOP x SACPD-CY211C Fatty Acid Composition ...... 32

2.9 FAD3AW81STOP x SACPD-CY211C Protein and Oil Composition ...... 33 * 2.10 FAD3CP267S x SACPD-CA218E Fatty Acid Composition ...... 34 * 2.11 FAD3CP267S x SACPD-CA218E Protein and Oil Composition ...... 35

2.12 Composition of FAD2-1AL41F x SACPD-CA218E, Mayaguez 201 ...... 36

2.13 Composition of FAD3AW81STOP x SACPD-CY211C, Mayaguez 2015...... 37

2.14 Composition of FAD3CP267S x SACPD-CA218E, Greenhouse 2015 ...... 38 vi

LIST OF FIGURES

Figure ...... Page 1.1 Stearic Acid Molecule with Carbon Numbering ...... 16 1.2 Fatty Acid Biosynthesis Pathway ...... 17 1.3. Sequence Alignment of SACPD-A/B/C, Arabidopsis, and Castor Bean ...... 18

1.4 SACPD-CA218E x Prize F2 Stearic Acid Percentage ...... 19

2.1 FAD2-1AW194STOP x (SACPD-CA218E x Prize) FA Composition Per Genotype ...... 39

2.2 FAD2-1AP284S x (SACPD-CA218E x Prize) FA Composition Per Genotype ...... 40

2.3 FAD2-1AL41F x (SACPD-CA218E x Prize) FA Composition Per Genotype...... 41

2.4 FAD3AW81STOP x SACPD-CY211C FA Composition Per Genotype ...... 42

2.5 FAD3CP267S x (SACPD-CA218E x Prize) FA Composition Per Genotype ...... 43

2.6 Genotypic and Phenotypic Distribution of FAD2-1AL41F x SACPD-CA218E ...... 44

2.7 Genotypic and Phenotypic Distribution of FAD3AW81STOP x SACPD-CY211C ...... 45

2.8 Genotypic and Phenotypic Distribution of FAD3CP267S x SACPD-CA218E ...... 46

vii

LIST OF ABBREVIATIONS

ACP - Acyl-carrier protein CTAB - Cetyltrimethyl Ammonium Bromide EDTA - Ethylenediaminetetraacetic acid ER - Endoplasmic Reticulum FA(S) - Fatty acid (synthesis) FAD2 - Fatty acid desaturase 2 FAD3- Fatty acid desaturase 3 GMO - Genetically Modified Organism KAS - Beta-ketoacyl-ACP synthase NIR - Near Infrared Spectroscopy SACPD - Delta-9-stearoyl-acyl-carrier protein desaturase TAE - Tris base, acetic acid, EDTA buffer TBE - Tris, borate, EDTA buffer TE - Tris EDTA buffer USB - United Soybean Board W82 - Williams 82

viii

ABSTRACT

Gaskin, Erik L. M.S., Purdue University, December 2016. Combinations of Mutations Within Pathway Provide for Combined Trait Phenotypes in Lines with SACPD Mutations in Soybean. Major Professor: Karen Hudson.

Stearic acid is one of the five major fatty acids produced in soybean. It is an 18 carbon fully saturated lipid and is known for neutral or positive effects on LDL cholesterol when consumed by humans. Unfortunately, stearic acid only accounts for about 4% of the total seed oil produced in commodity soybean. Previous work has shown that stearic acid can reach levels as high as 28% of the total oil fraction when SACPD-C, the gene responsible for most of the stearic acid variation in soybean seed, is knocked out. In order to increase stearic acid content and create soybeans with improved utility based on fatty acid composition, we combined SACPD-C mutations with other mutations in the fatty acid biosynthetic pathway. When combined, double mutant progeny carrying mutant alleles of

SACPD-C and FAD2-1A do not have elevated levels of oleic acid. However, sacpdc fad3 double mutants have statistically significantly elevated levels of stearic acid and statistically significantly lower linolenic acid.

CHAPTER 1. INTRODUCTION

At just under 4 billion bushels produced by the U.S. in 2014 (USDA-NASS, 2016) soybean (Glycine max) is a crop that most families rely on for many reasons, whether they are aware of it or not. Soybean is extremely useful, in that the seeds can be consumed as food for both animals and humans but the oils produced by the seed can also be extracted and used in the food industry or the production of consumer goods. Soybean oil consists of five different fatty acids that are generated by a highly conserved biosynthetic pathway. In soybean seeds, as in many other plant seeds, oil is stored in lipid bodies that are produced from the endoplasmic reticulum via budding (Huang, 1996).

These fatty acids are palmitic (16:0), stearic (18:0), oleic (18:1), linoleic (18:2) and linolenic (18:3) acid. Soybean protein and oil content averages about 32 to 51.1% and

16.5 to 22.5% of seed dry weight respectively (Huskey et al., 1990). For the Williams 82 cultivar (Williams 82 is a standard cultivar frequently used for genetics and genomics, with a fully sequenced reference genome) the composition of the five major fatty acids is

11% palmitic acid, 4% stearic acid, 23% oleic acid, 54% linoleic acid, and 8% linolenic acid (Hawkins et al., 1983). The percentage stated represents the fraction of that specific fatty acid within the total seed oil. Each of these oils has a unique molecular structure which contributes to biological activity. Soybean oil, with different balances of these five constituent fatty acids, behaves differently in a variety of everyday conditions. Scientists 2 hope to combine the knowledge of the oils’ biological activity in both consumption and production, in order to fully utilize the potential of soybean. Methyl soyate is the basis for many industrial uses and is a product of soybean oil methyl esterification (NTP, unknown). In 2014, 5,037 million pounds of soybean oil was subject to the methyl ester path (USDA-ERS, 2016). Because each of the fatty acids produced have different molecular structures, each fatty acid has its own capacity for impacting human health.

Palmitic acid (16:0), when administered alone, increased proliferation of lymphocytes in rats. However, this increase in LDL receptor activity was nullified when polyunsaturated FAs were introduced along with palmitic acid (Tinahones et al., 2004).

Multiple studies have shown that palmitic acid has the capacity to negatively affect LDL cholesterol levels. As reviewed in Odia et al., (2015) the effects of palmitic acid on cholesterol can be reduced when combined with the more beneficial oils. Stearic acid

(18:0) (Figure 1.1) is one of the few saturated fatty acids that is considered to have neutral, if not positive, effects on human health. In comparison to other saturated fatty acids, stearic acid was shown to decrease LDL cholesterol (Mensink, 2005). Much work has shown that the monounsaturated oleic acid is very beneficial to human health.

Thijssen and Mensink, (2005),report that diets rich in stearic, oleic, or linoleic acid did not show significant differences in decreasing levels of LDL-cholesterol. However, they note that the general trend is that the more unsaturated the oil is, the stronger the oil’s ability to decrease LDL-cholesterol levels. Linoleic and linolenic acid have similar metabolic consequences on human health due to their polyunsaturated state. As noted by

Chan et al., (1991) “... oleic acid, linoleic acid, and linolenic acid are equally 3 hypocholesterolemic and that unsaturated fatty acids exert their effects on plasma cholesterol through a common mechanism.”

Soybean oil has great influence in the food market. However, in 2015, the Food and Drug Administration (FDA) determined that trans fats will no longer be “Generally

Recognized as Safe.” Trans fats are generated through the partial hydrogenation of unsaturated oils (U.S. FDA, 2015A). The purpose of hydrogenation is to decrease levels of polyunsaturated fatty acids in favor of more saturated ones. This not only increases the shelf life, but also increases the viscosity of the oil. In general, the longer and the more saturated a fatty acid is, the more solid the overall oil is. Lipids aggregate together and form van der Waals interactions between the hydrophobic tails. The formation of these bonds helps hold the lipids closely together, thus creating a thicker oil. As double bonds, trans figurations, and heat are introduced into the lipids, the opportunities for these bonds to occur decreases. The lack of opportunities for these van der Waals interactions to occur is the driving force for lipid fluidity (Lodish et al., 2008). Decrease in fluidity also results in a higher melting temperature, which in turn helps inhibit molecular breakdown.

Partial hydrogenation is responsible for increasing the oxidative stability and overall shelf life of soybean oils, but is also responsible for the generation of trans fats (Clemente and

Cahoon, 2009). The final goal of partial hydrogenation is to create an 18:0 (stearic acid) or 18:1 (oleic) structure from 18:2 or 18:3. Partial hydrogenation of soybean oil results in about 9.3% polyunsaturated FA, 12.6% stearic acid, and 61.1% oleic acid with 29.7% of that oleic value being in trans. Full hydrogenation completely removes the polyunsaturated and monounsaturated fatty acids, which boosts stearic acid levels up to

89% (Johnson et al., 2008). To comply with the FDA expectations of eliminating trans 4 fats would require ceasing partial hydrogenation of polyunsaturated oils, which has already had an economic impact on the soybean oil market. As previously stated, over

60% of the seed oil content for Glycine max is comprised of linoleic and linolenic acid, both of which are polyunsaturated fatty acids. This means that of all the oil produced by the seed, most of it is a candidate for partial hydrogenation, resulting in a low-quality fry oil that would break down quickly. Taking advantage of current genetic resources in soybean, it may be possible to create a designer soybean oil that does not require chemical modification. The goal of this research is to produce a soybean line that encompasses increased levels of the more healthy and stable oils, which include stearic and oleic acid, while decreasing the polyunsaturated linoleic and linolenic acid through non-transgenic means. Germplasm with elevated oleic acid (up to 80% of the total oil) exists already (Thapa et al., 2015; Pham et al., 2010). Stearic acid can be used in solid fat applications which opens a new market niche for non-hydrogenated soybean oil. Though soybean germplasm for elevated palmitic acid exists, it was not used in this project and current commodity soybean palmitic acid levels of 10% are likely to be adequate for solid fat applications (Anai et al., 2012; Head et al., 2012).In addition, a number of soybean lines contain elevated levels of seed stearic acid (Hammond and Fehr, 1983; Pantalone et al., 2002; Boersma et al. 2012; Ruddle et al. 2013A/B/C; Thapa et al., 2014). The goal of this project is to elevate stearic levels from 4% to at least 20% and generate an improved soybean oil by combining lines containing stearoyl-acyl carrier protein desaturase-C

(SACPD-C) mutations with lines containing mutations in other genes in the fatty acid biosynthetic pathway. It is expected that combining these mutations will lead to decreased levels of linoleic and linolenic acid, while increasing stearic and oleic acid. If 5 accomplished, the traits will be further studied for stability under varying field conditions.

Stearic acid, also known as octadecanoic acid, is an extremely versatile oil. It can often be found in many personal care items such as beauty creams and soaps. Stearic acid is also used in many other consumer and industrial products. These uses include adhesives, sealants, lubricants, fuel additives, laundry and dishwashing products, personal care products, plastics, rubber, and much more (NIH, 2016; U.S.DHHS, 2016). In 2012 it was reported by a Goodyear Tire and Rubber location in Topeka, Kansas that they use a volume of 2,658,156 lb/yr of octadecanoic acid (EPA, 2016). On the same report generated by the EPA, it was found that the national production volume for octadecanoic acid was 550,354,785 lb/yr. Stearic acid can also be found in any of the edible products that contain soybean oil. This places stearic acid in products like salad dressings, sauces, baked goods, and more. In 2014 the United States generated 22,828 million pounds of soybean oil. Of that, 2,014 million was exported and 18,959 million pounds was consumed in the U.S. alone (USDA-ERS, 2016).

