Grant Application Form Please Complete the Following Form for IETF

Grant Application Form

Please complete the following form for IETF grant applications. This form and all the attachments below must be combined into one document before submitting electronically. Grant submissions will not be accepted otherwise.

Attachments Required 1. Specific aims of the proposal (1 page maximum). 2. Rationale of the proposal and relevance to essential tremor (1-2 pages maximum). 3. Preliminary data, if available should be incorporated into the Rationale/Relevance section. Preliminary data are not required for a proposal. However, if preliminary data are referred to in the proposal rationale, or have been used to formulate the hypotheses to be tested, such information must be formally presented in this section. 4. Research methods and procedures (1-2 pages maximum). 5. Anticipated results (half-page maximum). 6. Detailed budget and justification (1 page maximum). 7. Biographic sketch of principal investigator and all professional personnel participating in the project (standard NIH format, including biosketch and other support). 8. Copies of relevant abstracts and/or articles that have been published, are in press, or have been submitted for publication. 9. Completed conflict of interest questionnaire.

Project Title: ______

Sponsoring Institution: ______

Principal Investigator: Last Name: ______First Name: ______Middle Initial: __

Degree(s): ______Current Title/Position: ______

Department: ______

Address: ______

City: ______State: ______Postal Code: ______

Country: ______E-mail address: ______

Phone: ______Fax: ______

All grant applicants acknowledge that the Board of Directors of the IETF is the only entity authorized to award grants on behalf of the IETF and the amounts of and occasions for awarding such grants, if any shall be awarded at all, shall be wholly within the sole and exclusive discretion of said Board and its judgment shall be final and conclusive and not subject to review for any reason judicial or otherwise.

Grant Proposal - Conflict of Interest Policy

PURPOSE The International Essential Tremor Foundation (IETF) is a nonprofit, tax-exempt organization. Maintenance of its tax- exempt status is important both for its continued financial stability and for public support.Therefore, the IRS as well as state regulatory and tax officials view the operations of the IETF as a public trust, which is subject to scrutiny by and accountable to such governmental authorities as well as to members of the public.

Consequently, there exists between the members of the Medical Advisory Board, officers and members of the IETF Board of Directors, IETF employees and the public a fiduciary duty, which carries with it a broad and unbending duty of loyalty and fidelity. The officers and members of the IETF Board of Directors and IETF employees have the responsibility of administering the affairs of the IETF honestly and prudently, and of exercising their best care, skill, and judgment for the sole benefit of the IETF. Those persons shall exercise the utmost good faith in all transactions involved in their duties, and they shall not use their positions with the IETF or knowledge gained for their personal benefit.The interests of the organization must be the first priority in all decisions and actions.

PERSONS CONCERNED This statement is directed to those persons who may submit grant proposals to the IETF Medical Advisory Board. For the purposes of this policy, a relative is any person who is related by blood or marriage, or whose relationship is similar to that of persons who are related by blood or marriage.

AREAS IN WHICH THERE IS A DIRECT CONFLICT 1. A direct conflict arises if an individual is a member of the IETF Board of Directors or an employee of the IETF. Therefore, individuals who serve on the IETF Board of Directors or who are employees of the IETF are not permitted to submit grant proposals.

2. A direct conflict arises when an individual who is employed by a firm(s) that provide funding to the IETF such as, but not limited to pharmaceutical and medical device companies submit grants. Therefore, these individuals are not permitted to submit grant proposals.

AREAS IN WHICH A CONFLICT MAY ARISE NECESSITATING A REVIEW A conflict of interest, direct or indirect, may be considered to exist in some instances when individuals submit a grant:

1. There may be a conflict if an individual is a member of the board of a competing organization(s) 2. There may be a conflict if an individual is an employee of an agency, organization. or association which affect the operations of the IETF 3. There may be a conflict if an individual is a relative of a member of the IETF Board of Directors, IETF Medical Advisory Board or IETF employee 4. There may be a conflict if an individual receives gifts, gratuities, entertainment or remuneration for services with respect to individual transactions involving the IETF

A conflict of interest can arise in other instances. While it is impossible to list every circumstance giving rise to a possible conflict of interest, the above will serve as a guide to the types of activities which do as well as possibly cause conflict.

Full disclosure of any situation that might raise an actual or potential conflict of interest will be reviewed by the IETF Board of Directors in order to permit an impartial and objective determination. It should be particularly noted that this disclosure relates not only to you, but also relatives.

Individuals who submit grant proposals are to read, review and sign a Conflict of Interest Questionnaire when submitting a grant.

CONFLICT OF INTEREST QUESTIONNAIRE Grant Proposal Submissions

Pursuant to the purposes and interests of the policy adopted by the IETF Board of Directors requiring disclosure of certain interests, a copy of which has been furnished to me, I hereby state that I or relatives have the following affiliations or interests and have taken part in the following transactions which, when considered in conjunction with my relationship to the International Essential Tremor Foundation (IETF) might create or be a conflict of interest. (Write “none” where applicable).

1. Advisory Board or Panel Affiliation

2. Consulting, Speakers Bureau or Contractual Services

3. Research/Grant Support

4. Financial or Material Support not otherwise listed.

I hereby acknowledge the information given is complete and accurate to the best of my knowledge and belief. I understand that failure to accurately disclose a potential interest may cause revocation of my grant award if approved. I also understand that if any of the above circumstances change, that I am to complete a new questionnaire.

______

New York, NY 10029-6574 Grants and Contracts Office Phone: 212.824-8300 Facsimile: 212.241-3294

PI: Dr. Elena Sanchez-Rodriguez Title: Underlying the genetics mechanisms of essential tremor Sponsor: International Essential Tremor Foundation (IETF) GCO#: 15-0421-00001-01

Hello,

Please note: the GCO has officially approved of the above‐referenced proposal. This proposal may be submitted to the sponsor.

Proposals which do not require institutional signature/submission, must still be approved by the institutional official/GCO prior to submission to the Sponsor, per ISMMS policy. This email represents official GCO approval, for your records.

Please inform us of any future notifications from the sponsor.

Don’t hesitate to contact me should you have any questions or concerns.

Sincerely, Dianna Kim Title: Underlying the genetics mechanisms of essential tremor

Summary:

Essential tremor (ET) is one of the most frequent movement disorders in humans and can be associated with substantial disability, but its causes remain largely unknown. ET is a clinically and etiologically heterogeneous syndrome, with both genetic and environmental causes implicated in its pathogenesis. Although the frequency of family history in patients with ET is high (~50%), identifying the responsible underlying genes has been challenging. Complexities of essential tremor include genetic heterogeneity, different penetrance, and variable expressivity, leading to difficulties both in differential diagnosis and in genetic analysis. Recently, we have witnessed remarkable advances in the availability of tools used to identify disease-causing genes. Whole-exome sequencing (WES; DNA sequencing that targets all the exons of all genes in the genome that code for proteins) and more recently Whole-genome sequencing (WGS; DNA sequencing that targets the entire, coding and non-coding, genome), have enabled the identification of rare variant with large effect size, including unmasking missense or nonsense mutations, as well as small insertions or deletions, which have important implication in risk prediction, diagnose, and treatment of neurological disease. WGS has been shown to detect genetic changes with higher and more uniform quality than those detected by WES and can detect hundreds of potentially damaging coding variants that could be missed through WES approached. For this reason we proposed in this project to perform WGS and subsequent validation studies in 3 families presenting ET with co-existing anxiety and depression. We strongly believe that this WGS approach in a subtype of ET will help to understand the underlying mechanisms contributing to this heterogeneous syndrome. Elucidating the disease- associated mechanisms of ET is important for determining both the etiology and the overall pathophysioloy of tremor (an important unmet clinical need), understanding the disease process, and improving diagnosis and treatment of ET and possibly other neurodegenerative disease. In conclusion, our goal is to discover new genes for ET to understand the causes and the progress of the disease and help to identify new potential therapeutic targets and a more efficient diagnostic with the ultimate goal of increasing quality of life of affected patients.

1) Specific aims of the proposal (1 page maximum) The long-term goal of this proposal is to gain insights into the etiology of complex essential tremor (ET), which remains poorly understood, by determining novel gene mutations underlying and contributing to ET. ET is one of the most common neurological diseases in adult life, with a prevalence increasing steadily with age; having ET also increases the likelihood for the development of other neurodegenerative diseases (1). However, even though ~50% of ET is hereditary, conventional linkage analysis performed in ET have failed to identify causal genes (2). Recent advances in high-throughput sequencing technologies have revolutionized our capacities to decipher the human genome, providing new opportunities to better understand common and rare genetic diseases. As a result of the development of Next Generation Sequencing (NGS) technologies, whole-exome sequencing (WES), or even whole- genome sequencing (WGS), have become considerably faster and more affordable over the past 5 years. Both technologies have identified numerous rare variants important in complex neurological diseases, as well as Mendelian neurological conditions. More importantly, NGS technology has enabled the identification of rare variant with large effect size, including unmasking missense or nonsense single-base substitutions, as well as small insertions or deletions, which have important implications in risk prediction, diagnose, and treatment of neurological diseases (Figure 1 shows simplified workflows for NGS) (3). The value of NGS has been also demonstrated in the publishing explosion seen in the last three years, as more than 600 published studies used NGS to identify genes associated with a variety of disorders. Currently, WES has wider applications than WGS, largely because of its relatively lower cost (the exome is approximately 1% of the whole genome) and the notion that most sequence variations leading to a severe phenotypic effect are located in the coding part of the genome. However, increasing evidence suggests that non- coding variants cause or increase the risk of neurodegenerative diseases. Since WGS provides better coverage than WES, even in coding regions, and the cost of sequencing continues to drop, it will eventually be more time-efficient and cost-effective to perform the WGS in patients rather than to sequence the exome only. Using WES analyses, our group has identified three novel tremor-causing genes (2 for familial cortical myoclonus tremor and epilepsy and 1 for ET), but failed to identify the pathogenic gene detect in other ET family analyzed. This coupled with the fact that WGS has been show to detect genetic changes with higher and more uniform quality than those detected by WES and can detect hundreds of potentially damaging coding variants that could be missed through WES approaches led us to request funding to perform WGS in families with complex ET and subsequent validation analyses. Aim. Identify novel gene mutations underlying inherited autosomal dominant complex ET with co-existing anxiety and depression through WGS and subsequent validation analyses. Our ET sample collection includes a large family (n= 40) and two small families (n= 11 and 10) presenting with an autosomal dominant complex ET with co-existing anxiety and depression. In order to reduce cost WGS has been performed in selected members of two of these families at the New York Genome Center (NYGC) using a previous R21 grant held by Dr. Paisan-Ruiz (see preliminary data section for more information). The analyses, currently ongoing, are focused on coding and splice site regions. After analysis of the WGS data, target resequencing and Sanger sequencing will be performed in the non-sequenced family members to validate the segregation of the proposed variants. In addition, genes harboring ET-segregating mutations will be evaluated using the mention technologies in an additional cohort of sporadic cases and healthy ethnicity-matched controls for further proof of pathogenicity. Disease-segregating variants absent in controls and showing full penetrance will be considered as disease-causing mutations. We strongly believe that this study will help to understand the causes, the progress and the diagnosis of this complex disease and to identify new potential therapeutic targets for treatment with the ultimate goal of increasing health-related quality of life of affected patients and reducing health care cost. 2) Rationale of the proposal and relevance to essential tremor (1-2 pages maximum). 2.a) Background and significance Essential tremor (ET) is one of the most common movement disorders in adults. Although ET is frequently and erroneously labeled a “benign” disease, ET is a progressive, disabling disorder that produces eating, writing, body care, and driving disabilities. Medical treatment is effective in most ET patients, however many treated patients respond only partially, highlighting the need of developing more effective treatments. ET is a pathologically heterogeneous neurodegenerative disorder with a spectrum of motor and non-motor features, adding difficulty to its differential diagnosis. The ET spectrum, includes various non-motor aspects, such as cognitive and personality changes, hearing loss, depression and anxiety among others. ET is a classic example of a disorder whose interpretation has shifted from of a one-dimensional disease with prominent motor features to a multi-dimensional disease, with varied non-motor features (4, 5). Although it is debated whether non-motor manifestations in ET result from widespread neurodegeneration or are merely secondary to impaired motor functions and reduced quality of life resulting from tremor, the literature supports the hypothesis that the severity of some of these non-motor features is not correlated with tremor duration or severity, thereby indicating that these non-motor features are probably a primary feature in ET. Furthermore, ET has been overdiagnosed, suggesting that in large families some members may be misdiagnosed as affected individuals. The overdiagnosis seen in ET is partly caused by the lack of strict diagnostic criteria, as reflected in the difficulty of assessing the differential diagnosis of tremor phenotypes and the high rate of misdiagnosis reported in ET (37-50%). Both genetic and environmental causes have been implicated in the pathogenesis of ET (6, 7). However, ET genetics is a surprisingly challenging area of movement disorders research (8). Despite the high prevalence of ET families following Mendelian pattern of inheritance, the number of causative genes conclusively linked to ET remains negligible. Recently, we have witnessed remarkable advances in the availability of tools used to identify disease-causing genes (3). To date, genetic variants within the LINGO1, DRD3, HS1-BP3, SLC1A2, FUS and more recently HTRA2 genes are the sole genetic factors associated with the risk of developing ET (9-11). Two genome-wide association studies (GWAS) have found association between a single nucleotide polymorphism (SNP) close to the LINGO1 gene and SLC1A2 and ET (12). However, these mutations do not cause Mendelian forms of ET. Whole-exome sequencing (WES) had identified a nonsense mutation in the RNA-binding protein FUS in a large family with ET (10). However, a recently sequencing study of the FUS gene in 85 European familial ET patients did not show any putatively causal variants in this gene and the meta-analysis of seven available follow-up studies suggest that rare missense variants in FUS are not more common in ET patients than in general population individuals, neither in familial nor in sporadic ET patients (13). A study trying to evaluate a large ET family with co-existing dystonia using a novel genetic approach combining GWAS and WES failed to identify any copy number variant (CNV) or mutation in the FUS gene that segregated with the disease phenotype (14). More recently, a non-sense mutation in the gene HTRA2 has been identified in a six-generation consanguineous family with both essential tremor and Parkinson disease (11). These results emphasize the remarkably challenging field of tremor genetics and indicate that future studies should perhaps focus in ET subsets. A detailed evaluation of non-motor features may help us to improve our understanding of ET with regards to its clinical spectrum, and to assist us in determining whether we are dealing with a single entity or a family of diseases. Because both WES and WGS have become fruitful strategies for gene identification in both complex and Mendelian traits (15-19), both constitute the most appropriate techniques for investigating disease-causing variation in tremor phenotypes. Due to the rapid progress and continuously decreasing cost of these technologies, we here propose to apply WGS technology to our families with complex ET-anxiety-depression. WGS, considered to be the most comprehensive genetic screening, provides a much richer data set as it captures both coding and non-coding genetic variation. WGS has also been shown to be a more powerful technique for detecting coding variation (20). Additionally, the continuous progress of read coverage uniformity and allele reduced bias in WGS (19) leads to improved detection of copy number changes and de novo variations (15, 21). WGS will not only allow us to get better coverage in coding regions but also will allow us to characterize CNV with unprecedented resolution. Therefore, we strongly believe that the application of WGS to our cohorts of complex ET patients and comparison with control individuals provided by Dr. Paisan- Ruiz is by far the best strategy to accomplish our goal of identifying novel gene mutations underlying complex ET. To accomplish our goal of identifying novel gene mutations underlying a subset of complex ET with co-existing anxiety and depression, we have collected DNA samples (n=61) from 3 families suffering from dominant ET- anxiety-depression (Figure 2) as well as apparently sporadic patients with ET. All proposed patients are from the same geographical region in the North of Spain, thus reducing both locus and allelic heterogeneity and increasing statistical power for identification of disease-causing variation. Patients are subject to a full clinical workup that is headed by. Marti-Masso at the Hospital Donostia Medical Center (Spain) and includes a clinical evaluation using the Fahn-Tolosa-Marin tremor rating scale (TRS), a neurophysiological analysis with accelerometer, a magnetic resonance imaging study with voxel based morphometry (VBM), and a comprehensive neuropsychological examination. All patients included meet criteria for definite or probable ET; their progression is continually being evaluated. To address the existing clinical barriers that hinder the identification of disease-causing genetic variation in ET, we have selected for the proposed project, families presenting a specific subtype of ET with co-existing anxiety and depression from the same geographically isolated region to reduce allelic heterogeneity and increase statistical power for gene identification. Moreover, our group has already demonstrated how powerful the use of clinically well-characterized families is in identifying novel genes for movement disorders, as highlighted in some of her previous published works (22-28). 2.b) Preliminary data supporting the proposed research We are currently sequencing, analyzing, and validating WES and WGS data in two of our families (Families 1 and 2) (Figure 2). These preliminary data have been supported by a previous R21 held by Dr. Paisan-Ruiz to investigate the genetic basis of dominant and recessive ET through WES. This funding just ended and therefore I am requesting IETF funding to follow up with the data provided by this previous grant and to perform WGS in Family 3. Family 1: WES has been already performed in four affected members (10-602, 10-609, 10-611 and 10-612) and WGS in two members from the same family (10-610 and 10-612). After WES analysis we failed to detect any potential disease-segregating mutation. Both, WES and WGS have been performed in one affected member of this family (10- 612). WGS identified an average of 24,711 coding variants whereas WES an average of 22,688. Importantly, the number of novel coding missense variants detected by WGS and missed by WES (424) was much larger that the number of novel coding missense variants identify by WES and missed by WGS (210) and only 6% of these variants were detected by both methods (Figure 3). Our data support the fact that WGS is more powerful than WES for detecting potential disease-causing mutations in the exome. Candidate mutations detected by WGS but not through WES will be tested for segregation in non-WGS affected and unaffected members of this family by Targeted resequencing, which is a most cost-effective approach than Sanger sequencing. Family 2: WES has been performed in four individuals from this family (2 members with apparently only common tremor and 2 members with complex ET-anxiety-depression). After adequate filtering and by keeping variants only shared by affected individuals, we were left with 14 missense variants as potential disease-associated mutations. For one of these variants, predicted to be pathogenic with a MutPred score of 0.77, Sanger sequencing has already been performed in all family members for disease-segregation analysis. However, as this latter variant did not segregate with disease, we are now testing if any of the other variants segregate with disease. Currently we are also carrying out WGS in the same 4 members in which WES was performed and 2 additional affected members from this family. We are expecting to find novel candidate variants shared by all affected members and no detected previously by WES as shown by our previous WGS data (Family 1, Figure 2). Because families 1 and 2 present individuals with apparently only common tremor and individuals with complex tremor-anxiety-depression phenotype, we will analyze separately individuals presenting complex tremor to detect a second mutation specific for this complex subtype of ET. In addition, we will analyze in these individuals CNV for possible structural changes lead to this specific subset of ET. These new WGS data will be ready in a few weeks and will be analyzed in the next 3-4 months. If this proposal gets funded by IETF we expect that by beginning of July 2015, candidate disease-causing mutations in Families 1 and 2 will already be identified. Therefore, we will be ready to start validation and disease-segregation studies through Sanger and Target sequencing in the non-sequenced family members. These studies together with the WGS and analysis of Family 3 will take the major time in the proposed project. However, data obtained from this proposal will allow me, as a senior postdoctoral fellow, to apply for further grants to carry out functional studies in the disease- causing variants found here. 2.c) Relevance to Essential Tremor Finding genetic causes in individuals presenting ET has been a real challenge for geneticists due to the existing clinical barriers associated with ET, and remains a serious and ongoing public health burden. However, with the advent of NGS, the identification of almost every genetic variant that exists in a genome or an exome is now feasible. WES, despite of its limitations, has successfully been employed for disease-causing mutations’ identification in several neurological phenotypes, including Parkinson disease (PD), cerebral palsy, sclerosis lateral amyotrophic and spastic paraplegia, among others (18). On the other hand, WGS provides an improved uniformity in read coverage, allowing better sequencing and mapping approaches and displaying and increased sensitivity for coding variation detection (19). Other potential causes for the repeated lack of success in genetic studies in ET include complex modes of inheritance or the presence of phenocopies. In fact, a fundamental problem with ET genetic resides in the definition of the phenotype and its highly variable penetration. In the context of rare coding variants, it is plausible that we are not facing single highly penetrant coding variants that segregate with the phenotype, but a collection of rare variants with variable penetrance that result in a heterogeneous phenotype. Therefore, we strongly believe that with the execution of the proposed project, which aims to apply WGS to clinically well-characterized subtype of ET patients with co-existing anxiety and depression, novel disease-causing mutations underlying complex ET will be identified. This not only is important and necessary for determining both the etiology and the overall pathophysiology of tremor, which are poorly understood, but also for improving both diagnosis and treatment in ET patients, thus reducing health care cost and benefiting human health. 3) Research methods and procedures (1-2 pages maximum). Description of the samples: A series of 3 families presenting a dominant form of ET with co-existing anxiety and depression have been collected (Figure 3). In addition, we have samples for apparently sporadic patients with ET (n= 62) and ethnicity-matched control cohort (n= 175). All patients are from the same isolated geographical region in the North of Spain and are subject to a continuing full clinical analysis and including exhaustive clinical, neurophysiological, neuroimaging, and neuropsychological examinations. Control data: WES data generated in ethnicity-matched cases with other diseases is also available for exclusion of rare genetic variation that is population-specific and not clinically relevant. Whole Genome Sequencing procedures: WGS in selected members of families 1 and 2 has been already performed with previous R21 funding (PI: Dr. Paisan-Ruiz) at The New York Genome Center (NYGC) (see Preliminary data section). NYGC has extensive experience in WGS and many other types of next generation sequencing and analysis, and have provided end-to-end security and quality control from reception of incoming samples to final delivery of data. Briefly,after quality control (QC) of DNA quality, sequencing libraries for the HiSeq X are prepared using the TruSeq PCR-free DNA sample preparation kit (Illumina). Intact genomic DNA is sheared using the Covaris sonicator, followed by end-repair and bead based size selection of fragmented molecules. The selected fragments are then be poly-A tailed, and Illumina sequence adaptors ligated onto the fragments, followed by PCR amplification and final library QC. Sequencing is performed in the HiSeq X instrument. (Figure 1). Data analysis: WGS data is being processed through an automated pipeline at NYGC’s high-performance computational facility. Paired-end 150bp reads will be aligned to the GRCh37 human reference using the Burrows-Wheeler Aligner and processed using the GATK best-practices pipeline that includes marking of duplicate reads by the use of Picard tools (v1.83), realignment around indels, and base recalibration via Genome Analysis Toolkit. Variants will be called using GATK HaplotypeCaller. Variant annotation will be performed using SnpEff, VCFtools and in-house software. Annotations of variants include predictions of the effect of nucleotide change on protein sequence using SnpEff; variant frequencies in different populations from 1000 Genome Project, NHLBI GO Exome Sequencing Project; cross-species conservation scores from PhyloP, Genomic Evolutionary Rate Profilling, PhastCons; functional prediction scores from Polyphen2 and SIFT; variant disease associations from OMIM, Clinvar, Genetic Association Database (GAD) (Figure 4). WGS strategy for the identification of clinically relevant genetic variants in ET: The analysis is being confined to the coding and splice site variations. Genetic variants mapping into intra-genic, intronic, and non-coding exonic regions are being removed for further analysis (Follow-up project). i) Any potential mutation observed as common variation (frequency > 5%) in the latest SNPs databases have been removed, as they are unlikely to be pathogenic. ii) Common genetic variations present in the ethnicity-matched controls whole genome sequenced, and exomes generated in house (23) are also been removed. iii) To determine the disease-causing allele(s) in each of our families with a pattern of dominant inheritance, meaning that one mutant allele is sufficient to cause disease, novel heterozygous variants are being prioritized as potential disease-associated candidates. iv) To assist in gene identification, the pathogenicity of each novel coding allele identified is also being predicted by two additional computational methods (MutPred and SNPs&GO). Validation and segregation analysis: Priority candidates will be validated through Sanger sequencing or targeted sequencing approaches depending on the total number of candidates, and examined in additional non-sequenced family members for disease segregation analysis. If the total number of candidate genes is ≤15 validation will be performed by Sanger sequencing. However, if candidates genes for validation are >16 then Targeted sequencing will be used. Targeted sequencing using Haloplex target enrichment system enables us to capture and sequence a genomic region of interest. This system in a cost-effective approach with the advantage of screening numerous genes in patients and once the library is established, it can be used for repetitive interrogation of the same genomic regions in different individuals. Briefly, based on the RefSeq gene set, exonic regions of the genes of interest will be captured using a SureSelect Target Enrichment System kit (Agilent Technology) and sequenced through MySeq system (Illumina). The generated reads will be aligned to the GRCh37 human reference sequence and the bioinformatics analysis workflow will be as described previously in Figure 4. Furthermore, variants segregating with disease will be tested by Sanger sequencing in an additional Spanish controls cohort (n= 175) for further proof of pathogenicity. Finally, disease-causing variants found in this study will be tested in additional families presenting with common ET (Families provided by Dr. Paisan-Ruiz) to prove if those mutations are specific of ET-anxiety- tremor phenotype or can as well be found in common ET as well. 4) Anticipated results and future directions (half-page maximum) Based in our previous work and the preliminary data presented here, we are confident that at the end of this grant novel coding disease-causing mutations for complex ET will be identified. Consistent with previous studies illustrating the clinical heterogeneity of ET, we suggest that these families with autosomal dominant ET with co- existing anxiety and depression represent a subtype of ET. Clustering large families into similar phenotypes, such as the ET-anxiety-depression subtype, will likely help in genetics studies to reduce the noise caused by etiological heterogeneity. This approach is crucial for drawing accurate genotype-phenotype correlations and will undoubtedly improve diagnosis for ET and family counseling and will reveal new therapeutic targets. Clinical use of NGS methods offers an unbiased genotype-based approach, which can facilitate molecular diagnostics. Thus, targeted sequencing methods with a selected panel of candidate ET genes can be used as a cost-effective, first-line genetic test for the evaluation of patients with ET. This approach will decreases time to diagnosis, increases diagnostic rate, and provides insight into the genotype-phenotype correlation of ET in a cost-effective way. Exploring the pathogenic mechanisms of novel identified ET-associated mutations will be one of the next steps to follow in this project. The functionality of these causal mutations and their pathological implications will be tested using molecular in vitro and in vivo approaches. Our laboratory has demonstrated experience in in vitro studies (23)(29) and recently, I have started a new independent research line in our group using zebrafish as animal models to directly explore the molecular and cellular mechanisms by which these mutations lead to ET. In addition, the next challenge in disease research will be to study the role of variations in the non-coding part of the genome and structural variations such as CNV. Although the causal interpretation of non-coding genetic variants demands further advances in the understanding of non-coding regulatory and functional elements and in the identification of both genetic and environmental modifiers, WGS has been proved to be a well-justified strategy for the discovery or rare non-coding alleles underlying Mendelian and complex traits. This work will most likely extend beyond the timeline of this grant. In this sense, the data emerging from this project will give enough preliminary data for follow-up studies (identify the role of the non-coding genetic variations and define the functional role of these novel elements contributing to the pathophysiology of ET) and will allow me as a senior postdoctoral with more than 5 years of experience, to apply for my own research grants (NIH,…), and helping me to establish my independent career. 5) Detailed budget and justification (1 page maximum) Equipment: This project will be carrying out at Icahn School of Medicine at Mount Sinai in Dr. Paisan-Ruiz laboratory (Department of Neurology). Her well-established laboratory has all necessary equipment to carry out the proposed project. In addition, WGS will be performed at NYGC premises that count with all necessary material and equipment. Personnel: Elena Sanchez-Rodriguez, PhD, Postdoctoral Fellow, Principal Investigator (2.5%). Dr. S-R will design experiments, data analysis, Sanger sequencing, report results ($1,677). Coro Paisan-Ruiz, PhD, Mentor. Dr. P-R will advise, supervise analysis, support with equipment and material (no salary support is requested for Dr. P-R). Supplies: Whole Genome Sequencing: $4,500 Sanger Sequencing: $5,807 Target Re-sequencing: $11,016 Publication costs: We are requesting $2,000 for publication expenses.

