DOCSLIB.ORG

Noncoding RNA Slides

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Noncoding RNA Slides ncRNA: Interest extensive noncoding sequence conservation Modeling and Searching even more extensive transcription for Non-Coding RNA “invisible” structural conservation? many RNA binding proteins W.L. Ruzzo examples: microRNAs, riboswitches http://www.cs.washington.edu/homes/ruzzo Bottom line: important regulatory roles Outline Why RNA? Examples of RNA biology Computational Challenges Modeling Fig. 2. The arrows show the situation as it seemed in 1958. Solid arrows represent Search probable transfers, dotted arrows possible transfers. The absent arrows (compare Fig. 1) Inference represent the impossible transfers postulated by the central dogma. They are the three possible arrows starting from protein. 1 RNA Secondary Structure: The “Central Dogma” RNA makes helices too DNA RNA Protein U C A A Base pairs G C C G Protein A gene A U G C U A DNA C G C G A U (chromosome) RNA G C A (messenger) CA A A cell U “Classical” RNAs Non-coding RNA mRNA Messenger RNA - codes for proteins tRNA Non-coding RNA - all the rest rRNA Before, say, mid 1990’s, 1-2 dozen known (critically snRNA (small nuclear - spl icing) important, but narrow roles: e.g. tRNA) snoRNA (small nucleolar - guides for t/rRNA modifications) Since mid 90’s dramatic discoveries RNAseP (tRNA maturation; ribozyme in bacteria) Regulation, transport, stability/degradation SRP (signal recognition particle; co-translational E.g. “microRNA”: ≈ 100’s in humans targeting of proteins to membranes) By some estimates, ncRNA >> mRNA telomerases 2 Bacteria Triumph of proteins 80% of genome is coding DNA Functionally diverse receptors motors catalysts regulators (Monod & Jakob, Nobel prize 1965) … . e 3 Gene Regulation: The MET Repressor , l a t e The , Riboswitch s t r e protein b l alternative A way SAM SAM Grundy & Henkin, Mol. Microbiol 1998 Epshtein, et al., PNAS 2003 Winkler et al., Nat. Struct. Biol. 2003 Protein Alberts, et al, 3e. DNA 3 . e e 3 3 , , l l a a t t e The e The , Riboswitch , Riboswitch s s t t r r e protein e protein b b l alternatives l alternatives A way A way SAM-II SAM-III SAM-I SAM-I SAM-II Fuchs et al., Corbino et al., NSMB 2006 Genome Biol. 2005 Grundy, Epshtein, Winkler Grundy, Epshtein, Winkler Corbino et al., et al., 1998, 2003 et al., 1998, 2003 Genome Biol. 2005 . e 3 , l a t e The , Riboswitch s t r e protein b l alternatives A way Widespread, deeply conserved, structurally boxed = confirmed sophisticated, functionally diverse, biologicariblloyswitch SAM-III important uses for ncRNA throughout (+2 more) SAM-I SAM-II SAM-IV prokaryotic world. Grundy, Epshtein, Winkler Corbino et al., Fuchs et al., Weinberg et al., et al., 1998, 2003 Genome Biol. 2005 NSMB 2006 RNA 2008 Weinberg, et al. Nucl. Acids Res., July 2007 35: 4809-4819. 4 RNA on the Rise Human Predictions In humans Evofold more RNA- than DNA-binding proteins? S Pedersen, G Bejerano, A Siepel, K Rosenbloom, much more conserved DNA than coding K Lindblad-Toh, ES Lander, J Kent, W Miller, D Haussler, "Identification and classification of MUCH more transcribed DNA than coding conserved RNA secondary structures in the In bacteria human genome." PLoS Comput. Biol., 2, #4 regulation of M ANY genes involves RNA (2006) e33. dozens of classes & thousands of new 48,479 candidates (~70% FDR?) examples in just last 5 years RNAz FOLDALIGN S Washietl, IL Hofacker, M Lukasser, A Hutenhofer, E Torarinsson, M Sawera, JH Havgaard, M PF Stadler, "Mapping of conserved RNA secondary structures predicts thousands of functional Fredholm, J Gorodkin, "Thousands of noncoding RNAs in the human genome." Nat. corresponding human and mouse genomic Biotechnol., 23, #11 (2005) 1383-90. regions unalignable in primary sequence 30,000 structured RNA elements contain