DOCSLIB.ORG

Modeling and Searching for Non-Coding RNA

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Modeling and Searching for Non-Coding RNA Modeling and Searching for Non-Coding RNA W.L. Ruzzo http://www.cs.washington.edu/homes/ruzzo Outline • Why RNA? • Examples of RNA biology • Computational Challenges – Modeling – Search – Inference The “Central Dogma” DNA RNA Protein gene Protein DNA (chromosome) RNA (messenger) cell “Classical” RNAs • mRNA • tRNA • rRNA • snRNA (small nuclear - spli cing) • snoRNA (small nucleolar - guides for t/rRNA modifications) • RNAseP (tRNA maturation; ribozyme in bacteria) • SRP (signal recognition particle; co-translational targeting of proteins to membranes) • telomerases Non-coding RNA • Messenger RNA - codes for proteins • Non-coding RNA - all the rest – Before, say, mid 1990’s, 1-2 dozen known (critically important, but narrow roles: e.g. tRNA) • Since mid 90’s dramatic discoveries – Regulation, transport, stability/degradation – E.g. “microRNA”: ≈ 100’s in humans • By some estimates, ncRNA >> mRNA RNA Secondary Structure: RNA makes helices too U C A A Base pairs G C C G A A U G C U A C G C G A U G C A A CA AU RNA on the Rise • In humans – more RNA- than DNA-binding proteins? – much more conserved DNA than coding – MUCH more transcribed DNA than coding • In bacteria – regulation of MANY genes involves RNA – dozens of classes & thousands of new examples in just last 5 years Human Predictions • Evofold – S Pedersen, G Bejerano, A Siepel, K Rosenbloom, K Lindblad-Toh, ES Lander, J Kent, W Miller, D Haussler, "Identification and classification of conserved RNA secondary structures in the human genome." PLoS Comput. Biol., 2, #4 (2006) e33. – 48,479 candidates (~70% FDR?) • RNAz – S Washietl, IL Hofacker, M Lukasser, A H殳 tenhofer, PF Stadler, "Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome." Nat. Biotechnol., 23, #11 (2005) 1383- 90. – 30,000 structured RNA elements – 1,000 conserved across all vertebrates. – ~1/3 in introns of known genes, ~1/6 in UTRs – ~1/2 located far from any known gene • FOLDALIGN – E Torarinsson, M Sawera, JH Havgaard, M Fredholm, J Gorodkin, "Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure." Genome Res., 16, #7 (2006) 885-9. – 1800 candidates from 36970 (of 100,000) pairs • CMfinder – unpublished – 6500 candidates in ENCODE alone (again high FDR) Fastest Human Gene? Origin of Life? Life needs information carrier: DNA molecular machines, like enzymes: Protein making proteins needs DNA + RNA + proteins making (duplicating) DNA needs proteins Horrible circularities! How could it have arisen in an abiotic environment? Origin of Life? RNA can carry information too (RNA double helix) RNA can form complex structures RNA enzymes exist (ribozymes) The “RNA world” hypothesis: 1st life was RNA-based ncRNA Example: Xist • large (12kb?) • unstructured RNA • required for X-inactivation in mammals ncRNA Example: 6S • medium size (175nt) • structured • highly expressed in e. coli in certain growth conditions • sequenced in 1971; function unknown for 30 years 6S mimics an open promoter E.coli Barrick et al. RNA 2005 Trotochaud et al. NSMB 2005 Willkomm et al. NAR 2005 ncRNA Example: IRE Iron Response Element: a short conserved stem- loop, bound by iron response proteins (IRPs). Found in UTRs of various mRNAs whose products are involved in iron metabolism. E.g., the mRNA of ferritin (an iron storage protein) contains one IRE in its 5' UTR. When iron concentration is low, IRPs bind the ferritin mRNA IRE. repressing translation. Binding of multiple IREs in the 3' and 5' UTRs of the transferrin receptor (involved in iron acquisition) leads to increased mRNA stability. These two activities form the basis of iron homeostasis in the vertebrate cell. Iron Response Element IRE (partial seed alignment): Hom.sap. GUUCCUGCUUCAACAGUGUUUGGAUGGAAC Hom.sap. UUUCUUC.UUCAACAGUGUUUGGAUGGAAC Hom.sap. UUUCCUGUUUCAACAGUGCUUGGA.GGAAC Hom.sap. UUUAUC..AGUGACAGAGUUCACU.AUAAA Hom.sap. UCUCUUGCUUCAACAGUGUUUGGAUGGAAC Hom.sap. AUUAUC..GGGAACAGUGUUUCCC.AUAAU Hom.sap. UCUUGC..UUCAACAGUGUUUGGACGGAAG Hom.sap. UGUAUC..GGAGACAGUGAUCUCC.AUAUG Hom.sap. AUUAUC..GGAAGCAGUGCCUUCC.AUAAU Cav.por. UCUCCUGCUUCAACAGUGCUUGGACGGAGC Mus.mus. UAUAUC..GGAGACAGUGAUCUCC.AUAUG Mus.mus. UUUCCUGCUUCAACAGUGCUUGAACGGAAC Mus.mus. GUACUUGCUUCAACAGUGUUUGAACGGAAC Rat.nor. UAUAUC..GGAGACAGUGACCUCC.AUAUG Rat.nor. UAUCUUGCUUCAACAGUGUUUGGACGGAAC SS_cons <<<<<...