References 1. E. D. Louis, Lancet Neurol 9, 613 (Jun). 2. A. Zimprich, Curr Opin Neurol 24, 318 (Aug). 3. J. Bras, R. Guerreiro, J. Hardy, Nat Rev Neurosci 13, 453 (Jul). 4. E. D. Louis et al., Mov Disord 16, 914 (Sep, 2001). 5. W. J. Lombardi, D. J. Woolston, J. W. Roberts, R. E. Gross, Neurology 57, 785 (Sep 11, 2001). 6. E. D. Louis, Neuroepidemiology 31, 139 (2008). 7. H. Deng, W. Le, J. Jankovic, Brain 130, 1456 (Jun, 2007). 8. C. M. Testa, Tremor Other Hyperkinet Mov (N Y) 3. 9. G. Kuhlenbaumer, F. Hopfner, G. Deuschl, Neurology 82, 1000 (Mar 18). 10. N. D. Merner et al., Am J Hum Genet 91, 313 (Aug 10). 11. H. Unal Gulsuner et al., Proc Natl Acad Sci U S A 111, 18285 (Dec 23). 12. H. Stefansson et al., Nat Genet 41, 277 (Mar, 2009). 13. F. Hopfner et al., Mov Disord, (Jan 28). 14. P. Gonzalez-Alegre et al., Tremor Other Hyperkinet Mov (N Y) 4, 258. 15. C. Gilissen et al., Nature 511, 344 (Jul 17). 16. A. B. Singleton, Lancet Neurol 10, 942 (Oct). 17. M. J. Bamshad et al., Nat Rev Genet 12, 745 (Nov). 18. C. E. Krebs, C. Paisan-Ruiz, Front Genet 3, 75. 19. A. M. Meynert, M. Ansari, D. R. FitzPatrick, M. S. Taylor, BMC Bioinformatics 15, 247. 20. A. Belkadi et al., Whole-genome sequencing is more powerful than whole-exome sequencing for detecting exome variants. 21. D. I. Ritter et al., Genet Med, (Jan 8). 22. C. Paisan-Ruiz et al., Neuron 44, 595 (Nov 18, 2004). 23. C. E. Krebs et al., Hum Mutat 34, 1200 (Sep). 24. M. C. Kruer et al., Neurology 74, 1473 (May 4). 25. J. F. Marti-Masso et al., Hum Genet 131, 435 (Mar). 26. C. Paisan-Ruiz et al., Ann Neurol 65, 19 (Jan, 2009). 27. C. Paisan-Ruiz, G. Scopes, P. Lee, H. Houlden, Am J Med Genet B Neuropsychiatr Genet 150B, 993 (Oct 5, 2009). 28. S. Camargos et al., Lancet Neurol 7, 207 (Mar, 2008). 29. E. Sanchez et al., Scientific Reports (submitted)

OMB No. 0925-0001/0002 (Rev. 08/12 Approved Through 8/31/2015)

BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors. Follow this format for each person. DO NOT EXCEED FIVE PAGES. NAME: Elena Sanchez-Rodriguez eRA COMMONS USER NAME (credential, e.g., agency login): ERODRIGUEZ14

POSITION TITLE: Postdoctoral Fellow at Department of Neurology at Icahn School of Medicine at Mount Sinai.

EDUCATION/TRAINING (Begin with baccalaureate or other initial professional education, such as nursing, include postdoctoral training and residency training if applicable. Add/delete rows as necessary.) Completion DEGREE Date FIELD OF STUDY INSTITUTION AND LOCATION (if applicable) MM/YYYY

University of Granada, Granada, Spain B.S. 07/2002 Biology University of Granada, Granada, Spain PhD 11/2008 Genetics King’s College London, London, UK Postdoctoral 09/2013 Immunogenetics

NOTE: The Biographical Sketch may not exceed five pages. Follow the formats and instructions below.

A. Personal Statement I am a Senior Posdoctoral Fellow at Department of Neurology in Icahn School of Medicine at Mount Sinai. My work focuses on elucidating and understanding the molecular basis underlying and contributing to Essential tremor (ET), Parkinson Disease (PD), parkinsonian-like syndromes, and other movement disorders. To accomplish this I employ a variety of molecular biology techniques, such as homozygosity mapping, whole exome sequencing, whole genome sequencing, target re-sequencing, RNA-seq, and animal models as functional approaches to identify disease-causing genes and the role of these genes in the pathogenesis of the disease. I have the expertise and motivation necessary to successfully carry out the proposed work. I have a broad background in genetics of human diseases, high throughput genomic techniques and big data analysis. In addition, as a Marie Curie Intra-European Fellow at King’s College London (UK), I have acquired skills in more functional Molecular and Cell Biology techniques such as immunoassays, cell culture, animal models, and flow cytometry among others. In summary, I have a demonstrated record of accomplished and productive research projects in the area of human genetics, and my expertise and experience have prepared me to carry out the proposed project.

B. Positions and Honors Positions and Employment 2003-2008 PhD student. Instituto de parasitologia y biomedicina Lopez-Neyra (CSIC), Granada, Spain.

2008-2009 Postdoctoral Fellow Instituto de parasitologia y biomedicina Lopez-Neyra (CSIC), Granada, Spain.

2010-2011 Associate Research Scientist, Oklahoma Medical Research Foundation, Oklahoma City, OK, United States.

2011-2013 Marie-Curie Intra-European Postdoctoral Fellow, King’s College London, London, United Kingdom.

2013- Postdoctoral Fellow, Icahn School of Medicine at Mount Sinai, New York City, NY, USA.

Other Experience and Professional Memberships 2003- Member, Spanish Society of Immunology (www.inmunologia.org) 2004- Member, European Federation of Immunogenetics (EFI), (www.efiweb.org ) 2007-2012 Member, Spanish Society of Rheumatology (www.ser.es) 2010- Member, American Society of Human Genetics (www.ashg.org)

Honors 2008 Thesis dissertation: “Molecular basis of systemic lupus erythematosus: Identification of genetic markers”, University of Granada, Spain. Mark: Excellent Cum laude (with Honors). 2008 European Doctorate degree: “Molecular basis of systemic lupus erythematosus: Identification of genetic markers”. Mark: Excellent Cum laude (with honors). 2008 Award for Best Poster presentation at the 2nd Congress of the Andalusia Association of Autoimmune Diseases, Granada, Spain (www.aadea.es). 2009 Rheumatology Young Researcher Travel Award (http://rheumatology.oxfordjournals.org)

C. Contribution to Science 1. During my early research stage as a PhD student I have identified some of the most relevant genes associated with systemic lupus erythematosus (SLE) in European-descent populations. These findings have enormous contributed to the understanding of the physiological pathways involves in SLE and some of these genes such as PTPN22 was established as the first common genetic component of autoimmunity. I served as the primary investigator or co-investigator in all of these studies.

a. Orozco G*, Sánchez E*, Gonzalez-Gay MA, López-Nevot MA, Torres B, Caliz R, et al. Association of a functional single nucleotide polymorphism of PTPN22, encoding lymphoid protein phosphatase, with rheumatoid arthritis and systemic lupus erythematosus. Arthritis and Rheumatism 2005; 52:219-224. *Co-first Authors. b. Sánchez E, Abelson Ak, Sabio JM, González-Gay MA, Ortego-Centeno N, Jiménez-Alonso J, et al. Association on a CD24 gene polymorphism with susceptibility to systemic lupus erythematosus. Arthritis and Rheumatism 2007; 58:3080-3086. c. Delgado-Vega AM*, Abelson AK*, Sánchez E*, Witte T, D´Alfonso S, Lima G, et al. Replication of the TNFSF4 (OX40L) promoter region association with systemic lupus erythematosus. Genes and Immunity 2008; 10: 248-253.*Co-first Authors. d. Abelson AK*, Delgado-Vega AM*, Kozyrev SV*, Sánchez E*, Velázquez-Cruz R, Eriksson N, et al. The Genetic Association of STAT4 with SLE Occurs Through Several Independent Effects, Correlates with Gene Expression and Acts Additively with IRF5 to Increase Risk. Ann Rheum Dis 2009; 68:1746-1753. *Co-first Authors

2. In addition, during these early studies I collaborated with the leading groups in the field in order to established the functional role of some of these genes in the development of the SLE. One of the major accomplishments though this collaboration were a) the discovery of the new gene BANK1 implicated in susceptibility to SLE, with variants affecting regulatory sites and key functional domains. These disease-associated variants contribute to sustained B cell-receptor signaling and B-cell hyperactivity characteristic of this disease. b) Kallikrein genes are protective disease-associated genes in anti-GBM antibody-induced nephritis and lupus. Another important discovery in which I was the primary investigator was a variant in the promoter region of the pro-inflammatory IL18 gene associated with SLE and its implication in gene expression and regulation. a. Kozyrev SV, Abelson AK, Wojcik J, Zaghlool A, Linga Reddy MVP, Sánchez E, et al. The B Cell Gene BANK1 is Associated with Systemic Lupus Erythematosus Through the Effect of Several Functional Variants. Nature Genetics 2008; 40:211-216. b. Liu K*, Li QZ*, Abelson AK*, Sánchez E*, Kelly JA*, Li L, Liu Y, et al. Kallikrein genes are associated with lupus and glomerular basement membrane-specific antibody-induced nephritis in mice and humans. J Clin Invest 2009; 119: 911-923 *Co-first Authors. c. Sánchez E, Palomino-Morales RJ, Ortego-Centeno N, Jiménez-Alonso J, González-Gay MA, López-Nevot MA, et al. Identification of a new putative functional IL18 gene variant through an association study in systemic lupus erythematosus. Hum Mol Genet 2009; 18: 3739-3748.

3. After I got my Phd I focused my work in deciphering the genetics basis of SLE in different ethnic background such as Hispanic, African-American and Asian. SLE is a disease in which health and prevalence disparities are clearly present, as it more severely affects females, young persons and individuals of African-American or Hispanic origin. However, the genetic differences implicates in these disparities were not previously reported. We performed the largest genomic study in four ethnically different populations to date with more than 14,000 samples in multicenter study collaboration. These studies corroborate the genetic increased risk of SLE in African-American and Hispanics compared with European-descent patients. In addition, we have described the main genes/SNPs associated with each different background. In addition we have performed the first GWAS in SLE patients with a Hispanic origin and subsequently identified Hispanic-exclusive SLE genes a. Sánchez E, Webb R, Rasmussen A, Kelly JA, Riba L, Kaufman KM, et al. Genetically Determined amerindian ancestry correlates with increased frequency of risk alleles for systemic lupus erythematosus. Arthritis Rheum 2010; 62:3722-3729. b. Sanchez E, Nadig A, Richardson BC, Freedman BI, Kaufman KM, Kelly JA, et al. Phenotypic associations of genetic susceptibility loci in systemic lupus erythematosus. Ann Rheum Dis 2011; 70:1752-1757. c. Sanchez E, Comeau ME, Freedman BI, Kelly JA, Kaufman KM, Langefeld CD, et al. Identification of novel genetic susceptibility loci in African-American lupus patients using a candidate gene association study. Arthritis Rheum 2011; 63:3493-501. d. Hughes T, Adler A, Merrill JT, Kelly JA, Kaufman KM, Williams A, Langefeld CD, Gilkeson GS, Sanchez E, et al. Analysis of autosomal genes reveals gene-sex interactions and higher total genetic risk in men with systemic lupus erythematosus. Ann Rheum Dis 2012; 71(5): 694-9. e. Sanchez E, Rasmussen A, Riba L, Acebedo E, Kelly JA, Langefeld CD, et al. Impact of Genetic Ancestry and Socio-Demographic Status on the Clinical Expression of Systemic Lupus Erythematosus in Amerindian-European Populations. Arthritis Rheum 2012 Nov;64(11):3687-9.