common RNA structure." Genome 1,000 conserved across all vertebrates. Res., 16, #7 (2006) 885-9. ~1/3 in introns of known genes, ~1/6 in UTRs 1800 candidates from 36970 (of 100,000) ~1/2 located far from any known gene pairs 5 Fastest Human CMfinder Torarinsson, Yao, Wiklund, Bramsen, Gene? Hansen, Kjems, Tommerup, Ruzzo and Gorodkin. Comparative genomics beyond sequence based alignments: RNA structures in the ENCODE regions. Genome Research, Feb 2008, 18(2):242-251 PMID: 18096747 6500 candidates in ENCODE alone (better FDR, but still high) Origin of Life? Origin of Life? RNA can carry information too (RNA double helix) Life needs RNA can form complex structures information carrier: DNA RNA enzymes exist (ribozymes) molecular machines, like enzymes: Protein making proteins needs DNA + RNA + proteins The “RNA world” hypothesis: making (duplicating) DNA needs proteins 1st life was RNA-based Horrible circularities! How could it have arisen in an abiotic environment? Some extant RNAs are relicts of that origin; some are “modern” inventionsrel 6 ncRNA Example: Xist ncRNA Example: 6S large (12kb?) medium size (175nt) largely unstructured RNA structured required for X-inactivation in mammals highly expressed in E. coli in certain growth conditions sequenced in 1971; function unknown for 30 years 6S mimics an open promoter ncRNA Example: IRE Iron Response Element: a short conserved stem- loop, bound by iron response proteins (IRPs). Found in UTRs of various mRNAs whose products are involved in iron metabolism. E.g., the mRNA of ferritin (an iron storage protein) contains one IRE in its 5' UTR. When iron concentration is low, IRPs bind the ferritin mRNA IRE, repressing translation. Binding of multiple IREs in the 3' and 5' UTRs of the transferrin receptor (involved in iron acquisition) leads to increased mRNA E.coli stability. These two activities form the basis of iron homeostasis in the vertebrate cell. Barrick et al. RNA 2005 Trotochaud et al. NSMB 2005 Willkomm et al. NAR 2005 7 Iron Response Element ncRNA Example: MicroRNAs IRE (partial seed alignment): short (~22 nt) unstructured RNAs excised from Hom.sap. GUUCCUGCUUCAACAGUGUUUGGAUGGAAC Hom.sap. UUUCUUC.UUCAACAGUGUUUGGAUGGAAC ~75nt precursor hairpin Hom.sap. UUUCCUGUUUCAACAGUGCUUGGA.GGAAC approx antisense to mRNA targets, often in 3’ UTR Hom.sap. UUUAUC..AGUGACAGAGUUCACU.AUAAA Hom.sap. UCUCUUGCUUCAACAGUGUUUGGAUGGAAC regulate gene activity, e.g. by destabilizing (plants) Hom.sap. AUUAUC..GGGAACAGUGUUUCCC.AUAAU Hom.sap. UCUUGC..UUCAACAGUGUUUGGACGGAAG or otherwise suppressing (animals) message Hom.sap. UGUAUC..GGAGACAGUGAUCUCC.AUAUG Hom.sap. AUUAUC..GGAAGCAGUGCCUUCC.AUAAU hundreds and growing, each w/ perhaps 10x Cav.por. UCUCCUGCUUCAACAGUGCUUGGACGGAGC targets Mus.mus. UAUAUC..GGAGACAGUGAUCUCC.AUAUG Mus.mus. UUUCCUGCUUCAACAGUGCUUGAACGGAAC Some conserved human to worm; Mus.mus. GUACUUGCUUCAACAGUGUUUGAACGGAAC Rat.nor. UAUAUC..GGAGACAGUGACCUCC.AUAUG others evolving rapidly Rat.nor. UAUCUUGCUUCAACAGUGUUUGGACGGAAC SS_cons <<<<<...<<<<<......>>>>>.>>>>> ncRNA Example: T-boxes ncRNA Example: Riboswitches • UTR structure that directly senses/binds small molecules & regulates mRNA • widespread in prokaryotes • some in eukaryotes 8 Example: Glycine Regulation The Glycine Riboswitch • How is glycine level regulated? • Actual answer (in many bacteria): • Plausible answer: gce g gce protein protein g g g g g g g 5′ 3′ TF g gce mRNA TF glycine cleavage enzyme gene DNA glycine cleavage enzyme gene DNA transcription factors (proteins) bind to DNA to turn nearby genes on or off Mandal et al. Science 2004 (Mandal, Lee, Barrick, Weinberg, Emilsson, Ruzzo, Breaker, Science 2004) 5’ gcvT ORF 3’ And… Fig. 3. Cooperative binding of two glycine molecules by the VC I-II RNA. Plot depicts the • More examples means better alignment fraction of VC II (open) and VC I-II (solid) bound to ligand versus the concentration of glycine. • Understand phylogenetic distribution The constant, n, is the Hill coefficient for the lines as indicated that best fit the aggregate data from four different regions (fig. S3). Shaded boxes demark the dynamic range (DR) of glycine • Find riboswitch in front of new gene concentrations needed by the RNAs to progress from 10%- to 90%-bound states. 