<<<<<......>>>>>.>>>>> ncRNA Example: MicroRNAs • short (~22 nt) unstructured RNAs excised from ~75nt precursor hairpin • approx antisense to mRNA targets, often in 3’ UTR • regulate gene activity, e.g. by destabilizing (plants) or otherwise suppressing (animals) message • several hundred, w/ perhaps thousands of targets, are known ncRNA Example: T-boxes ncRNA Example: Riboswitches • UTR structure that directly senses/binds small molecules & regulates mRNA • widespread in prokaryotes • some in eukaryotes Gene Regulation: The MET Repressor SAM Protein Alberts, et al, 3e. DNA . e 3 The , l a t e protein , s t r e b way l A Riboswitch alternatives (2 of 4 shown) Corbino et al., Genome Biol. 2005 Example: Glycine Regulation • How is glycine level regulated? • Plausible answer: g gce protein g g g TF g TF glycine cleavage enzyme gene DNA transcription factors (proteins) bind to DNA to turn nearby genes on or off The Glycine Riboswitch • Actual answer (in many bacteria): gce protein g g g g 5′ 3′ gce mRNA glycine cleavage enzyme gene DNA Mandal et al. Science 2004 Why? • RNA’s fold, and function • Nature uses what works Impact of RNA homology search (Barrick, et al., 2004) glycine riboswitch operon B. subtilis L. innocua A. tumefaciens V. cholera M. tuberculosis (and 19 more species) Impact of RNA homology search (Barrick, et al., 2004) Using our glycine techniques, we riboswitch operon found… B. subtilis L. innocua A. tumefaciens V. cholera M. tuberculosis (and 19 more species) (and 42 more species) RNA Informatics • RNA: Not just a messenger anymore – Dramatic discoveries – Hundreds of families (besides classics like tRNA, rRNA, snRNA…) – Widespread, important roles • Computational tools important – Discovery, characterization, annotation – BUT: slow, inaccurate, demanding Q: What’s so hard? A A G A A A A A A U G C G U U C U C A C G C G C U C U G A G G C A A G G G G U A G C C G G A G C U C G C C A A G A G G G A A G G A G A A G G A C C C A C U G U A C U C C C G A A A A A GG C G U C A A C A A A U A A G A G A C G G A U U A C U C U U U C U C U G G G U U C G C G A C G G G U G C C G A G A G C U U C G A A A U U G U A C C G U U G U G U A G G C G A: Structure often more important than sequence Computational Challenges • Search - given • CM-based search related RNA’s, find more • Modeling - describe • Hand-curated a related family alignments -> CMs • Meta-modeling - • Covariance Models what’s a good modeling framework? Predict Structure from Multiple Sequences … GA … UC … Compensatory … GA … UC … mutations reveal … GA … UC … structure, but in … CA … UG … usual alignment algorithms they are … CC … GG … doubly penalized. … UA … UA … How to model an RNA “Motif”? • Conceptually, start with a profile HMM: – from a multiple alignment, estimate nucleotide/ insert/delete preferences for each position – given a new seq, estimate likelihood that it could be generated by the model, & align it to the model mostly G del ins all G How to model an RNA “Motif”? • Covariance Models (aka “profile SCFG”) – Probabilistic models, like profile HMMs, but adding “column pairs” and pair emission probabilities for base-paired regions <<<<<<< >>>>>>> … p a ire d c o lu m n s … “RNA sequence analysis using covariance models” Eddy & Durbin Nucleic Acids Research, 1994 vol 22 #11, 2079-2088 What • A probabilistic model for RNA families – The “Covariance Model” – ≈ A Stochastic Context-Free Grammar – A generalization of a profile HMM • Algorithms for Training – From aligned or unaligned sequences – Automates “comparative analysis” – Complements Nusinov/Zucker RNA