Complete List of Published Work in MyBibliography: http://www.ncbi.nlm.nih.gov/sites/myncbi/1VkDQC7ocxQz/bibliograpahy/47420892/public/?sort =date&direction=ascending

D. Research Support

Current Research Support

Title: Dissecting the genetic underpinnings of essential tremor (R21) Funding Source: NINDS (NIH) Duration: 03/15/13-02/28/15 Goal: To gain insights into the etyology of essential tremor, which remains poorly understood, by determining novel coding gene mutations underlying tremor. Role: Postdoctoral Fellow

Completed Research Support Title: Genetics of Systemic lupus erythematosus in northern and southern European Populations. Funding Source: European Commission, FP7-PEOPLE-2009-IEF, Marie Curie Intra-European Fellowships for Career Development (IEF). Duration: 2011/2013 Goals: To define the genetic basis of SLE in different populations from Northern and Southern Europeans and to explore the possible phenotypic associations of the disease-associated genes with the disease. Role: PI

Title: Identification of Susceptibility Genes for SLE of Amerindian Origin in Hispanics. Funding Source: National Institute of Health (NIH/NIAMS) Duration: 2009/2011 Goals: To perform a genome-wide association scan with 2,000,000 markers in 600 Hispanic SLE cases and 200 controls and 600 out-of-study controls as a first stage towards the identification of genes of Amerindian origin for lupus in Hispanics and replicate the putative genetic associations in large sets of independent Hispanic cases and controls in a second stage analysis. Role: Co-investigator

OMB No. 0925-0001/0002 (Rev. 08/12 Approved Through 8/31/2015)

BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors. Follow this format for each person. DO NOT EXCEED FIVE PAGES. NAME: Coro Paisán-Ruiz eRA COMMONS USER NAME (credential, e.g., agency login): PAISANC11

POSITION TITLE: Tenure-track Assistant Professor, Departments of Neurology, Psychiatry, and Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, New York, USA. EDUCATION/TRAINING (Begin with baccalaureate or other initial professional education, such as nursing, include postdoctoral training and residency training if applicable. Add/delete rows as necessary.) DEGREE Completion (if Date FIELD OF STUDY INSTITUTION AND LOCATION applicable) MM/YYYY

University of Navarra - Faculty of Sciences, B.Sc. 9/98 Medical Sciences Pamplona, Spain University of The Basque Country - Faculty of Ph.D. 2/06 Neurosciences Medicine, San Sebastian, Spain Genetics of Parkinson’s National Institute on Aging, NIH, Bethesda, US Postdoctoral 12/07 disease and related disorders Genetics of Movement UCL Institute of Neurology, London, UK Postdoctoral 07/10 Disorders

A. Personal Statement

I have the expertise, leadership, training, and motivation necessary to successfully carry out the proposed research project. My laboratory focuses on the identification and characterization of genes underlying Parkinson’s disease (PD), Essential Tremor (ET), and other complex forms of Parkinsonism. To accomplish this ambitious goal, we employ state-of-the-art molecular genetic techniques, such as whole exome (WES), whole genome (WGS), whole transcriptome, and custom panel sequencing technologies, and conduct cellular and animal (zebrafish) work to further characterize novel disease-causing mutations. Through the identification of LRRK2 (ref. 1), PLA2G6 (ref. 2), and SYNJ1 (ref. 5) as causative genes for Parkinson’s disease, I have made significant contributions to the understanding of Parkinson’s genetics and biology. I have played a leading role in all these projects, being responsible for the conception, execution, resolution, and interpretation of all molecular analyses carried out. In the proposed project I plan to make use of the recently emerged whole-genome sequencing technology in order to achieve genetic findings in a more cost-effective and less time-consuming way than conventional techniques. I am very familiar with the use and analysis of whole- exome sequencing technologies, with which we have identified the first pathogenic mutations in early-onet generalized dystonia (GCDH, ref. 3), in progressive myoclonus epilepsy (COL6A2; ref. 4), in recessive parkinsonism with seizures (SYNJ1; ref. 5), in familial cortical myoclonic tremor and epilepsy (ACMSD; ref. 6), and in essential tremor (SORT1, under submission). In summary, I have the expertise, leadership, and motivation necessary to successfully carry out the proposed work. I have a demonstrated record of successful and productive work that has remarkably contribute to the field of movement disorder genetics, and my expertise, experience, and enthusiasm have prepared me to lead the proposed research.

1. Paisán-Ruiz C*, Jain S*, Evans EW, Gilks WP, Simon J, van der Brug M, Lopez de Munain A, Aparicio S, Gil AM, Khan N, Johnson J, Martinez JR, Nicholl D, Carrera IM, Pena AS, de Silva R, Lees A, Marti- Masso JF, Perez-Tur J, Wood NW, and Singleton AB. Cloning of the gene containing mutations that cause PARK8-linked Parkinson's disease. Neuron. 2004 Nov 18; 44(4): 595-600.

2. Paisán-Ruiz C, Bhatia KP, Li A, Hernandez D, Davis M, Wood NW, Hardy J, Houlden H, Singleton A, and Schneider SA. Characterization of PLA2G6 as a locus for dystonia-parkinsonism. Ann Neurol. 2009 Jan; 65(1): 19-23. 3. Marti-Masso JF, Ruiz-Martinez J, Makarov V, Lopez de Munain A, Gorostidi A, Bergareche A, Yoon S, Buxbaum JD, and Paisán-Ruiz C. Exome sequencing identifies GCDH (Glutaryl-Coa-dehydrogenase) mutations as a cause of a progressive form of early-onset generalized dystonia. Hum Genet. 2012 Mar; 131(3): 435-442. Epub Sep13 2011 4. Karkheiran S, Krebs CE, Makarov V, Nilipour Y, Hubert B, Darvish H, Frucht S, Shahidi GA, Buxbaum JD and Paisán-Ruiz C. Identification of COL6A2 mutations in progressive myoclonus-epilepsy syndrome. Human Genet. 2013 Mar; 132(2): 275-283. Epub 2012 Nov 9th. 5. Krebs KE*, Karkheiran S*, Powell JC, Cao M, Makarov V, Darvish H, Di Paolo G, Walker RH, Shahidi GA, Buxbaum JD, De Camilli P, Yue Z, and Paisán-Ruiz C. The Sac1 domain of SYNJ1 identified mutated in a family with early-onset progressive parkinsonism with generalized seizures. Rapid communication. Hum Mutat. 2013 Sep; 34(9): 1200-12007. doi: 10.1002/humu.22372 6. Martí-Massó JF, Bergareche A, Makarov V, Ruiz-Martinez J, Gorostidi A, López de Munain A, Poza JJ, Buxbaum JD, and Paisán-Ruiz C. Identification of a nonsense ACMSD mutation (p.W26X) in familial cortical myoclonic tremor with epilepsy and parkinsonism. J Mol Med. 2013 Dec; 91(12): 1399-1406.

B. Positions and Honors Positions and Employment 2000-2004 PhD student Fellowship, Hospital Donostia, San Sebastian, Spain. 2004-2006 PhD student Fellowship, Division of Intramural Research, National Institute on Aging, NIH, Bethesda, MD, USA. 2006-2008 Research Fellow, Division of Intramural Research, National Institute on Aging, NIH, Bethesda, MD, USA. 2008-2010 Senior Research Fellow, UCL Institute of Neurology, London, United Kingdom. 2010-Present Assistant Professor, Departments of Neurology, Psychiatry, Genetics and Genomic Sciences Icahn School of Medicine at Mount Sinai, New York, USA.

Other Experience and Professional Memberships 2009- Present Associate Editor, BMC Neurology 2010-2011 Member of International Society for Eye Research (ISER) 2011- Present Editorial Member, Journal of Neurology Research 2011- Present Professor, Master Degree in Movement Disorders. University of Murcia, Editorial Viguera, Spain 2014- Present Member of the Medical and Scientific Advisory Council (MSAC) of the Dystonia Medical Research Foundation (DMRF) 2014- Present Peer Reviewed Medical Research Program, Pre-Dystonia (PRE-DYS), Defense Medical Research and Development Program, Department of Defense, USA 2014- Reviewer for MCHDI Pilot Program 2014, Mindich Child Health and Development Institute, Icahn School of Medicine at Mount Sinai, USA 2014- Expert reviewer for Orphanet (http://www.orpha.net/) in the following diseases: Young adult- onset Parkinsonism, atypical juvenile parkinsonism, and hereditary late-onset Parkinson disease.

Honors 2002 2nd “Dr Don Jose Beguiristain” Award for the work entitled “Parkinson’s Disease in Guipuzcoa, Spain.” Spain. 2008 Extraordinary Degree Award for PhD thesis entitled “Molecular Studies in Parkinson’s Disease”, University of Basque Country, Bilbao, Spain. 2010 23rd Khwarizmi International Award (KIA). Awardees: Drs Elahe Elahi, Mehdi Shojaee, and Coro Paisán-Ruiz. 2012 Lucien Côté Early Investigator Award in Clinical Genetics, Parkinson’s Disease Foundation (PDF), New York, USA. The Côté Award will support postdoctoral researchers and junior faculty in the New York City metropolitan area whose clinical or basic science investigations explore the genetics of Parkinson’s disease. 2013 Dr. Harold and Golden Lamport Research Award, Icahn School of Medicine at Mount Sinai, New York, USA. This award is given to tenure-track Assistant Professors who show exceptional potential for making significant contributions over an extended period of time.

C. Contribution to Science

1. During my scientific career I have actively contributed key findings that underpin PD genetics and biology: I have not only identified three genes underlying PD [LRRK2 (PARK8, ref. 1), PLA2G6 (PARK14, ref. 2), and SYNJ1 (PARK20, ref. 5)], but have also contributed to the identification of many other PD-associated mutations, including the most common mutation identified to date in PD [G2019S, refs: a, b, c, d]. My research in genetics of movement disorders has been highly recognized in academic and clinical spheres as evidenced by my high profile publications (average citation per article: 61.08; h-index: 28) and the application of LRRK2, PLA2G6, and SYNJ1 testing in the diagnosis of PD. My first article describes the identification of a novel gene (LRRK2), which mutations cause an autosomal dominant form of Parkinson’s disease (PD). This work was truly a breakthrough discovery: LRRK2 mutation is today considered the most common cause for both familial and sporadic PD and due to its relative frequency, both state and private companies are now investing a large sums of money (over $40 million) in LRRK2-related research. Michael J. Fox Foundation is currently funding a large LRRK2 consortium of more than 30 investigator teams to test critical hypotheses about both normal and pathological LRRK2 in addition to its LRRK2 Challenge program that focuses on the development of novel therapeutic strategies targeting LRRK2. a. Nichols WC, Pankratz N, Hernandez D, Paisán-Ruiz C, Jain S, Halter CA, Michaels VE, Reed T, Rudolph A, Shults CW, Singleton A, and Foroud T; Parkinson Study Group-PROGENI investigators. Genetic screening for a single common LRRK2 mutation in familial Parkinson's disease. Lancet. 2005 Jan 29-Feb 4; 365 (9457): 410-412. b. Hernandez DG, Paisán-Ruiz C, McInerney-Leo A, Jain S, Meyer-Lindenberg A, Evans EW, Berman KF, Johnson J, Auburger G, Schaffer AA, Lopez GJ, Nussbaum RL, and Singleton AB. Clinical and positron emission tomography of Parkinson's disease caused by LRRK2. Ann Neurol. 2005 Mar; 57 (3): 453-456. c. Paisán-Ruiz C, Lang AE, Kawarai T, Sato C, Salehi-Rad S, Fisman GK, Al-Khairallah T, St George-Hyslop P, Singleton A, and Rogaeva E. LRRK2 gene in Parkinson disease. Neurology. 2005 Jun 15; 65(5): 696- 700. d. Paisán-Ruíz C, Nath P, Washecka N, Gibbs JR, and Singleton AB. Comprehensive analysis of LRRK2 in publicly available Parkinson’s disease cases and neurologically normal controls. Hum Mutat. 2008 Apr; 29 (4): 485-490.

2. In 2013, my group identified the first SYNJ1 (Synaptojanin 1) mutations in patients featuring recessive parkinsonism with generalized seizures (ref. 5) and showed that SYNJ1 mutation, in particular the mutation we identified, impairs the Sac1-like domain activity of synaptojanin 1 and consequently its synaptic functions (ref. 5). The identification of a SYNJ1 mutation linked to parkisonism is very interesting because this lipid metabolizing enzyme is a key regulator of phosphoinositide metabolism in the nervous system and has been shown to regulate key synaptic processes, such as the recycling of synaptic vesicles, the internalization of AMPA receptors, as well as actin dynamics. Moreover SYNJ1 deficiency in mice, c. elegans, and zebrafish results in severe nervous system defects, such as weakness, poor motor coordination, ataxia, and abnormal balance, posture, and locomotion. Taken together, this finding adds further evidence that defects in membrane trafficking at the synapse may be key factors in the development of both Parkinson disease and parkinsonism, and suggests phosphoinositide metabolism, the Sac1-like domain in particular, as a novel therapeutic target for parkinsonism. After our discovery, other

research groups have recently linked SYNJ1 mutation with several epileptic syndromes and tau pathology, further implicating the role of Synaptojanin 1 in the development of several neurological phenotypes.

3. Through the identification of a gene for essential tremor (under submission), and 2 genes for familial cortical tremor and epilepsy (ref. 6, and in preparation), we have made relevant contributions to the genetics and biology of tremor. Despite significant efforts made to identify the genetic basis of tremor, with linkage, genome wide association, and candidate gene studies failing to detect reliable risk and causative alleles for tremor, we recently identified a disease-segregating mutation (p.G171A) that results in sortilin deficiency by performing WES analyses in a dominant family with ET. Although the expression of sortilin is known to be altered in aging of the nervous system and under pathological conditions, it was never associated with the development of tremor. Moreover, given the role of sortilin in proneurotrophins-induced neuronal apoptosis via its interaction with p75 neurotrophin receptor (p75NTR), we also sought to determine whether the SORT1 mutation we identified alter the p75NTR mRNA levels. The mRNA levels of p75NTR, which also modulates cholinergic transmission, were found significantly higher in mutant cells when compared to wild-type. Considering that p75NTR is not only upregulated in pathological conditions but also in impaired GABAergic transmission, it is very likely that the sortilin deficiency caused by the p.G171A mutation might also be responsible for defects in neurotransmission, resulting in both the development of tremor and high p75NTR expression. Taken together, this study associates sortilin downregulation and p75NTR upregulation, already known to play role in neurodegeneration and impairment of the central nervous system, with the development of essential tremor, further contributing to the discovery of the molecular mechanisms underlying Essential Tremor.

Complete List of Published Work in My Bibliography: http://www.ncbi.nlm.nih.gov/sites/myncbi/collections/bibliography/45263726/

In summary, my research contributes enormously to the advance of movement disorder genetic and biology since breakthrough discoveries of new disease-causing genes (mutations) 1) are immediately effective in translation into clinical practice, providing diagnostic and predictive gene test for at risk families, and 2) provide enhanced knowledge of all disease-related molecular targets as well as further understanding of the biochemical pathways underlying disease.

D. Research support

Ongoing Research Support

R21 NS082881-02 Paisan-Ruiz (PI) 03/15/13- 02/28/15 Dissecting the genetic underpinnings of essential tremor The goal of this study is to gain insights into the etiology and biology of essential tremor (ET), which remain poorly understood, by determining novel gene mutations underlying tremor. Role: PI; TDC: $275K

R01 NS079388-02 Paisan-Ruiz (PI) 04/01/13-03/31/18 Elucidating and understanding the genetic basis of movement disorders The major goal of this proposal is to identify as many complex movement disorder (CMD) genes as possible and to define accurate genotype-phenotype correlations. This proposal focuses on the recruitment of familial and sporadic patients with CMDs, and the identification of their disease-causing alleles. We believe that intense study of these disorders represents a powerful approach to elucidate disease mechanism for both CMDs and more common disorders such as Parkinson’s disease, and will lead to improvements in both diagnoses and treatments. Role: PI; TDC: $1,094K

Completed Research Support

The Bachman Strauss Foundation Hardy (PI) 01/01/08-12/31/08

The role of PRKRA in Early-onset Parkinsonism The goal of this study was to examine the role of PRKRA genetic variability in early-onset Parkinson’s disease (PD) and dystonia. PRKRA generic variability is very rare in both PD and dystonia. We identified the first PLA2G6 mutations in patients with parkinsonism and without mutations in the PRKRA gene. Role: Co-PI; TDC: $50K

The Michael J. Fox Foundation Paisan-Ruiz (PI) 01/05/08-30/04/10 The Glucosylceramide Pathway in Parkinson’s disease and other synucleonopathies The goal of this study was to examine the role of GBA genetic variability in Parkinson’s disease (PD) and multiple system atrophy (MSA). Role: Co-PI; TDC: $75K

Iran National Science Foundation Elahe (PI) 09/19/09-09/18/11 Identification of novel glaucoma gene The goal of this study was to identify a novel glaucoma gene by performing genetic studies in a large consanguineous family with primary congenital glaucoma. We identified LTBP2 as the causative gene for this form of glaucoma. Role: co-PI

Dystonia Medical Research Foundation Paisan-Ruiz (PI) 12/15/10-05/14/11 Whole exome sequencing in dominantly inherited Cervical Dystonia The goal of this study was to identify novel genes underlying cervical dystonia through the use of whole exome sequencing techniques. A GCDH mutation was identified to be involved in the pathophysiology of generalized dystonia. Role: PI; TDC: $65K

Parkinson’s Disease Foundation (PDF) Paisan-Ruiz (PI) 06/30/12-06/29/13 Identifying genetic causes underlying early-onset Parkinson’s disease The goal of this study was to identify novel genes underlying autosomal recessive early-onset Parkinsonism by examining a small number of consanguineous families with recessive Parkinsonism. We identified SYNJ1 as a novel gene for recessive PD. Role: PI; TDC: $55K

Hum Genet (2013) 132:275–283 DOI 10.1007/s00439-012-1248-1

ORIGINAL INVESTIGATION

Identiﬁcation of COL6A2 mutations in progressive myoclonus epilepsy syndrome

Siamak Karkheiran • Catharine E. Krebs • Vladimir Makarov • Yalda Nilipour • Benjamin Hubert • Hossein Darvish • Steven Frucht • Gholam Ali Shahidi • Joseph D. Buxbaum • Coro Paisa´n-Ruiz

Received: 21 August 2012 / Accepted: 30 October 2012 / Published online: 9 November 2012 Ó Springer-Verlag Berlin Heidelberg 2012

Abstract In this study, a consanguineous family with of control individuals, including control individuals of progressive myoclonus epilepsy (PME) was clinically Iranian ancestry, was identified in both affected siblings. examined and molecularly investigated to determine the COL6A2 was shown to be expressed in the human cere- molecular events causing disease. Since exclusion of bral cortex and muscle biopsy revealed no specific histo- known genes indicated that novel genes causing PME still chemical pathology. We conclude that the COL6A2 remained unidentified, homozygosity mapping, exome p.Asp215Asn mutation is likely to be responsible for PME sequencing, as well as validation and disease-segregation in this family; however, additional studies are warranted to analyses were subsequently carried out for both loci and further establish the pathogenic role of both COL6A2 and gene identification. To further assure our results, a muscle the extracellular proteolysis system in the pathogenesis of biopsy and gene expression analyses were additionally PME. performed. As a result, a homozygous, disease-segregating COL6A2 mutation, p.Asp215Asn, absent in a large number Introduction

Progressive myoclonus epilepsy (PME) comprises a group Electronic supplementary material The online version of this of rare inherited neurodegenerative diseases characterized article (doi:10.1007/s00439-012-1248-1) contains supplementary material, which is available to authorized users.