9 Riboswitches Why? • ~ 20 ligands known; multiple nonhomologous • RNA’s fold, solutions for some and function • dozens to hundreds of instances of each • TPP known in archaea & eukaryotes • on/off; transcription/translation; splicing; • Nature uses combinatorial control what works • In some bacteria, more riboregulators identified than protein TFs • all found since ~2003 Outline Homology search • ncRNA: what/why? Sequence-based • What does computation bring? – Smith-Waterman – FASTA • How to model and search for ncRNA? – BLAST • Faster search • Better model inference Sharp decline in sensitivity at ~60-70% identity So, use structure, too 10 Impact of RNA homology search (Barrick, et al., 2004) Structure Prediction glycine riboswitch operon • Xray crystalography, NMR, etc B. subtilis • Comparative modeling L. innocua – Alignment & compensatory substitutions A. tumefaciens • Single-sequence Folding V. cholera – mfold, mccaskill, vienna… – est 50-70% accurate up to 200-300 nt M. tuberculosis • Multiple sequence alignment/folding (and 19 more species) Impact of RNA homology search (Barrick, et al., 2004) Using our glycine techniques, we RNA Informatics riboswitch operon found… B. subtilis • RNA: Not just a messenger anymore L. innocua – Dramatic discoveries – Hundreds of families (besides classics like A. tumefaciens tRNA, rRNA, snRNA…) – Widespread, important roles V. cholera • Computational tools important M. tuberculosis – Discovery, characterization, annotation (and 19 more species) (and 42 more species) – BUT: slow, inaccurate, demanding 11 Q: What’s so hard? A A G A A A
Load more

Recommended publications
  • Modeling and Searching for Non-Coding RNA
    Modeling and Searching for Non-Coding RNA W.L. Ruzzo http://www.cs.washington.edu/homes/ruzzo Outline • Why RNA? • Examples of RNA biology • Computational Challenges – Modeling – Search – Inference The “Central Dogma” DNA RNA Protein gene Protein DNA (chromosome) RNA (messenger) cell “Classical” RNAs • mRNA • tRNA • rRNA • snRNA (small nuclear - spli cing) • snoRNA (small nucleolar - guides for t/rRNA modifications) • RNAseP (tRNA maturation; ribozyme in bacteria) • SRP (signal recognition particle; co-translational targeting of proteins to membranes) • telomerases Non-coding RNA • Messenger RNA - codes for proteins • Non-coding RNA - all the rest – Before, say, mid 1990’s, 1-2 dozen known (critically important, but narrow roles: e.g. tRNA) • Since mid 90’s dramatic discoveries – Regulation, transport, stability/degradation – E.g. “microRNA”: ≈ 100’s in humans • By some estimates, ncRNA >> mRNA RNA Secondary Structure: RNA makes helices too U C A A Base pairs G C C G A A U G C U A C G C G A U G C A A CA AU RNA on the Rise • In humans – more RNA- than DNA-binding proteins? – much more conserved DNA than coding – MUCH more transcribed DNA than coding • In bacteria – regulation of MANY genes involves RNA – dozens of classes & thousands of new examples in just last 5 years Human Predictions • Evofold – S Pedersen, G Bejerano, A Siepel, K Rosenbloom, K Lindblad-Toh, ES Lander, J Kent, W Miller, D Haussler, "Identification and classification of conserved RNA secondary structures in the human genome." PLoS Comput. Biol., 2, #4 (2006) e33. – 48,479 candidates (~70% FDR?) • RNAz – S Washietl, IL Hofacker, M Lukasser, A H殳 tenhofer, PF Stadler, "Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome." Nat.