folding • Algorithms for searching Main Results • Very accurate search for tRNA – (Precursor to tRNAscanSE - current favorite) • Given sufficient data, model construction comparable to, but not quite as good as, human experts • Some quantitative info on importance of pseudoknots and other tertiary features Probabilistic Model Search • As with HMMs, given a sequence, you calculate llikelihood ratio that the model could generate the sequence, vs a background model • You set a score threshold • Anything above threshold => a “hit” • Scoring: – “Forward” / “Inside” algorithm - sum over all paths – Viterbi approximation - find single best path (Bonus: alignment & structure prediction) Example: searching for tRNAs Alignment Quality Comparison to TRNASCAN • Fichant & Burks - best heuristic then a i t r – 97.5% true positive n e t e i r – 0.37 false positives per MB r e c f f i n d • CM A1415 (trained on trusted alignment) o i t y l a – > 99.98% true positives t u h l g a – <0.2 false positives per MB i l v • Current method-of-choice is “tRNAscanSE”, a CM- S e based scan with heuristic pre-filtering (including TRNASCAN?) for performance reasons. CM Structure • A: Sequence + structure • B: the CM “guide tree” • C: probabilities of letters/ pairs & of indels • Think of each branch being an HMM emitting both sides of a helix (but 3’ side emitted in reverse order) Overall CM Architecture • One box (“node”) per node of guide tree • BEG/MATL/INS/DEL just like an HMM • MATP & BIF are the key additions: MATP emits pairs of symbols, modeling base-pairs; BIF allows multiple helices CM Viterbi Alignment th xi = i letter of input xij = substring i,..., j of input Tyz = P(transition y " z) ! E y P(emission of x ,x from state y) xi ,x j = i j y Sij = max# logP(xij generated starting in state y via path #) ! Viterbi, cont.
Load more

Recommended publications
  • Guanine Riboswitch Variants from Mesoplasma Florum Selectively Recognize 2؅-Deoxyguanosine
    Guanine riboswitch variants from Mesoplasma florum selectively recognize 2؅-deoxyguanosine Jane N. Kim†, Adam Roth‡, and Ronald R. Breaker†‡§¶ †Department of Molecular, Cellular, and Developmental Biology, §Department of Molecular Biophysics and Biochemistry, and ‡Howard Hughes Medical Institute, Yale University, P.O. Box 208103, New Haven, CT 06520-8103 Edited by Jeffrey W. Roberts, Cornell University, Ithaca, NY, and approved August 21, 2007 (received for review June 22, 2007) Several mRNA aptamers have been identified in Mesoplasma florum witch aptamers for the modified nucleobase 7-aminomethyl-7- that have sequence and structural features resembling those of deazaguanine have been identified that require as few as 34 guanine and adenine riboswitches. Two features distinguish these nucleotides to form a selective and high-affinity binding pocket RNAs from established purine-sensing riboswitches. All possess short- (31). Moreover, there are three classes of aptamers for S- ened hairpin-loop sequences expected to alter tertiary contacts adenosylmethionine (SAM) (23, 24, 32) whose representatives are known to be critical for aptamer folding. The RNAs also carry nucle- more rare in bacteria than the SAM-I class of riboswitches com- otide changes in the core of each aptamer that otherwise is strictly monly found in Gram-positive bacteria (33–35). These findings conserved in guanine and adenine riboswitches. Some aptamers indicate that a far greater diversity of metabolite-sensing ribos- retain the ability to selectively bind guanine or adenine despite these witches exists that might be difficult for existing search strategies to mutations. However, one variant type exhibits selective and high- definitively identify and classify. affinity binding of 2؅-deoxyguanosine, which is consistent with its One possibility is that some organisms will have recently evolved occurrence in the 5؅ untranslated region of an operon containing riboswitch classes with aptamers that are unique in architecture or ribonucleotide reductase genes.