Stearic acid was found to comprise less than 7% in a comparison of fourteen distinct vegetable oils (Osavova et al., 2015).(Since soybean is typically about 4% stearic acid, there seems to be no dominating crop for stearic production).The genome of

Glycine max, an ancient polyploid, has been successfully sequenced (Schmutz et al.,

2010). This has allowed for a wealth of development in soybean science. With the many resources of genetic material, the capacity at which the United States grows soybean, and the lack of competitors, soybean is an excellent candidate for attempting to elevate natural production of stearic acid. Domestication of modern soybean from its wild 6 ancestor, Glycine soja, is thought to have occurred in Southeast Asia at about 1100 B.C.

(Hymowitz and Kaizuma, 1981).Since then, it has been accepted in many countries around the world. Soybean became a key crop in the U.S. in 1940, when an increased demand of oils was brought about by WWII (Windish, 1981). At that time, the beans were used as a cheap source of protein as well as a source of feed for livestock. The oils were also extracted and used as a base in many consumer goods, such as plastics.

The production of oils in the soybean seed begins with fatty acid synthesis (FAS).

The foundation of fatty acid synthesis is the addition of 2-carbon molecules, one pair at a time, to a growing hydrocarbon chain that is attached to a carboxylic group (Johnson et al., 2008). Later, the hydrocarbon chains can be desaturated at several positions to further alter the molecular structure.

The biosynthesis of soybean oils begins in the stroma of the chloroplasts.

Reactions involving beta-ketoacyl synthase III (KAS III) initiates the synthesis of fatty acids. KAS I, which has an affinity for chains of 4 to 14 carbon atoms long, will extend the chain to C16 (palmitic acid), with the help of malonyl-ACP (Voelker and Kinney,

2001). At this point, chain extension can be terminated by multiple methods, but one of the more common is when the acyl moiety from the ACP is hydrolyzed. This occurs via a

16:0 ACP thioesterase encoded by the gene known as FatB (Buchanan et al., 2015).

Alternatively, the chain can be extended further by KAS II, which has an affinity for chains 10 to 16 carbons long. KAS II will utilize the newly formed palmitoyl-ACP to extend the chain by another 2-carbon molecule. Most commonly in soybean, chain elongation will terminate here, similarly to the C16 chain, but with FatA instead of FatB.

However, fatty acids of longer length are also generated, but in very small concentrations. 7

Once terminated at C18, stearic acid is formed. Stearic acid is the terminal product produced in the chloroplast (Johnson et al., 2008).

Fatty acid desaturation in soybean occurs mostly with either 16 or 18 carbon chains, however in soybean, 18 carbon chains are most common (Johnson et al., 2008).

Desaturation of stearic acid into oleic acid occurs in the cytoplasm and is regulated by the

Δ9 stearoyl-ACP desaturase (SACPD) (Shanklin and Cahoon, 1998). The newly formed oleic acid is then relocated into the endoplasmic reticulum (ER), where further desaturation occurs. Once inside the ER, stearic acid is then desaturated on the Δ9 carbon by the microsomal enzyme, ɷ-6 fatty acid desaturase (Figure 1.2). This desaturase is encoded by a gene known as FATTY ACID DESATURASE2 (FAD2) (Ohlrogge and

Browse, 1995). Desaturation of oleic acid produces linoleic acid, which contains double bonds at Δ9 and Δ12 locations (Buchanan et al., 2015). Linoleic acid is desaturated by enzymes that are produced by the FAD3 gene. The activation of FAD3 leads to the generation of another double bond, found at Δ15 (Buchanan et al., 2015). The final product of this pathway, linolenic acid, is an eighteen carbon chain with three double bonds at Δ9, Δ12, and Δ15.

Because soybean has experienced a recent chromosomal duplication, multiple genes encode several isoforms of each enzyme (Shoemaker et al., 1996; Cardinal et al.,

2007).This duplication event has resulted in genetic redundancies in the genome. Because of this, some genes are highly similar at the sequence level. FATB, the gene responsible for coding the enzyme that converts palmitic acid into stearic acid, has two sets of homeologs. These are FATB1a, FATB1b, FATB2a, and FATB2b. Of the four genes, it was found that FATB1a is responsible for most of the variation (62 to 70%) in palmitic 8 acid in soybean seeds when it was knocked out (Cardinal et al., 2007). It was also found that FATB1a and FATB1b are over 96% identical in sequence while FATB2a and

FATB2b are thought to be about 95% identical. However the two sets (FATB1 and

FATB2) differ between each other by only about 27%. The desaturation of stearic acid into oleic is controlled by SACPD, encoded by the genes SACPD-A, SACPD-B, and

SACPD-C. While all three isoforms are found to be expressed in the seeds, SACPD-C is responsible for most of the variation in stearic acid content of seeds (Byfield et al., 2006;

Zhang et al., 2008). Figure 1.3 is a sequence alignment that depicts the similarity of

SACPD-A, SACPD-B, and SACPD-C from Glycine max, FAB2 from Arabidopsis, and

SACPD from castor bean. SACPD-A and SACPD-B are 98% similar to one another while

SACPD-C is only 63% similar to either SACPD-A or SACPD-B (Byfield et al., 2006;

Zhang et al., 2008). FAD2 is the enzyme responsible for the desaturation of oleic acid into linoleic acid. In soybean, there are 5 different genes that encode for FAD2: FAD2-

1A, FAD2-1B, FAD2-1C, FAD2-2A, and FAD2-2B. The FAD2-1 genes are all expressed within the developing seed tissue (Anai et al., 2008). FAD2-2 genes are expressed primarily in the leaf tissue, but are also found expressed in the developing seeds

(Heppard et al., 1996). Three FAD3 (ɷ3 microsomal desaturases) genes are involved in seed composition, and they are FAD3a, FAD3b, and FAD3c (Bilyeu et al., 2003). Of the three genes present in soybean for FAD3, FAD3a was found to account for 60% of the expression in developing seeds. In 2011, it was found that combinations of mutations in the three genes, FAD3a, FAD3b, and FAD3c created a phenotype of 1% linolenic acid

(Bilyeu et al., 2011). Because these genes have multiple homeologs, the pathway has many functional redundancies. This means that a singular mutation will not fully 9 eliminate the biological function because multiple isoforms are present. All of these genes, and their different enzyme isoforms, are the focus of genetic research to improve soybean oil.

As previously mentioned, stearic acid is known to average 2-4% in Glycine max.

Attempts to increase stearic acid levels in soybean seeds have been productive. In 1983, a new soybean line (A6) was reported to contain 28.1% stearic acid (Hammond and Fehr,

1983). The high stearic acid phenotype in A6 was later found to be due to a very large chromosomal deletion that includes the region containing the SACPD-C gene (Zang et al., 2008). However, work by Gillman et al., (2014B) it is hypothesized that additional unidentified mutations may also be adding to the stearic phenotype in A6. The A6 line has a maturity group of zero, which means optimal growth for this line is minimal and mostly restricted to Northern regions due to its early maturity date. Due to the visual appearance of the line, in comparison to other agronomical characters, it was deemed inferior to other commercially grown lines (Hammond and Fehr, 1983).

A cross between FAM94-41, which produces a two-fold increase in stearic levels, and A6, produced an F2 population with a range of 7-27% (each tail belonging to single mutant genotypes) and an average of 15.3% stearic acid. Results of this complementation test showed that most of the increase in stearic acid was due to the reduction of further downstream C18 unsaturated products. FAM94-41 was subsequently shown to contain a point mutation encoding a substitution of asparagine for aspartic acid at position 126 in the amino acid sequence of SACPD-C (Zhang, et al, 2008). When FAM94-41 was crossed to C1727, a mutant for low KASII activity, it was shown that the mutations 10 producing the elevated stearic acid phenotype seen in the first cross, was not associated with KASII activity (Pantalone et al., 2002).

Boersma et al. (2012) demonstrated that mutations in the SACPD-C gene of soybean resulted in increased levels of stearic acid in the seed tissue. Using recombinant inbred lines (RILs) that were sequenced and found to contain a point mutation in the gene, they analyzed a segregating population for genotype and phenotype. RG7 contained a point mutation that resulted in a premature stop codon at the 64th amino acid and a stearic level of 120 g kg-1. RG8 contained a mutation in the second exon that resulted in a proline instead of leucine and had a stearic acid content of 106g kg-1.They found that all but one line that had an excess of 64 g kg-1 (compared to the normal ~54 g kg-1) contained the RG7 mutation. A strong correlation (r = .98) was found between the mutation and the above-normal stearic acid level. They also combined the RG7 line with a low palmitic acid line, RG2. This combination provided a stearic acid level of 180g kg-

1. It was found in the population that palmitic acid content is independent of stearic acid content (r = -0.20), stearic acid and oleic acid are negatively correlated (r = -0.87), stearic acid and linolenic acid were positively correlated (r = 0.65), and oleic acid and linolenic acid were also positively correlated (r = 0.35). All correlations are based on single mutant lines.

Ruddle II et al. (2013B) attempted to show the effects of SACPD mutations and deletions in combination with mutations in FAD2-1A and FAD2-1B. Their aim was to combine high stearic and oleic acid phenotypes. In two different triple mutants of

SACPD-C/FAD2-1A/FAD2-1B they achieved elevated stearic and oleic levels. One of the genotypes contained a mutated SACPD-C gene, while the other contained a deletion. The 11

SNP genotype generated 12.7% stearic acid and 65% oleic acid. The other triple mutant, containing the SACPD-C deletion, provides 10.4% stearic acid and 75.9% oleic acid. In comparison to the expectation of their single mutants the SNP genotype saw a gain of

1.2% in the triple than just the stearic mutant genotype, and a loss of 12.6% oleic compared to the double FAD2 mutant. The deletion genotype had a loss of 1.5% stearic and 5.9% oleic (Ruddle II et al., 2013B).

Additionally, Ruddle II et al. (2013A)showed that a double mutant line consisting of a SACPD-C point mutation in combination with a SACPD-B deletion averaged 14.6% stearic acid. The single SACPD-C mutant had a seed stearic acid level of 11.9% alone, and the SACPD-B single mutant had a seed stearic acid content of 10.4%. Even though

SACPD-A and SACPD-B are associated with non-seed development of stearic acid

(Kachroo et al., 2008), SACPD-B has an additive effect to the elevated stearic acid phenotype in the seed, caused by SACPD-C mutation (Ruddle II et al., 2013A). However, it was found that SACPD-B mutations brought about poor agronomic performance. Seeds produced were smaller, yield was reduced, and mature plants were 15% shorter (Ruddle

II et al., 2013B). It was hypothesized that the mutation in SACPD-B not only influenced stearic acid in the seed, but the mutation also altered the composition within vegetative tissue (Ruddle II et al., 2013C).