    [Show full text]
  • Global Genomic Approaches to the Iron-Regulated Proteome
    Available online at www.annclinlabsci.org 230 Annals of Clinical & Laboratory Science, vol. 35, no. 3, 2005 Overview: Global Genomic Approaches to the Iron-Regulated Proteome Ying Liu, Zvezdana Popovich, and Douglas M. Templeton Department of Laboratory Medicine and Pathobiology, University of Toronto,Toronto, Canada Abstract. Iron interacts with cells to regulate the proteome through complex effects on gene expression. In simple organisms such as bacteria and yeast, intra- and extra-cellular iron influences gene expression through defined signal transduction pathways. In higher organisms, effects are probably mediated at the transcriptional level through secondary effects of reactive oxygen species, while post-transcriptional effects operate through well-defined pathways involving iron-regulatory proteins. To investigate the impact of iron levels on gene expression and the proteome, approaches such as differential display and subtractive hybridization have the advantage of surveying the entire geneome. However, they are technically demanding and have given way to microarray techniques. To date, numerous microarray experiments with various organisms have not yielded any definitive picture of the role of iron. Common themes throughout such studies are that both iron excess and iron depletion influence expression of proteins related to energy metabolism, cell proliferation, matrix structure, and the metabolism of iron itself. That no consistent set of genes is involved from one study to the next probably results both from the uncertainties inherent in the technique and the biological variability of the systems under study. We briefly describe two types of iron-dependent microarray experiments from our laboratory to examine major cellular targets of iron toxicity. Using Affymetrix oligonucleotide arrays with cardiac cells, we found several hundred genes whose mRNA levels were affected by iron, including an increase in several genes responding to oxidative stress and a decrease in several kinases and phosphatases.
    [Show full text]
  • Iron Regulatory Protein 2 Exerts Its Oncogenic Activities by Suppressing Tap63 Expression Yanhong Zhang1, Xiuli Feng1,2, Jin Zhang1, and Xinbin Chen1
    Published OnlineFirst April 10, 2020; DOI: 10.1158/1541-7786.MCR-19-1104 MOLECULAR CANCER RESEARCH | CANCER GENES AND NETWORKS Iron Regulatory Protein 2 Exerts its Oncogenic Activities by Suppressing TAp63 Expression Yanhong Zhang1, Xiuli Feng1,2, Jin Zhang1, and Xinbin Chen1 ABSTRACT ◥ Iron regulatory protein 2 (IRP2) is a key regulator of iron To determine the biological significance of this regulation, we homeostasis and is found to be altered in several types of human showed that IRP2 facilitates cell proliferation, at least in part, via cancer. However, how IRP2 contributes to tumorigenesis repressing TAp63 expression. Moreover, we found that IRP2 remains to be elucidated. In this study, we sought to investigate deficiency markedly alleviated cellular senescence in TAp63- the role of IRP2 in tumorigenesis and found that IRP2 promotes deficient mouse embryo fibroblasts. Together, we have uncovered cell growth by repressing TAp63, a member of p53 tumor a novel regulation of TAp63 by IRP2 and our data suggest that suppressor family. Specifically, we found that IRP2 overexpres- IRP2 exerts its oncogenic activities at least in part by repressing sion decreased, whereas IRP2 deficiency increased, TAp63 TAp63 expression. expression. We also showed that the repression of TAp63 by IRP2 was independent of tumor suppressor p53. To uncover the Implications: We have revealed a novel regulation of TAp63 by molecular basis, we found that IRP2 stabilized TAp63 mRNA by IRP2 and our data suggest that IRP2 exerts its oncogenic activities, binding to an iron response element in the 30UTR of p63 mRNA. at least in part, by repressing TAp63 expression. Introduction erythropoietic abnormalities and dysregulation of body iron metab- olism (19, 20).