S. Karkheiran Á G. A. Shahidi H. Darvish Movement Disorders Clinic, Hazrat Rasool Hospital, Department of Clinical Genetics, Shahid Beheshti University Tehran University of Medical Sciences, Tehran, Iran of Medical Sciences, Tehran, Iran

C. E. Krebs Á B. Hubert Á S. Frucht Á C. Paisań-Ruiz (&) S. Frucht Á J. D. Buxbaum Á C. Paisań-Ruiz Department of Neurology, Mount Sinai School of Medicine, Friedman Brain Institute, Mount Sinai School of Medicine, One Gustave L. Levy Place, Box 1137, New York, USA One Gustave L. Levy Place, New York, USA e-mail: [email protected] G. A. Shahidi V. Makarov Á J. D. Buxbaum Department of Neurology, Hazrat Rasool Hospital, The Seaver Autism Center for Research and Treatment, Tehran University of Medical Sciences, Tehran, Iran Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, USA J. D. Buxbaum Department of Neuroscience, Mount Sinai School of Medicine, V. Makarov Á J. D. Buxbaum Á C. Paisań-Ruiz One Gustave L. Levy Place, New York, USA Department of Psychiatry, Mount Sinai School of Medicine, One Gustave L. Levy Place, New York, USA J. D. Buxbaum Á C. Paisań-Ruiz Department of Genetics and Genomic Sciences, Y. Nilipour Mount Sinai School of Medicine, Department of Pathology, Myopathology Lab, Toos Hospital, One Gustave L. Levy Place, New York, USA Tehran, Iran

123 276 Hum Genet (2013) 132:275–283 by myoclonus, seizures, dementia, and ataxia, leading to Materials and methods severe cognitive impairment and early death in many cases (Berkovic et al. 1986; Shahwan et al. 2005). PME may also Subjects manifest in other metabolic and neurological diseases, such as spinocerebellar, basal ganglia, and cortical dementia A first-degree consanguineous Iranian family suffering disorders (Caviness and Brown 2004). from a recessive form of PME was clinically examined. The majority of PME is inherited in a recessive manner. The local ethics committee at Tehran University of Med- Four clinical entities account for most of the autosomal ical Sciences approved this study and informed consent recessively inherited PME: Unverricht–Lundborg disease was obtained from all participants. DNA samples from all (ULD; MIM #254800) caused by mutation in CSTB; Lafora members were isolated from whole blood using standard disease (LD; MIM #254780) caused by mutations in either procedures. EPM2A or EPM2B; the neuronal ceroid lipofuscinoses The p.Asp215Asn mutation was additionally tested by (NCLs) explained by mutations in TPP1 (MIM #607998), direct Sanger sequencing of COL6A2 exon 3 in 96 DNA CLN3 (MIM #204200), CLN5 (MIM #256731), or CLN6 samples from control individuals of Iranian ancestry and 92 (MIM #601780); and the sialidosis caused by mutations in DNA samples of neurologically normal individuals of NEU1 (MIM #256550) encoding lysosomal neuraminidase Caucasian ancestry available for purchase at Coriell Cell (Ramachandran et al. 2009; Shahwan et al. 2005). PME is Repository (NINDS control panel, NDPT093). also a common feature in the action myoclonus-renal failure syndrome (AMRF; OMIM #254900) caused by Gene screening analyses mutations in SCARB2 (Rubboli et al. 2011). More recently, mutations in PRICKLE1 (OMIM #612437) and GOSR2 Genomic primers for PCR amplifications were designed (MIM #614018) have been reported to cause an autosomal- using a public primer design website (http://ihg.gsf. recessive progressive myoclonus epilepsy-ataxia syndrome de/ihg/ExonPrimer.html). Primers were used to amplify (Bassuk et al. 2008; Corbett et al. 2011). CSTB (all exons), COL6A2 (exons 3, 6, 7 and 16), WDR4 In this study, we report on a consanguineous family (exon 6), HSF2BP (exon 2), C21orf33 (exon 2), C21orf2 presenting with recessive PME. After exclusion of CSTB (exon 2), TRPM2 (exon 29), ADARB1 (exon 7 of mutations, a homozygous, disease-segregating mutation NM_015833), COL6A1 (exon 25), LSS (exon 14), PCNT (p.Asp215Asn), which lies within the first von Willebrand (exon 4), PIK3C3 (exon 13), IFLTD1 (exon 1 of factor (vWF) type A domain (VWA) of the COL6A2 NM_001145727), C12orf70 (exon 5), NDUFV3 (exon 1), protein, was identified through homozygosity mapping and COL18A1 (exons 1, 2, 19, 20, 21, 25, 32, 34, and 36) and whole exome sequencing analyses. COL6A2 muta- (primer sequences available upon request). PCR amplifi- tions are known to cause Bethlem myopathy (BM; MIM cations were performed as previously described (Marti- #158810), congenital myosclerosis (CM; MIM #255600), Masso et al. 2012). The dodecamer CSTB expansion was and Ullrich congenital muscular dystrophy (UCMD; MIM amplified as previously described (Joensuu et al. 2007) and #254090) (Camacho Vanegas et al. 2001; Jobsis et al. using the Phusion high-fidelity PCR master mix with GC 1999; Mercuri et al. 2002; Merlini et al. 2008). It is also buffer (Finnzymes) that produces a PCR product of 200 bp very interesting to note that chromosomal aberrations at corresponding to two copies of the dodecamer repeat chromosome 21q22.3, encompassing the COL6A2 gene, expansion. All purified PCR products were then sequenced have been reported in idiopathic generalized epilepsy in both forward and reverse directions with Applied Bio- (IGE) and febrile seizures (FS; Kim et al. 2007) sug- systems BigDye terminator v3.1 sequencing chemistry as gesting that additional COL6A2 mutations may also be per the manufacturer’s instructions. The resulting responsible for other types of epileptic syndromes. sequencing reactions were resolved on an ABI3130 genetic Indeed, it has been suggested that different protein func- analyzer (Applied Biosystems, Foster City, CA, USA) and tions and interactions may be altered depending on the analyzed using Sequencher 5.0 software (Gene Codes nature and localization of the mutations (Bonnemann Corporation, Ann Arbor, MI, USA). 2011). We conclude that the COL6A2 p.Asp215Asn mutation is High-throughput SNP genotyping and autozygosity likely to be responsible for PME in the family we report; mapping however, additional studies are warranted to further establish the pathogenic role of both COL6A2 and the SNP genotyping was performed using the HumanOmni- extracellular proteolysis system in the pathogenesis of Express beadchips and HiScanSQ system (http://www. PME. illumina.com). Genotyping quality assessments were

123 Hum Genet (2013) 132:275–283 277 undertaken according to the appropriate options within the were calculated for each exon by querying the MySQL Genome Studio program (GS; Illumina). PLINK input table. reports were generated within the GS and uploaded to The pathogenicity of the disease-segregating COL6A2 PLINK v1.07 program (Purcell et al. 2007). Homozygous mutation (p.Asp215Asn) was predicted by two computa- segments were identified using the runs of homozygosity tional methods previously evaluated as most efficient (ROH) tool within PLINK, where a minimum physical size (Thusberg et al. 2011), MutPred (http://mutpred.mutdb.org/) threshold of 1 Mb and at least 100 homozygous adjacent and SNPs&GO (http://snps-and-go.biocomp.unibo.it/snps- markers in length, including no more than two SNPs with and-go/), as well as PolyPhen (http://genetics.bwh.harvard. missing genotypes and only one possible heterozygous edu/pph2/). The HomoloGene database from NCBI website genotype, were used as inclusion criteria. Subsequently, was used to examine the conservation of p.Asp215Asn overlapping and potentially matching segments were also within different species (http://www.ncbi.nlm.nih.gov/ identified in PLINK using an allelic matching of 0.99 as homologene). threshold. Homozygous segments were also visualized using the Illumina Genome Viewer (IGV) within the GS Muscle biopsy program. Large copy number variations (CNVs) were also A muscle biopsy from the left biceps of patient I was examined through the CNVpartition v3.1.6 plug-in soft- obtained by open technique and frozen in isopentane ware within the GS program (Illumina). cooled in liquid nitrogen. One paraffin and two frozen blocks were prepared. Hematoxylin and eosin (H&E) Whole exome sequencing staining followed by Go¨mo¨ri trichrome, Congo red, ORO, PAS, NADH-TR, SDH, Cox and ATPase reactions in Whole exome sequencing was performed in both affected acidic and alkaline pHs were performed on frozen sections. siblings. The SureSelect Human All Exon 50 Mb exon- capture kit was used for library enrichment (http://www. Gene expression analyses genomics.agilent.com/). The captured exome libraries were then sequenced on a HiSeq2000 according to the manu- Human cerebral cortex total RNA was acquired from facturer’s instructions for paired-end 100 bp reads (http:// Clontech (http://www.clontech.com/) and reverse tran- www.illumina.com) and on a single flow cell lane. After scribed using the SuperScript II First-Strand Synthesis sequencing, data were put through a computational pipeline system, according to the manufacturer’s instructions for WES data processing and analysis following the gen- (Invitrogen). Absolute quantification using a standard eral workflow adopted by the 1,000 genomes project curve generated with ten serial dilutions of cDNA ranging (DePristo et al. 2011). First, the alignment of raw sequence from 0.1 to 1,000 ng was used to quantify the gene reads to the human reference genome sequence (NCBI expression levels of COL6A2 and two reference genes GRCh37) was performed using a fast lightweight Burrows- (B2M and GAPDH). RT-PCR was performed on an Eco Wheeler Alignment tool (BWA) (Li and Durbin 2009). Real-time PCR system (Illumina) using SYBR green PCR Genome Analysis Toolkit (GATK v1.5-16-g58245bf) was master mix (Applied Biosystems). Each gene was run in then used for base-quality recalibration and local realign- quadruplicate. The data were automatically analyzed with ment to minimize base calling error and mapping error, the Eco software (Livak and Schmittgen 2001). respectively. Lastly, GATK Unified Genotyper tool was employed to call single-nucleotide substitutions (SNP/ SNV) and short insertions/deletions (INDEL). Only pass- Results ing variants were included in the final variant set. Calls were filtered based on the mapping quality (q30 or higher) Patient physical examination and depth of coverage (d10 or higher). Resulting calls were annotated with AnnTools, an exhaustive genome annota- A consanguineous Iranian family suffering from a reces- tion toolkit (Makarov et al. 2011). We also developed a sive form of PME was examined. The nuclear family method to assess coverage for each exon. Exons’ coordi- consisted of healthy parents, who were first cousins, as well nates for each gene/transcript from the refGene table as one healthy and two affected siblings (Fig. 1). downloaded from the UCSC genome browser were parsed. The corresponding BAM files were converted to BED Patient I format with the bamToBed tool (part of BEDTools) and loaded to temporary MySQL table (Quinlan and Hall This is a 21-year-old man born to consanguineous parents. 2010). Finally, the number of reads and percent coverage His early childhood was unremarkable. He showed mild 123 278 Hum Genet (2013) 132:275–283

Fig. 1 Left Pedigree structure of the family with myoclonic epilepsy plots of both affected siblings are shown. Both siblings share a LOH and jerks, and chromatograms of COL6A2 exon 3 showing both segment at the chromosome 21q22.3 (blank area). The localization of homozygous (upper sequence) and heterozygous (middle sequence) COL6A2 within this LOH area is also represented with a small red p.Asp215Asn mutant sequences as well as wild-type sequence line within the chromosome (color ﬁgure online) (bottom sequence). Right The chromosome 21 B-allele-frequency

stuttering exacerbated with stress at the age of 5 years and Patient II experienced his first generalized seizure when he was 7 years old. His poor handwriting was also noticeable at this This is the youngest brother of patient I, whose symptoms age. Myoclonic jerks started to appear gradually in upper started at the age of 9 years with a morning attack of atonic limbs and seizures recurred in the forms of absence, atonic, seizure. Thereafter, atonic and absence seizures recurred and generalized tonic–clonic. At the age of 12 years, the and action myoclonus appeared in hands. His symptoms subject left school due to recurrent falls and writing dis- progressed very slowly. At the age of 17 years, patient ability, losing his ability to walk by the age of 20 years and complained of sudden muscle jerks and the stiffness during becoming wheel chair bound by 23 years old. Despite the walking, which made him walk slowly and with difficulty. severity of myoclonus and epilepsy, his cognitive abilities His writing was not impaired. His symptoms exacerbated remained unaffected. At the age of 27 years, muscle forces with infectious disorders and emotional stress. He still were normal but his tendon reflexes were diminished, he attends high school and does daily activity without help. had spontaneous and action myoclonus in all four limbs. He He takes Sodium Valproate, Phenobarbital, and Piracetam. had bouncing gait with severe postural instability. There In both patients, serum levels of lactate, pyruvate, was no reflex myoclonus to tactile, visual, and acoustic ammonium, creatine kinase, anti-gliadin antibody, anti- stimulations. Although his speech was dysarthric, he did not endomysial antibody, copper, and ceruloplasmin were nor- have dysphagia. In oculomotor examination, pursuit eye mal. EEG showed mildly slow background with 7–7.5 cps movements were fragmented and oculomotor apraxia and and generalized polyspike and spike-slow activities without initiation delay were seen in saccadic movements. Gen- constant photosensitivity, though all available EEG were eralized myoclonus was often seen before saccades initia- taken after anti-epileptic drug commenced. Ocular fundus tion. According to his parents, jerks progressively examination, electroneurography, and electromyography exacerbate in a period of 10–15 days leading to a series of were also normal in both patients. Brain magnetic resonance seizures, after which the patient improves, being able to eat imaging (MRI) performed in both patients showed no brain without assistance and talk more intelligibly. Sodium Val- anomaly (data not shown). Although diminished tendon proate, Clonazepam, and Piracetam were administered to reflexes, which are usually lost in muscular dystrophies, control both seizures and myoclonus. were seen in both patients, neither joint contractures nor

123 Hum Genet (2013) 132:275–283 279 cutaneous abnormalities, commonly seen in COL6A2 phe- chromosomes of Iranian ancestry and 184 control chro- notype, were observed. mosomes of Caucasian ancestry tested by direct Sanger sequencing. All together, and also considering public Molecular analyses SNP databases, the c.643G [ A transition was absent in over 10,000 control chromosomes, further supporting its CSTB pathogenic mutations were first excluded: patients pathogenicity. were shown to carry two copies of the dodecamer repeat The exome data were also used to investigate whether expansion while the remaining family members carried rare small deletions or insertions across the entire linkage three copies. Subsequently, autozygosity mapping revealed areas did also segregate with disease; however, no relevant five potential loci associated with disease (Table 1). genetic variant was identified present in both affected sib- Although three of these loci were located on chromosome lings. To insure that the COL6A2 p.Asp215Asn mutation 12, the PRICKLE1 gene was not included in these loci and was the only genetic defect identified in our family, all the our patients showed no clear sign of ataxia. The genotyping exomic coding regions located in the previously associated data were also used to exclude large CNVs as causative loci but not sufficiently covered by the exome sequencing genetic events. Then, the exome sequencing performed in were also screened by direct Sanger sequencing in at least the two affected siblings captured 99.15 and 99.16 % of the one affected individual (n = 25, see ‘‘Materials and meth- target exome for patients I and II, respectively. More than ods’’). A common, homozygous 9 bp deletion, rs11276732, 96 % of the exomic region was captured at 20-fold cover- within COL18A1, was the only genetic variant identified. age or higher. After an adequate filtering, which consisted To test whether the COL6A2 p.Asp215Asn mutation of removing variants present in the latest dbSNP build and identified in our patients was also associated with a neuro- 1000 Genomes Project, 509 and 547 novel coding SNPs/ muscular pathology, a muscle biopsy was performed in one SNVs, of which 331 and 341 were non-synonymous, were affected sibling. H&E stain revealed almost uniform angular identified for patient I and II, respectively (Fig. 2). Four muscle fibers with no necrosis or regeneration. Endomysial novel nonsense SNPs/SNVs were also identified, but none connective tissue was normal. No ragged-red fiber was seen were present in both affected individuals. From the novel in Go¨mo¨ri trichrome stain and neither lipid nor glycogen variants identified, only 11 homozygous variants were excess was seen in muscle fibers. Oxidative stains show no found present in both affected individuals, of which eight abnormality and ATPase reactions reveal normal checker- were also identified in Exome Variant Server (2012)(http:// board pattern. These findings suggest no muscle pathology evs.gs.washington.edu/EVS/), which contains exome data in our patients (Supplementary material 1). from 6,503 samples of multiple sequencing projects, or Since the motor cortex is the most affected part of the exome data generated in-house, which consist of exomes brain in myoclonus (Caviness and Brown 2004) and no from individuals with other diseases that are part of other muscular pathology was observed in our patients, COL6A2 ongoing projects. No compound heterozygous mutations expression was also examined in the human cerebral cor- were found common in both patients. tex, revealing that COL6A2, though less expressed than Of these three non-synonymous homozygous SNPs/ GAPDH and B2M genes, is expressed in the human cere- SNVs, not found in prior studies, only one was located in a bral cortex (Fig. 3). previously disease-associated locus (Fig. 1). This SNP/ SNV, located in the exon 3 of COL6A2, is a c.643G [ A transition that results in p.Asp215Asn (Fig. 1; Table 2). Discussion Although this disease-segregating variant affects a non-conserved amino-acid residue and is therefore pre- In this study, we clinically examined a consanguineous dicted to be non-deleterious, it was absent in 192 control family presenting with a recessive form of PME. Then, to

Table 1 Homozygous segments found present in both affected siblings after performing homozygosity mapping through genome-wide SNP genotyping Chrom SNP-1 SNP-2 Position 1 (bp) Position 2 (bp) Size (Kb) SNPs (#)

12 rs17822087 rs1500072 15,241,484 33,285,193 18,043.70 5,863 12 rs6488130 rs12315121 33,308,022 34,853,011 1,544.99 201 12 rs4002730 rs287044 37,876,400 42,013,167 4,136.77 849 18 rs12962762 rs6507588 36,901,805 42,419,103 5,517.30 1,204 21 rs186531 rs10483083 43,808,927 48,100,155 4,291.23 1,378 Highlighted in bold is the genomic region carrying the pathogenic disease-segregation mutation identiﬁed in all affected siblings

123 280 Hum Genet (2013) 132:275–283

Fig. 2 a Exome coverage. Percentages of the targeted exome library and total coverage with at least 20-fold depth for both targets coverage and 50 bp flanking regions are shown. b Coding SNPs. The total number of all coding SNPs identified in both patients sequenced is also represented: 509 and 547 novel coding SNPs were, respectively, identified for patients I and II. Nonsense SNPs are not shown due to their limited number (1 and 3 SNPs for patients I and II, respectively)

Table 2 Homozygous SNPs identiﬁed in both affected siblings after performing exome sequencing followed by adequate ﬁltering SNPs Chr Position (bp) Gene Nucleotide change Protein change Function/associated disease

SNP-1 5 135,390,455 TGFBI c.1315A [ G p.Ile439Val Corneal dystrophy SNP-2 6 74,519,866 CD109 c.3284G [ T; c.3515G [ T p.Arg1172Ile; p.Arg1095Ile Platelet-speciﬁc antigen SNP-3 21 47,532,420 COL6A2 c.643G > A p.Asp215Asn Bethlem myopathy; Ullrich muscular dystrophy Chromosome position, affected gene, nucleotide and protein changes, as well as function or associated disease are shown for each SNP identiﬁed. Highlighted in bold is the only SNP found present in a previously shown disease-associated locus

identify the genetic events causing disease, we performed autozygosity mapping and exome sequencing followed by SNP validation and disease-segregation analyses. Finally, to further explore the phenotype, we carried out a muscle biopsy and gene expression analyses. We identified a homozygous, disease-segregating mutation, p.Asp215Asn, in the COL6A2 gene, which was also located within a disease-associated locus (Fig. 1; Table 2). The p.Asp215Asn mutation was absent in a large number of control individuals, including individuals of Iranian ancestry, and no additional mutation was identified in the remaining genes located within the previously identified disease-associated loci (Tables 1, 2). Although this novel mutation affects a non-conserved amino-acid residue (data not shown), it is already well known that many other non-conserved mutations are associated with protein dysfunction. For instance, the non-conserved synuclein mutation, p.Ala53Thr, is responsible for causing familial forms of Parkinson’s dis- Fig. 3 COL6A2 expression in the human brain cerebral cortex. The ease (Polymeropoulos et al. 1997). absolute quantification of COL6A2 and two reference genes is It is very interesting to consider that COL6A2 mutations represented. Y-axis mean quantity, X-axis gene amplifications of are known to cause other neurological diseases, such as human brain cortex cDNA. Although the expression of COL6A2 is slightly lower when compared to both GAPDH and B2M expressions, muscular dystrophies and myopathies, and chromosomal all genes are expressed in the cerebral cortex aberrations involving the COL6A2 gene have already been

123 Hum Genet (2013) 132:275–283 281 reported in IGE and febrile seizures (Kim et al. 2007), encodes three different transcripts (NM_001849, consistent with a role for COL6A2 in diverse phenotypes NM_058175, and NM_058174) (Saitta and Chu 1994). including epileptic syndromes. Mutations in an additional Since it is already known that the alternative promoters of collagen gene, COL18A1, although known to cause COL1A1 and COL9A2 determine their tissue-specific Knobloch syndrome, have also been linked to epilepsy expression (Bennett and Adams 1990; Nishimura et al. (Paisan-Ruiz et al. 2009). Furthermore, in consistency with 1989), one may suggest that COL6A2 promoters can also the above, we are continually seeing through the applica- control the tissue-specific expression of COL6A2 tran- tion of linkage analyses and exome sequencing that same scripts, leading to the development of different diseases genes may be responsible for two or more different neu- depending on which cells/tissues are affected. In fact, it has rological phenotypes (Krebs and Paisan-Ruiz 2012). recently been reported that COL6A2, which is also COL6A2 encodes one of the three alpha chains of type expressed in myocytes of the heart muscle (Klewer et al. VI collagen and is composed of a signal peptide domain, 1998), interacts cooperatively with DSCAM to cause con- three different VWA domains, which are typically protein- genital heart defects in flies and mice (Grossman et al. binding domains that have been shown to bind extracellular 2011). This along with the fact that COL6A2 is also matrix (ECM) proteins, and several collagen units. expressed in the brain and no muscle defects have been P.Asp215Asn affects the first VWA of the encoded protein. identified in our patients clearly suggests that the wide Collagen VI, which is encoded by COL6A1, COL6A2, and phenotypic heterogeneity associated with COL6A2 genetic COL6A3, is an ECM protein that is essential for skeletal variability is due to its wide tissue expression, most likely muscle integrity and function, and is implicated in orga- triggered by its promoters and other molecular factors not nizing matrix components (Cheng et al. 2011). Interest- yet known. The exact phenotype presented may also be ingly, cystatin-B (CSTB), whose mutations cause PME, is influenced by specific additional loci, as a form of genetic also involved in the proteolytic remodeling of ECM and is background, or by other non-genetic factors. a well-known activator of the urokinase-type plasminogen activator (uPA) (Royer-Zemmour et al. 2008), whose deficiency enhances the muscle dystrophy and reduces the Conclusion muscular function in mouse models of Duchenne muscular dystrophy (Suelves et al. 2007), further associating the We conclude that the COL6A2 disease-segregating CSTB molecular pathway with the development of mus- p.Asp215Asn mutation, which is the sole genetic variant cular dystrophy. Accordingly, epilepsy has been reported in identified in our family that meets all criteria as a con- several types of muscular dystrophies (Tsao and Mendell tributing locus, is likely to be the genetic defect causing 2006), proving that molecular links between muscular disease in our family, and that alterations in the extracel- dystrophies and epilepsies exist. lular proteolysis system due to defects in CSTB, uPA,or Although little is known about the role of collagens in COL6A2 may play an important role in the development of the brain, it has recently reported that Ab neurotoxicity is both muscular dystrophies and epileptic syndromes. Fur- increased by reduction of collagen VI, while the formation ther and extensive molecular investigations are needed to of Ab42 oligomers and their interaction with neurons are further establish the pathogenic role of COL6A2 in the prevented by the treatment of neurons with soluble colla- pathogenesis of PME. gen VI (Cheng et al. 2009, 2011). These latter findings along with both the demonstration of COL6A2 expression Acknowledgments The authors would like to thank the patients and in the cerebral cortex and the implication of COL6A2 in their relatives for their participation in this study. The authors also thank the Department of Neurology and the Friedman Brain Institute several epilepsy syndromes (Kim et al. 2007) clearly sug- at the Mount Sinai School of Medicine for support (C.P-R). gest that collagen VI also plays an important role in the central nervous system. Indeed, recent studies have unex- Conflict of interest The authors declare that they have no conflict pectedly identified novel roles for collagens in the devel- of interest. oping vertebrate nervous system, and there is growing evidence associating collagens with both axon guidance and neuronal migration (Fox 2008; Hubert et al. 2009). However, the precise molecular mechanisms by which References COL6A2 mutations may also cause PME are still unclear. Nevertheless, it has been demonstrated that two different Bassuk AG, Wallace RH, Buhr A, Buller AR, Afawi Z, Shimojo M, Miyata S, Chen S, Gonzalez-Alegre P, Griesbach HL, Wu S, promoters, regulated by positive and negative cis-acting Nashelsky M, Vladar EK, Antic D, Ferguson PJ, Cirak S, Voit T, DNA elements and trans-acting factors, control the tran- Scott MP, Axelrod JD, Gurnett C, Daoud AS, Kivity S, Neufeld scription of the human COL6A2 gene, which additionally MY, Mazarib A, Straussberg R, Walid S, Korczyn AD, Slusarski 123 282 Hum Genet (2013) 132:275–283

