DOCSLIB.ORG

Mutation Analysis of SYNJ1: a Possible Candidate Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mutation Analysis of SYNJ1: a Possible Candidate Gene Molecular Psychiatry (2001) 6, 387–395 2001 Nature Publishing Group All rights reserved 1359-4184/01 $15.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Mutation analysis of SYNJ1: a possible candidate gene for chromosome 21q22-linked bipolar disorder T Saito, F Guan, DF Papolos, S Lau, M Klein, CSJ Fann and HM Lachman Department of Psychiatry, Division of Psychiatry Research, Albert Einstein College of Medicine, Bronx, New York 10461, USA Genes involved in the regulation of synaptic vesicle function are potential candidates for the development of psychiatric disorders. In addition to experimental and theoretical consider- ations, a number of genes involved in synaptic vesicle function map to regions of the genome that have been linked to bipolar disorder (BPD) and schizophrenia (SZ). One is synaptojanin 1(SYNJ1) which maps to 21q22.2, a chromosomal region that has been linked to BPD in a subset of families in several studies. Synaptojanin 1 is an inositol 5-phosphatase that has an important role in synaptic vesicle endocytosis. Mutation screening of 32 exons, intron–exon junctions, and 839 bases of 5Ј-flanking DNA resulted in the identification of 11 mutations of which four were very common and seven were very rare. Of the 11 mutations identified, sev- eral may have functional significance including two coding variants, two that may affect the binding of a transcription factor, and two that involve known splicing regulatory domains. Five bipolar patients out of 149 analyzed were found who have one of the four rare variants that were most likely to have functional significance compared with 0/148 controls. The allele frequencies for three of the four common variants were very similar in bipolar patients and controls. A slight difference in allele frequency was found for an interesting mutation we detected in intron 12 in which two non-adjacent thymidine residues are deleted in a poly-AT tract located near the exon 12 splice donor site (␹2 = 2.45, P = 0.12, 2-tailed). Although we failed to unequivocally identify a specific SYNJ1 allele that could be responsible for putative chromosome 21q22-linked BPD, several interesting variants were found to be increased in bipolar subjects and should be further investigated. Molecular Psychiatry (2001) 6, 387–395. Keywords: SNP; SNARE; polymorphism; candidate gene; chromosome 21; manic depression; manic depressive illness Introduction cal features of ADHD overlap with those found in mania and hypomania. Fifth, altered expression of the Genes involved in the regulation of synaptic vesicle synaptic proteins SNAP-25, synaptophysin, and com- function are good candidates to consider for BPD sus- plexins I and II, have been found in the brains of ceptibility. This idea is based on several observations. 5–9 + schizophrenics and bipolar individuals. Finally, a First, Ca2 and phosphoinositides, which are critical number of genes encoding homologs of SNARE and mediators of synaptic vesicle function, are targets for vesicle proteins, and their regulators, map to regions some of the drugs used to treat BPD.1 Second, of the genome that are suspected to harbor BPD and SZ depletion of vesicle catecholamines by reserpine may susceptibility genes. SNAP29, RAB36, phosphatidyl- cause depression, especially in patients with underly- inositol 4-kinase (Pl4K), synapsin III and synaptogyrin ing mood disorders.2 Third, amphetamine, which 1 map to chromosome 22q11–13,10–16 synapsin I and induces behavioral changes similar to those found in synaptophysin map to Xp11,17 SYBL1 maps to Xq28,18 SZ and in mania, causes the redistribution of cat- syntaxin 7 maps to 6q2119–21 and SYNJ1, which echolamines from vesicles to cytosol.3 Fourth, deletion encodes synaptojanin, a