Genetic modification using transgenes provide another mechanism to manipulate stearic acid levels in soybean seed, even though transgenic plants may be received negatively by consumers. Regardless of social acceptance, transgenics provide an unrivaled look into genetic possibilities. Mangosteen is one of the top producers of stearic acid, at a high of about 56% of the seed composition (Hawkins et al., 1998). Park et al. 12

(2014) created a transgenic soybean line containing a mangosteen stearoyl-ACP thioesterase gene crossed to a high oleic and low palmitic acid transformant. The combination resulted in a soybean line with 19.7% stearic acid and 67.7% oleic acid.

However, it was found that after five generations the high oleic phenotype was lost while the high stearic levels remained, though slightly decreased. This is likely due to the eventual silencing of the promoter driving the expression of the FAD2 silencing transgene. One of their end products contained a mean 16.4% stearic acid and 33.9% oleic acid. Their work showed that the desired high stearic and oleic phenotypes were possible, but further work is needed to maintain these traits (Park et al., 2014).

Point mutations are arguably not subject to the same regulations as transgenic genetic modifications because they are the basis of natural mutation. Carrero-Colón et al.

(2014) described six SNPs in the SACPD-C gene, many of which increase stearic acid levels over two to three fold (Table 1.1). F2 from a cross of SACPD-CA218E x Prize resulted in a number of segregants with statistically significantly higher levels of stearic acid, which could indicate the presence of an enhancer gene. Seeds from this line have been observed to contain 21% stearic acid, as seen in figure 1.4. In subsequent trials, elevated stearic levels remained conserved at an average of 17.8% (data not shown).

Disruptions in the SACPD-C gene also resulted in atypical nodule formation on the roots. It was found that the gene was not only highly expressed in the seed, but also the nodules. When compared to wild type and even FAD2-1A (elevated oleic acid) mutated lines, the SACPD-C mutated lines had nodules with a discolored central cavity formation. They also observed that older nodules developed central necrotic zones as early as two weeks post bacterial inoculation. The A6 line, which has a SACPD-C 13 knockout, also developed these symptoms slightly more prominently. Though these lines showed atypical nodule formation and activity, nitrogen fixation was not inhibited in a laboratory setting (Gillman et al., 2014A). Their work shows some of the first evidence of a morphological change due to SACPD-C mutation, and opens the question of whether stearic acid has signaling roles outside of the seed.

Because of its benefit to human health, high oleic soybeans are desired in the food industry. The United Soybean Board (USB) are the directors of the soybean checkoff.

The soybean checkoff is a fund that is supported by individual soybean farmers who supply 0.5 percent of the market price per bushel at the end of each season. This money is used to support marketing, research, and commercialization programs (United Soybean

Board, 2013). According to their 2016 budget summary, they allocated over 17 million dollars into oil research programs. A recent emphasis has been on is high oleic soybeans.

They claim that some of the key features of high oleic soybeans are that they have yields equal to the traditional lines, farmers are paid a premium for growing high oleic lines, and that the demand for oleic acid is greatly increasing due to its use as a frying oil, biofuel, and other industrial needs (United Soybean Board, 2015).

VistiveTM Gold, also known as MON 87705, is a high oleic and low saturate soybean line generated by Monsanto Company. VistiveTM Gold has a fatty acid composition of 2.5 % palmitic, 3.5% stearic, 72% oleic, 16% linoleic, and 3% linolenic acid (Monsanto, 2016). This transgene line was created using dsRNA to silence FATB and FAD2 activity (Biosafety Clearing House, 2014). PlenishⓇ is another high oleic transgenic soybean line that was created by DuPont Pioneer using microprojectile bombardment. The phenotype is achieved by silencing the ɷ-6-desaturase (FAD2). This 14 suppresses the plant’s ability to desaturate oleic acid into linoleic acid, and subsequently linolenic acid as well (Biosafety Clearing House, 2013). The reported fatty acid composition for PlenishⓇ is 6.5% palmitic, 4% stearic, 75% oleic, 7% linoleic, and 2.5% linolenic acid (Dupont, 2014). Both lines display a high oleic acid and greatly lowered polyunsaturated level. However, both lines are considered genetically modified organisms. This status of being a genetically modified organism brings issues to consumers.

Table 1.1 SACPD-C Mutant Lines

Palmitic Acid Stearic Acid Oleic Acid Linoleic Acid Linolenic Acid n (16:0) (18:0) (18:1) (18:2) (18:3)

W82 10.0 + 0.2 4 + 0.1 20.6 + 0.5 57.0 + 0.5 8.3 + 0.2 6

15073 8.1 + 0.4 12.1 +1.2 15.9 + 0.6 55.0 + 1.3 8.8 + 0.6 6 -6* -8* -8* * SACPD-CG224E 1.3e 1.8e 4.6e 0.0055 0.13

14197 8.8 + 0.4 12.1 + 3.5 20.0 + 2.9 51.6 + 0.7 7.6 + 0.6 3 -4* -4* -6* * SACPD-CY211C 1.25e 5.3e 0.62 2.4e 0.0044

18190 8.5 + 0.6 13.5+ 0.6 14.8 + 0.2 53.8 + 0.4 9.3 + 0.3 3 -4* -9* -7* -5* -4* SACPD-CA218E 4.2e 1.8e 2.6e 1.8e 5.0e

18948 10.1 + 0.5 9.5 + 1.3 17.4 + 0.6 54.9 + 1.1 8.1 + 0.4 4 -6* -5* * SACPD-CH223R 0.75 4.4e 1.3e 0.0034 0.26

18610 9.45 + 0.6 6.1 + 1.2 22.2 + 1.2 54.1 + 2.0 8.1 + 0.9 6 * * * * SACPD-CA239T 0.032 0.0021 0.0093 0.0057 0.57

21084 8.4 + 0.3 8.7 + 0.8 27.8 + 1.8 48.6 + 1.4 6.5 + 0.8 4 -4* SACPD-CR329I 0.79 5.3e 0.016 0.51 0.77

This data represents the different fatty acid profiles, and the standard deviations, for multiple mutant SACPD-C alleles as found in Carrero-Colón et al., (2014). The seed used was homozygous M4 or M5 lines and is compared to Williams 82 as a wild type control. Two-tailed type 2 t-tests were performed and p-values are provided in italics. A single asterix indicates significance when compared to p < 0.05.

Figure 1.1Stearic Acid Molecule with Carbon Numbering

Figure 1.2 Fatty Acid Biosynthesis Pathway as Seen in Brassicaceae

This image was obtained from Barker et al., 2007. A-H indicate the different pathways for

triacylglycerolproduction. ACCase, Acetyl-CoA carboxylase; FA, fatty acid; FAS, fatty acid synthase; FAT, fatty ACP thioesterase; DES, desaturase; ACS, acyl-CoA synthetase; MC, medium chain; AT, various acyl transferases; PC, phosphatidylcholine; TAG, triacylglycerol.

Figure 1.3 Sequence Alignment of SACPD-A/B/C, Arabidopsis, and Castor Bean

Sequence alignment was obtained from Carrero-Colón et al., (2014). Multiple sequence alignment for soybean SACPD-C with close sequence homologs showing the position of mutations in conserved locations. Other proteins shown are SACPD-A and SACPD-B from soybean, FAB2 from Arabidopsis (At3g02610/DES2), and the castor bean SACPD (30020.m000203.rco). Mutations described in this work are located at the following positions: 1. SACPD-CY211C 2. SACPD-CA218E 3. SACPD-CH223R 4. SACPD-CG224E 5. SACPD-CA239T 6. SACPD-CR329I

Figure 1.4 SACPD-CA218Ex Prize F2 Stearic Acid Percentage

Stearic acid ranges per genotype for F2 seed produced at ACRE in 2012

CHAPTER 2. RESULTS

The goal of this project is to increase stearic acid through mutant combinations, and generate conventional germplasm with elevated stearic acid in combination with an elevated oleic and/or low linolenic acid phenotype. In order to accomplish this, we combined different mutant alleles from three candidate genes and evaluated fatty acid composition. The use of SNP mutants has the potential to provide different levels of gene inhibition, thus leading to different seed composition profiles. We compared double mutant, single mutant and wild type genotypes to evaluate the effects of the individual and double mutations to the seed.

This project used two alleles of SACPD-C, 18190 (SACPD-CA218E) and 14197

(SACPD-CY211C) (Carrero-Colón et al., 2014). SACPD-CY211C with a tyrosine to cysteine substitution at position 211, produces seed containing 12.1% stearic acid as a proportion of total fatty acids (Table 1.1). SACPD-CA218E, which has an alanine to glutamic acid substitution at position 218 in the protein chain, confers a phenotype of 13.5% stearic acid in seeds. These two mutations fall within a domain of the SACPD-C enzyme thought to be important for function (Figure 1.3, Carrero-Colón et al., 2014). In addition, when

SACPD-CA218E was crossed to Prize, a cultivar frequently used for outcrossing by our group because of its purple flowers, some of the F2 showed stearic acid levels of up to

21%, suggesting the existence of a gene that enhances the elevate stearic acid 21 phenotype (Figure 1.4). Attempts at discovering the identity of this modifier are still underway. The self-pollinated F3 and F4 progeny from this original cross were subsequently propagated in the field, and retain stearic acid levels above 17%. When

* used in further cross combinations, we have designated it as SACPD-CA218E to indicate the presence of the enhancer.

To generate germplasm with elevated oleic acid in combination with elevated stearic acid, three different FAD2-1A alleles were used in crosses for this project. FAD2-

1AL41F, with a leucine to phenylalanine mutation at position 41, has been observed to have seed levels of oleic acid as high as 29.71% of total fatty acids in the seed. Another allele, FAD2-1AP284S, which carries a serine in place of proline at position 284, has oleic acid levels of 30.30%. With 39.07% oleic acid, the third FAD2-1A mutant line used was

FAD2-1AW194STOP, which has a stop codon in place of tryptophan at position 194 (Thapa et al., 2015). By combining these FAD2 mutant lines with SACPD-C mutants we should see elevated oleic and stearic acid in the progeny.

The FAD3 mutants that were used in the crossing program were FAD3AW81STOP and FAD3CP267S. These lines are used to provide the desired low linolenic phenotype.

Both lines have been seen to bring linolenic levels from 7% down to about 4% (Thapa, In

Preparation 2016).

After a successful cross, the new progeny were genotyped using SNP genotyping markers (Table 2.1) and analyzed using gas chromatography and near infrared spectrometry. The data acquired through these methods allowed for the analysis of the fatty acid content in relation to genotype, as well as any significant changes in the total protein and oil content of the seed. In all cases, gas chromatography-derived composition 22 of each of the five major soybean fatty acids is expressed as a fraction of the total extractable fatty acids. For each of the mentioned lines the data were acquired from F2:3 seed produced at Purdue's ACRE.

Cross combinations of SACPD-C mutant alleles and multiple FAD2-1A mutant alleles were made and analyzed. This cross represents a combination of the strongest mutant alleles of these two genes. FAD2-1AW194STOP x (SACPD-CA218E x Prize) is shown in Figure 2.1 and Table 2.2. Single FAD2-1A mutants in the population showed statistically significantly increased oleic acid levels and decreased palmitic and linoleic acid as well. The SACPD-C single mutant exhibited an increase in stearic and linolenic acid levels and a decrease in palmitic, oleic, and linoleic acid levels. In comparison to wild-type genotypes, the double mutant line is statistically significantly increased in stearic, oleic, and linolenic acid, while providing a decrease in palmitic and linoleic acid.