    [Show full text]
  • Ferritin L-Subunit Gene Mutation and Hereditary Hyperferritinaemia Cataract Syndrome: a Case Report and Literature Review
    Ferritin L-subunit Gene Mutation and Hereditary Hyperferritinaemia Cataract Syndrome: A Case Report and Literature Review Yunfan Yang Sichuan University West China Hospital Ting Lin Sichuan University West China Hospital Xincuan Chen ( [email protected] ) Sichuan University West China Hospital https://orcid.org/0000-0001-9292-9623 Case Report Keywords: L-Ferritin, cataract, gene, mutation Posted Date: March 9th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-290096/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/16 Abstract Background: Hereditary hyperferritinaemia cataract syndrome (HHCS) is an autosomal dominant disease characterized by high serum ferritin levels and juvenile bilateral cataracts. It is often caused by mutations in the Iron Response Element (IRE) of the ferritin L-subunit (FTL) gene. Most of the mutations are point mutations located in the upper stem and the conserved hexanucleotide of the hairpin structure of IRE, only a few mutations are deletions. Case presentation: Here we report a 73-year-old woman who presented to clinic with persistently elevated serum ferritin and family history of juvenile bilateral cataracts in four generations. DNA sequencing analyses identied a heterozygous c.-167C>T mutation in the 5’ untranslated region (UTR) of the FTL gene. Her daughter and granddaughter were also conrmed to have the same genetic mutation. Conclusion: HHCS should be considered in the differential diagnosis of hyperferritinemia, especially in the presence of normal serum iron concentration and transferrin saturation. For patients with unexplained hyperferritinemia and bilateral cataracts who have experienced early vision loss, the establishment of genetic counseling is essential to diagnose other family members who are at risk in time, so as to avoid unnecessary liver biopsy and venesection.
    [Show full text]
  • Hypoxia Pathway Proteins Are Master Regulators of Erythropoiesis
    International Journal of Molecular Sciences Review Hypoxia Pathway Proteins are Master Regulators of Erythropoiesis Deepika Watts 1, Diana Gaete 1 , Diego Rodriguez 1, David Hoogewijs 2, Martina Rauner 3, Sundary Sormendi 1 and Ben Wielockx 1,* 1 Institute of Clinical Chemistry and Laboratory Medicine, Technische Universität Dresden, 01307 Dresden, Germany; [email protected] (D.W.); [email protected] (D.G.); [email protected] (D.R.); [email protected] (S.S.) 2 Section of Medicine, Department of Endocrinology, Metabolism and Cardiovascular System, University of Fribourg, 1700 Fribourg, Switzerland; [email protected] 3 Department of Medicine III and Center for Healthy Aging, Technische Universität Dresden, 01307 Dresden, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-351-458-16260 Received: 3 October 2020; Accepted: 28 October 2020; Published: 30 October 2020 Abstract: Erythropoiesis is a complex process driving the production of red blood cells. During homeostasis, adult erythropoiesis takes place in the bone marrow and is tightly controlled by erythropoietin (EPO), a central hormone mainly produced in renal EPO-producing cells. The expression of EPO is strictly regulated by local changes in oxygen partial pressure (pO2) as under-deprived oxygen (hypoxia); the transcription factor hypoxia-inducible factor-2 induces EPO. However, erythropoiesis regulation extends beyond the well-established hypoxia-inducible factor (HIF)–EPO axis and involves processes modulated by other hypoxia pathway proteins (HPPs), including proteins involved in iron metabolism. The importance of a number of these factors is evident as their altered expression has been associated with various anemia-related disorders, including chronic kidney disease.