phosphatase enriched in pre- of the gene encoding the SNARE protein SNAP-25 in synaptic terminals, maps to 21q22.2.22–28 the coloboma mouse strain causes behavioral alter- Phosphoinositides are important regulators of vesicle ations that mimic those found in patients with atten- exocytosis and endocytosis.29 The endocytic proteins tion deficit hyperactivity disorder (ADHD).4 The clini- synaptojanin, dynamin 1 and amphiphysin, and synap- totagmin, a synaptic vesicle protein involved in exocytosis through its role as a Ca2+ sensor, all bind Correspondence: HM Lachman, Department of Psychiatry, phosphoinositides.30–34 Synaptojanin regulates endo- Division of Psychiatry Research, Albert Einstein College of Medi- cytosis by dephosphorylating soluble and lipidic phos- cine, 1300 Morris Park Ave, Bronx, New York 10461, USA. E- Ј mail: LachmanȰaecom.yu.edu phoinositides at the 5 position of the inositol ring. Its Received 4 October 2000; revised 11 December 2000; accepted 19 targets include phosphatidylinositol 4,5-bisphosphate December 2000 (Pl(4,5)P2) and phosphatidylinositol 3,4,5-trisphos- Mutation analysis of SYNJ1 T Saito et al 388 29–32 phate (Pl(3,4,5)P3. The dephosphorylation of and AP000277). Primers were derived from intron Pl(4,5)P2 by synaptojanin is a critical step in the sequences and were designed to amplify exons and uncoating of clathrin from endocytic vesicles. intron–exon junctions. Overlapping primers were used The SYNJ1 gene encodes 170-kDa and 145-kDa syn- to amplify the 5Ј-flanking region. The primers used in aptojanin isoforms that are generated by alternative this study are shown in Table 1. The SYNJ1 gene is splicing; synaptojanin-170 is expressed at low concen- cloned in the opposite orientation in all of the genomic trations in many tissues and fetal brain whereas synap- clones in GenBank. However, the polymorphisms tojanin-145 is primarily found in nerve terminals.33–35 reported in this study are reported from the perspective The SYNJ1 gene encodes three distinct functional of the sense strand. domains. The central portion encodes the inositol 5- PCR-amplified genomic DNA fragments were phosphatase activity. The 5Ј-region is homologous to screened for polymorphisms using a modification of the cytosolic portion of the yeast Sac1 protein, which the single strand conformation polymorphism (SSCP) has been implicated in the regulation of vesicular traffic. The Sac1-like homology has been shown to have an intrinsic polyphosphoinositide phosphatase activity Table 1 Primers used to amplify SYNJ1 exons and intron separate from that encoded by the central 5-phospha- exon junctions tase domain.36,37 The 3Ј end encodes a proline-rich region that is involved in binding synaptojanin to Exon Forward primer Reverse primer Size amphiphysin and other proteins found on endocytic vesicles.33,34,37,38 1 ggcgcaatgcggaagagatg gacgctgcggaggcagagac 200 Based on its role in vesicle recycling, as well as its 2 atgctttgcagtccttgctg ggttgcatctgaattgtttcaa 283 location on 21q22.2, a region of the genome mapped 3 gaatccaatgtttcaggtca ctctcaaatccttagaattac 206 in a subset of families with BPD, we viewed SYNJ1 as 4 aggtgcaagaagaaatggaa actgaacaactgctgaacat 400 5 catactttgttacttagtat tgttattctagtattttctgtg 350 a credible candidate gene for BPD. 6 gtaagtgtaacaacttttct actatccagaaagtttagaa 210 7 gtgtgttcagcaaagaaatt gaagtgaatcagtaaataca 240 Methods 8 attgaaaaaattgggcttc aataccattctaggggtcca 210 9 ttagatggatatttgccttt atgttccaattcaaagaaca 270 Subjects 10 cctcaattattcactgtttg ttaaagaggcagatgataca 203 Patients with BPD were diagnosed on the basis of 11 tctggtagttcttaaaagcc ggccatttaaaagctttatgaag 299 either a SADS-L interview or by unstructured clinical 12 aaaacctaatgagtaaaatcag gtttacatttacctcttggcc 291 interview modified from SADS-L that yielded diagnos- 13 ttttgtcactatactcaacattt ccaattatatggctttatttgt 195 tic information enabling the diagnosis of BPD using 14 