The double mutant gained ~11.3% stearic acid and only ~3% oleic acid. Though significant, the oleic acid content of the double mutant is much lower than the single mutant genotype. NIR spectrometry was performed to determine if the fad2-1a sacpd-c mutant had statistically significantly altered protein or oil content, and it was found that the total protein content for the double mutant was statistically significantly reduced

(~8%) when compared to the wild type genotype. The total oil content was not statistically significantly altered (Table 2.3). Results from the cross of FAD2-1AP284S x

(SACPD-CA218E x Prize) (Figure 2.2 and Tables 2.4 & 2.5) and FAD2-1AL41F x (SACPD-

CA218Ex Prize) (Figure 2.3 and Tables 2.6 & 2.7) were similar to each other. Stearic acid was statistically significantly increased in both double mutants, while oleic acid was not changed. Both double mutants also exhibit decreased palmitic and linoleic acid, while 23 having an increase in linolenic acid when compare to their wild type genotype. In both cases, there were no significant differences between the protein or oil levels in comparison to their wild type genotype (Tables 2.5 & 2.7). Additionally, Figure 2.6 further demonstrates the effects that a single SACPD-C mutation has on oleic acid concentrations for FAD2-1AL41F. This may indicate that the reduction in seed protein content observed in the FAD2-1AW194STOP x (SACPD-CA218E x Prize) cross may be the result of another mutation affecting protein accumulation in the background. These results suggest that, at least when combined with only one FAD2-1 mutation, oleic acid levels are generally unaltered when combined with SACPD-C mutations. In all cases, the stearic levels were as expected in that they were less than the single mutant genotype, but still statistically significantly increased relative to the wild type genotype.

Two crosses were performed to determine the effect of combining a low linolenic acid phenotype conferred by a mutation in one of the FAD3 genes, with the elevated stearic acid phenotype. Double mutants carrying the FAD3AW81STOP and SACPD-CY211C resulted in seeds containing 15.46% stearic acid and 4.27% linolenic acid (Figure 2.4 and

Tables 2.8 & 2.9). No double mutants were produced from our FAD3CP267S x SACPD-

* CA218E cross (Figure 2.5 and Tables 2.10 & 2.11). It was found that in the FAD3A cross not only was stearic acid increased to a statistically significant level compared to the wild type genotype, but that the percentage was higher than the single mutant genotype.

Linolenic acid was also decreased statistically significantly by about ~2.5% total compared to the wild type genotype. The cross also had statistically significantly decreased palmitic acid and oleic acid percentages. No differences in total protein or oil were observed in either combinations for the genotypes available (Tables 2.9 & 2.11). 24

In addition to the data obtained at ACRE, seed from the greenhouse and our

Winter nursery in Puerto Rico was chipped for genotype and phenotype. FAD2-1AL41F x

SACPD-CA218E and FAD3AW81Stop x SACPD-CY211C were both obtained from Mayaguez,

Puerto Rico in 2015. Unlike the previous data, this data also includes the phenotypic results for heterozygotes. For the double mutants of the FAD2-1A x SACPD-C cross, the stearic acid was increased to 11.1% while the single SACPD mutation produced 12.6%.

Oleic acid was reduced to about 21.9% compared to the single FAD2 mutant having

27.4%. Compared to the wild type genotype, palmitic and linoleic acid were statistically significantly decreased while stearic, oleic, and linolenic acid were statistically significantly increased (Figure 2.6 and Table 2.12). The FAD3A x SACPD combination only provided one double mutant and one wild type genotype. Compared to the mutant genotypes, stearic acid was slightly reduced from 14.3% to 14.1% and linolenic acid was increased from 4.3% to 5.0%, Compared to the wild type genotype, palmitic, oleic, linoleic and linolenic acid were reduced while only stearic acid was increased (Figure 2.7 and Table 2.13). No statistical tests were performed on this cross. Seed for FAD3CP267S x

SACPD-CA218E was obtained from the greenhouse in 2015. Stearic acid in the double mutants produced 14.6% stearic compared to the single mutants producing 16.9% while linolenic acid was 6.7% compared to the 5.7% produced by the single mutant. When compared to the wild type genotype, palmitic, oleic, linoleic, and linolenic acid were all statistically significantly reduced, while stearic acid was statistically significantly increased (Figure 2.8 and Table 2.14). All seed was processed as provided in the seed chipping methods.

Table 2.1 Mutant SNP Markers and Specifications

Annealing Digestion

Gene Mutation Primer F Primer F Sequence Primer R Primer R Sequence Temp (C) Enzyme Gel %

FAD2-1A L41F MCC34 TGGCCAAAGTGGAAGTTCAA KK317 TGAGGGATTGTAGTTCTGTTGG 54-56 BpuE1 3

FAD2-1A P284S MCC34 TGGCCAAAGTGGAAGTTCAA MCC35 ATTGGTTGCTCCATCAATACTTGT 54-56 Acc I 1

FAD2-1A W194STOP KK317 TGAGGGATTGTAGTTCTGTTGG MCC35 ATTGGTTGCTCCATCAATACTTGT 54-56 BstE II 1

SACPD-C Y211C KK505 TGTATTTTGTTTTGATTAAATTGGGTA KK532 CCACGATTCTTGAGTACGCGTTC 54-56 Rsa I 3

SACPD-C A218E KK689 GCCGAGCCGTGTTCCCGTGCGCCGCAAATGT KK690 TGGCAATCGGAGCTTTCTCATAG 52-54 BstAP1 3

FAD3C P267S KJH39 CAGTGGTTAGATTTGGTTGT KJH40 ACTTGTGAGGACAATTTGGT 48-50 Sty I 1

FAD3A W81STOP KK519 GCCAAATGAAATGAGGTAGGC KK520 TTCTCTGGCTAATCTAcTG 54-56 Bsr I 3

Forward and reverse primer sequences, suggested PCR program annealing temperatures, restriction digestion enzyme used for genotyping, and the gel percent used for genotyping per mutant allele.

* Table 2.2 FAD2-1AW194STOP x SACPD-CA218E Fatty Acid Composition

Genotype (FAD2-1A) N SD 2Tail SD 2Tail SD 2Tail SD 2Tail SD 2Tail (SACPD-C) Palmitic (±) T-Test Stearic (±) T-Test Oleic (±) T-Test Linoleic (±) T-Test Linolenic (±) T-Test (+/+)/(+/+) 7 10.256 0.490 3.779 0.112 25.506 1.828 53.177 1.183 7.282 0.631 (+/+)/(-/-) 3 9.175 0.133 0.00653 16.559 1.279 0.00000 15.619 0.281 0.00002 49.968 0.288 0.00201 8.680 0.771 0.01636 (-/-)/(+/+) 18 9.345 0.634 0.00241 3.950 0.297 0.15621 39.284 4.494 0.00000 39.749 3.622 0.00000 7.672 0.840 0.27922 (-/-)/(-/-) 7 8.441 0.567 0.00003 14.420 3.007 0.00000 28.626 2.686 0.02593 39.773 4.428 0.00001 8.740 0.369 0.00020

This population of F2:3 seed consisted of 35 individuals and was harvested from ACRE 2015. Compositional phenotype of five major fatty acids measured as compared to original genotype, given in percentage. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.3 FAD2-1AW194STOP x SACPD-CA218E Protein and Oil Composition

Genotype (FAD2-1A) Mean SD Protein Mean SD Oil 2Tail T-Test 2Tail (SACPD-C) N Protein (±) Oil (±) Protein T-Test Oil (+/+)/(+/+) 7 44.633 1.973 18.800 0.674 (+/+)/(-/-) 3 41.387 2.739 19.670 1.100 0.064 0.154 (-/-)/(+/+) 18 42.721 2.979 19.429 1.368 0.132 0.261 (-/-)/(-/-) 7 40.964 0.950 19.159 1.032 0.001 0.456

This population of F2:3 seed consisted of 35 individuals and was harvested from ACRE 2015. Mean values are provided in percentage of total composition. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.4 FAD2-1AP284S x SACPD-CA218E Fatty Acid Composition

Genotype (FAD2-1A) N SD 2Tail SD 2Tail SD 2Tail SD 2Tail SD 2Tail (SACPD-C) Palmitic (±) T-Test Stearic (±) T-Test Oleic (±) T-Test Linoleic (±) T-Test Linolenic (±) T-Test (+/+)/(+/+) 4 10.389 0.237 4.663 0.502 30.124 2.882 48.216 2.562 6.608 0.177 (+/+)/(-/-) 2 8.960 0.00137 19.247 0.00000 16.859 0.00490 46.687 0.48805 8.246 0.01049 (-/-)/(+/+) 2 9.990 0.20761 4.491 0.67153 41.312 0.01310 36.983 0.00537 7.224 0.14812 (-/-)/(-/-) 5 8.424 0.553 0.00031 16.382 0.995 0.00000 29.960 0.933 0.90687 37.058 1.509 0.00008 8.175 0.340 0.00007

This population of F2:3 seed consisted of 13 individuals and was harvested from ACRE 2015. Compositional phenotype of five major fatty acids measured as compared to original genotype, given in percentage. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.5 FAD2-1AP284S x SACPD-CA218E Protein and Oil Composition

Genotype (FAD2-1A) Mean SD Protein Mean SD Oil 2 Tail T-Test 2 Tail (SACPD-C) N Protein (±) Oil (±) Protein T-Test Oil (+/+)/(+/+) 4 41.500 1.688 19.033 0.776 (+/+)/(-/-) 2 39.615 19.310 0.208 0.842 (-/-)/(+/+) 2 42.525 19.290 0.572 0.811 (-/-)/(-/-) 5 41.384 1.340 18.984 0.659 0.896 0.369

This population of F2:3 seed consisted of 13 individuals and was harvested from ACRE 2015. Mean values are provided in percentage of total composition. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.6 FAD2-1AL41F x SACPD-CA218E Fatty Acid Composition

Genotype (FAD2-1A) N SD 2Tail SD 2Tail SD 2Tail SD 2Tail SD 2Tail (SACPD-C) Palmitic (±) T-Test Stearic (±) T-Test Oleic (±) T-Test Linoleic (±) T-Test Linolenic (±) T-Test (+/+)/(+/+) 3 11.342 0.239 4.152 0.130 22.535 1.234 55.055 0.801 6.917 0.407 (+/+)/(-/-) 3 9.485 0.745 0.01471 15.215 1.751 0.00040 15.944 0.756 0.00140 51.370 1.511 0.02028 7.986 0.797 0.10755 (-/-)/(+/+) 4 10.716 0.414 0.06859 4.303 0.229 0.35781 33.642 2.261 0.00063 44.077 2.113 0.00039 7.263 0.228 0.20726 (-/-)/(-/-) 4 9.247 0.737 0.00562 14.457 2.297 0.00064 23.633 1.176 0.28412 44.838 2.637 0.00142 7.825 0.472 0.04502

This population of F2:3 seed consisted of 14 individuals and was harvested from ACRE 2015. Compositional phenotype of five major fatty acids measured as compared to original genotype, given in percentage. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.7 FAD2-1AL41F xSACPD-CA218E Protein and Oil Composition