    [Show full text]
  • Developing a Riboswitch-Mediated Regulatory System for Metabolic Flux Control in Thermophilic Bacillus Methanolicus
    International Journal of Molecular Sciences Article Developing a Riboswitch-Mediated Regulatory System for Metabolic Flux Control in Thermophilic Bacillus methanolicus Marta Irla , Sigrid Hakvåg and Trygve Brautaset * Department of Biotechnology and Food Sciences, Norwegian University of Science and Technology, 7034 Trondheim, Norway; [email protected] (M.I.); [email protected] (S.H.) * Correspondence: [email protected]; Tel.: +47-73593315 Abstract: Genome-wide transcriptomic data obtained in RNA-seq experiments can serve as a re- liable source for identification of novel regulatory elements such as riboswitches and promoters. Riboswitches are parts of the 50 untranslated region of mRNA molecules that can specifically bind various metabolites and control gene expression. For that reason, they have become an attractive tool for engineering biological systems, especially for the regulation of metabolic fluxes in industrial microorganisms. Promoters in the genomes of prokaryotes are located upstream of transcription start sites and their sequences are easily identifiable based on the primary transcriptome data. Bacillus methanolicus MGA3 is a candidate for use as an industrial workhorse in methanol-based biopro- cesses and its metabolism has been studied in systems biology approaches in recent years, including transcriptome characterization through RNA-seq. Here, we identify a putative lysine riboswitch in B. methanolicus, and test and characterize it. We also select and experimentally verify 10 putative B. methanolicus-derived promoters differing in their predicted strength and present their functionality in combination with the lysine riboswitch. We further explore the potential of a B. subtilis-derived purine riboswitch for regulation of gene expression in the thermophilic B. methanolicus, establishing a Citation: Irla, M.; Hakvåg, S.; novel tool for inducible gene expression in this bacterium.
    [Show full text]
  • Global Genomic Approaches to the Iron-Regulated Proteome
    Available online at www.annclinlabsci.org 230 Annals of Clinical & Laboratory Science, vol. 35, no. 3, 2005 Overview: Global Genomic Approaches to the Iron-Regulated Proteome Ying Liu, Zvezdana Popovich, and Douglas M. Templeton Department of Laboratory Medicine and Pathobiology, University of Toronto,Toronto, Canada Abstract. Iron interacts with cells to regulate the proteome through complex effects on gene expression. In simple organisms such as bacteria and yeast, intra- and extra-cellular iron influences gene expression through defined signal transduction pathways. In higher organisms, effects are probably mediated at the transcriptional level through secondary effects of reactive oxygen species, while post-transcriptional effects operate through well-defined pathways involving iron-regulatory proteins. To investigate the impact of iron levels on gene expression and the proteome, approaches such as differential display and subtractive hybridization have the advantage of surveying the entire geneome. However, they are technically demanding and have given way to microarray techniques. To date, numerous microarray experiments with various organisms have not yielded any definitive picture of the role of iron. Common themes throughout such studies are that both iron excess and iron depletion influence expression of proteins related to energy metabolism, cell proliferation, matrix structure, and the metabolism of iron itself. That no consistent set of genes is involved from one study to the next probably results both from the uncertainties inherent in the technique and the biological variability of the systems under study. We briefly describe two types of iron-dependent microarray experiments from our laboratory to examine major cellular targets of iron toxicity. Using Affymetrix oligonucleotide arrays with cardiac cells, we found several hundred genes whose mRNA levels were affected by iron, including an increase in several genes responding to oxidative stress and a decrease in several kinases and phosphatases.