tttataaatggtttgatgcagc acacagtcaggatttattaac 290 RDC criteria.39,40 Patients with either bipolar disorder 15 gttggatggggttgctattt agtttccctcaactggcaaa 201 I (BPI) (n = 95) or bipolar disorder II (BPII) (n = 54) were 16 ttgtcataaaataggctattgt tttcttgttatttaatggtagg 263 17 tcttgaaatttcaaatctgcga tatatttcaaagctttatcttc 284 included in the study. The patients were recruited from 18 aagcatatctcaggcaaaga cgacccaaaatcttaatgca 291 clinics and private practices affiliated with the Albert 19 tgtctgaatgaaaacagaac tcataagtttacattagttcatt 272 Einstein College of Medicine. Forty-three subjects were 20 tcctgcttatacagcttctc caaacaatttcaaacactatta 219 unrelated patients with BPI obtained from the Coriell 21 gaaatttgtttgaaatacacc cccaaataaggtgatttcta 358 Institute in conjunction with the The National Insti- 22 gcttgttatgtctatggtat agataatcttgctgcatgtc 220 tutes of Mental Health Bipolar Genetics Initiative. 23 gtcagcctctttattccaaa cagattggaagaaaacatatc 292 Patients signed an informed consent approved by the 24 tggagttatctctgatcaag catcaagcacattggccaca 300 local Committee on Clinical Investigation. Control sub- 25 atcttcttacctcctgtgcg gagtgaagaattttacatctagc 220 jects were students, anonymous blood bank donors, 26 atactatagcaatctttgac ctttcaggtgtaaaacattaat 181 27 gtttactatggaaattgtct gggcgctgacactgagaaa 199 anonymous DNA samples obtained from liver biopsies 28/29 agcaagctgatgttatgcaa tagtagtaaacaggacttag 370 in consenting patients undergoing abdominal surgery, 30 agaattttacctgtggaagg aaattttctgggctcaagtgatc 220 and hospital, medical school, and clinic staff. No for- 31 cttccttcattataccacaa ggtatgttcaaagactaaatc 425 mal testing procedure was used to screen controls for 32 aaagcattttgttgactgaa ttcatacatctaatgtgttg 180 underlying psychiatric illness. All patients and con- trols were Caucasian. There were 79 female and 70 5Ј-flanking male controls (mean age 45.5 ± 15.2 female, 44.3 ± 15.7 male), and 83 female and 66 male patients with BPD pro1
Load more

Recommended publications
  • Dynamin Functions and Ligands: Classical Mechanisms Behind
    1521-0111/91/2/123–134$25.00 http://dx.doi.org/10.1124/mol.116.105064 MOLECULAR PHARMACOLOGY Mol Pharmacol 91:123–134, February 2017 Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics MINIREVIEW Dynamin Functions and Ligands: Classical Mechanisms Behind Mahaveer Singh, Hemant R. Jadhav, and Tanya Bhatt Department of Pharmacy, Birla Institute of Technology and Sciences Pilani, Pilani Campus, Rajasthan, India Received May 5, 2016; accepted November 17, 2016 Downloaded from ABSTRACT Dynamin is a GTPase that plays a vital role in clathrin-dependent pathophysiology of various disorders, such as Alzheimer’s disease, endocytosis and other vesicular trafficking processes by acting Parkinson’s disease, Huntington’s disease, Charcot-Marie-Tooth as a pair of molecular scissors for newly formed vesicles originating disease, heart failure, schizophrenia, epilepsy, cancer, dominant ’ from the plasma membrane. Dynamins and related proteins are optic atrophy, osteoporosis, and Down s syndrome. This review is molpharm.aspetjournals.org important components for the cleavage of clathrin-coated vesicles, an attempt to illustrate the dynamin-related mechanisms involved phagosomes, and mitochondria. These proteins help in organelle in the above-mentioned disorders and to help medicinal chemists division, viral resistance, and mitochondrial fusion/fission. Dys- to design novel dynamin ligands, which could be useful in the function and mutations in dynamin have been implicated in the treatment of dynamin-related disorders. Introduction GTP hydrolysis–dependent conformational change of GTPase dynamin assists in membrane fission, leading to the generation Dynamins were originally discovered in the brain and identi- of endocytic vesicles (Praefcke and McMahon, 2004; Ferguson at ASPET Journals on September 23, 2021 fied as microtubule binding partners.