Genotype (FAD2-1A) Mean SD Protein Mean SD Oil 2 Tail T-Test 2 Tail (SACPD-C) N Protein (±) Oil (±) Protein T-Test Oil (+/+)/(+/+) 3 41.957 2.716 20.373 1.069 (+/+)/(-/-) 3 41.843 1.820 19.343 0.478 0.955 0.202 (-/-)/(+/+) 4 42.300 0.862 19.490 0.473 0.817 0.193 (-/-)/(-/-) 4 41.408 1.669 19.688 0.890 0.752 0.395

This population of F2:3 seed consisted of 14 individuals and was harvested from ACRE 2015. Mean values are provided in percentage of total composition. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

Table 2.8 FAD3AW81STOP x SACPD-CY211C Fatty Acid Composition

Genotype (FAD3A) N SD 2Tail SD 2Tail SD 2Tail SD 2Tail SD 2Tail (SACPD-C) Palmitic (±) T-Test Stearic (±) T-Test Oleic (±) T-Test Linoleic (±) T-Test Linolenic (±) T-Test (+/+)/(+/+) 4 10.317 0.374 4.189 0.214 22.968 0.404 55.787 0.946 6.739 0.758 (+/+)/(-/-) 4 8.839 0.497 0.00315 14.191 1.469 0.00001 16.240 0.319 0.00000 52.405 1.168 0.00410 8.325 0.253 0.00739 (-/-)/(+/+) 4 10.460 0.307 0.57669 4.193 0.090 0.97213 22.793 1.020 0.76121 58.710 1.008 0.00551 3.843 0.080 0.00027 (-/-)/(-/-) 4 8.869 0.633 0.00764 15.455 1.719 0.00001 16.300 0.805 0.00001 55.104 1.003 0.35977 4.272 0.188 0.00074

This population of F2:3 seed consisted of 16 individuals and was harvested from ACRE 2015. Compositional phenotype of five major fatty acids measured as compared to original genotype, given in percentage. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

Table 2.9 FAD3AW81STOP x SACPD-CY211C Protein and Oil Composition

Genotype (FAD3A) Mean SDProtein Mean SD Oil 2 Tail T-Test 2 Tail (SACPD-C) N Protein (±) Oil (±) Protein T-Test Oil (+/+)/(+/+) 4 40.890 1.484 20.508 0.340 (+/+)/(-/-) 4 38.818 2.396 20.228 0.745 0.192 0.520 (-/-)/(+/+) 4 40.768 0.773 20.448 0.923 0.888 0.907 (-/-)/(-/-) 4 39.665 2.390 20.193 1.234 0.417 0.640

This population of F2:3 seed consisted of 16 individuals and was harvested from ACRE 2015. Mean values are provided in percentage of total composition. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

* Table 2.10 FAD3CP267S x SACPD-CA218E Fatty Acid Composition

Genotype (FAD3C) N SD 2Tail SD 2Tail SD 2Tail SD 2Tail SD 2Tail (SACPD-C) Palmitic (±) T-Test Stearic (±) T-Test Oleic (±) T-Test Linoleic (±) T-Test Linolenic (±) T-Test (+/+)/(+/+) 2 10.509 4.625 23.711 54.067 7.088 (+/+)/(-/-) 1 9.458 14.761 16.400 52.710 6.671 (-/-)/(+/+) 2 9.986 0.67713 8.928 0.43940 19.441 0.37895 55.297 0.13614 6.349 0.48335 (-/-)/(-/-) 0

This population of F2:3 seed consisted of 5 individuals and was harvested from ACRE 2015. Compositional phenotype of five major fatty acids measured as compared to original genotype, given in percentage. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference. Lack of population size resulted in lack of data acquired and tests performed.

* Table 2.11 FAD3CP267S x SACPD-CA218E Protein and Oil Composition

Genotype (FAD3C) Mean SD Protein Mean SD Oil 2 Tail T-Test 2 Tail (SACPD-C) N Protein (±) Oil (±) Protein T-Test Oil (+/+)/(+/+) 2 40.355 19.830 (+/+)/(-/-) 1 40.850 19.670 (-/-)/(+/+) 2 38.495 20.700 0.303 0.118 (-/-)/(-/-) 0

This population of F2:3 seed consisted of 5 individuals and was harvested from ACRE 2015. Mean values are provided in percentage of total composition. Two tail t-test significance is based on p = 0.05 and use wild type genotype as reference.

Table 2.12 Composition of FAD2-1AL41F x SACPD-CA218E, Mayaguez 2015

FAD2-1A SACPD-C Pal (%) Ste (%) Ole (%) Lle (%) Lln (%) N ++ ++ 13.5 3.6 18.8 54.7 9.4 8 SD ±0.352 ±0.402 ±1.904 ±1.366 ±0.457

++ +- 13.2 5* 19 53.4 9.3 13 ±0.632 ±0.309 ±1.459 ±1.461 ±0.737 P 0.326 0.000 0.778 0.057 0.848 ++ -- 9.9 12.6 15.1 52 10.4 1

+- ++ 13.2 3.5 21.6* 52* 9.7 12 ±0.683 ±0.234 ±1.195 ±1.233 ±0.533 0.411 0.269 0.001 0.000 0.157 +- +- 12.9* 5.1* 20.9* 51.7* 9.4 23 ±0.627 ±0.324 ±1.636 ±1.280 ±0.549 0.023 0.000 0.006 0.000 0.747 +- -- 11.2* 11.1* 16.6* 51.1* 10.1* 6 ±0.879 ±1.340 ±0.501 ±0.874 ±0.575 0.000 0.000 0.020 0.000 0.021 -- ++ 12.9 3.3 27.4* 47.1* 9.2 5 ±0.687 ±0.375 ±2.812 ±1.712 ±0.870 0.084 0.186 0.000 0.000 0.684 -- +- 12.6* 5.1* 26* 47.1* 9.3 14 ±0.590 ±0.295 ±2.472 ±1.836 ±0.668 0.001 0.000 0.000 0.000 0.819 -- -- 10.9* 11.1* 21.9* 45.9* 10.1* 5 ±0.594 ±2.338 ±1.813 ±2.455 ±0.365 0.000 0.000 0.013 0.000 0.011

This population of F2 seed was grown over Winter 2014-2015 at Isabela, Puerto Rico. Data were obtained by seed chipping. Standard deviations are provided in italics. Two tail T-test significance at p = .05 denoted with *

Table 2.13 Composition of FAD3AW81STOP x SACPD-CY211C, Mayaguez 2015

FAD3A SACPD-C Pal (%) Ste (%) Ole (%) Lle (%) Lln (%) N ++ ++ 12.1 3.2 21.2 55.7 7.7 1

++ +- 11.6 5.2 21.2 53.5 8.4 9 CHAPTER 3. SD ±0.424 ±0.256 ±1.592 ±1.631 ±0.449 ++ -- 9.8 14.3 17.2 49.8 8.8 13 ±0.487 ±2.073 ±1.066 ±2.055 ±0.702 +- ++ 12.2 3.2 23.4 55.2 6.0 5 ±0.515 ±0.349 ±1.959 ±1.241 ±0.638 +- +- 11.8 5.3 22.6 54.2 6.2 23 ±0.480 ±0.393 ±2.343 ±1.915 ±0.537 +- -- 9.8 14.8 17.3 51.5 6.6 9 ±0.719 ±3.237 ±0.660 ±2.753 ±0.371 -- ++ 12.2 3.3 23.9 56.2 4.3 16 ±0.747 ±0.293 ±3.848 ±3.630 ±0.372 -- +- 11.6 5.1 22.4 56.4 4.4 8 ±0.424 ±0.165 ±1.629 ±1.551 ±0.358 -- -- 10.3 14.1 16.1 54.5 5.0 1

This population of F2 seed was grown over Winter 2014-2015 at Isabela, Puerto Rico. Data were obtained by seed chipping. Standard deviations are provided in italics. Lack of wild genotype population prevented T-test.

Table 2.14 Composition of FAD3CP267S x SACPD-CA218E, Greenhouse 2015

FAD3C SACPD-C Pal (%) Ste (%) Ole (%) Lle (%) Lln (%) N ++ ++ 11.4 3 24.1 53.4 8.1 5 SD ±0.653 ±0.230 ±3.347 ±2.744 ±0.658

++ +- 11.1 5* 22.1 53.6 8.2 11 ±0.332 ±0.346 ±3.209 ±2.545 ±0.950 P 0.144 0.000 0.286 0.860 0.824 ++ -- 9.1* 16.9* 18.2* 47.5* 8.3 6 ±0.656 ±2.742 ±3.082 ±4.557 ±0.652 0.000 0.000 0.014 0.034 0.592 +- ++ 11.4 3.3 23.5 54.6 7.3 12 ±0.682 ±0.284 ±3.210 ±2.525 ±0.847 0.987 0.105 0.723 0.391 0.066 +- +- 10.6* 5.1* 23.3 54 7* 20 ±0.591 ±0.365 ±3.863 ±3.279 ±0.541 0.014 0.000 0.690 0.709 0.001 +- -- 9.4* 15* 16.5* 51.2 7.8 10 ±0.765 ±1.824 ±2.213 ±2.580 ±0.865 0.000 0.000 0.000 0.159 0.527 -- ++ 10.9 3 26.9 53.5 5.7* 14 ±0.417 ±0.246 ±4.517 ±4.794 ±0.710 0.067 0.925 0.184 0.927 0.000 -- +- 11.1 5* 23.2 54.4 6.3* 11 ±0.534 ±0.816 ±4.517 ±4.794 ±0.710 0.305 0.000 0.856 0.852 0.001 -- -- 9.1* 14.6* 17.9* 51.6 6.7* 4 ±0.347 ±1.806 ±3.474 ±4.053 ±0.983 0.000 0.000 0.030 0.471 0.042

This population of F2 seed was grown over Winter 2014-2015 in the greenhouse. Data were obtained by seed chipping. Standard deviations are provided in italics. Two tail T-test significance at p = .05 denoted with *

* Figure 2.1 FAD2-1AW194STOP x SACPD-CA218E FA Composition Per Genotype

This population of F2:3 seed consisted of 35 individuals and was harvested from ACRE 2015.Data represents fatty acid composition in percentage of total composition, per genotype, for given cross. Significance is denoted at p = .05.

* Figure 2.2 FAD2-1AP284S x SACPD-CA218E FA Composition Per Genotype

This population of F3 seed consisted of 13 individuals and was harvested from ACRE 2015.Data represents fatty acid composition in percentage of total composition, per genotype, for given cross. Significance is denoted at p = .05.

* Figure 2.3 FAD2-1AL41F x SACPD-CA218E FA Composition Per Genotype

This population of F3 seed consisted of 14 individuals and was harvested from ACRE 2015.Data represents fatty acid composition in percentage of total composition, per genotype, for given cross. Significance is denoted at p = .05.

Figure 2.4 FAD3AW81STOP x SACPD-CY211C FA Composition Per Genotype

This population of F3 seed consisted of 16 individuals and was harvested from ACRE 2015.Data represents fatty acid composition in percentage of total composition, per genotype, for given cross. Significance is denoted at p = .05.

* Figure 2.5 FAD3CP267S x SACPD-CA218E FA Composition Per Genotype

This population of F3 seed consisted of 5 individuals and was harvested from ACRE 2015.Data represents fatty acid composition in percentage of total composition, per genotype, for given cross. No statistical tests were able to be performed due to population size.