    [Show full text]
  • An Internal Residue Mimicking the Purine Ligand Vanessa Delfosse1, Patricia Bouchard1, Eric Bonneau1, Pierre Dagenais1, Jean-Franc¸ Ois Lemay2, Daniel A
    Published online 18 December 2009 Nucleic Acids Research, 2010, Vol. 38, No. 6 2057–2068 doi:10.1093/nar/gkp1080 Riboswitch structure: an internal residue mimicking the purine ligand Vanessa Delfosse1, Patricia Bouchard1, Eric Bonneau1, Pierre Dagenais1, Jean-Franc¸ ois Lemay2, Daniel A. Lafontaine2,* and Pascale Legault1,* 1De´ partement de Biochimie, Universite´ de Montre´ al, C.P. 6128, Succursale Centre-Ville, Montre´ al, Que´ bec, H3C 3J7 and 2Groupe ARN/RNA Group, De´ partement de Biologie, Faculte´ des Sciences, Universite´ de Sherbrooke, Sherbrooke, Que´ bec, J1K 2R1, Canada Received September 16, 2009; Revised November 3, 2009; Accepted November 4, 2009 ABSTRACT modulate gene expression in response to the concentration level of their cognate ligand (1–3). They are positioned The adenine and guanine riboswitches regulate in the 50-UTR of bacterial mRNA and are composed of gene expression in response to their purine ligand. two overlapping domains: a purine-binding aptamer X-ray structures of the aptamer moiety of these domain and a downstream expression platform. Binding riboswitches are characterized by a compact fold of the ligand stabilizes the formation of a compact in which the ligand forms a Watson–Crick base aptamer structure, which prevents the formation of pair with residue 65. Phylogenetic analyses an alternate structure and thereby modulates gene revealed a strict restriction at position 39 of the expression. aptamer that prevents the G39–C65 and A39–U65 Depending on the expression platform composition, combinations, and mutational studies indicate that gene expression control takes place at the levels of tran- aptamers with these sequence combinations are scription or translation, and ligand binding, either posi- tively or negatively, regulates gene expression (1–3).
    [Show full text]
  • Iron Regulatory Protein 2 Exerts Its Oncogenic Activities by Suppressing Tap63 Expression Yanhong Zhang1, Xiuli Feng1,2, Jin Zhang1, and Xinbin Chen1
    Published OnlineFirst April 10, 2020; DOI: 10.1158/1541-7786.MCR-19-1104 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS Iron Regulatory Protein 2 Exerts its Oncogenic Activities by Suppressing TAp63 Expression Yanhong Zhang1, Xiuli Feng1,2, Jin Zhang1, and Xinbin Chen1 ABSTRACT ◥ Iron regulatory protein 2 (IRP2) is a key regulator of iron To determine the biological significance of this regulation, we homeostasis and is found to be altered in several types of human showed that IRP2 facilitates cell proliferation, at least in part, via cancer. However, how IRP2 contributes to tumorigenesis repressing TAp63 expression. Moreover, we found that IRP2 remains to be elucidated. In this study, we sought to investigate deficiency markedly alleviated cellular senescence in TAp63- the role of IRP2 in tumorigenesis and found that IRP2 promotes deficient mouse embryo fibroblasts. Together, we have uncovered cell growth by repressing TAp63, a member of p53 tumor a novel regulation of TAp63 by IRP2 and our data suggest that suppressor family. Specifically, we found that IRP2 overexpres- IRP2 exerts its oncogenic activities at least in part by repressing sion decreased, whereas IRP2 deficiency increased, TAp63 TAp63 expression. expression. We also showed that the repression of TAp63 by IRP2 was independent of tumor suppressor p53. To uncover the Implications: We have revealed a novel regulation of TAp63 by molecular basis, we found that IRP2 stabilized TAp63 mRNA by IRP2 and our data suggest that IRP2 exerts its oncogenic activities, binding to an iron response element in the 30UTR of p63 mRNA. at least in part, by repressing TAp63 expression. Introduction erythropoietic abnormalities and dysregulation of body iron metab- olism (19, 20).