DC, Berkovic SF, El-Shanti HI (2008) A homozygous mutation Krebs CE, Paisan-Ruiz C (2012) The use of next-generation in human PRICKLE1 causes an autosomal-recessive progressive sequencing in movement disorders. Front Genet 3:75 myoclonus epilepsy-ataxia syndrome. Am J Hum Genet Li H, Durbin R (2009) Fast and accurate short read alignment with 83:572–581 Burrows-Wheeler transform. Bioinformatics 25:1754–1760 Bennett VD, Adams SL (1990) Identification of a cartilage-specific Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression promoter within intron 2 of the chick alpha 2(I) collagen gene. data using real-time quantitative PCR and the 2(-Delta Delta J Biol Chem 265:2223–2230 C(T)) method. Methods 25:402–408 Berkovic SF, Andermann F, Carpenter S, Wolfe LS (1986) Progres- Makarov V, O’Grady T, Cai G, Lihm J, Buxbaum JD, Yoon S (2011) sive myoclonus epilepsies: specific causes and diagnosis. N Engl AnnTools: a comprehensive and versatile annotation toolkit for J Med 315:296–305 genomic variants. Bioinformatics 28:724–725 Bonnemann CG (2011) The collagen VI-related myopathies: muscle Marti-Masso JF, Ruiz-Martinez J, Makarov V, Lopez de Munain meets its matrix. Nat Rev Neurol 7:379–390 A, Gorostidi A, Bergareche A, Yoon S, Buxbaum JD, Paisan- Camacho Vanegas O, Bertini E, Zhang RZ, Petrini S, Minosse C, Ruiz C (2012) Exome sequencing identifies GCDH (glutaryl- Sabatelli P, Giusti B, Chu ML, Pepe G (2001) Ullrich scleroa- CoA dehydrogenase) mutations as a cause of a progressive tonic muscular dystrophy is caused by recessive mutations in form of early-onset generalized dystonia. Hum Genet collagen type VI. Proc Natl Acad Sci USA 98:7516–7521 131:435–442 Caviness JN, Brown P (2004) Myoclonus: current concepts and recent Mercuri E, Yuva Y, Brown SC, Brockington M, Kinali M, Jungbluth advances. Lancet Neurol 3:598–607 H, Feng L, Sewry CA, Muntoni F (2002) Collagen VI Cheng JS, Dubal DB, Kim DH, Legleiter J, Cheng IH, Yu GQ, involvement in Ullrich syndrome: a clinical, genetic, and Tesseur I, Wyss-Coray T, Bonaldo P, Mucke L (2009) Collagen immunohistochemical study. Neurology 58:1354–1359 VI protects neurons against Abeta toxicity. Nat Neurosci Merlini L, Martoni E, Grumati P, Sabatelli P, Squarzoni S, Urciuolo 12:119–121 A, Ferlini A, Gualandi F, Bonaldo P (2008) Autosomal recessive Cheng IH, Lin YC, Hwang E, Huang HT, Chang WH, Liu YL, Chao myosclerosis myopathy is a collagen VI disorder. Neurology CY (2011) Collagen VI protects against neuronal apoptosis 71:1245–1253 elicited by ultraviolet irradiation via an Akt/phosphatidylinositol Nishimura I, Muragaki Y, Olsen BR (1989) Tissue-specific forms of 3-kinase signaling pathway. Neuroscience 183:178–188 type IX collagen-proteoglycan arise from the use of two widely Corbett MA, Schwake M, Bahlo M, Dibbens LM, Lin M, Gandolfo separated promoters. J Biol Chem 264:20033–20041 LC, Vears DF, O’Sullivan JD, Robertson T, Bayly MA, Gardner Paisan-Ruiz C, Scopes G, Lee P, Houlden H (2009) Homozygosity AE, Vlaar AM, Korenke GC, Bloem BR, de Coo IF, Verhagen mapping through whole genome analysis identifies a COL18A1 JM, Lehesjoki AE, Gecz J, Berkovic SF (2011) A mutation in the mutation in an Indian family presenting with an autosomal Golgi Qb-SNARE gene GOSR2 causes progressive myoclonus recessive neurological disorder. Am J Med Genet B Neuropsy- epilepsy with early ataxia. Am J Hum Genet 88:657–663 chiatr Genet 150B:993–997 DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Gabriel SB, Altshuler D, Daly MJ (2011) A framework for Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, variation discovery and genotyping using next-generation DNA Nussbaum RL (1997) Mutation in the alpha-synuclein gene sequencing data. Nat Genet 43:491–498 identified in families with Parkinson’s disease. Science Exome Variant Server (2012) NHLBI Exome Sequencing Project 276:2045–2047 (ESP), Seattle, WA. URL: http://evs.gs.washington.edu/EVS/ Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender Fox MA (2008) Novel roles for collagens in wiring the vertebrate D, Maller J, Sklar P, de Bakker PI, Daly MJ, Sham PC (2007) nervous system. Curr Opin Cell Biol 20:508–513 PLINK: a tool set for whole-genome association and population- Grossman TR, Gamliel A, Wessells RJ, Taghli-Lamallem O, Jepsen based linkage analyses. Am J Hum Genet 81:559–575 K, Ocorr K, Korenberg JR, Peterson KL, Rosenfeld MG, Quinlan AR, Hall IM (2010) BEDTools: a flexible suite of utilities for Bodmer R, Bier E (2011) Over-expression of DSCAM and comparing genomic features. Bioinformatics 26:841–842 COL6A2 cooperatively generates congenital heart defects. PLoS Ramachandran N, Girard JM, Turnbull J, Minassian BA (2009) The Genet 7:e1002344 autosomal recessively inherited progressive myoclonus epilep- Hubert T, Grimal S, Carroll P, Fichard-Carroll A (2009) Collagens in sies and their genes. Epilepsia 50(Suppl 5):29–36 the developing and diseased nervous system. Cell Mol Life Sci Royer-Zemmour B, Ponsole-Lenfant M, Gara H, Roll P, Leveque C, 66:1223–1238 Massacrier A, Ferracci G, Cillario J, Robaglia-Schlupp A, Jobsis GJ, Boers JM, Barth PG, de Visser M (1999) Bethlem Vincentelli R, Cau P, Szepetowski P (2008) Epileptic and myopathy: a slowly progressive congenital muscular dystrophy developmental disorders of the speech cortex: ligand/receptor with contractures. Brain 122(Pt 4):649–655 interaction of wild-type and mutant SRPX2 with the plasmin- Joensuu T, Kuronen M, Alakurtti K, Tegelberg S, Hakala P, Aalto A, ogen activator receptor uPAR. Hum Mol Genet 17:3617–3630 Huopaniemi L, Aula N, Michellucci R, Eriksson K, Lehesjoki Rubboli G, Franceschetti S, Berkovic SF, Canafoglia L, Gambardella AE (2007) Cystatin B: mutation detection, alternative splicing A, Dibbens LM, Riguzzi P, Campieri C, Magaudda A, Tassinari and expression in progressive myclonus epilepsy of Unverricht- CA, Michelucci R (2011) Clinical and neurophysiologic features Lundborg type (EPM1) patients. Eur J Hum Genet 15:185–193 of progressive myoclonus epilepsy without renal failure caused Kim HS, Yim SV, Jung KH, Zheng LT, Kim YH, Lee KH, Chung SY, by SCARB2 mutations. Epilepsia 52:2356–2363 Rha HK (2007) Altered DNA copy number in patients with Saitta B, Chu ML (1994) Two promoters control the transcription of different seizure disorder type: by array-CGH. Brain Dev the human alpha 2(VI) collagen gene. Eur J Biochem 29:639–643 223:675–682 Klewer SE, Krob SL, Kolker SJ, Kitten GT (1998) Expression of type Shahwan A, Farrell M, Delanty N (2005) Progressive myoclonic VI collagen in the developing mouse heart. Dev Dyn epilepsies: a review of genetic and therapeutic aspects. Lancet 211:248–255 Neurol 4:239–248

123 Hum Genet (2013) 132:275–283 283

Suelves M, Vidal B, Serrano AL, Tjwa M, Roma J, Lopez-Alemany Thusberg J, Olatubosun A, Vihinen M (2011) Performance of R, Luttun A, de Lagran MM, Diaz-Ramos A, Jardi M, Roig M, mutation pathogenicity prediction methods on missense variants. Dierssen M, Dewerchin M, Carmeliet P, Munoz-Canoves P Hum Mutat 32:358–368 (2007) uPA deﬁciency exacerbates muscular dystrophy in MDX Tsao CY, Mendell JR (2006) Coexisting muscular dystrophies and mice. J Cell Biol 178:1039–1051 epilepsy in children. J Child Neurol 21:148–150

123 NIH Public Access Author Manuscript J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01.

NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: J Mol Med (Berl). 2013 December ; 91(12): . doi:10.1007/s00109-013-1075-4.

The ACMSD gene, involved in tryptophan metabolism, is mutated in a family with cortical myoclonus, epilepsy, and parkinsonism

Jose Felix Martí-Massó1,2,3,4,#, Alberto Bergareche1,2,3, Vladimir Makarov5, Javier Ruiz- Martinez1,2,3, Ana Gorostidi1,2,3, Adolfo López de Munain1,2,3,4, Juan Jose Poza1,2,3, Pasquale Striano6, Joseph D. Buxbaum7,8,9,10, and Coro Paisán-Ruiz7,8,10,11,# 1Biodonostia Research Institute, Neurosciences area, University of the Basque Country, EHU- UPV San Sebastián, Gipuzkoa, Spain 2Hospital Universitario Donostia, Department of Neurology, Movement Disorders Unit, San Sebastián, Guipuzcoa, Spain 3Centro de investigación biomédica en Red para enfermedades Neurodegenerativas (CIBERNED), Carlos III Health Institute, Madrid, Spain 4Department of Neurosciences, University of the Basque Country, EHU-UPV, San Sebastián, Guipuzcoa, Spain 5Columbia University, Mailman School of Public Health, Department of Biostatistics, 722 west 168 St., New York, NY 10032, USA 6Pediatric Neurology and Muscular Diseases Unit, Department of Neurosciences-DINOGMI, Gaslini Institute, Genova, Italy 7Department of Psychiatry, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 8Department of Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 9Department of Neurosciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 10Friedman Brain and Mindich Child Health and Development Institutes, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 11Department of Neurology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA

Abstract Familial cortical myoclonic tremor and epilepsy is a phenotypically and genetically heterogeneous autosomal dominant disorder characterized by the presence of cortical myoclonic tremor and epilepsy that is often accompanied of additional neurological features. Despite the numerous familial studies performed and the number of loci identified, there is no gene associated with this syndrome. It is expected that through the application of novel genomic technologies, such as

#Correspondence should be addressed to: Jose Feliz Martí-Massó (Clinical studies), Department of Neurology, Hospital Donostia, San Sebastián, Guipuzcoa, Spain. [email protected] and Coro Paisán-Ruiz (Genetic studies) Department of Neurology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, USA. [email protected], phone: 212-241-0108, fax: 212-828-4221. . Disclosure Statement: All authors declare they have no competing interest. Martí-Massó et al. Page 2

whole exome sequencing and whole genome sequencing, a substantial number of novel genes will come to light in the coming years. In this study, we describe the identification of two disease-

NIH-PA Author Manuscript NIH-PA Author Manuscriptsegregating mutations NIH-PA Author Manuscript in a large family featuring cortical myoclonic tremor with epilepsy and parkinsonism. Due to the previous association of ACMSD deficiency with the development of epileptic seizures, we concluded that the identified nonsense mutation in the ACMSD gene, which encodes for a critical enzyme of the kynurenine pathway of the tryptophan metabolism, is the disease-segregating mutation most likely to be responsible for the phenotype described in our family. This finding not only reveals the identification of the first gene associated with familial cortical myoclonic tremor and epilepsy but also discloses the kynurenine pathway as a potential therapeutic target for the treatment of this devastating syndrome.

Keywords FCMTE; Whole Exome Sequencing; ACMSD; Kynurenine Pathway

Introduction Familial cortical myoclonic tremor and epilepsy (FCMTE), also known as BAFME, FAME, FEME, FCTE, and ADCME, is an autosomal dominant disorder characterized by adult- onset cortical myoclonus, rare epileptic seizures, benign course, and beneficial response to antiepileptic drug therapy; cerebellar ataxia, dementia, and marked photosensitivity may also manifest [1, 2]. Myoclonus is usually the first symptom and is characterized by tremulous finger movements and myoclonus of the extremities [3]. Although diagnosis is made based on clinical and electrophysiological criteria, FCMTE might be misdiagnosed of essential tremor (ET) or progressive myoclonus epilepsy (PME). To avoid confusion and possible misdiagnosis of patients, van Rootselaar and colleagues proposed “familial cortical myoclonic tremor with epilepsy” as unifying term [1]. Four different autosomal dominant FCMTE loci have already been reported. FCMTE1 (8q23.3-q24.11) was identified in a large Japanese family who mainly presented with tremulous finger movement and/or myoclonus of the extremities at an average of age of 30.5 years. Previously, familial febrile convulsions and idiopathic generalized epilepsy syndrome were also mapped to chromosome 8q [2]. FCMTE2 (2p11.1-q12.2) was first described in a large pedigree from Tuscany who affected members presented with non-progressive cortical reflex myoclonus and generalized EEG abnormalities; however, in this family patients also had focal frontotemporal EEG abnormalities and some patients (n=3) additionally featured complex partial seizures. More Italian families were subsequently mapped to the same locus [4, 5], which was later refined in two European descent families by positional cloning techniques [6, 7]. FCMTE3 was first described in families from South Africa [8] but later mapped to chromosome 5p15.31-p15.1 in a large French family [3]. FCMTE4 (3q26.32-3q28) has recently been reported in a large family from Thailand, which consisted of 13 affected members and featured clinical symptoms similar to those previously reported [9].

Despite all genetic analyses performed in FCMTE families, no causal gene has been identified. In this context, whole exome sequencing (WES) is dramatically accelerating the field of biomedical research, particularly in Mendelian diseases, and is becoming a fruitful strategy for gene identification. Through the use of WES, novel genes have recently been identified in several neurological disease, including ET [10], and in families previously deemed statistically underpowered for positional cloning [11]. In this study we aimed to identify the genetic causes underlying FCMTE in a large Spanish family through the application of WES. As a result, a stop codon mutation (p.Trp26Stop) in the ACMSD gene, which is part of the kynurenine pathway, was identified as the disease-segregating mutation. ACMSD deficiency has already been implicated in the genesis of epileptic seizures [12] and

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 3

has been proved to result in quinolinate accumulation that is thought to be involved in various central nervous system phenomena, including synaptic plasticity and

NIH-PA Author Manuscript NIH-PA Author Manuscriptneurodegeneration NIH-PA Author Manuscript [13].

We concluded that, while further studies are warranted to establish the molecular mechanisms by which ACMSD mutation may contribute to the development of cortical myoclonic tremor, epilepsy, and parkinsonism, both brain-specific kynurenic acid deficiency and quinolinate accumulation are likely to play an important role in the pathogenesis of cortical myoclonic tremor and epilepsy.

Materials and methods Subjects A detailed family pedigree was constructed by collecting clinical histories on all putatively affected as well as unaffected individuals and spouses. The inheritance pattern was autosomal dominant. There were 7 affected individuals over three different generations and full clinical evaluation was conducted in 4 affected individuals (Figure 1A, Table 1). Written informed consent, fully approved by the local ethics committee at the Hospital Universitario Donostia, was obtained from all participants. All members’ DNA samples were isolated from whole blood using standard procedures.

94 DNA samples belonging to ethnicity-matched neurologically normal individuals (49 females and 45 males) and without family history of any movement disorders were also available. The age at sample collection of the control individuals ranged from 60 to 93 years with an average of 69.1 years.

11 familial and 58 sporadic cases featuring ET and 54 sporadic cases featuring late-onset Parkinson’s disease (LOPD) were additionally available.

All cases examined were from the same geographical region in the North of Spain.

Neuropsychological and Electrophysiological Studies The Montreal Cognitive Assessment (MoCA), which assesses different cognitive domains (http://www.mocatest.org/), was used for the determination of cognitive dysfunction.

Electroencephalographies (EEGs) were obtained after the application of electrodes and conducting jelly, using the International 10-20 System of Electrode Placement. Standard techniques for nerve conduction studies were used. Peroneal and tibial motor responses and sural sensory responses were recorded. For somatosensory evoked potentials (SEP), the median nerve at the wrist was stimulated and upper limb SEP were recorded at the contralateral scalp (C3′ and C4′: 2 cm posterior to C3 and C4 on the international 10-20 system). Stimulation rate was 3 Hz with duration of 0.2 msec. Digital averaging was performed using 200 samples; the filters were set at a high cut of 500 Hz and a low cut of 10 Hz. The latencies of the N20 and P25 peaks and the interpeak amplitudes of N20-P25 were analysed. Averaging was typically performed three times to ensure reproducibility.

Surface electromyographies (EMGs) were recorded from wrist extensor and flexor muscles using surface electrodes placed over the muscle bellies 3 cm apart. The filters were set with a bandpass of 10Hz-1kHz. A triaxial accelerometer was placed over the first dorsal interosseous muscle of the hand.

C-reflexes were recorded from the abductor pollicis brevis muscle after delivering a supramaximal stimulus over median nerve in the wrist.

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 4

WES WES was performed in three affected cases (I-5, II-3, and III-1; Figure 1A). The SureSelect

NIH-PA Author Manuscript NIH-PA Author ManuscriptHuman NIH-PA Author Manuscript All exon 50Mb exon-capture kit was used for library enrichment (Agilent Technologies Inc., Santa Clara, CA, USA). The captured exome libraries were then sequenced on a HiSeq2000 according to the manufacturer’s instructions for paired-end 100- bp reads (Illumina Inc, San Diego, CA, USA) and on a single flow cell lane each to capture the maximum possible genetic variation. After sequencing, data were put through a computational pipeline for WES data processing and analysis following the general workflow adopted by the 1000 genomes project and analyzed as previously described [14].

Later, any potential mutation observed as common variation in the dbSNP137 or 1000 Genomes Project Phase 1 was removed for further analyses. Genetic variants mapping to intra-genic, intronic, and non-coding exonic regions, with the exception of those variants mapping close to splice sites, were also removed since they are unlikely to be causative. Genetic variants present in other public databases, such as the Exome Variant Server of the National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (http:// evs.gs.washington.edu/EVS/) [15] and exomes generated in house were also removed.

To assist in causative gene identification, the pathogenicity of each disease-segregating mutation was predicted by two computational methods previously evaluated as most efficient [16] (Figure 1A, Table 2). The HomoloGene database from NCBI web site was also used to examine the conservation of both disease-segregating mutations in different species (http://www.ncbi.nlm.nih.gov/homologene).