Figure 2.6 Genotypic and Phenotypic Distribution of FAD2-1AL41F x SACPD-CA218E

This population of F2 seed was grown over Winter 2014-2015 at Isabela, Puerto Rico. Data were obtained by seed chipping.

Figure 2.7 Genotypic and Phenotypic Distribution of FAD3AW81STOP x SACPD-CY211C

This population of F2 seed was grown over Winter 2014-2015 at Isabela, Puerto Rico. Data were obtained by seed chipping.

Figure 2.8 Genotypic and Phenotypic Distribution of FAD3CP267S x SACPD-CA218E

This population of F2 seed was grown over Winter 2014-2015 in the greenhouse. Data were obtained by seed chipping. 47

CHAPTER 3. DISCUSSION

The data has demonstrated that the elevated oleic acid phenotype, conferred by a single mutation in FAD2-1A, does not translate into an elevated oleic acid phenotype in combination with a SACPD-C mutation. Even though our FAD2-1AW194STOP x SACPD-

* CA218E double mutant showed a significant increase in oleic acid, this gain was very small. Compared to the wild type genotype, the double mutant only gained an additional

3%. Compared to oleic levels we know are possible, and even compared to the single mutant genotype, this result is not strong enough to dispute current evidence against a high stearic and high oleic acid double mutant. Meanwhile, we found that the elevated stearic acid and low linolenic acid phenotypes both were significant in SACPD-C x FAD3 combinations. It is anticipated that by combining FAD2-1A and FAD2-1B mutations with a SACPD-C mutation will permit an elevated oleic acid phenotype in combination with high stearic acid levels. A combination of SACPD-C, FAD2-1A, and FAD2-1B previously resulted in a line with 12.7% stearic acid and 65% oleic acid (Ruddle II et al., 2013B).

According to this data, the SACPD-C mutant alone contains 11.5% stearic acid. In comparison, the enhanced SACPD-CA218E x Prize line has been observed to have stearic acid levels exceeding 21%. Several combinations generated with FAD2-1BP284S and

FAD2-1A mutant alleles used in this work resulted in fad double mutants with oleic acid content in the range of 70-80% (Sweeney et al., 2016). It may be possible that since our 48 line has a stronger SACPD-C mutation, that we may be able to combine FAD2-1B with our SACPD-C x FAD2-1A mutants and observe high stearic acid levels while additionally preserving a high oleic trait. In addition to a multiple FAD2-1 and SACPD-C combination, the addition of FAD3 mutations could further boost stearic and oleic levels.

Ruddle also reported that their gain in stearic acid was mostly at the expense of oleic acid

(r = -0.87). It may be that a mutation in FAD3 in addition to multiple FAD2 mutations could provide adequate oleic acid levels to compensate for the SACPD-C mutation.

In this project, no attempt was made to combine SAC mutations and mutations in the FATB gene. Instead of palmitic acid (16:0) being converted into stearic acid (18:0) by

KAS II, FATB is responsible for ending chain elongation, thus making palmitic acid a product. Thapa et al. (2016) demonstrates that a mutation in FATB1A decreased both palmitic and stearic acid. Because the pathway is sequential, the decrease in the supply of upstream fatty acids should decrease the production of downstream fatty acids. This is the same reasoning behind why it may be so difficult to carry a high stearic and high oleic phenotype synonymously, since oleic is immediately downstream of stearic. There is the possibility that by also enhancing either KAS III, KAS II or FATB, one may see increased palmitic acid and stearic acid respectively. However, for the scope of this project, none of our SNPs are responsible for the upregulation of downstream genes.

In a parallel approach, Park et al. (2014) used transgenes to successfully achieve a high stearic and oleic phenotype. However, high levels of oleic acid did not persist after five generations due to the loss ofFAD2 silencing. Potentially, a combined approach using point mutations to elevate oleic acid levels and transgenes to enhance stearic acid 49 production could resolve this issue. The mutations found in Thapa et al. (2014) provide oleic acid levels equivalent to those observe in FAD2-silenced plants.

In 2015 the FDA provided regulations for companies who wish to voluntarily label their products as containing or not containing GMO plants (U.S. FDA, 2015C).

Also in 2015 the FDA determined that the transgenic salmon, known as AquAdvantage salmon, was safe for human consumption (U.S. FDA, 2015B). There are countless consumer articles that fight for either side of the discussion for GMOs. In 2016 the U.S.

Senate proposed a bill to amend Agricultural Marketing Act of 1946 to account for the labeling of food containing genetically engineered ingredients (114th Congress, 2016).

With regulations getting more strict, only time will tell if GMOs will become more accepted by society. If we can manage to generate a line with a combination of high stearic, high oleic, and low polyunsaturated acids using conventional means, we can replace the need for a transgenic solution.

Because we are dealing with a genotyped and phenotyped F3 population, 2016 provided us with many more individuals for crossing than what was available in 2015. As well, it provides an additional year of data for the double mutant populations. Field 2016 will end with our double mutants being single plant harvested and analyzed again for FA composition data via GC and protein and oil levels via NIR. This will provide us with an additional year to compare how our phenotypic traits are maintained under different yearly conditions.

Stearic acid is thought to be influenced by temperatures. As temperature increases, stearic acid production also increases. It was found that in a high stearic acid sunflower line (CAS-14), that stearic production was maximized at 39/24℃ versus 50

30/20℃ for day and night temperatures. They observed 14.2% stearic acid levels for

30/20℃ and 36.9% at 39/24℃. At the highest temperatures, the control line, CAS-10, only achieved an average 7.5% stearic. However, they state that the temperatures must always be high in order for the mutant to achieve this phenotypic result (Fernández-Moya et al., 2002). The theory that stearic acid is influenced by temperatures has carried over

* into our own work. As previously mentioned, SACPD-CA218E has achieved over 21% stearic acid. While we are still testing the presence of an enhancer gene brought on by

Prize, we cannot rule out the possibility that the increased temperatures and drought stress observed in the 2012 growing season in Indiana may have affected stearic acid

* levels in the SACPD-CA218E line, because this line was first analyzed in 2012 (NWS,

2013). While we still attempt to determine the potential genetic cause of this phenotypic response, we are also attempting an environmental based study. Currently, we and the collaborators are performing a multi-location study on elevated stearic acid lines. For this study, each scientist’s top performing stearic lines were selected to be grown in multiple locations of Missouri, North Carolina, and Indiana. Included with this list is the SACPD-

C deleted A6 line and a Williams 82 control. These lines represent maturity groups from

0 to 5. The purpose of this study is to determine if factors involved with latitude

(recommended maturity group, temperature, weather conditions, etc.) have an impact on these lines. During this study, the dates for V3, R5, and R8 will be taken as described by

Fehr and Caviness (1977), as well as final height and lodging scores. At the end, the lines will be harvested and analyzed for oil composition and more. At the conclusion of the study, we hope to find additional information that may help determine the impact of environmental conditions, such as temperature, on stearic acid levels in soybean. 51

In 2015, double mutants were intercrossed to generate triple and quadruple mutants. Genotypic results obtained in 2016 have shown that some of these crosses were successful. With typical, unlinked Mendelian genetics, it is anticipated that only one out of sixty-four plants would have a triple mutant genotype in a segregating F2 population.

Additionally, only one out of two hundred fifty-six are expected to carry four mutations.

For the sake of comparing mutation influence, any heterozygous genotype resulted in the plant being excluded from further studies. As of now, genotypic data has shown that

* triple mutant combinations exist for [FAD3CP267S x SACPD-CA218E x (FAD2-1AP284S)],

[FAD2-1AL41F x FAD2-1BP284S x SACPD-CA218E)], [FAD2-1AP284S x FAD2-1BP284S x

* * SACPD-CA218E ], and [FAD2-1AW194STOP x SACPD-CA218E x FAD2-1BP284S]. Phenotypic data to support these genotypes is currently underway (data not shown). 52

CHAPTER 4. MATERIALS AND METHODS

4.1 Initial Mutagenesis

Initial mutagenesis was performed on Williams 82 seed using NMU (N-Nitroso-N- methylurea). M3 seed was screened for phenotypic changes. Various lines were selected from a total population of 7000 M3 lines on the basis of altered oil composition identified by GC screen. Information on this process is documented in Hudson (2012).

4.2 Germplasm Development

Parental lines were M4 or M5 generation descended from Williams 82 seed treated with

NMU. These lines were intercrossed to generate double mutants. The double mutant F1 plants were allowed to self-pollinate to generate F2 populations. F1 populations were

* grown in greenhouse except for FAD2-1AL41F x SACPD-CA218E and FAD3AW81STOP x

SACPD-CY211C which were grown in Puerto Rico. Seed was analyzed for composition either at the F2 stage, where single seed chips were genotyped and phenotyped, or the F2 plants were genotyped and allowed to self pollinate to produce the F2:3 seed that was analyzed in 5-seed bulks. If chipped, the seed was further grown in the greenhouse under the conditions listed. Each analysis consisted of F2 derived from a single F1 plant, however two F1 plants were represented in the field for each combination. The enhanced 53

* SACPD-CA218E used in crosses was an F3:4 derived from the cross SACPD-CA218E x Prize selected on the basis of the >20% stearic acid phenotype.

4.3 DNA Extraction

DNA was extracted using one of four methods. These methods include Edwards extractions, King extraction, Omega Bio-tek E.Z.N.A extraction (Omega Bio-tek,

Norcross, GA), or a CTAB extraction. The Edwards extractions (Edwards et al., 1991) were performed with no modifications. King extractions (King et al., 2014), which in themselves are a modification of the Edwards protocol, were further modified to resuspend the pellet in a final volume of 100µl of TE. The Omega Bio-tek E.Z.N.A. E-Z

96 Plant DNA Kit D1086-02 (Omega Bio-tek, Norcross, GA) extractions were performed on both seed and leaf tissue. DNA samples from leaf discs were eluted with two sequential elutions, 100µL for the first, and the second used 75µL of extraction buffer.

Seed chips were imbibed with 200µL of distilled water the day before and allowed to soften overnight. Seed chip DNA samples were eluted into two distinct samples using the same volumes as leaf tissue. CTAB extractions were performed according to Richards,

(2001) with multiple modifications. Once chloroform has been added, the samples are centrifuged for 10 minutes at 16,000 g. For nucleic acid precipitation, 120% of CTAB precipitation buffer was added. After isopropanol was added, samples were centrifuged for 20 minutes. 2 µL RNAse A was added and the samples are incubated at 37℃ for 1 hour. Solution was then transferred to a new tube and equal parts phenol/chloroform isoamyl alcohol are added. Aqueous fraction was extracted with the use of phase lock gel tubes (5 Prime GmbH, Max-Volmer-Str. 8, 40724 Hilden, Germany) and centrifuged for 54

5 minutes at 16,000 g. Top layer was transferred and an equal volume of chloroform isoamyl alcohol was added. Mixture was separated again with phase lock tubes. After isolating the aqueous layer, the DNA was precipitated with 0.6 volume isopropanol and centrifuged again for 20 minutes at 4℃. The pellet was then washed with 80% ethanol, allowed to dry, and then resuspended in 100 µL TE. DNA concentrations were checked using Thermo Scientific NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific,

Hanover Park, IL 60133).