    [Show full text]
  • Bioinformatic Analysis of Riboswitch Structures Uncovers Variant Classes
    Bioinformatic analysis of riboswitch structures PNAS PLUS uncovers variant classes with altered ligand specificity Zasha Weinberga,1,2, James W. Nelsonb,1,3, Christina E. Lünseb,4, Madeline E. Sherlockc, and Ronald R. Breakera,b,c,5 aHoward Hughes Medical Institute, Yale University, New Haven, CT 06520; bDepartment of Molecular, Cellular and Developmental Biology, Yale University, New Haven, CT 06520; and cDepartment of Molecular Biophysics and Biochemistry, Yale University, New Haven, CT 06520 Contributed by Ronald R. Breaker, February 2, 2017 (sent for review December 8, 2016; reviewed by Robert T. Batey and Elena Rivas) Riboswitches are RNAs that form complex, folded structures that Several variant riboswitches share a number of characteristics selectively bind small molecules or ions. As with certain groups of that could have been exploited in a bioinformatic search for such protein enzymes and receptors, some riboswitch classes have RNAs. We chose to apply three important properties common to evolved to change their ligand specificity. We developed a pro- the guanine/adenine (15) and c-di-GMP-I/c-AMP-GMP (13, 14) cedure to systematically analyze known riboswitch classes to find riboswitch sets, among other variants. The first of these proper- additional variants that have altered their ligand specificity. This ties is that some variant riboswitches with altered ligand speci- approach uses multiple-sequence alignments, atomic-resolution ficity will remain somewhat close in both sequence and structure structural information, and riboswitch gene associations. Among to the predominant or “parent” class. For example, the initial the discoveries are unique variants of the guanine riboswitch class collections of representatives for guanine (23) and c-di-GMP-I ′ that most tightly bind the nucleoside 2 -deoxyguanosine.
    [Show full text]
  • Synthetic Ligands for Preq1 Riboswitches Provide Structural and Mechanistic Insights Into Targeting RNA Tertiary Structure
    ARTICLE https://doi.org/10.1038/s41467-019-09493-3 OPEN Synthetic ligands for PreQ1 riboswitches provide structural and mechanistic insights into targeting RNA tertiary structure Colleen M. Connelly1, Tomoyuki Numata2,3, Robert E. Boer1, Michelle H. Moon1, Ranu S. Sinniah1, Joseph J. Barchi1, Adrian R. Ferré-D’Amaré 2 & John S. Schneekloth Jr. 1 1234567890():,; Riboswitches are naturally occurring RNA aptamers that regulate gene expression by binding to specific small molecules. Riboswitches control the expression of essential bacterial genes and are important models for RNA-small molecule recognition. Here, we report the discovery of a class of synthetic small molecules that bind to PreQ1 riboswitch aptamers. These molecules bind specifically and reversibly to the aptamers with high affinity and induce a conformational change. Furthermore, the ligands modulate riboswitch activity through tran- scriptional termination despite no obvious chemical similarity to the cognate ligand. X-ray crystallographic studies reveal that the ligands share a binding site with the cognate ligand but make different contacts. Finally, alteration of the chemical structure of the ligand causes changes in the mode of RNA binding and affects regulatory function. Thus, target- and structure-based approaches can be used to identify and understand the mechanism of synthetic ligands that bind to and regulate complex, folded RNAs. 1 Chemical Biology Laboratory, National Cancer Institute, Frederick, MD 21701, USA. 2 Biochemistry and Biophysics Center, National Heart, Lung and Blood Institute, Bethesda, MD 20892, USA. 3 Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8566, Japan. These authors contributed equally: Colleen M.