Gene screening analyses Genomic primers for PCR amplifications were designed using a primer design public website (http://ihg.gsf.de/ihg/ExonPrimer.html). Primers were used to amplify ACMSD and MYBBP1A all coding exons and splice sites (Electronic supplementary material). PCR amplifications and sequencing reactions were performed and analyzed as previously described [14].

Results Here we report a family featuring a heterogeneous form of FCMTE. Clinical characteristics in affected members included seizures and postural hand tremor. Gait and postural disturbances that were levodopa responsiveness were also seen in one patient. Table 1 includes the main phenotypic characteristics of the four affected individuals fully examined by us (I-5, II-3, III-1, and III-7). More detailed clinical information about these four patients, three additional patients not examined by us (I-9, II-5, and II-8), and three neurologically unaffected family members, of which two (II-12 and II-13) have recently been examined by us, are described below. The clinical information of patients not examined by us was collected from medical records and communications with patients’ relatives.

Patients’ clinical details Patient 1 (I-5)—At the age of 17 he started suffering from myoclonic and generalized seizures that were rare and precipitated by sleep deprivation or alcohol intake. At 20 years of age he also showed tremor of both hands. Seizures had good response to medications but his tremor worsened considerably after treatment with valproate. At the age of 63 epileptic seizures disappeared and the medication was discontinued. At the age of 73 he was cognitively normal and had no intolerance of light. He had postural tremor of both hands without any cerebellar, rigid-akinetic, or dystonic signs. EMG recorded in the arms showed 4-5Hz frequency with co-contraction of agonists and antagonists muscles. Brain MRI

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 5

showed mild temporoparietal atrophy (data not shown). He died in 2011 due to a right temporal lobe hematoma. NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript Patient 2 (I-9)—He suffered from epilepsy since childhood but no history of tremor was collected. He also had diabetes and a chronic lung disease and died at the age of 63 of lung squamous carcinoma.

Patient 3 (II-3)—This is a 53-yearl-old woman who suffered from postural tremor of both hands since the age of 17 and generalized convulsive seizures since the age of 20. Treatment with sodium valproate (2000 mg/day) kept her in good seizure control but worsened her tremor. At the age of 49 she complained of a gait disorder. On examination, she showed hypomimia, mild gait and postural disturbance, orthostatic tremor, mild akinesia, and rigidity of neck and arms. A diagnosis of parkinsonism was made and treatment with carbidopalevodopa (300 mg/day) was given. The sodium valproate was later replaced by levetiracetam (2000 mg/day) and she developed new seizures without improvement of parkinsonism. On her last neurological examination, she had high intolerance of light and wore sunglasses to avoid photosensitive myoclonic seizures. She had rhythmic involuntary movements in her upper and lower extremities particularly induced by posture and action. The tremor of her hand became more severe with a postural component and her leg tremor worsened during orthostatism, increasing her postural instability. Her gait was slow with short steps and hesitations during turns. Reflexes were brisk and plantar responses were flexor. Ocular movements and finger-nose-finger and heel-shin coordination tests were normal. She showed mild deficits in attention, memory, and executive function (MoCA score 19/30). Her EEG showed generalized spike and wave complexes more predominant in the left frontotemporal area. SEP were giant with amplitude of 15μV in both sides. Bilateral C-reflexes were obtained in abductor pollicis brevis. Surface EMG showed a myoclonic tremor with irregular bursts of agonist and antagonist muscle co-contraction at a frequency of 4-6Hz, which confirmed that the tremor was actually myoclonus, and showed periodic, irregular muscle bursts with short burst duration of about 50ms. Brain MRI showed mild cerebellar atrophy and high-intensity signals in T2 and Flair- weighted images in ventral area of brainstem, and a bilateral linear hypointense images in Inversion Recovery (IR) sequences, suggesting a corticospinal tract wallerian degeneration (Figure 1D).

Patient 4 (II-5)—This is a 55-year-old woman who presented with seizures in her teens and is now without treatment.

Patient 5 (II-8)—This is a 54-year-old man who suffers from seizures and is now on treatment.

Patient 6 (III-1)—This 28-year-old man had myoclonic and generalized seizures, properly controlled with sodium valproate (1000 mg/day), since the age of 17. He had mild hand tremor but showed no signs of photosensitivity or gait disturbances. He was cognitively normal (MoCA: 30/30). His neuropsychological evaluation showed normal EEG without photoparoxismal response. SEP had a normal amplitude (6μV). C-waves were no obtained and surface EMG revealed an irregular tremor at 8-10 Hz with co-contraction of agonist and antagonist muscles of the forearm. His brain MRI was also normal.

Patient 7 (III-7)—This is a 23-year-old man. Starting from age 22, he had several partial secondarily generalized convulsive seizures that are properly controlled with oxcarbazepine (1200 mg/day) and clonazepam (1mg/day). He has mild hand tremor that sometimes exacerbates without disabling him and feels some photosensitivity. He had a MoCA score of 30/30 and normal brain MRI. His EEG and SEP (2μV) were normal. C-waves were no

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 6

obtained and surface EMG revealed an irregular tremor at 8-10 Hz with co-contraction of agonist and antagonist muscles of the forearm. NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript Brief medical records for three additional family members were also available. For individual II-11 no history of tremor or epilepsy was recorded. Individual II-12 was reported to have gait disturbances and personality problems with intellectual disability but not tremor or epilepsy. Currently, she is not taking any medication and her last neurological examination revealed mild ataxia with areflexia in the legs and progressive distal sensory loss. She had a MoCA score of 25 and normal EEG. Individual II-13 had one or two episodes of loss of consciousness at the age of 10 but at 45 years old she is neurologically normal with a MoCA score of 30/30 and normal EEG.

WES More than 85% of the target exome was captured at 20-fold coverage or higher: 85.68% for patient I-5, 85.36% for patient II-3, and 89.15% for patient III-1. After an adequate filtering of common genetic variation, 181 non-synonymous and 7 nonsense SNVs were identified for patient I-5, 209 non-synonymous and 7 nonsense SNVs for patient II-3, and 241 non- synonymous and 6 nonsense SNVs for patient III-1. Of these only two, highly conserved among other species and absent in large number of control individuals (n>10,000), including 188 ethnicity-matched control chromosomes, were identified as disease-segreagting mutations (Figure 1A). These variants were both a G to A transition resulting in p.Trp26Stop and p.Ala920Thr, respectively. Only the p.Trp26Stop mutation, which lies in the ACMSD gene (MIM #608889) that encodes for the α-amino-β-carboxymuconate-ε- semialdehyde decarboxylase, was predicted to be pathogenic (Table 2). ACMSD is an enzyme that is part of the kynurenine pathway of tryptophan degradation in mamals and reacts with α-amino-β-carboxymuconate-ε-semialdehyde (ACMS) to produce α- aminomuconate-ε-semialdehyde (AMS). Under absence of ACMSD, ACMS is unstable and rapidly converts to quinolinate (quinolinic acid; QA), which is a potent excitotoxin thought to be involved in the pathogenesis of neurodegenerative diseases such as epilepsy, Alzheimer’s disease, and Huntington’s disease [17-20]. The p.Ala920Thr mutation is located in the MYBBP1A gene (MIM #604885); MYBBP1A encodes for MYB binding protein (P160) 1A, which acts as tumor suppressor and is essential for early embryonic development, controls cell cycle, and mitosis [21].

Based on the evidence that the kynurenine pathway has already been involved in the genesis of epileptic seizures [22] and alterations in the levels of the kynurenine pathway metabolites have been implicated in several neurological conditions, including Hungtington disease, Alzheimer disease, and Parkinson’s disease [23], we concluded that the ACMSD mutation identified here is likely to be pathogenic and responsible for the cortical myoclonic tremor and epilepsy seen in our patients.

Later, due to the proximity of ACMSD to FCMTE2, the entire coding region and splice sites of ACMSD were examined in two families previously linked to this locus. Because tremor of both hands is a common feature of all our patients, these were also examined in 11 familial and 58 sporadic cases featuring ET. Sequencing data of 3′ and 5′ ACMSD untranslated regions were also available and investigated in the 11 familial cases. And since genetic variants close to the ACMSD locus were previously associated with an increased risk for sporadic PD [24], the p.Trp26Stop mutation was also examined in 54 sporadic LOPD patients by direct Sanger sequencing. No additional mutation carrier was identified.

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 7

Discussion We here report a large family featuring a heterogeneous form of FCMTE. All patients NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript suffered from cortical myoclonic tremor, which could be misdiagnosed of ET in the first stages of the disease, and epilepsy. In one individual the epilepsy disappeared in the adulthood. As the family described by Magnin and colleagues [25], one of our patient (II-3) also had gait disturbances, cognitive impairment, and photosensitivity that appeared during the disease progression and under treatment with valproate. The anomaly seen in the brain MRI of this patient (Figure 1D) that may explain her variable phenotype has never been described in previously reported FCMTE families [26]. This patient was first diagnosed of L-dopa responsive parkinsonism, however the semiology of the gait disturbance, the type of tremor, and the remaining motor symptoms differ from the phenotype described in PD. For instance, her instability associated with the orthostatic tremor of the lower extremities has never seen in PD. Another, relatively young patient (III-7) also felt some light sensitivity that might enhance with the disease progression. Although the mother (II-11) of this patient was not available for examination, given the AD pattern of inheritance of this family, she is an obligate carrier. Two of her sisters were also examined, however none them developed epilepsy or tremor (Figure 1A).

In order to identify the genetic causes underlying disease in our family, WES was performed in three affected individuals of three different generations. This led us to identify two disease-segregating mutations in ACMSD and MYBBP1A genes, respectively (Table 2). Both mutations (Trp26Stop and p.Ala920Thr) were absent in large number of control chromosomes, including ethnicity matched controls, but only the mutation in ACMSD, p.Trp26Stop, which causes a premature stop codon and is conserved among other orthologs, was predicted to be pathogenic (Figure 1B/C). The fact that only one family was identified with mutations in this gene is not surprising, as almost each FCMTE family maps to a different locus. The absence of pathogenic mutations in two families previously linked to FCMTE2 also suggests that ACMSD is not responsible for the FCMTE2 phenotype and the FCMTE2 gene remains to be discovered. While it is also possible that the ACMSD disease- segregating mutation that causes a truncated protein may be a very rare benign variant, the already-known involvement of kynurenines in the genesis of epileptic seizures in mice, frogs, and rats further supports its pathogenicity [20]. Even though we were unable to identify any ET or LOPD patient with mutations in ACMSD, the presence of tremor in all our patients and the observation of parkinsonism in one of them support the possibility that the nigrostriatal dopaminergic system may also be vulnerable to ACMSD mutation, as suggested by previously published GWAS studies [24]. However this should be interpreted with caution since only one of our patients presents with parkinsonism, the PD-associated SNPs lie outside the ACMSD locus, and this association, which showed moderate evidence of heterogeneity across populations [24], has not been replicated by all PD-associated GWAS studies [27].

The association of ACMSD mutation with cortical myoclonus, epilepsy, and parkinsonism is very interesting. Human ACMSD, predicted to be a cytosolic enzyme, is expressed at very low but significant levels in the brain [28]. ACMSD is part of the kynurenine pathway, which is the main route of tryptophan metabolism. Many kynurenines, including quinolinate, which levels increase at ACMSD deficiency, cannot cross the blood-brain barrier, or do very poorly, and as such must be formed locally within the brain [12], suggesting that the regulation of quinolinate is brain-specific. While we were unable to examine the brain-specific ACMSD in our patients, the ACMSD expression levels have already been shown to be highly correlated to the enzyme activity levels [28], suggesting that the ACMSD mutation identified in our patients probably results in a significant decrease of its enzymatic activity. It has additionally been shown that the inhibition of ACMSD

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 8

blocks the conversion of tryptophan to picolinic acid (PA), which results in cellular QA accumulation (Figure 2) [29], and that intracerebroventricular inyection of QA causes

NIH-PA Author Manuscript NIH-PA Author Manuscriptseizure NIH-PA Author Manuscript activity in mice [18]. Taken together, we hypothesize that the ACMSD p.Trp26Stop mutation may result in a significant increased of the cellular QA levels in the brain, probably due to impairments in its enzymatic activity, leading to the initiation and propagation of seizures. These QA-induced seizures have been shown to be associated with increased levels of extracellular KYNA, suggesting that high KYNA levels arise as a response to the seizure activity and are therefore neuroprotectives [20, 30].

In addition, the involvement of abnormal serotonin transmission in the generation of seizures and myoclonus has been discussed for a long time. In particular, previous research has demonstrated a reduction of tryptophan and other serotonin metabolites in animals and patients with PME as well as cerebrospinal fluid of patients with cortical myoclonus; recent data also support the implication of altered tryptophan metabolism in the pathogenesis of Unverricht-Lundborg disease [31, 32]; and both 5-hydroxy-L-tryptophan and alpha- lactoalbumin have already been used for the treatment of myoclonus [33, 34].

In conclusion, despite that further studies are warranted to elucidate the molecular mechanisms by which ACMSD mutation may cause cortical myoclonus, epilepsy, and parkinsonism, we conclude that the disease-segregating ACMSD p.Trp26Stop mutation is likely to be responsible for the FCMTE phenotype seen in our patients. This finding supports the evidence that cellular changes in the metabolites of the kynurenine pathway are implicated in neurodegeneration [12, 23] and suggests that both brain-specific KYNA deficiency and QA accumulation may also be important factors in the pathogenesis of cortical myoclonic tremor and epilepsy. Ultimately, the kynurenine pathway is likely to be a potential drug target for treating these and other devastating neurodegenerative disorders [35].

Supplementary Material

Refer to Web version on PubMed Central for supplementary material.

Acknowledgments

We thank the patients and their families for participating in this study. This work is supported in part by the “Instituto de Salud Carlos III” (FIS PI10/02714; JFMM) and the National Institute of Neurological Disorders and Stroke of the National Institute of Health under award number R21NS082881 to CPR.

References 1. van Rootselaar AF, van Schaik IN, van den Maagdenberg AM, Koelman JH, Callenbach PM, Tijssen MA. Familial cortical myoclonic tremor with epilepsy: a single syndromic classification for a group of pedigrees bearing common features. Mov Disord. 2005; 20:665–673. [PubMed: 15747356] 2. Mikami M, Yasuda T, Terao A, Nakamura M, Ueno S, Tanabe H, Tanaka T, Onuma T, Goto Y, Kaneko S, Sano A. Localization of a gene for benign adult familial myoclonic epilepsy to chromosome 8q23.3-q24.1. Am J Hum Genet. 1999; 65:745–751. [PubMed: 10441581] 3. Depienne C, Magnin E, Bouteiller D, Stevanin G, Saint-Martin C, Vidailhet M, Apartis E, Hirsch E, LeGuern E, Labauge P, Rumbach L. Familial cortical myoclonic tremor with epilepsy: the third locus (FCMTE3) maps to 5p. Neurology. 2010; 74:2000–2003. [PubMed: 20548044] 4. de Falco FA, Striano P, de Falco A, Striano S, Santangelo R, Perretti A, Balbi P, Cecconi M, Zara F. Benign adult familial myoclonic epilepsy: genetic heterogeneity and allelism with ADCME. Neurology. 2003; 60:1381–1385. [PubMed: 12707452]

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 9

5. Striano P, Chifari R, Striano S, de Fusco M, Elia M, Guerrini R, Casari G, Canevini MP. A new benign adult familial myoclonic epilepsy (BAFME) pedigree suggesting linkage to chromosome 2p11.1-q12.2. Epilepsia. 2004; 45:190–192. [PubMed: 14738428] NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript 6. Saint-Martin C, Bouteiller D, Stevanin G, Popescu C, Charon C, Ruberg M, Baulac S, LeGuern E, Labauge P, Depienne C. Refinement of the 2p11.1-q12.2 locus responsible for cortical tremor associated with epilepsy and exclusion of candidate genes. Neurogenetics. 2008; 9:69–71. [PubMed: 17992546] 7. Crompton DE, Sadleir LG, Bromhead CJ, Bahlo M, Bellows ST, Arsov T, Harty R, Lawrence KM, Dunne JW, Berkovic SF, Scheffer IE. Familial adult myoclonic epilepsy: recognition of mild phenotypes and refinement of the 2q locus. Arch Neurol. 2012; 69:474–481. [PubMed: 22491192] 8. Carr JA, van der Walt PE, Nakayama J, Fu YH, Corfield V, Brink P, Ptacek L. FAME 3: a novel form of progressive myoclonus and epilepsy. Neurology. 2007; 68:1382–1389. [PubMed: 17452583] 9. Yeetong P, Ausavarat S, Bhidayasiri R, Piravej K, Pasutharnchat N, Desudchit T, Chunharas C, Loplumlert J, Limotai C, Suphapeetiporn K, Shotelersuk V. A newly identified locus for benign adult familial myoclonic epilepsy on chromosome 3q26.32-3q28. Eur J Hum Genet. 2013; 21:225– 228. [PubMed: 22713812] 10. Merner ND, Girard SL, Catoire H, Bourassa CV, Belzil VV, Riviere JB, Hince P, Levert A, Dionne-Laporte A, Spiegelman D, Noreau A, Diab S, Szuto A, Fournier H, Raelson J, Belouchi M, Panisset M, Cossette P, Dupre N, Bernard G, Chouinard S, Dion PA, Rouleau GA. Exome sequencing identifies FUS mutations as a cause of essential tremor. Am J Hum Genet. 2012; 91:313–319. [PubMed: 22863194] 11. Krebs CE, Paisan-Ruiz C. The use of next-generation sequencing in movement disorders. Front Genet. 2012; 3:75. [PubMed: 22593763] 12. Schwarcz R, Bruno JP, Muchowski PJ, Wu HQ. Kynurenines in the mammalian brain: when physiology meets pathology. Nat Rev Neurosci. 2012; 13:465–477. [PubMed: 22678511] 13. Stone TW, Darlington LG. Endogenous kynurenines as targets for drug discovery and development. Nat Rev Drug Discov. 2002; 1:609–620. [PubMed: 12402501] 14. Karkheiran S, Krebs CE, Makarov V, Nilipour Y, Hubert B, Darvish H, Frucht S, Shahidi GA, Buxbaum JD, Paisan-Ruiz C. Identification of COL6A2 mutations in progressive myoclonus epilepsy syndrome. Hum Genet. 2013; 132:275–283. [PubMed: 23138527] 15. Exome Variant Server. NHLBI Exome Sequencing Project (ESP). Seattle, WA: 2012. URL: http:// evsgswashingtonedu/EVS/) [06/2013] 16. Thusberg J, Olatubosun A, Vihinen M. Performance of mutation pathogenicity prediction methods on missense variants. Hum Mutat. 2011; 32:358–368. [PubMed: 21412949] 17. Guidetti P, Luthi-Carter RE, Augood SJ, Schwarcz R. Neostriatal and cortical quinolinate levels are increased in early grade Huntington’s disease. Neurobiol Dis. 2004; 17:455–461. [PubMed: 15571981] 18. Lapin IP. Stimulant and convulsive effects of kynurenines injected into brain ventricles in mice. J Neural Transm. 1978; 42:37–43. [PubMed: 641543] 19. Rahman A, Ting K, Cullen KM, Braidy N, Brew BJ, Guillemin GJ. The excitotoxin quinolinic acid induces tau phosphorylation in human neurons. PLoS One. 2009; 4:e6344. [PubMed: 19623258] 20. Wu HQ, Schwarcz R. Seizure activity causes elevation of endogenous extracellular kynurenic acid in the rat brain. Brain Res Bull. 1996; 39:155–162. [PubMed: 8866691] 21. Mori S, Bernardi R, Laurent A, Resnati M, Crippa A, Gabrieli A, Keough R, Gonda TJ, Blasi F. Myb-binding protein 1A (MYBBP1A) is essential for early embryonic development, controls cell cycle and mitosis, and acts as a tumor suppressor. PLoS One. 2012; 7:e39723. [PubMed: 23056166] 22. Lapin IP. Kynurenines and seizures. Epilepsia. 1981; 22:257–265. [PubMed: 6263604] 23. Amaral M, Outeiro TF, Scrutton NS, Giorgini F. The causative role and therapeutic potential of the kynurenine pathway in neurodegenerative disease. J Mol Med (Berl). 2013; 91:705–713. [PubMed: 23636512] 24. Nalls MA, Plagnol V, Hernandez DG, Sharma M, Sheerin UM, Saad M, Simon-Sanchez J, Schulte C, Lesage S, Sveinbjornsdottir S, Stefansson K, Martinez M, Hardy J, Heutink P, Brice A, Gasser