4.4 PCR Programs

Two different programs were used for DNA amplification for SNP genotyping.

The first was used for amplicons of approximately 500 base pairs or higher. We used an initial denaturing temperature of 94℃ for 1 minute. A single cycle consisted of a 20 second 94℃ denaturing step, followed by a the lower annealing temperature listed in table2.1of the primer set for 20 seconds, and is finished by a 68℃ extension time for 4 minutes. This cycle is performed 5 times. It then moves to a similar cycle set that consists of a 95℃ denaturing temperature and uses the higher suggested temperature instead. This cycle is performed 25 times. There is then a 10 minute final extension time at 68℃, followed by a drop to 4℃ forever. The second program is for amplicons of smaller sizes

(less than approximately 500 base pairs). The differences between the two programs is that this shorter program has an initial denaturing temperature of 95℃ and each initial cycle denaturing phase is 94℃. Additionally, each extension time is only 1 minute long, excluding the final extension time of 3 minutes. Cycle numbers also vary, with the first cycle being performed a total of 7 times and the second a total of 28 times. 55

4.5 Gel Extraction

Amplified DNA for sequence screening was extracted from agarose gels using the

QIAquick Gel Extraction Kit (Qiagen, Valencia, CA). This procedure was done following the manufacturer's recommendations without modifications.

4.6 Genotyping

Each line produced was genotyped for each gene that was involved in the cross. These genes include KASII, SACPD, FAD2, and FAD3. For each mutation, either CAPS or dCAPS markers were developed and used for marker assisted selection and these are described in full in table 2.1. For each mutation, the sequence flanking the polymorphism was amplified via PCR using marker-specific primers (Table 2.1). After amplification, each marker was digested using restriction enzymes. Digestions were separated on agarose gels as specified in table 2.1. These gels were then imaged using the

FOTODYNEⓇ FOTO/Analyst FX (FOTODYNE Incorporated, Hartland, WI).

4.7 Greenhouse Genotyping and Seed Chipping

Seeds from an F2 population were selected and chipped for genotypic and phenotypic processing. The selected seeds were placed in six well plates and exposed to chlorine gas for twelve hours. Chips were taken from the endosperm end of the seed, avoiding the embryo. DNA extraction was done using modifications of the Omega Bio-tek E.Z.N.A extraction kit to account for seed tissue instead of leaf. GC data were performed using additional seed chips. After chipping, the seed was placed back in the well with 3 mL of sterile water and covered. The plates were placed in an incubator at full light for three 56 days at 25℃. After germination, the seedlings were placed in plastic trays containing sand and allowed to grow at 25℃ with an initial 16 hr photoperiod, changing to 12 hours to induce flowering and pod development. During this time, genotyping with the markers listed in table 2.1was done for each sample. Plants found to be positive for the desired genotype were transferred to large pots with soil and allowed to grow until seed was ready for harvest. The greenhouse was additionally used to grow F1 seed during off- season times. Leaf tissue was collected and extracted using the Edwards protocol

(Edwards et al., 1991). Genotypic results would determine if the cross was a success.

4.8 Sequencing

Amplification was performed by polymerase chain reaction (PCR). Temperatures used during the reaction were dependent on the developed primer’s G:C concentrations and suggested annealing temperatures are listed in table 2.1. After amplification was successful, the products were separated on either a .7%, 1%, or 3% agarose gel as shown.

If .7% or 1%, the gel was purely agarose LE and made with either TAE or TBE buffer.

Higher percentage gels (3%)were a mixture of 75% metaphor agarose and 25% agarose

LE in TBE buffer. Gel Red (RGB-4103, Phenix Research Products, Chandler, NC) was added for visualization. After gel solidification, the PCR product was mixed with a gel loading dye (50% glycerol, 10% 0.5M EDTA, and Orange G for color) and pipetted into the wells alongside a ladder of appropriate band sizes. For cycle sequencing, the

BigDye® Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Foster City,

CA) was used with a final reaction volume of 12.5 µL. Samples were concentrated using ethanol precipitation and resuspended in 15 µL or nuclease free water. The samples are 57 sequenced by low-throughput Sanger sequencing at the Purdue Genomics Core Facility.

Arbor, MI).

4.9 Gas Chromatography

Fatty acid composition was determined using Agilent Technologies 7890B GC with a

7693 Autosampler and aDB-23 column. The Fatty Acid Methyl Ester (FAME) GC program was used as described by Sigma-Aldrich (Sigma-Aldrich,2008). Samples were whole seed or seed chips. The extraction buffer consisted of 53% chloroform, 33% hexane, and 13% methanol. The methylating reagent is 28% ethyl ether, 57% petroleum ether, and 14% sodium methoxide. Extraction volume was 0.5mL for seed chips and for seed samples 1 ml per whole seed and .5 ml for every additional seed, of extraction buffer. Samples were extracted overnight. For seed chips, all of the extract is transferred to a new vial and 100 µL transferred for multi seed extractions. This is transferred to a new vial where 75 µL methylating reagent is added. Hexane is added to bring the volume up to 1 ml. Only biological replicates were tested.

4.10 West Lafayette Field Location

Field studies were performed at Purdue University’s Agronomy Center for Research &

Education (ACRE). The address for this location is: 4540 US-52, West Lafayette, IN

47906. The geographical coordinates are: 40° 28' 4.29'' N,86° 59' 28.40'' W.

4.11 Puerto Rico Field Location

Crops were occasionally grown at a Winter Nursery at Isabela Experimental Station in

Isabela, Puerto Rico. The address for this location is: CRR #2, KM 115, ISABELA, PR

00662. The geographical coordinates are: 18° 30' 11.97'' N,67° 1' 31.86'' W.

LIST OF REFERENCES

Articles:

Anai, T., T. Yamada, R. Hideshema, T. Kinoshita, S. Rahman, Y. Takagi.2008. Two high-oleic-acid soybean mutants, M23 and KK21, have disrupted microsomal omega- 6 fatty acid desaturase, encoded by GmFAD2-1a. Breeding Science 58:447-452. doi.org/10.1270/jsbbs.58.447

Anai, T., T. Hoshino, N. Imai, Y. Takagi. 2012. Molecular characterization of two high- palmitic-acid mutant loci induced by X-ray irradiation in soybean. Breeding Science 61: 631–638. doi:10.1270/jsbbs.61.631

Barker, G.C., T.R. Larson, I.A. Graham, J.R. Lynn, G.J. King. 2007. Novel Insights into Seed Fatty Acid Synthesis and Modification Pathways from Genetic Diversity and Quantitative Trait Loci Analysis of the Brassica C Genome. Plant Physiology Vol. 144, pp. 1827–1842, doi:10.1104/pp.107.096172

Bilyeu, K.D., L. Palavalli, D.A. Sleper, P.R. Beuselinck. 2003. Three Microsomal Omega-3 Fatty-acid Desaturase Genes Contribute to Soybean Linolenic Acid Levels. Crop Sci. 43:1833-1838. doi:10.2135/cropsci2003.1833

Bilyeu, K., J. Gillman, A.R. LeRoy. 2011. Novel FAD3 Mutant Allele Combinations Produce Soybeans Containing 1% Linolenic Acid in the Seed Oil. Crop Sci. 51:259- 264.doi:10.2135/cropsci2010.01.0044

Boersma, J.G., J.D. Gillman, K.D. Bilyeu, G.R. Ablett, C. Grainger, I. Rajcan. 2012. New Mutations in a Delta-9-Stearoyl-Acyl Carrier Protein Desaturase Gene Associated with Enhanced Stearic Acid Levels in Soybean Seed. Crop Sci. 52:1736- 1742. doi:10.2135/cropsci2011.08.0411

Byfield, G.E., H. Xue, R.G. Upchurch. 2006. Two Genes from Soybean Encoding Soluble Δ9 Stearoyl-ACP Desaturases. Crop Sci. 46:840-846. doi:10.2135/cropsci2005.06-0172

Cardinal, A.J., J.W. Burton, A.M. Camacho-Roger, J.H. Yang, R.F. Wilson, R.E. Dewey. 2007. Molecular Analysis of Soybean Lines with Low Palmitic Acid Content in the Seed Oil. Crop Sci. 47:304-310. doi:10.2135/cropsci2006.04.0272 60

Carrero-Colón, M., N. Abshire, D. Sweeney, E. Gaskin, K. Hudson. 2014. Mutations in SACPD-C Result in a Range of Elevated Stearic Acid Concentration in Soybean Seed. PLOS One doi.org/10.1371/journal.pone.0097891

Chan, J., V.M. Bruce, B.E. McDonald. 1991. Dietary a-linolenic acid is as effective as oleic acid and linoleic acid in lowering blood cholesterol in normolipidemic men. Am. J. Clin. Nutr.53:1230-1234

Clemente, T.E., E.B. Cahoon. 2009. Soybean Oil: Genetic Approaches for Modification of Functionality and Total Content. Plant Physiology 151:1030-1040. doi:10.1104/pp.l09.146282

Edwards, K., C. Johnstone, C. Thompson. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research Vol. 19 no. 6

Fehr, W.R., C.E. Caviness. 1977. Stages of Soybean Development. Ag. and Home Econ. Exper. Station. Special Report 80. CODEN:IWSRBC (80) 1-12 (1977)

Fernández-Moya, V., E. Martínez-Force, R. Garcés. 2002. Temperature effect on a high stearic acid sunflower mutant. Phytochemistry 59:33–37.doi.org/10.1016/S0031- 9422(01)00406-X

Gillman, J.D., M.G. Stacey, Y. Cui, H.R. Berg, G. Stacey. 2014A. Deletions of the SACPD-C locus elevate seed stearic acid levels but also result in fatty acid and morphological alterations in nitrogen fixing nodules. BMC Plant Biology 14:143. doi:10.1186/1471-2229-14-143

Gillman, J.D., A. Tetlow, K. Hagely, J.G. Boersma, A. Cardinal, K. Bilyeu. 2014B. Identification of the molecular genetic basis of the low palmitic acid seed oil trait in soybean mutant line RG3 and association analysis of molecular markers with elevated seed stearic acid and reduced seed palmitic acid. Mol Breeding 34:447–455. doi: 10.1007/s11032-014-0046-y

Hammond, E.G., W.R. Fehr. 1983. REGISTRATION OF A5 GERMPLASM LINE OF SOYBEAN. Crop Sci. 23:192-192. doi:10.2135/cropsci1983.0011183X002300010085x

Hawkins, D.J., J.C. Kridl. 1998. Characterization of acyl-ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola. The Plant Journal 13(6):743–752 doi:10.1046/j.1365- 313X.1998.00073.x

Hawkins, S.E., W.R. Fehr, E.G. Hammond. 1983. Resource Allocation in Breeding for Fatty Acid Composition of Soybean Oil. Crop Sci. 23:900-904. doi:10.2135/cropsci1983.0011183X002300050021x

Head, K., T. Galos, Y. Fang, K. Hudson. 2012. Mutations in the soybean 3-ketoacyl-ACP synthase gene are correlated with high levels of seed palmitic acid. Mol. Breeding 30:1519–1523doi: 10.1007/s11032-012-9707-x