    [Show full text]
  • Loss of Conserved Noncoding Rnas in Genomes of Bacterial Endosymbionts
    GBE Loss of Conserved Noncoding RNAs in Genomes of Bacterial Endosymbionts Dorota Matelska1, Malgorzata Kurkowska1, Elzbieta Purta1, Janusz M. Bujnicki1,2,*and Stanislaw Dunin-Horkawicz1,* 1Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology, Warsaw, Poland 2Laboratory of Structural Bioinformatics, Institute of Molecular Biology and Biotechnology, Adam Mickiewicz University, Poznan, Poland *Corresponding author: E-mail: [email protected]; [email protected]. Accepted: January 11, 2016 Abstract The genomes of intracellular symbiotic or pathogenic bacteria, such as of Buchnera, Mycoplasma,andRickettsia, are typically smaller compared with their free-living counterparts. Here we showed that noncoding RNA (ncRNA) families, which are conserved in free- living bacteria, frequently could not be detected by computational methods in the small genomes. Statistical tests demonstrated that their absence is not an artifact of low GC content or small deletions in these small genomes, and thus it was indicative of an independent loss of ncRNAs in different endosymbiotic lineages. By analyzing the synteny (conservation of gene order) between the reduced and nonreduced genomes, we revealed instances of protein-coding genes that were preserved in the reduced genomes but lost cis-regulatory elements. We found that the loss of cis-regulatory ncRNA sequences, which regulate the expression of cognate protein-coding genes, is characterized by the reduction of secondary structure formation propensity, GC content, and length of the corresponding genomic regions. Key words: endosymbionts, noncoding RNA loss, covariance models, Rfam. Introduction The length of fully sequenced bacterial genomes ranges from 2001), and chromosomes undergo rearrangements (Belda 110 kb (Bennett and Moran 2013)to15Mb(Han et al.
    [Show full text]
  • Core Requirements of the Adenine Riboswitch Aptamer for Ligand Binding
    JOBNAME: RNA 13#3 2007 PAGE: 1 OUTPUT: Wednesday February 7 07:09:20 2007 csh/RNA/131630/rna1420 Downloaded from rnajournal.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Core requirements of the adenine riboswitch aptamer for ligand binding JEAN-FRANCxOIS LEMAY and DANIEL A. LAFONTAINE De´partement de biologie, Faculte´ des sciences, Universite´ de Sherbrooke, Que´bec, J1K 2R1, Canada ABSTRACT The adenine riboswitch aptamer, the A box, positively regulates gene expression upon adenine binding. To provide insight into structure–function relationships, important for the adenine riboswitch aptamer, we have created alignments for six aptamer sequences that reveal the core requirements. In addition, 2-aminopurine (2AP) binding studies have been used to test the consensus sequence derived from the alignment. Overall, the consensus secondary structure is consistent with 2AP binding studies. However, a position in the core, previously identified as variable, shows restriction in nucleotide sequence. Further- more, this restriction is found to be related with the ligand specificity of the riboswitch. The implications of this relationship for the riboswitch gene regulation mechanism are discussed. Keywords: riboswitch; RNA structure; RNA folding; aptamer; molecular recognition; fluorescence spectroscopy INTRODUCTION 2003), glucosamine-6-phosphate (Winkler et al. 2004), glycine (Mandal et al. 2004), lysine (Grundy et al. 2003; Riboswitches are regulatory elements found predominantly Sudarsan et al. 2003b), intracellular magnesium (Cromie in 59-untranslated regions of messenger RNAs (mRNAs). et al. 2006), S-adenosylmethionine (Epshtein et al. 2003; These genetic switches are highly structured domains that McDaniel et al. 2003; Winkler et al. 2003), and thiamine can bind cellular metabolites and regulate the expression of pyrophosphate (Mironov et al.
    [Show full text]
  • Gene Expression Control by Bacillus Anthracis Purine Riboswitches
    Downloaded from rnajournal.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Kirchner and Schneider 1 Gene expression control by Bacillus anthracis purine riboswitches Marion Kirchner* and Sabine Schneider* Center for Integrated Protein Science at the Department of Chemistry Technische Universität München, Lichtenbergstrasse 4, 85748 Garching, Germany * To whom correspondence should be addressed. Tel: +49 89 289 13336; Fax: +49 89 289 13363; Email: [email protected]; [email protected] Running Title: Purine riboswitches of Bacillus anthracis Keywords (max 6): purine riboswitches, Bacillus anthracis, purine biosynthesis, nucleobase salvage, nucleotide metabolism ABSTRACT In all kingdoms of life, cellular replication relies on the presence of nucleosides and nucleotides, the building blocks of nucleic acids and the main source of energy. In bacteria, the availability of metabolites sometimes directly regulates the expression of enzymes and proteins involved in purine salvage, biosynthesis and uptake through riboswitches. Riboswitches are located in bacterial mRNAs and can control gene expression by conformational changes in response to ligand binding. We have established an inverse reporter gene system in Bacillus subtilis that allows us to monitor riboswitch-controlled gene expression. We used it to investigate the activity of five potential purine riboswitches from B. anthracis in response to different purines and pyrimidines. Furthermore, in vitro studies on the aptamer domains of the riboswitches reveal their variation in guanine binding affinity ranging from nM to µM. These data do not only provide insight into metabolite sensing but can also aid to engineer artificial cell regulatory systems. Downloaded from rnajournal.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Kirchner and Schneider 2 INTRODUCTION Riboswitches are structural elements in the 5’ untranslated region of mRNAs, which consist of an aptamer domain and an expression platform (Fig.