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 10

T, Singleton AB, Wood NW. Imputation of sequence variants for identification of genetic risks for Parkinson’s disease: a meta-analysis of genome-wide association studies. Lancet. 2011; 377:641– 649. [PubMed: 21292315] NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript 25. Magnin E, Vidailhet M, Ryff I, Ferreira S, Labauge P, Rumbach L. Fronto-striatal dysfunction in type 3 familial cortical myoclonic tremor epilepsy occurring during aging. J Neurol. 2012; 259:2714–2719. [PubMed: 22736081] 26. Sharifi S, Aronica E, Koelman JH, Tijssen MA, Van Rootselaar AF. Familial cortical myoclonic tremor with epilepsy and cerebellar changes: description of a new pathology case and review of the literature. Tremor Other Hyperkinet Mov (N Y). 2012; 2:472–482. 27. Liu X, Cheng R, Verbitsky M, Kisselev S, Browne A, Mejia-Sanatana H, Louis ED, Cote LJ, Andrews H, Waters C, Ford B, Frucht S, Fahn S, Marder K, Clark LN, Lee JH. Genome-wide association study identifies candidate genes for Parkinson’s disease in an Ashkenazi Jewish population. BMC Med Genet. 2011; 12:104. [PubMed: 21812969] 28. Fukuoka S, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H, Shibata K. Identification and expression of a cDNA encoding human alpha-amino-beta-carboxymuconate-epsilon- semialdehyde decarboxylase (ACMSD). A key enzyme for the tryptophan-niacine pathway and “quinolinate hypothesis”. J Biol Chem. 2002; 277:35162–35167. [PubMed: 12140278] 29. Fukuwatari T, Ohsaki S, Fukuoka S, Sasaki R, Shibata K. Phthalate esters enhance quinolinate production by inhibiting alpha-amino-beta-carboxymuconate-epsilon-semialdehyde decarboxylase (ACMSD), a key enzyme of the tryptophan pathway. Toxicol Sci. 2004; 81:302–308. [PubMed: 15229365] 30. Schwarcz R, Speciale C, French ED. Hippocampal kynurenines as etiological factors in seizure disorders. Pol J Pharmacol Pharm. 1987; 39:485–494. [PubMed: 2906431] 31. Arbatova J, D’Amato E, Vaarmann A, Zharkovsky A, Reeben M. Reduced serotonin and 3- hydroxyanthranilic acid levels in serum of cystatin B-deficient mice, a model system for progressive myoclonus epilepsy. Epilepsia. 2005; 46(Suppl 5):49–51. [PubMed: 15987253] 32. Striano P, D’Amato E, Pezzella M, Mainardi P, Zara F, Striano S. Sudden death in Unverricht- Lundborg patients: is serotonin the key? Neurol Sci. 2010; 31:115–116. [PubMed: 19953285] 33. Errichiello L, Pezzella M, Santulli L, Striano S, Zara F, Minetti C, Mainardi P, Striano P. A proof- of-concept trial of the whey protein alfa-lactalbumin in chronic cortical myoclonus. Mov Disord. 2011; 26:2573–2575. [PubMed: 22025266] 34. Pranzatelli MR, Tate E, Galvan I, Wheeler A. A controlled trial of 5-hydroxy-L-tryptophan for ataxia in progressive myoclonus epilepsy. Clin Neurol Neurosurg. 1996; 98:161–164. [PubMed: 8836591] 35. Vecsei L, Szalardy L, Fulop F, Toldi J. Kynurenines in the CNS: recent advances and new questions. Nat Rev Drug Discov. 2013; 12:64–82. [PubMed: 23237916]

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 11

KEY MESSAGES: JMME-D-13-00147R1

NIH-PA Author Manuscript NIH-PA Author Manuscript- ACMSD NIH-PA Author Manuscript is mutated in a family with cortical myoclonus, epilepsy, and parkinsonism. - ACMSD mutation contributes to the development of FCMTE. - QA accumulation is likely to play an important role in the pathogenesis of FCMTE. - The kynurenine pathway as a potential drug target for the treatment of epilepsy.

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 12 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 1. A) Pedigree structure of the Spanish family featuring a complex form of FCMTE. Both disease-segregating mutations are shown. B) Sequence chromatograms showing the ACMSD wild-type mutation sequence at the bottom and the heterozygous ACMSD mutant sequence at the top (Blue arrow). C) ACMSD p.W26X mutation conservation across different species is represented. HS: homo sapiens; BT: Bos Taurus; CL: Canis Lupus; MM: Mus musculus; PT: Pan troglodytes, RN: Rattus Norvegicus. D) Brain MRI of patient II-3. Left: Coronal Inversion Recovery (IR): hypointense linear signals (arrows) in the corticospinal pathways. Right: Transversal T2 weighted image showing a high-intensity signals in the brainstem (arrow). Mild vermian cerebellar atrophy is shown.

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 13 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 2. Diagram of the kynurenine pathway of tryptophan degradation in mammals [12, 35]. In red is highlighted what is believed to occur in the presence of ACMSD deficiency. KYNA levels are elevated in response to seizure activity. IDO: Indoleamine 2,3-dioxigenase; TDO: Tryptophan 2,3-dioxygenase; KYNA: Kynurenic acid; KATs: Kynurenine aminotransferases; 3-HK: 3-hydroxykynurenine; 3-HANA: 3-hydroxyyanthranilic acid; 3- HAO: 3-hydroxyyanthranilic acid 3,4-dioxygenase; ACMSD: α-amino-β-carboxymuconate- ε-semialdehyde decarboxylase; ACMS: α-amino-β-carboxymuconate-ε-semialdehyde; AMS: α-aminomuconate-ε-semialdehyde; QA: Quinolinic acid (quinolinate).

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 14 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript None None Seizures 3 partials 5 (Yearly) frequency (Past year) VPA Dopa Medication OXCBZ, CZP VPA, LVT, L- PB, VPA, none V μ − − N/A SEP 15 (Both sides) Giant Table 1 − + − Mild Photic PSW EEG Normal Normal Multifocal Focal PSW 17 20 17 22 GTC Age at onset of 20 17 23 N/A of tremor Age at onset 73 52 28 23 Age at follow-up F M M M Gender ID I-5 II-3 III-1 III-7 Patient EEG: Electroencephalogram, GTC: Generalized tonicclonic convulsions, SEP: Somatosensory evoked potentials, PSW: Polyspikes and waves, PB: Phenobarbital, VPA: Valproic acid, LVT: Levetiracetam, OXCBZ: Oxcarbazepine, CZP: Clonazepam, N/A: Not available, −: Absence, +: Present. Clinical and neurophysiological findings in patients with benign adult familial cortical myoclonic epilepsy

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Martí-Massó et al. Page 15 NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript http:// and Huntington Tumor suppressor Associated disease Epilepsy, Alzheimer brain Expression Highly expressed Kidney, liver, and Table 2 0.592/Neutral ). Truncated protein (MutPred/SNPs&Go) Pathogenecity Prediction Absent Absent Spanish Control Population (n=188) Protein p.W26X p.A920T variation http://snps-and-go.biocomp.unibo.it/snps-and-go/ c.77G>A variation Nucleotide c.2758G>A ) and SNPs&GO ( Chr 2q21.3 17p13.3 Gene ACMSD MYBBP1A Disease-segregating mutations identified through WES and subsequent analyses in a Spanish family featuring FCMTE mutpred.mutdb.org/ Highlighted in bold is the disease-segregating mutation responsible for FCMTE phenotype seen our patients.Computational methods pathogenecity prediction: MutPred (

J Mol Med (Berl). Author manuscript; available in PMC 2014 December 01. Manuscript under revision at Scientific Report Journal (February 2015) Identification of a SORT1 mutation resulting in sortilin deficiency in an inherited form of essential tremor

Elena Sánchez1, Alberto Bergareche2,3,4, Catharine E. Krebs1, Ana Gorostidi2,3,4, Vladimir Makarov5, Javier Ruiz-Martinez2,3, 4, Alejo Chorny6, Adolfo Lopez de Munain2,3,4,7, Jose Felix Marti- Masso2,3,4,7*&, and Coro Paisán-Ruiz1,8,9*&

1Department of Neurology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 2Biodonostia Research Institute, Neurosciences area, University of the Basque Country, EHU- UPV San Sebastián, Gipuzkoa, Spain 3Hospital Universitario Donostia, Department of Neurology, Movement Disorders Unit, San Sebastián, Guipuzcoa, Spain 4Centro de investigación biomédica en Red para enfermedades Neurodegenerativas (CIBERNED), Carlos III Health Institute, Madrid, Spain 5Human Oncology and Pathogenesis Program, Memorial Sloan-Kettering Cancer Center, 1275 York Ave, New York, NY 10065 6 The Immunology Institute, Department of Medicine, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 7Department of Neurosciences, University of the Basque Country, EHU-UPV, San Sebastián, Guipuzcoa, Spain 8Departments of Psychiatry and Genetics and Genomic Sciences, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA 9Friedman Brain and Mindich Child Health and Development Institutes, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA

*Joint last authors &Correspondence should be addressed to: Coro Paisán-Ruiz, Department of Neurology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, USA. Email: [email protected], phone: 212-241- 0108, fax: 212-828-4221. Jose Felix Martí-Massó, Department of Neurology, Hospital Donostia, San Sebastián, Guipuzcoa, Spain. Email: [email protected]

Abstract

Essential tremor (ET) is the most prevalent movement disorder affecting millions of people in the United States. Although a positive family history is one of the most important risk factors for ET, the genetic causes of ET remain unknown. Therefore, in this study, whole exome sequencing and subsequent analyses were performed in a family with an autosomal dominant form of early- onset ET. Functional analyses including mutagenesis, cell culture, gene expression, enzyme- linked immunosorbent, and apoptosis assays were also performed. A disease-segregating mutation (p.Gly171Ala), absent in normal population, was identified in the SORT1 gene. It was shown that the p.Gly171Ala mutation not only impairs the expression of its encoding protein sortilin, but also the mRNA levels of its binding partner p75 neurotrophin receptor that is known to be implicated in brain injury and neurotransmission. This study describes the identification of SORT1 as a causative gene for an inherited form of early-onset ET.

J Neurol (2014) 261:2411–2423 DOI 10.1007/s00415-014-7516-3

ORIGINAL COMMUNICATION

Compound heterozygous PNPLA6 mutations cause Boucher–Neuha¨user syndrome with late-onset ataxia

A. Deik • B. Johannes • J. C. Rucker • E. Sa´nchez • S. E. Brodie • E. Deegan • K. Landy • Y. Kajiwara • S. Scelsa • R. Saunders-Pullman • C. Paisa´n-Ruiz

Received: 9 July 2014 / Revised: 18 September 2014 / Accepted: 19 September 2014 / Published online: 30 September 2014 Ó Springer-Verlag Berlin Heidelberg 2014

Abstract PNPLA6 mutations, known to be associated heterozygosity was confirmed by cloning and sequencing with the development of motor neuron phenotypes, have the patient’s genomic DNA from coding exons 26–29. recently been identified in families with Boucher–Neuha¨- Furthermore, both mutations (one novel and one known) user syndrome. Boucher–Neuhaüser is a rare autosomal fell in the phospholipase esterase domain, where most recessive syndrome characterized by the co-occurrence of pathogenic mutations seem to cluster. Taken together, we cerebellar ataxia, hypogonadotropic hypogonadism, and herein confirm PNPLA6 mutations as the leading cause of chorioretinal dystrophy. Gait ataxia in Boucher–Neuhaüser Boucher–Neuhaüser syndrome and suggest inquiring about usually manifests before early adulthood, although onset in a history of hypogonadism or visual changes in patients the third or fourth decade has also been reported. However, presenting with late-onset gait ataxia. We also advocate for given the recent identification of PNPLA6 mutations as the neuroophthalmologic evaluation in suspected cases. cause of this condition, the determining factors of age of symptom onset still need to be established. Here, we have Keywords Autosomal recessive Boucher–Neuhaüser identified a sporadic Boucher–Neuhaüser case with late- Chorioretinal dystrophy Hypogonadotropic onset gait ataxia and relatively milder retinal changes due hypogonadism PNPLA6 mutations NTE domain to compound heterozygous PNPLA6 mutations. Compound

A. Deik K. Landy Department of Neurology, Parkinson’s Disease and Movement Icahn School of Medicine at Mount Sinai, The Graduate School Disorders Center, University of Pennsylvania, 330 S. 9th Street, of Biomedical Sciences, One Gustave L. Levy Place, New York, Philadelphia, PA 19107, USA NY 10029, USA

B. Johannes E. Deegan S. Scelsa R. Saunders-Pullman Y. Kajiwara C. Paisań-Ruiz Department of Neurology, Mount Sinai Beth Israel, 10 Union Department of Psychiatry, Icahn School of Medicine at Mount Square East, Suite 5K, New York, NY 10003, USA Sinai, One Gustave L. Levy Place, New York, NY 10029, USA e-mail: [email protected] C. Paisań-Ruiz J. C. Rucker E. Sańchez R. Saunders-Pullman Department of Genetics and Genomic Sciences, Icahn School of C. Paisań-Ruiz (&) Medicine at Mount Sinai, One Gustave L. Levy Place, Department of Neurology, Icahn School of Medicine at Mount New York, NY 10029, USA Sinai, One Gustave L. Levy Place, Box 1137, New York, NY 10029, USA C. Paisań-Ruiz e-mail: [email protected] Friedman Brain and Mindich Child Health and Development Institutes, Icahn School of Medicine at Mount Sinai, One J. C. Rucker S. E. Brodie Gustave L. Levy Place, New York, NY 10029, USA Department of Ophthalmology, Icahn School of Medicine at Mount Sinai, One Gustave L. Levy Place, New York, NY 10029, USA

123 2412 J Neurol (2014) 261:2411–2423

Introduction that both mutations identified in this study were located in- trans, the patient’s genomic DNA containing both PNPLA6 Boucher–Neuhaüser (B–N; MIM #215470) is a rare syn- mutations was amplified by PCR using forward primer 50- drome characterized by the triad of early-onset autosomal ATGGAGGCCCGAATTCCTAAGTGCTGCTTGCTCAC recessive cerebellar ataxia (ARCA), hypogonadotropic CC-30 and reverse primer 50-GCCGCGGTACCTCGAG hypogonadism, and chorioretinal dystrophy [1, 2]. Gait CATACCACTCTGGGCTTTAAGTAGC-30, and Phusion ataxia in Boucher–Neuhaüser has been typically reported High-Fidelity polymerase (Thermo Fisher Scientific Inc, between the first and third decades of life; later ages of Waltham, MA, USA). Purified PCR fragment of 2,801 bp onset are rare [1, 3–5]. Although sporadic cases without was cloned into pCMV-HA vector (Clontech, Mountain apparent consanguinity have been reported, most reports View, CA, USA) using In-FusionÒ HD following the are among siblings (about 80 %) [6, 7], often of consan- manufacturer’s protocol. Ten independent colonies were guineous parents [3, 6]. It is unclear whether there is a picked randomly and sequenced in both directions as reporting bias away from sporadic cases in this autosomal described above. PredictSNP (http://loschmidt.chemi.muni. recessive disorder, but this seems plausible. Its genetic cz/predictsnp), which is a consensus of six prediction tools causes have recently been established by the identification [11], and Mutation Taster (http://www.mutationtaster.org) of PNPLA6 (patatin-like phospholipase domain containing were used for mutation pathogenicity prediction. The Ho- 6) mutations in both B–N and Gordon–Holmes (G-H) moloGene database from NCBI web site (http://www.ncbi. syndromes. PNPLA6 genetic variability was known to be nlm.nih.gov/homologene) was also used to examine the implicated in motor neuron phenotypes including spastic conservation of the PNPLA6 p.Ser1173Arg mutation in paraplegia [8, 9]. PNPLA6 (MIM #603197; 19p13.2) different species. encodes for a neuropathy target esterase (NTE). Five different transcripts have been identified, with the longest transcript, transcript variant 1 (NM_001166111.1), encod- Results ing a protein (NP_001159583.1) of 1,375 amino acids. In this study, we have identified a sporadic case of B–N This 59-year-old woman, born to non-consanguineous syndrome with an unusually late age of onset of ataxic parents from Spain and Italy, had normal development until symptoms due to compound heterozygous PNPLA6 muta- adolescence, when it was noted that she had primary tions. Details of her phenotype, including ophthalmologic amenorrhea. Hormone therapy for 1 year in her 20s led to findings, are described. menses, but was poorly tolerated and stopped. First onset of neurological symptoms was at age 43, when she noted mild, but progressive, binocular vertical or oblique diplopia Materials and methods on lateral gaze in either direction. Between ages 50–51 she developed gait imbalance and veering to either side, which Due to the recent identification of PNPLA6 mutations in slowly worsened. When she was 54–55 years her voice B–N syndrome [6, 10], these were investigated in a patient became ‘‘raspy’’. with sporadic B–N syndrome. The ethics committees at At age 58, her symptoms started to worsen rapidly over both Mount Sinai Beth Israel and Icahn School of Medicine several months. She started to feel mentally clouded and at Mount Sinai approved this study, and written informed developed word-finding difficulties, although this did not consent was obtained from the participant. The partici- interfere with everyday function. She also reported anhe- pant’s DNA samples were isolated from whole blood using donia. Of note, she had no monocular visual symptoms, but standard procedures. Genomic primers for PCR amplifi- had seen ophthalmologists in the past who noted retinal cations covering exons and intron–exon boundaries were abnormalities, suggesting either macular degeneration or a designed using a primer design public website (http://ihg. ‘‘burn from the sun’’. gsf.de/ihg/ExonPrimer.html; primer sequences available On examination, she had excellent recall of short- and upon request). All purified PCR products were then long-term events. However, her Montreal Cognitive sequenced in both forward and reverse directions with Assessment (MoCA) score was 19/30 (normal [25), with Applied Biosystems BigDye terminator v3.1 sequencing deficits in attention, visuospatial abilities, and delayed chemistry as per the manufacturer’s instructions. The recall. She had a scanning quality to her speech, with mild resulting sequencing reactions were resolved on an labial and lingual dysarthria. She had decreased hearing to ABI3130 genetic analyzer (Applied Biosystems, Foster finger rub on the left. city, CA, USA) and analyzed using Sequencer 5.2.3 soft- Visual acuity was 20/25 bilaterally. Color vision (Ishi- ware (Gene Codes Corporation, Ann Arbor, MI, USA). hara) was 10/10 plates correct in both eyes. There was no Due to the lack of additional family members, and to verify afferent pupillary defect. She had hypometric vertical and 123 J Neurol (2014) 261:2411–2423 2413 horizontal saccades, saccadic smooth pursuit, gaze-evoked Family history was notable for her mother developing nystagmus and poor visual suppression of vestibular ocular dementia and parkinsonism in her 50s, and death at the age reflexes. Although ocular motor range was full, she had an of 77. The patient’s mother also lost eight full-term chil- alternating skew deviation on lateral gaze, which explained dren within 1 day of their birth, and had three spontaneous her diplopia on lateral gaze. There was also a small esophoria abortions of unknown gestation lengths. The patient’s only in central position that increased in right and left gaze. sibling to survive the perinatal period was her full brother, Retinal atrophy was evident on the dilated fundoscopic who is in his 60s. exam, as is shown in Fig. 1. Spectral mode ocular coher- Brain magnetic resonance imaging (MRI) (Fig. 4a, b) ence tomography (OCT) imaging (Heidelberg Spectralis) demonstrated superior cerebellar/vermian atrophy and confirmed these changes (Fig. 2). The phototopic electro- prominent cerebellar folia, with a normal pituitary gland retinogram (ERG) was reduced by 50 %, but scotopic and only minimal, likely age-related periventricular white function reduction was less severe. Goldmann visual field matter disease. Electromyography and nerve conduction showed bitemporal central defects and a slight blind spot studies (EMG/NCS) showed absent bilateral tibial H enlargement bilaterally, as well as a small paracentral reflexes, and absent medial plantar mixed nerve response. scotoma to the I2 isopter on the left (Fig. 3a, b). The sural and peroneal sensory response amplitudes were She had normal strength, tone and no tremor. Reflexes in the lower range of normal. Peroneal and tibial F wave were normal, except for reduced ankle jerks, and there was minimal latencies were also normal. The peroneal CMAP mild vibratory loss in her toes. She had dysdiadochokinesia amplitude and conduction velocity were normal. There in her arms and legs, dysmetria on heel-to-shin but not on were borderline, high-amplitude motor unit potentials and finger-to-nose, and significant overshoot on the finger fibrillations in the gastrocnemius muscle. Overall, the study chase task, bilaterally. Her stance was wide-based, her gait was consistent with a mild distal axonal neuropathy. was ataxic with occasional veering to either side, and she Blood chemistries and thyroid hormones, rheumatologic was able to tandem walk with much difficulty. tests, vitamin E level and paraneoplastic panel were all