    [Show full text]
  • Evaluating the Effectiveness of Transferrin Receptor-1 (Tfr1) As a Magnetic Resonance Reporter Gene Sofia M
    Full paper Received: 16 September 2015, Revised: 6 January 2016, Accepted: 8 January 2016, Published online in Wiley Online Library: 29 February 2016 (wileyonlinelibrary.com) DOI: 10.1002/cmmi.1686 Evaluating the effectiveness of transferrin receptor-1 (TfR1) as a magnetic resonance reporter gene Sofia M. Pereiraa, Anne Herrmannb, Diana Mossa, Harish Poptania, Steve R. Williamsc, Patricia Murraya and Arthur Taylora* Magnetic resonance (MR) reporter genes have the potential for tracking the biodistribution and fate of cells in vivo, thus allowing the safety, efficacy and mechanisms of action of cell-based therapies to be comprehensively assessed. In this study, we evaluate the effectiveness of the iron importer transferrin receptor-1 (TfR1) as an MR reporter gene in the model cell line CHO-K1. Overexpression of the TfR1 transgene led to a reduction in the levels of endogenous TfR1 mRNA, but to a 60-fold increase in total TfR1 protein levels. Although the mRNA levels of ferritin heavy chain-1 (Fth1) did not change, Fth1 protein levels increased 13-fold. The concentration of intracellular iron increased signif- icantly, even when cells were cultured in medium that was not supplemented with iron and the amount of iron in the extracellular environment was thus at physiological levels. However, we found that, by supplementing the cell cul- ture medium with ferric citrate, a comparable degree of iron uptake and MR contrast could be achieved in control cells that did not express the TfR1 transgene. Sufficient MR contrast to enable the cells to be detected in vivo follow- ing their administration into the midbrain of chick embryos was obtained irrespective of the reporter gene.
    [Show full text]
  • The Iron Maiden. Cytosolic Aconitase/IRP1 Conformational Tran- 2 Sition in the Regulation of Ferritin Translation and Iron Hemosta- 3 Sis 4
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.28.454104; this version posted July 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Article 1 The iron maiden. Cytosolic aconitase/IRP1 conformational tran- 2 sition in the regulation of ferritin translation and iron hemosta- 3 sis 4 Cécilia Hognon1, Emmanuelle Bignon1, Guillaume Harle2, Nadège Touche2, Stéphanie Grandemange2, * and Anto- 5 nio Monari1,3* 6 1 Université de Lorraine and CNRS, UMR 7019 LPCT, F-5400 Nancy, France 7 2 Université de Lorraine and CNRS, UMR 7039 CRAN, F-54000 Nancy, France 8 3 Université de Paris and CNRS, ITODYS, F-75006 Paris, France. 9 * Correspondence: SG [email protected] , AM [email protected] 10 Abstract: Maintaining iron homeostasis is fundamental for almost all living being, and its deregu- 11 lation correlates With severe and debilitating pathologies. The process is made more complicated by 12 the omnipresence of iron and by its role as a fundamental component of a number of crucial metallo 13 proteins. The response to modifications in the amount of the free iron pool is performed via the 14 inhibition of ferritin translation by sequestering consensus messenger RNA (mRNA) sequences. In 15 turn this is regulated by the iron-sensitive conformational equilibrium betWeen aconitase and IRP, 16 mediated by the presence of an iron-sulfur cluster. In this contribution We analyze by full-atom 17 molecular dynamics simulation, the factors leading to both the interaction With mRNA, and the 18 conformational transition.