Heppard, E.P., A.J. Kinney, K.L. Stecca, G. Miao. 1996. Developmental and Growth Temperature Regulation of Two Different Microsomal ɷ-6 Desaturase Genes in Soybeans. Plant Physiol. 110:311-319. doi.org/10.1104/pp.110.1.311

Huang, A.H.C. 1996. Oil Bodies and Oleosins in Seeds. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43:177-200. doi:10.1146/annurev.pp.43.060192.001141

Hudson, K. 2012. Soybean Oil-Quality Variants Identified by Large-Scale Mutagenesis. International Journal of Agronomy Vol. 2012, Article ID 569817, 7 pages doi:10.1155/2012/569817

Huskey, L., H.E. Snyder, E.E. Gbur. 1990. Analysis of Single Soybean Seeds for Oil and Protein. JAOCS Vol. 67, no 10

Hymowitz, T., N. Kaizuma.1981. Soybean Seed Protein Electrophoresis Profiles from 15 Asian Countries or Regions: Hypotheses on Paths of Dissemination of Soybeans from China. Economic Botany, 35(1), pp. 10-23

Kachroo, A., D. Fu, W. Havens, D. Navarre, P. Kachroo, S.A. Ghabrial. 2008. An Oleic Acid–Mediated Pathway Induces Constitutive Defense Signaling and Enhanced Resistance to Multiple Pathogens in Soybean. MPMI 21:564-575.doi:10.1094/ MPMI -21-5-0564

King, Z., J. Serrano, H.R. Boerma, Z. Li. 2014. Non-toxic and efficient DNA extractions for soybean leaf and seed chips for high-throughput and large-scale genotyping. Biotechnol. Lett. 36:1875–1879.doi:10.1007/s10529-014-1548-8

Mensink, R.P. 2005. Effects of Stearic Acid on Plasma Lipid and Lipoproteins in Humans. Lipids 40:1201-1205.doi:10.1007/s11745-005-1486-x

Odia, O., S. Ofori, O. Maduka. 2015.Palm oil and the heart: A review. World J. Cardiol. 7(3): 144-149. doi:10.4330/wjc.v7.i3.144

Ohlrogge, J., J. Browse. 1995. Lipid Biosynthesis. The Plant Cell Vol. 7 no. 7.Pp. 957- 970.doi: 10.2307/3870050

Orsavova, J., L. Misurcova, J.V. Ambrozova, R. Vicha, J. Mlcek. 2015. Fatty Acids Composition of Vegetable Oils and Its Contribution to Dietary Energy Intake and Dependence of Cardiovascular Mortality on Dietary Intake of Fatty Acids. Int. J. Mol. Sci. 16:12871-12890. doi:10.3390/ijms160612871

Pantalone, V.R., R.F. Wilson, W.P. Novitzky, J.W. Burton. 2002. Genetic Regulation of Elevated Stearic Acid Concentration in Soybean Oil. JAOCS Vol. 79 no. 6

Park, H., G. Graef, Y. Xu, P. Tenopir, T.E. Clemente. 2014. Stacking of a stearoyl-ACP thioesterase with a dual-silenced palmitoyl-ACP thioesterase and Δ12 fatty acid desaturase in transgenic soybean. Plant Biotechnology Journal 12:1035-1043. doi: 10.1111/pbi.12209

Pham, A.T., J.D. Lee, J.G. Shannon, K.D. Bilyeu. 2010.Mutant alleles of FAD2-1A and FAD2-1B combine to produce soybeans with the high oleic acid seed oil trait. BMC Plant Biology 10:195. doi:10.1186/1471-2229-10-195

Richards, E., M. Reichardt, S. Rogers. 2001. Preparation of genomic DNA from plant tissue. Curr. Protoc. Mol. Biol. Chapter 2 Unit 2.3. doi:10.1002/0471142727.mb0203s27

Ruddle II, P., R. Whetten, A. Cardinal, R.G. Upchurch, L. Miranda. 2013A. Effect of a novel mutation in a D9-stearoyl-ACP-desaturase on soybean seed oil composition. Theor. Appl. Genet. 126:241-249. doi:10.1007/s00122-012-1977-5

Ruddle II, P., R. Whetten, A. Cardinal, R.G. Upchurch, L. Miranda. 2013B. Effect of Δ9‐stearoyl‐ACP‐desaturase‐C mutants in a high oleic background on soybean seed oil composition. Theor. Appl. Genet. 127:349–358 doi:10.1007/s00122-013-2223-5

Ruddle II, P., A. Cardinal, R.G. Upchurch, C. Arellano, L. Miranda. 2013C. Agronomic Effects of Mutations in Two Soybean Δ9–Stearoyl-Acyl Carrier Protein-Desaturases. Crop Sci. 53:1187-1893. doi:10.2135/cropsci2013.02.0120

Schmutz J., S.B. Cannon, J. Schlueter, J. Ma, T. Mitros, W. Nelson, …, S.A. Jackson. 2010. Genome sequence of the paleopolyploid soybean. Nature 464:178-183. doi:10.1038/nature08670

Shanklin, J. E.B. Cahoon. 1998. Desaturation and related modifications of fatty acids. Annu. Rev. Plant. Physiol. Plant Mol. Biol. 49:611-641

Sweeney, D., M. Carrero-Colón, K. Hudson. 2016. Characterization of new allelic combinations for high oleic soybeans. Crop Science. in press.

Thapa, R., M. Carrero-Colón, M. Crowe, E. Gaskin, K. Hudson. 2015. Novel FAD2–1A Alleles Confer an Elevated Oleic Acid Phenotype in Soybean Seeds. Crop Sci. 56:1-6. doi:10.2135/cropsci2015.06.0339

Thapa, R., M. Carrero-Colón, C. Addo-quaye, Y. Fang, J. Held, B. Dilkes, K. Hudson. In Preparation (2016). New alleles of FAD3A confer reduced linolenic acid to soybean seeds.

Thijssen, M.A., R.P. Mensink. 2005. Small differences in the effects of stearic acid, oleic acid, and linoleic acid on the serum lipoprotein profile of humans. Am J Clin. Nutr. 82:-510-516

Tinahones, F.J., Gomez-Zumaquero, A. Monzon, G. Rojo-Martinez, A. Pareja, S. Morcillo, F. Cardona, G. Olveira, F. Soriguer. 2004. Dietary palmitic acid influences LDL-mediated lymphocyte proliferation differently to other mono- and polyunsaturated fatty acids in rats. Diab. Nutr. Metab. 17:250-258

Voelker, T., A. Kinney. 2001. VARIATIONS IN THE BIOSYNTHESIS OF SEED- STORAGE LIPIDS. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52:335–61. doi:10.1146/annurev.arplant.52.1.335

Zhang, P., J.W. Burton, R.G. Upchurch, E. Whittle, J. Shanklin, R.E. Dewey. 2008. Mutations in a Δ9–Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds. Crop Sci. 48:2305-2313. doi: 10.2135/cropsci2008.02.0084

Books:

Buchanan B.B., W. Gruissem, R.L. Jones. 2015. Biochemistry & Molecular Biology of Plants. Second Edition. The Atrium, Southern Gate, Chichester, West Sussex (UK): John Wiley &Sons. (1264).

Johnson, L.A., P.J. White, R. Galloway. 2008. Soybeans Chemistry, Production Processing, and Utilization. Urbana (IL):AOCS Press. (842).

Lodish, H., A. Berk, C.A. Kaiser, M. Krieger, M.P. Scott, A. Bretscher, H. Ploegh, P. Matsudaira. 2008. Molecular Cell Biology. Sixth Edition. Houndmills, Basingstoke, RG21 6Xs, England: W. H. Freeman and Company. (1150).

Windish, L.G. 1981. The Soybean Pioneers Trailblazers… Crusaders… Missionaries. Henry, IL. M&D Printing.

Websites:

114th Congress 2D Session. 2016. Bill S. 764. Available from http://www.agriculture.senate.gov/imo/media/doc/Ag%20biotech%20co mpromise%20proposal.pdf

Biosafety Clearing-House. 2013. Modified Organism DP-3Ø5423-1 - TREUS™ Plenish™ Soybean. Available from http://bch.cbd.int/database/record.shtml?documentid=49073

Biosafety Clearing-House. 2014. Modified Organism MON-877Ø5-6 - Vistive Gold™ Soybean. Available from http://bch.cbd.int/database/record.shtml?documentid= 104683

Dupont Pioneer. 2014. Plenish: Oil Profile. Available from http://www.plenish.com/food/nutritional_profile.aspx

EPA. 2016. Chemical Data Access Tool (CDAT): Octadecanoic Acid. Available from https://java.epa.gov/oppt_chemical_search/

Monsanto Company. 2016.Vistive Gold High Oleic Soybeans. Available from http://www.vistivegold.com/About

National Toxicology Program. Unknown. SUMMARY OF DATA FOR CHEMICAL SELECTION Methyl Soyate 67784-80-9. Available from https://ntp.niehs.nih.gov/ntp/htdocs/chem_background/exsumpdf/ methylsoyate_508.pdf

National Weather Service. 2013. 2012 Year in Review: A look back at the year in weather across Northern Indiana, Southwest Lower Michigan and Northwest Ohio. Available from https://www.weather.gov/iwx/2012_review

NIH. 2016. Stearic Acid. Available from https://pubchem.ncbi.nlm.nih.gov/compound/stearic_acid#section=Industry-Uses

Sigma-Aldrich. 2008. Fatty Acid/FAME Application Guide Analysis of Foods for Nutritional Needs. Available from: sigma-aldrich.com/fame

United Soybean Board. 2013. Your United Soybean Board (USB). Available from http://unitedsoybean.org/about-usb/

United Soybean Board. 2015. USB Action Plan FY2016. Available from http://unitedsoybean.org/wp-content/uploads/52610_final_FY16_ActionPlan.pdf

USDA-Economic Research Service. 2016. Table 5--Soybean oil: Supply, disappearance, and price, U.S., 1980/81-2015/16. Available from http://www.ers.usda.gov/data- products/oil-crops-yearbook.aspx#56958

USDA-National Agricultural Statistics Service. 2016. Crop Production 2015 Summary January2016. Available from http://usda.mannlib.cornell.edu/usda/current/ CropProdSu/CropProdSu-01-12-2016.pdf

U.S. Department of Health & Human Services. 2016. Household Products Database: Stearic acid. Available from https://householdproducts.nlm.nih.gov/cgibin/household/ brands?tbl=chem&id=76

U.S. Food and Drug Administration. 2015A. FDA Cuts Tans Fat in Processed Foods. Available from http://www.fda.gov/downloads/ForConsumers/ConsumerUpdates/ UCM451467.pdf

U.S. Food and Drug Administration. 2015B. FDA Has Determined That the AquAdvantage Salmon is as Safe to Eat as Non-GE Salmon. Available from http://www.fda.gov/ForConsumers/ConsumerUpdates/ucm472487.htm

U.S. Food and Drug Administration. 2015C. Guidance for Industry: Voluntary Labeling Indicating Whether Foods Have or Have Not Been Derived from Genetically Engineered Plants. Available fromhttp://www.fda.gov/Food/GuidanceRegulation/ GuidanceDocumentsRegulatoryInformation/LabelingNutrition/ucm059098.htm