    [Show full text]
  • Exceptional Conservation of Horse–Human Gene Order on X Chromosome Revealed by High-Resolution Radiation Hybrid Mapping
    Exceptional conservation of horse–human gene order on X chromosome revealed by high-resolution radiation hybrid mapping Terje Raudsepp*†, Eun-Joon Lee*†, Srinivas R. Kata‡, Candice Brinkmeyer*, James R. Mickelson§, Loren C. Skow*, James E. Womack‡, and Bhanu P. Chowdhary*¶ʈ *Department of Veterinary Anatomy and Public Health, ‡Department of Veterinary Pathobiology, College of Veterinary Medicine, and ¶Department of Animal Science, College of Agriculture and Life Science, Texas A&M University, College Station, TX 77843; and §Department of Veterinary Pathobiology, University of Minnesota, 295f AS͞VM, St. Paul, MN 55108 Contributed by James E. Womack, December 30, 2003 Development of a dense map of the horse genome is key to efforts ciated with the traits, once they are mapped by genetic linkage aimed at identifying genes controlling health, reproduction, and analyses with highly polymorphic markers. performance. We herein report a high-resolution gene map of the The X chromosome is the most conserved mammalian chro- horse (Equus caballus) X chromosome (ECAX) generated by devel- mosome (18, 19). Extensive comparisons of structure, organi- oping and typing 116 gene-specific and 12 short tandem repeat zation, and gene content of this chromosome in evolutionarily -markers on the 5,000-rad horse ؋ hamster whole-genome radia- diverse mammals have revealed a remarkable degree of conser tion hybrid panel and mapping 29 gene loci by fluorescence in situ vation (20–22). Until now, the chromosome has been best hybridization. The human X chromosome sequence was used as a studied in humans and mice, where the focus of research has template to select genes at 1-Mb intervals to develop equine been the intriguing patterns of X inactivation and the involve- orthologs.
    [Show full text]
  • Phosphorylation of Synaptojanin Differentially Regulates Endocytosis of Functionally Distinct Synaptic Vesicle Pools
    8882 • The Journal of Neuroscience, August 24, 2016 • 36(34):8882–8894 Cellular/Molecular Phosphorylation of Synaptojanin Differentially Regulates Endocytosis of Functionally Distinct Synaptic Vesicle Pools X Junhua Geng,1* Liping Wang,1,2* Joo Yeun Lee,1,4 XChun-Kan Chen,1 and Karen T. Chang1,3,4 1Zilkha Neurogenetic Institute, 2Department of Biochemistry and Molecular Biology, and 3Department of Cell and Neurobiology, Keck School of Medicine, University of Southern California, Los Angeles, California 90089, and 4Neuroscience Graduate Program, University of Southern California, Los Angeles, California 90089 The rapid replenishment of synaptic vesicles through endocytosis is crucial for sustaining synaptic transmission during intense neuronal activity. Synaptojanin (Synj), a phosphoinositide phosphatase, is known to play an important role in vesicle recycling by promoting the uncoating of clathrin following synaptic vesicle uptake. Synj has been shown to be a substrate of the minibrain (Mnb) kinase, a fly homolog of the dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A); however, the functional impacts of Synj phosphorylation by Mnb are not well understood. Here we identify that Mnb phosphorylates Synj at S1029 in Drosophila. We find that phosphorylation of Synj at S1029 enhances Synj phosphatase activity, alters interaction between Synj and endophilin, and promotes efficient endocytosis of the active cycling vesicle pool (also referred to as exo-endo cycling pool) at the expense of reserve pool vesicle endocytosis. Dephosphorylated Synj, on the other hand, is deficient in the endocytosis of the active recycling pool vesicles but maintains reserve pool vesicle endocytosis to restore total vesicle pool size and sustain synaptic transmission. Together, our findings reveal a novel role for Synj in modulating reserve pool vesicle endocytosis and further indicate that dynamic phosphorylation and dephosphorylation of Synj differentially maintain endocytosis of distinct functional synaptic vesicle pools.