    [Show full text]
  • Accommodating Variety in Iron-Responsive Elements: Crystal Structure of Transferrin Receptor 1 B IRE Bound to Iron Regulatory Protein 1 ⇑ William E
    FEBS Letters 586 (2012) 32–35 journal homepage: www.FEBSLetters.org Accommodating variety in iron-responsive elements: Crystal structure of transferrin receptor 1 B IRE bound to iron regulatory protein 1 ⇑ William E. Walden, Anna Selezneva, Karl Volz Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612, United States article info abstract Article history: Iron responsive elements (IREs) are short stem-loop structures found in several mRNAs encoding Received 3 October 2011 proteins involved in cellular iron metabolism. Iron regulatory proteins (IRPs) control iron homeo- Revised 14 November 2011 stasis through differential binding to the IREs, accommodating any sequence or structural varia- Accepted 15 November 2011 tions that the IREs may present. Here we report the structure of IRP1 in complex with transferrin Available online 24 November 2011 receptor 1 B (TfR B) IRE, and compare it to the complex with ferritin H (Ftn H) IRE. The two IREs Edited by Kaspar Locher are bound to IRP1 through nearly identical protein-RNA contacts, although their stem conforma- tions are significantly different. These results support the view that binding of different IREs with IRP1 depends both on protein and RNA conformational plasticity, adapting to RNA variation while Keywords: Iron metabolism retaining conserved protein-RNA contacts. Iron regulatory protein Ó 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Iron-responsive element Translation Structure 1. Introduction We have sought to determine the X-ray crystal structures of various IREs bound to IRP1 in an effort to determine how IRE vari- Cellular iron uptake, utilization, and storage are tightly controlled ety is accommodated in this protein:RNA complex.
    [Show full text]
  • Vitamin a Modulation of Iron Homeostasis : the Role of Iron Regulatory Proteins
    Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations 1-1-2006 Vitamin A modulation of iron homeostasis : the role of iron regulatory proteins Stacy Eileen Schroeder Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/rtd Recommended Citation Schroeder, Stacy Eileen, "Vitamin A modulation of iron homeostasis : the role of iron regulatory proteins" (2006). Retrospective Theses and Dissertations. 19096. https://lib.dr.iastate.edu/rtd/19096 This Thesis is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Vitamin A modulation of iron homeostasis: the role of iron regulatory proteins by Stacy Eileen Schroeder A thesis submitted to the graduate faculty in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Major: Nutrition Program of ~t-~dy Committee: Kevin Schalinske, Major Professor Manj u Reddy Mary Ackermann Iowa State University Ames, Iowa 2006 11 Graduate College Iowa State University This is to certify that the master's thesis of Stacy Eileen Schroeder has met the thesis requirements ofIowa State University Signatures have been redacted for privacy 111 TABLE OF CONTENTS LIST OF FIGURES ....................................................................................................
    [Show full text]
  • 1 Targeting Iron Metabolism in Cancer Therapy Michael Morales1, Xiang Xue1, * 1 Department of Biochemistry and Molecular Biology
    Targeting iron metabolism in cancer therapy Michael Morales1, Xiang Xue1, * 1 Department of Biochemistry and Molecular Biology, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 * To whom correspondence should be addressed. Email: [email protected] Address: Fitz hall 259, 915 Camino de Salud NE, Albuquerque, NM 87131 Abstract: Iron is a critical component of many cellular functions including DNA replication and repair, and it is essential for cell vitality. As an essential element, iron is critical for maintaining human health. However, excess iron can be highly toxic, resulting in oxidative DNA damage. Many studies have observed significant associations between iron and cancer, and the association appears to be more than just coincidental. The chief characteristic of cancers, hyper-proliferation, makes them even more dependent on iron than normal cells. Cancer therapeutics are becoming as diverse as the disease itself. Targeting iron metabolism in cancer cells is an emerging, formidable field of therapeutics. It is a strategy that is highly diverse with regard to specific targets and the various ways to reach them. This review will discuss the importance of iron metabolism in cancer and highlight the ways in which it is being explored as the medicine of tomorrow. Keywords: Iron metabolism, Cancer, Therapy, Chelation, Ferroptosis 1 Graphical Abstract: 2 Introduction Iron is essential for cell vitality. It is found in proteins that perform a variety of functions including biomolecule synthesis, oxygen transport and homeostasis, and respiration [1]. Iron is a critical component of many proteins involved in nucleic acid metabolism and repair, as well as cell cycle progression [2].