    [Show full text]
  • Ferritin L-Subunit Gene Mutation and Hereditary Hyperferritinaemia Cataract Syndrome: a Case Report and Literature Review
    Ferritin L-subunit Gene Mutation and Hereditary Hyperferritinaemia Cataract Syndrome: A Case Report and Literature Review Yunfan Yang Sichuan University West China Hospital Ting Lin Sichuan University West China Hospital Xincuan Chen ( [email protected] ) Sichuan University West China Hospital https://orcid.org/0000-0001-9292-9623 Case Report Keywords: L-Ferritin, cataract, gene, mutation Posted Date: March 9th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-290096/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/16 Abstract Background: Hereditary hyperferritinaemia cataract syndrome (HHCS) is an autosomal dominant disease characterized by high serum ferritin levels and juvenile bilateral cataracts. It is often caused by mutations in the Iron Response Element (IRE) of the ferritin L-subunit (FTL) gene. Most of the mutations are point mutations located in the upper stem and the conserved hexanucleotide of the hairpin structure of IRE, only a few mutations are deletions. Case presentation: Here we report a 73-year-old woman who presented to clinic with persistently elevated serum ferritin and family history of juvenile bilateral cataracts in four generations. DNA sequencing analyses identied a heterozygous c.-167C>T mutation in the 5’ untranslated region (UTR) of the FTL gene. Her daughter and granddaughter were also conrmed to have the same genetic mutation. Conclusion: HHCS should be considered in the differential diagnosis of hyperferritinemia, especially in the presence of normal serum iron concentration and transferrin saturation. For patients with unexplained hyperferritinemia and bilateral cataracts who have experienced early vision loss, the establishment of genetic counseling is essential to diagnose other family members who are at risk in time, so as to avoid unnecessary liver biopsy and venesection.
    [Show full text]
  • Hypoxia Pathway Proteins Are Master Regulators of Erythropoiesis
    International Journal of Molecular Sciences Review Hypoxia Pathway Proteins are Master Regulators of Erythropoiesis Deepika Watts 1, Diana Gaete 1 , Diego Rodriguez 1, David Hoogewijs 2, Martina Rauner 3, Sundary Sormendi 1 and Ben Wielockx 1,* 1 Institute of Clinical Chemistry and Laboratory Medicine, Technische Universität Dresden, 01307 Dresden, Germany; [email protected] (D.W.); [email protected] (D.G.); [email protected] (D.R.); [email protected] (S.S.) 2 Section of Medicine, Department of Endocrinology, Metabolism and Cardiovascular System, University of Fribourg, 1700 Fribourg, Switzerland; [email protected] 3 Department of Medicine III and Center for Healthy Aging, Technische Universität Dresden, 01307 Dresden, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-351-458-16260 Received: 3 October 2020; Accepted: 28 October 2020; Published: 30 October 2020 Abstract: Erythropoiesis is a complex process driving the production of red blood cells. During homeostasis, adult erythropoiesis takes place in the bone marrow and is tightly controlled by erythropoietin (EPO), a central hormone mainly produced in renal EPO-producing cells. The expression of EPO is strictly regulated by local changes in oxygen partial pressure (pO2) as under-deprived oxygen (hypoxia); the transcription factor hypoxia-inducible factor-2 induces EPO. However, erythropoiesis regulation extends beyond the well-established hypoxia-inducible factor (HIF)–EPO axis and involves processes modulated by other hypoxia pathway proteins (HPPs), including proteins involved in iron metabolism. The importance of a number of these factors is evident as their altered expression has been associated with various anemia-related disorders, including chronic kidney disease.
    [Show full text]