    [Show full text]
  • Solitary and Repetitive Binding Motifs for the Ap2 Complex Α-Appendage in Amphiphysin and Other Accessory Proteins
    SOLITARY AND REPETITIVE BINDING MOTIFS FOR THE AP2 COMPLEX α-APPENDAGE IN AMPHIPHYSIN AND OTHER ACCESSORY PROTEINS Lene E. Olesen*, Eva M. Schmid*, Marijn G. J. Ford#*, Yvonne Vallis, M. Madan Babu, Peter Li, Ian G. Mills∑, Harvey T. McMahon§ and Gerrit J.K. Praefcke♣§ Laboratory of Molecular Biology, Medical Research Council, Neurobiology Division, Hills Road, Cambridge CB2 2QH, UK. ♣ Center for Molecular Medicine Cologne (CMMC), Institute for Genetics, Zülpicher Straße 47, 50674 Köln, Germany. Running Title: Classification of AP2 α-appendage-binding FxDxF and DxF/W motifs § Address correspondence to: Harvey T. McMahon, Email: [email protected]; Tel.: +44(0)1223-402311; Fax: +44(0)1223-402310 or Gerrit J.K. Praefcke, Email [email protected]; Tel.: +49(0)221-470-1561; Fax: +49(0)221-470-6749 Adaptor protein (AP) complexes bind to coated pits, for the platform subdomain of the transmembrane proteins destined for α-appendage. The motif domain of internalisation and to membrane lipids, so amphiphysin1 contains one copy of each of a linking cargo to the accessory internalisation DxF/W and FxDxF motif. We find that the machinery. This machinery interacts with the FxDxF motif is the main determinant for the appendage domains of APs, which have high affinity interaction with the α-adaptin platform and β-sandwich subdomains, appendage. We describe the optimal sequence forming the binding surfaces for interacting of the FxDxF motif using thermodynamic and proteins. Proteins which interact with the structural data and show how sequence subdomains do so via short motifs, usually variation controls the affinities of these motifs found in regions of low structural complexity for the α-appendage.
    [Show full text]
  • BIN1/M-Amphiphysin2 Induces Clustering of Phosphoinositides to Recruit Its Downstream Partner Dynamin
    ARTICLE Received 19 May 2014 | Accepted 22 Oct 2014 | Published 9 Dec 2014 DOI: 10.1038/ncomms6647 BIN1/M-Amphiphysin2 induces clustering of phosphoinositides to recruit its downstream partner dynamin Laura Picas1, Julien Viaud2, Kristine Schauer1, Stefano Vanni3, Karim Hnia4, Vincent Fraisier5, Aure´lien Roux6, Patricia Bassereau7,Fre´de´rique Gaits-Iacovoni2, Bernard Payrastre2, Jocelyn Laporte4, Jean-Baptiste Manneville1 & Bruno Goud1 Phosphoinositides play a central role in many physiological processes by assisting the recruitment of proteins to membranes through specific phosphoinositide-binding motifs. How this recruitment is coordinated in space and time is not well understood. Here we show that BIN1/M-Amphiphysin2, a protein involved in T-tubule biogenesis in muscle cells and fre- quently mutated in centronuclear myopathies, clusters PtdIns(4,5)P2 to recruit its down- stream partner dynamin. By using several mutants associated with centronuclear myopathies, we find that the N-BAR and the SH3 domains of BIN1 control the kinetics and the accumu- lation of dynamin on membranes, respectively. We show that phosphoinositide clustering is a mechanism shared by other proteins that interact with PtdIns(4,5)P2, but do not contain a BAR domain. Our numerical simulations point out that clustering is a diffusion-driven process in which phosphoinositide molecules are not sequestered. We propose that this mechanism plays a key role in the recruitment of downstream phosphoinositide-binding proteins. 1 Institut Curie and CNRS UMR 144, 26 rue d’Ulm, 75005 Paris, France. 2 INSERM, UMR1048, Universite´ Toulouse III, Institut des Maladies Me´taboliques et Cardiovasculaires, 1 avenue Jean Poulhe`s, 31432 Toulouse, France.