    [Show full text]
  • Systematic Surveys of Iron Homeostasis Mechanisms Reveal Ferritin Superfamily and Nucleotide Surveillance Regulation to Be Modif
    cells Article Systematic Surveys of Iron Homeostasis Mechanisms Reveal Ferritin Superfamily and Nucleotide Surveillance Regulation to be Modified by PINK1 Absence Jana Key 1,2, Nesli Ece Sen 1,2, Aleksandar Arsovi´c 1, Stella Krämer 1, Robert Hülse 1, Natasha Nadeem Khan 1, David Meierhofer 3 , Suzana Gispert 1, Gabriele Koepf 1 and Georg Auburger 1,* 1 Experimental Neurology, Medical School, Goethe University, 60590 Frankfurt am Main, Germany; [email protected] (J.K.); [email protected] (N.E.S.); [email protected] (A.A.); [email protected] (S.K.); [email protected] (R.H.); [email protected] (N.N.K.); [email protected] (S.G.); [email protected] (G.K.) 2 Faculty of Biosciences, Goethe-University, Altenhöferallee 1, 60438 Frankfurt am Main, Germany 3 Max Planck Institute for Molecular Genetics, Ihnestraße 63-73, 14195 Berlin, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-(0)-69-6301-7428 Received: 3 September 2020; Accepted: 29 September 2020; Published: 2 October 2020 Abstract: Iron deprivation activates mitophagy and extends lifespan in nematodes. In patients suffering from Parkinson’s disease (PD), PINK1-PRKN mutations via deficient mitophagy trigger iron accumulation and reduce lifespan. To evaluate molecular effects of iron chelator drugs as a potential PD therapy, we assessed fibroblasts by global proteome profiles and targeted transcript analyses. In mouse cells, iron shortage decreased protein abundance for iron-binding nucleotide metabolism enzymes (prominently XDH and ferritin homolog RRM2). It also decreased the expression of factors with a role for nucleotide surveillance, which associate with iron-sulfur-clusters (ISC), and are important for growth and survival.
    [Show full text]
  • Systematic Surveys of Iron Homeostasis Mechanisms Reveal Ferritin Superfamily and Nucleotide Surveillance Regulation to Be Modif
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 5 September 2020 doi:10.20944/preprints202009.0108.v1 1 Article 2 Systematic Surveys of Iron Homeostasis Mechanisms 3 reveal Ferritin Superfamily and Nucleotide Surveillance 4 Regulation to be modified by PINK1 Absence 5 Jana Key 1,2, Nesli Ece Sen 1,2, Aleksandar Arsovic 1, Stella Krämer 1, Robert Hülse 1, Natasha 6 Nadeem Khan 1, David Meierhofer 3, Suzana Gispert 1, Gabriele Koepf 1, and Georg Auburger 1,* 7 1 Experimental Neurology, Goethe University Medical School, 60590 Frankfurt am Main, Germany 8 2 Faculty of Biosciences, Goethe-University, Altenhöferallee 1, 60438 Frankfurt am Main, Germany 9 3 Max Planck Institute for Molecular Genetics, Ihnestraße 63-73, 14195 Berlin, Germany 10 * Correspondence: [email protected] 11 12 Abstract: Iron deprivation activates mitophagy and extends lifespan in nematodes. In patients 13 suffering from Parkinson’s disease (PD), PINK1-PRKN mutations via deficient mitophagy trigger 14 iron accumulation and reduce lifespan. To evaluate molecular effects of iron chelator drugs as a 15 potential PD therapy, we assessed fibroblasts by global proteome profiles and targeted transcript 16 analyses. In mouse cells, iron shortage decreased protein abundance for iron-binding nucleotide 17 metabolism enzymes (prominently XDH and ferritin homolog RRM2). It also decreased the 18 expression of factors with a role for nucleotide surveillance, which associate with iron-sulfur- 19 clusters (ISC), and are important for growth and survival. This widespread effect included 20 prominently Nthl1-Ppat-Bdh2, but also mitochondrial Glrx5-Nfu1-Bola1, cytosolic Aco1-Abce1-Tyw5, 21 and nuclear Dna2-Elp3-Pold1-Prim2.
    [Show full text]