    [Show full text]
  • Differential Physiological Role of BIN1 Isoforms in Skeletal Muscle Development, Function and Regeneration
    bioRxiv preprint doi: https://doi.org/10.1101/477950; this version posted December 11, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Differential physiological role of BIN1 isoforms in skeletal muscle development, function and regeneration Ivana Prokic1,2,3,4, Belinda Cowling1,2,3,4, Candice Kutchukian5, Christine Kretz1,2,3,4, Hichem Tasfaout1,2,3,4, Josiane Hergueux1,2,3,4, Olivia Wendling1,2,3,4, Arnaud Ferry10, Anne Toussaint1,2,3,4, Christos Gavriilidis1,2,3,4, Vasugi Nattarayan1,2,3,4, Catherine Koch1,2,3,4, Jeanne Lainné6,7, Roy Combe2,3,4,8, Laurent Tiret9, Vincent Jacquemond5, Fanny Pilot-Storck9, Jocelyn Laporte1,2,3,4 1Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), Illkirch, France 2Centre National de la Recherche Scientifique (CNRS), UMR7104, Illkirch, France 3Institut National de la Santé et de la Recherche Médicale (INSERM), U1258, Illkirch, France 4Université de Strasbourg, Illkirch, France 5Univ Lyon, Université Claude Bernard Lyon 1, CNRS UMR-5310, INSERM U-1217, Institut NeuroMyoGène, 8 avenue Rockefeller, 69373 Lyon, France 6Sorbonne Université, INSERM, Institute of Myology, Centre of Research in Myology, UMRS 974, F- 75013, Paris, France 7Sorbonne Université, Department of Physiology, UPMC Univ Paris 06, Pitié-Salpêtrière Hospital, F- 75013, Paris, France 8CELPHEDIA-PHENOMIN, Institut Clinique de la Souris (ICS), Illkirch, France 9U955 – IMRB, Team 10 - Biology of the neuromuscular system, Inserm, UPEC, Ecole nationale vétérinaire d’Alfort, Maisons-Alfort, 94700, France 10Sorbonne Université, INSERM, Institute of Myology, Centre of Research in Myology, UMRS 794, F- 75013, Paris, France Correspondence to: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/477950; this version posted December 11, 2018.
    [Show full text]
  • Gene Targeting Therapies (Roy Alcalay)
    Recent Developments in Gene - Targeted Therapies for Parkinson’s Disease Roy Alcalay, MD, MS Alfred and Minnie Bressler Associate Professor of Neurology Division of Movement Disorders Columbia University Medical Center Disclosures Funding: Dr. Alcalay is funded by the National Institutes of Health, the DOD, the Michael J. Fox Foundation and the Parkinson’s Foundation. Dr. Alcalay receives consultation fees from Genzyme/Sanofi, Restorbio, Janssen, and Roche. Gene Localizations Identified in PD Gene Symbol Protein Transmission Chromosome PARK1 SNCA α-synuclein AD 4q22.1 PARK2 PRKN parkin (ubiquitin ligase) AR 6q26 PARK3 ? ? AD 2p13 PARK4 SNCA triplication α-synuclein AD 4q22.1 PARK5 UCH-L1 ubiquitin C-terminal AD 4p13 hydrolase-L1 PARK6 PINK1 PTEN-induced kinase 1 AR 1p36.12 PARK7 DJ-1 DJ-1 AR 1p36.23 PARK8 LRRK2 leucine rich repeat kinase 2 AD 12q12 PARK9 ATP13A2 lysosomal ATPase AR 1p36.13 PARK10 ? ? (Iceland) AR 1p32 PARK11 GIGYF2 GRB10-interacting GYF protein 2 AD 2q37.1 PARK12 ? ? X-R Xq21-q25 PARK13 HTRA2 serine protease AD 2p13.1 PARK14 PLA2G6 phospholipase A2 (INAD) AR 22q13.1 PARK15 FBXO7 F-box only protein 7 AR 22q12.3 PARK16 ? Discovered by GWAS ? 1q32 PARK17 VPS35 vacuolar protein sorting 35 AD 16q11.2 PARK18 EIF4G1 initiation of protein synth AD 3q27.1 PARK19 DNAJC6 auxilin AR 1p31.3 PARK20 SYNJ1 synaptojanin 1 AR 21q22.11 PARK21 DNAJC13 8/RME-8 AD 3q22.1 PARK22 CHCHD2 AD 7p11.2 PARK23 VPS13C AR 15q22 Gene Localizations Identified in PD Disorder Symbol Protein Transmission Chromosome PD GBA β-glucocerebrosidase AD 1q21 SCA2
    [Show full text]
  • High-Throughput Discovery of Novel Developmental Phenotypes
    High-throughput discovery of novel developmental phenotypes The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Dickinson, M. E., A. M. Flenniken, X. Ji, L. Teboul, M. D. Wong, J. K. White, T. F. Meehan, et al. 2016. “High-throughput discovery of novel developmental phenotypes.” Nature 537 (7621): 508-514. doi:10.1038/nature19356. http://dx.doi.org/10.1038/nature19356. Published Version doi:10.1038/nature19356 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:32071918 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Nature. Manuscript Author Author manuscript; Manuscript Author available in PMC 2017 March 14. Published in final edited form as: Nature. 2016 September 22; 537(7621): 508–514. doi:10.1038/nature19356. High-throughput discovery of novel developmental phenotypes A full list of authors and affiliations appears at the end of the article. Abstract Approximately one third of all mammalian genes are essential for life. Phenotypes resulting from mouse knockouts of these genes have provided tremendous insight into gene function and congenital disorders. As part of the International Mouse Phenotyping Consortium effort to generate and phenotypically characterize 5000 knockout mouse lines, we have identified 410 Users may view, print, copy, and download text and data-mine the content in such documents, for the purposes of academic research, subject always to the full Conditions of use:http://www.nature.com/authors/editorial_policies/license.html#terms #Corresponding author: [email protected].
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Normal histone modifications on the inactive X chromosome in ICF and Rett syndrome cells: implications for methyl-CpG binding proteins Stanley M Gartler*1,2, Kartik R Varadarajan2, Ping Luo2, Theresa K Canfield2, Jeff Traynor3, Uta Francke3 and R Scott Hansen2 Address: 1Department of Medicine, University of Washington, Seattle, WA, USA, 2Department of Genome Sciences, University of Washington, Seattle, WA, USA and 3Department of Genetics, Stanford University, Stanford, CA, USA Email: Stanley M Gartler* - [email protected]; Kartik R Varadarajan - [email protected]; Ping Luo - [email protected]; Theresa K Canfield - [email protected]; Jeff Traynor - [email protected]; Uta Francke - [email protected]; R Scott Hansen - [email protected] * Corresponding author Published: 20 September 2004 Received: 23 June 2004 Accepted: 20 September 2004 BMC Biology 2004, 2:21 doi:10.1186/1741-7007-2-21 This article is available from: http://www.biomedcentral.com/1741-7007/2/21 © 2004 Gartler et al; licensee BioMed Central Ltd. This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: In mammals, there is evidence suggesting that methyl-CpG binding proteins may play a significant role in histone modification through their association with modification complexes that can deacetylate and/or methylate nucleosomes in the proximity of methylated DNA. We examined this idea for the X chromosome by studying histone modifications on the X chromosome in normal cells and in cells from patients with ICF syndrome (Immune deficiency, Centromeric region instability, and Facial anomalies syndrome).
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
    bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Anti-VAMP7 Monoclonal Antibody, Clone 25G579 (CABT-37960MH) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-VAMP7 monoclonal antibody, clone 25G579 (CABT-37960MH) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Mouse Monoclonall antibody to Human VAMP7. Antigen Description This gene encodes a transmembrane protein that is a member of the soluble N-ethylmaleimide- sensitive factor attachment protein receptor (SNARE) family. The encoded protein localizes to late endosomes and lysosomes and is involved in the fusion of transport vesicles to their target membranes. Alternate splicing results in multiple transcript variants. Specificity Detected in all tissues tested. Immunogen Recombinant full SYBL1 protein (Human) Isotype IgG1 Source/Host Mouse Species Reactivity Rat, Human Clone 25G579 Purification Affinity purified Conjugate Unconjugated Applications IP, ICC, WB Sequence Similarities Belongs to the synaptobrevin family.Contains 1 longin domain.Contains 1 v-SNARE coiled-coil homology domain. Reconstitution For reconstitution add 100 ul H2O to get a 1mg/ml solution in PBS. Format Lyophilized Size 100 ug Buffer Preservative: None. Constituents: Ascites Preservative None Storage Store at +4°C short term (1-2 weeks). Aliquot and store at -20°C long term. Avoid repeated freeze / thaw cycles. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION Gene Name VAMP7 vesicle-associated membrane protein 7 [ Homo sapiens ] Official Symbol VAMP7 Synonyms VAMP7; vesicle-associated
    [Show full text]