Fig. 1 Fundus photography of the posterior pole of the right eye (a) and the region nasal to the optic disk in the left eye (b) demonstrates a large patch of complete retinal pigment epithelium (RPE) and choriocapillaris atrophy nasally adjacent to the optic disk in each eye. A crescent-shaped patch of partial atrophy temporal to the macula is seen in the right eye, along with pigmentary macular changes. Choroidal vessels are visible in atrophic regions in each eye. There was no pigmentary deposition or clumping. Peripapillary regions demonstrate grayish discoloration. Autoﬂuorescence photographs of the right eye (c) and left eye (d) demonstrate crescent-shaped zones of patchy hyperﬂuorescence temporal to the macula and in the fovea bilaterally

123 2414 J Neurol (2014) 261:2411–2423

Fig. 2 Spectral mode OCT images through central fovea in right eye with loss of the layered retinal architecture. The choriocapillaris is (a) and left eye (b). Note retinal thinning and loss of the outer retinal absent, and adjacent to the optic disks, the larger choroidal vessels are ellipsoid line temporally (arrows) corresponding to areas of hyper- effaced as well. e Nerve fiber layer OCT shows bilateral nasal nerve autofluorescence. Spectral mode OCT images nasal to the optic disks fiber layer thinning in the right eye (c) and left eye (d). The retinas are severely thinned,

Fig. 3 Goldmann visual ﬁeld in the left eye (a) and right eye (b) shows large temporal defects in each eye and a tiny nasal scotoma in the left eye

123 J Neurol (2014) 261:2411–2423 2415

Fig. 4 Sagittal T1- (a) and axial T2- (b) weighted brain magnetic resonance images showing cerebellar folia prominence and marked vermian atrophy, respectively

normal. Luteinizing hormone was low at 0.1 mIU/mL along with the fact that mutations located in the phospholipid (normal postmenopausal 7.7–58.5), as was follicular stim- esterase domain are prone to abolish the catalytic activity of ulating hormone (0.3 mIU/mL, normal postmenopausal NTE [6], support the pathogenic role of the novel mutation 25.8–134.8). Prolactin, estradiol, and random cortisol were described here. To further examine whether mutations were within normal ranges (6 ng/mL, 13.23 pg/mL and 3.6 lg/ transmitted from both parents and were located on separate dL, respectively). alleles, the patient’s genomic DNA from coding exon 26 to Chromosome analysis was performed by Integrated exon 29 was cloned and sequenced. We observed that five out Genetics and revealed a normal female 46, XX karyotype. of ten clones only carried the p.Ser1045Leu mutation, while Mitochondrial DNA mutation and deletion testing for the the other five carried the p.Ser1173Arg mutation alone. This commercial GeneDx panel of 58 known disease-associated indicates that both mutations were located on separate alleles mutations was negative. Subsequent sequencing of the (one mutation was, therefore, transmitted from the father and mitochondrial genome showed a m.5780 G[A sequence one from the mother). change in the MT-TC gene, which has previously been associated with sensorineural hearing loss but has also been described as a benign polymorphism [12, 13]. Testing for Discussion SCA-7 at Athena Diagnostics, Inc., showed a normal number of 10 CAG repeats for both alleles. In this study, we have identified a sporadic B–N case PNPLA6 mutational screening identified compound het- presenting with unusually late-onset gait ataxia due to erozygous pathogenic mutations, one known (c.3134C[T; compound heterozygous PNPLA6 mutations, confirming p.Ser1045Leu) and one novel (c.3519C[G; p.Ser1173Arg), that genetic variability in PNPLA6 is probably the major in coding exons 26 and 29, respectively. The longest tran- cause of Boucher–Neuhaüser syndrome. Our case demon- script, transcript variant 1 (NM_001166111.1), was used for strated the classic triad of B–N syndrome, which includes mutation nomenclature. This novel PNPLA6 mutation, which cerebellar ataxia, hypopituitary hypogonadism, and chori- was found to be highly conserved among other orthologs and oretinal dystrophy [1, 2]. Like PLA2G6 (phospholipase A2, was predicted to be pathogenic by two computational meth- Group VI), PNPLA6 contains a patatin-like domain. ods (PredictSNP score: 0.61 and Mutation Taster score: 0.99), Interestingly, while PLA2G6 mutations have been reported fell in the phospholipid esterase domain (Patatin-like to cause infantile neuroaxonal dystrophy, atypical parkin- domain) at the C-terminal, where the majority of pathogenic sonism, and neurodegeneration with brain iron accumula- PNPLA6 mutations seem to cluster (Fig. 5a, b) [6]. The tion, PNPLA6 mutations have been typically related to p.Ser1173Arg mutation was additionally absent in 188 eth- hereditary spastic paraplegia, and, more recently, ataxia [6, nicity-matched, neurologically normal chromosomes tested 8, 15, 16]. Although these phenotypic heterogeneities are by direct screening of PNPLA6 exon 29 and other public SNP often seen in genes involved in diseases of the central databases such as dbSNP (http://www.ncbi.nlm.nih.gov/pro nervous system [17], it is likely that this broad clinical jects/SNP/) and Exome Variant Server of the National Heart, spectrum relates to the complex role of the patatin-like Lung, and Blood Institute (NHLBI) Exome Sequencing domain within the brain, which is involved in brain Project (http://evs.gs.washington.edu/EVS/)[14]. This, lipid metabolism, neuronal development, intracellular

123 2416 J Neurol (2014) 261:2411–2423

Fig. 5 a PNPLA6 protein structure showing its predicted functional mutations identified in spastic paraplegia (red), spastic ataxia (blue), domains and all described pathogenic mutations. Domains were and GHS (green). b Sequence chromatograms of wild-type and predicted by SMART (http://smart.embl-heidelberg.de). cNMP stands mutant PNPLA6 exon 29, novel mutation (p.Ser1173Arg) is high- for cyclic nucleotide-monophosphate binding domain and patatin lighted with a black arrow. Conservation among other species of the represents the patatin-like phospholipase domain also known as novel p.Ser1173Arg mutation (red) is also shown. Of note, conser- phospholipid esterase domain. A tyrosine kinase phosphorylation site vation scores (GERP?? and PhyloP) were 4.98 and 2.32 for the is also predicted at residues 403–410 (not shown). All mutations previously described mutation, and 1.02 and 0.469 for the novel identified in BNS are reported above with mutations identified in this herein described. BT Bos taurus, CL Canis lupus, DR Danio rerio, GG study highlighted in bold. The novel PNPLA6 mutation identified in Gallus gallus, HS Homo sapiens, MM Mus musculus. PT Pan trog- this study is also represented within a rectangle. Below are reported lodytes, RN Rattus norvegicus membrane trafficking, and axon maintenance, among oth- diagnosed molecularly. In that case series, the age of ataxia ers [18, 19]. Given that lipid metabolism is a highly pre- onset ranged 6–27 years of age. B–N patients’ ataxic served function among species and tissue types, the symptoms have been usually reported as subtle ‘‘clumsi- multisystem effects of PNPLA6 mutations are not surpris- ness’’ and/or minor balance abnormalities progressing to a ing. Indeed, PNPLA6 mutations can also cause autosomal gait disorder, with or without dysarthria [6]. Taking into recessive spastic paraplegia, spastic ataxia without chori- account all clinical B–N reports to date, our case is oretinal dystrophy or hypogonadism, and Gordon–Holmes exceedingly unusual in that the first sign of cerebellar syndrome. G-H differs from B–N in that it lacks chorio- dysfunction (diplopia) appeared at age 43, and gait ataxia retinal dystrophy, often has prominent spasticity [6], and did not appear until age 50. Besides ataxia, hormonal may be due to either mutations in PNPLA6 or RNF216. dysfunction (resulting from involution of gonadotropic Dysarthria is usually the presenting neurologic symptom in function) is typically not a prominent presenting feature, G-H, but ataxia leading to wheelchair dependency invari- and it may precede gait ataxia by years. Further, cases may ably ensues. Dementia is also prominent [20]. Because of respond to treatment with exogenous gonadotropins, and phenotypic similarities between RNF216 and PNPLA6 while our patient did not have children, maintained phys- gene mutation carriers, one may speculate that both of iological plasma testosterone concentrations, induced tes- these genes are involved in a pathway with common ticular enlargement and induction of spermatogenesis have downstream effects. Whether mutations in RNF216 also been reported in G-H syndrome, which is also due to cause B–N has not been determined. PNPLA6 mutations [21]. Whereas the clinical syndrome of B–N was first recog- The ocular changes noted in B–N are distinctive in their nized and reported in 1969 (Table 1), only the cases pattern of progressive RPE and choriocapillaris atrophy, reported by Synofzik et al. [6, 10] and now ours, have been with macular changes in the posterior pole and mid-

123 erl(04 261:2411–2423 (2014) Neurol J Table 1 Summary of Boucher–Neuhaüser cases reported since 1969 References Cases Consanguinity/ Age at case Mutation (s) Ataxia onset Age Ocular Fundoscopic findings/Dx Other Imaging or ethnicity description/ age at symptom/age age neurologic autopsy last HH of onset or Dx findings findings examination Dx and/ or TX

This study 1 woman No/mixed 59 Compound 51 11 Diplopia/43 ChD/58 CI CA Spanish- heterozygous Hyporreflexia Italian [p.Ser1045Leu; p.Ser1173Arg] Synofzik 1 woman N/A 37 Compound N/A 14 VI/37 ChD/37 Hyperreflexia CA et al. heterozygous and [10] [V738Qfs*98; hyporreflexia V1110M] Synofzik Family Yes/Brazilian 56 Homozygous 6–7 N/A VI/1–3 ChD Mild CI CA et al. [6] IHG25190 55 [p.Thr1058Ile] Pontine 4 siblings: 1 53 atrophy man, 3 48 Small pituitary women Family No/Italian 44 Compound 6 (sister N/A VI in only 1 ChD in the woman with Mild CI CA ARCA-05 42 heterozygous with intact sister/12 visual complaints Spasticity 2 sisters [p.Val738Glnfs*98; vision), 27 p.Val1110Met] (other) Family No/Brazilian 61 Compound 6 N/A N/A ChD N/A CA IHG25353 57 heterozygous 2 brothers [p.Gly578Trp; p.Phe1066Ser] Family No/ 26 Compound 20 N/A N/A ChD N/A CA IHG25357 Venezuelan heterozygous 1 man [p.Ser1045Leu; p.Pro1122Leu] Kate et al. Brother and Yes/U 22 (male N/A 20 22 None Mottled retinal pigment CI CA [7] sister proband) epithelium T ST2WMH N/A N/A 18 N/A N/A N/A CI CA ST2WMH Ling et al. 1 man No/Thai 45 N/A 43 43 VI/39 Retinal pigment epithelium Right foot CA [3] atrophy choriocapillaris dystonia Putaminal and and bone spicule-like Chorea midbrain

123 clumps of pigment Titubation atrophy deposits 2417 2418 123 Table 1 continued References Cases Consanguinity/ Age at case Mutation (s) Ataxia onset Age Ocular Fundoscopic findings/Dx Other Imaging or ethnicity description/ age at symptom/age age neurologic autopsy last HH of onset or Dx findings findings examination Dx and/ or TX

Yu et al. 1 man U/Asian 18 N/A 16 18 VI and Retinal pigment epithelium NCA [29] photophobia/ and choriocapillaris 12 atrophy, with visible choroidal vessels Jbour et al. 3 siblings: 1 Yes/Arab 21 (male N/A 6 20 Astigmatism Atrophic PR CI CA [25] man and 2 proband) Bilateral ptosis women 17 17 N/A 14 14 Santos 1 man Yes/U 34 N/A N/A N/A Night PR CA et al. blindness ST2WMH [22] Rizzi et al. 2 brothers No/U 38 N/A 20 20 VI/6 Chorioretinal atrophy with N CA [30] pigmentary changes Bilateral pes cavus 36 N/A 24 18 VI/24 Bilateral PR with marked N CA choroidal atrophy T Frontal cortical atrophy Rump Brother and No/U 31 (male N/A Slight, since 25 Night Retinal pigment epithelium Moderate pes CA (vermian) et al. sister proband) childhood blindness and choriocapillaris cavus [31] and atrophy in the mid- Hyporreflexia constricting peripheral areas visual fields/ peripapillary atrophy and 23 retinal pigment epithelium alterations of the maculae/23 24 N/A 21 Visual field Atrophic retinal pigment erl(04 261:2411–2423 (2014) Neurol J constriction/ epithelium atrophy 21 Narrow retinal vessels Bone spicule-like clumps of pigment deposition/24 Salvador 1 woman N/A 39 N/A 28 17 Progressive VI Retinal pigment epithelium T Diffuse CA et al. and and choriocapillaris Scanning [32] photophobia/ atrophy in the posterior speech 37 pole and mid-periphery erl(04 261:2411–2423 (2014) Neurol J Table 1 continued References Cases Consanguinity/ Age at case Mutation (s) Ataxia onset Age Ocular Fundoscopic findings/Dx Other Imaging or ethnicity description/ age at symptom/age age neurologic autopsy last HH of onset or Dx findings findings examination Dx and/ or TX

Tojo et al. 2 sisters Yes/U 52 N/A 20 28 ‘‘Visual ChD/52 T CA [5] problems’’/ Dysarthria 46 57 N/A 35 35 N/A ChD/57 Dysarthria Erdem 1 man Yes/U 27 N/A 12 27 VI/12 Peripheral pigmented N CA (vermian) et al. macular scars and atypical Slow pupillary Cortical and [23] pigmentary patterns responses subcortical Macular pigment Scanning atrophy epithelium atrophy speech Baroncini 2 brothers N/A 33 N/A 25 20 VI/6 PR/6 T Normal et al. Chorioretinal atrophy with Bilateral pes [24] macular involvement and cavus pigmentary changes/16 Brachycephaly 31 N/A 24 18 N/A Fine retinal pigmentary TCA changes and coarse Mild cerebral macular pigmentation/6 atrophy Choroidal atrophy/30 Fok et al. Brother and No/Chinese 18 (male N/A 8 18 High myopia Peripapillary degeneration N Diffuse CA [33] sister proband) and with chorioretinal Pendular knee Fourth astigmatism atrophy/18 jerks ventricular 21 N/A 6 21 N/A N/A dilatation 123 2419 2420 123 Table 1 continued References Cases Consanguinity/ Age at case Mutation (s) Ataxia onset Age Ocular Fundoscopic findings/Dx Other Imaging or ethnicity description/ age at symptom/age age neurologic autopsy last HH of onset or Dx findings findings examination Dx and/ or TX

Limber Family 1 1 No/U 32 (female N/A 27 15 Trouble Larger choroidal vessels N Chronic et al. [4] woman proband) reading from sclerosis atrophic changes T cerebellar and 1 man a of the retinal pigment degeneration blackboard/ epithelium with coarse (autopsy 20 pigmentation finding) Scotoma 25 N/A Early 17 N/A PR/15 N Slight childhood Speech delay prominence (male of cerebellar brother) folia Family 2a 2 Yes/mixed 53 N/A 33–38 53 Scotoma Early senile macular CI Normal at age sisters and Russian– (Neuhaüser) degeneration/53 N 53 2 brothers German and 69 Choroidal atrophy around Ocular (Limber) the disc, macular atrophic dysmetria (female lesions/69 proband) 58 (proband’s N/A 12 N/A N/A N/A T N/A brother) Neuhaüser’s Boucher 2 sisters No/U 35 N/A 34 35 VI/4 ChD CI N/A et al. [1] N 15 N/A U 15 VI/12 ChD N N/A Moderate limitation of upgaze Areflexia erl(04 261:2411–2423 (2014) Neurol J CA cerebellar atrophy, ChD chorioretinal dystrophy, CI cognitive impairment, Dx diagnosis, HH hypogonadotropic hypogonadism, N nystagmus, N/A not available, PR pigmentary retinopathy, ST2WMH subcortical T2-weighted white matter hyperintensities, T tremor, Tx treatment, U unknown, VI visual impairment a Previously reported by Neuhaüser and Opitz in 1975. In Neuhaüser’s paper, all four siblings were reported, but only one male and one female were examined. Information on the other two siblings was retrospective J Neurol (2014) 261:2411–2423 2421 periphery of each eye. Deposition of brown pigment cAMP or cGMP [28]. Therefore, possible complex inter- clumps in the mid-peripheral retina, known as pigmentary actions between NTE and other molecules (including the clumping, may also be present. Synofzik et al. [6, 10] transcriptase of RNF216) may give rise to the wide phe- recently published two separate reports of patients with notypic spectrum associated with PNPLA6 genetic vari- PNPLA6 mutations including photographic examples of ability. Genotyping of other B–N cases is necessary to these chorioretinal changes and pigmentary clumping. In better understand PNPLA6-associated genotype–phenotype one of these reports few visual details were available, but correlations. in the other, fundoscopy and OCT findings of a 37-year-old Our patient’s family history was interesting, but of woman with B–N with visual loss and ataxia were shown. unclear significance. Since we did not have a sample of OCT demonstrated retinal thinning and atrophy of cho- our patient’s mother’s DNA, we can only speculate roidal vessels in our patient like in Synofzik’s, but the about her possible carrier state. It is plausible that this degree of chorioretinal dystrophy was much less severe in heterozygous state may have predisposed her for what ours. Furthermore, our patient lacked pigmentary clumps. we can only hypothesize was a dementia with Lewy We find it interesting that, overall, our patient demon- bodies phenotype. Of course, we also cannot exclude the strated a milder form of the chorioretinal process than possibility of a de novo mutation in our patient, which previously reported, which is rather counterintuitive given would make her mother’s phenotype completely our patient’s older age. coincidental. Published B–N case descriptions suggest that additional In sum, we identified a novel B–N case with com- features may be present, including subcortical T2 white pound heterozygous PNPLA6 mutations, further con- matter hyperintensities [7, 22], basal ganglia [3], midbrain firming the causative role of PNPLA6 in B–N syndrome. [3], and cortical atrophy [23, 24], pyramidal tract abnor- Our case shows that sporadic-appearing gait ataxia malities and hyperkinetic movements (Table 1). Cognitive beginning in the 50s can be due to PNPLA6 mutations, decline was noted in our patient and others [1, 4, 7, 25], and and that it is justified to query for a history of hypogo- we suspect it may constitute a more prominent feature than nadism and retinal findings in adult-onset gait ataxia. previously recognized [1]. Although our patient never Furthermore, we recognize that visual symptoms may be underwent formal cognitive testing prior to our initial absent in patients with mild phenotypes, and suggest that evaluation, she reported normal cognition earlier in her life, patients in whom B–N is suspected undergo a neuro- and a very clear history of recent cognitive decline. To our ophthalmologic evaluation. Finally, our case adds weight knowledge, previous reports of cognitive impairment in B– to the assumption that PNPLA6 mutations are the leading N patients were present early in the patients’ lives, and cause of Boucher–Neuhaüser syndrome; since both of this progressive decline has not been clearly documented [1, 4, patient’s mutations were located in the phospholipase 6, 7, 25]. esterase domain (where most pathogenic mutations seem PNPLA6 encodes for NTE, which is the key protein in to cluster, as shown in Fig. 5), we believe the phospho- the pathogenesis of organophosphorous (OP) compound- lipase esterase domain will be the most appropriate induced delayed neuropathy (OPIDN) [26]. In this condi- molecular target for the development of novel therapeutic tion, certain OP esters lead to a degeneration of long axons strategies. in the spinal cord and peripheral nerves, either through direct protein inhibition or through generation of neuro- Acknowledgments Authors would like to thank the patient, rela- toxic complexes. Given the known role of PNPLA6 in the tives, and other participants for their contribution to this research. Research reported in this publication was supported by the National pathogenesis of neuropathy, it is plausible that loss of Institute of Neurological Disorders and Stroke (NINDS) of the function mutations may predispose B–N patients to the National Institute of Health (NIH) under Award Number development of polyneuropathy, which was largely sub- R01NS079388 (CPR) and NIH K02NS073836 (RSP). clinical in our patient as demonstrated only by her EMG/ Ethical Standards The patient described herein has given her NCS. informed consent for this manuscript’s publication. No patient-iden- NTE is also known to deacetylate intracellular phos- tifying information has been included in this manuscript. phatidylcholine to produce glycerophosphocholine [27]. It has also been reported to avidly hydrolyze a number of Conflicts of interest Dr. Deik has no conflicts of interest. Ms. Johannes has no conflicts of interest. Dr. Rucker has no conflicts of lysophospholipids, indicating a role in intracellular mem- interest. Dr. Sańchez has no conflict of interest. Dr. Brodie has no brane trafficking [28]. NTE is predicted to contain a single conflicts of interest. Dr. Deegan has no conflicts of interest. Ms. transmembrane domain, a tyrosine kinase phosphorylation Landy has no conflicts of interest. Dr. Kajiwara has no conflict of site, and regions of cyclic nucleotide-binding sites (Fig. 5), interest. Dr. Scelsa has no conflicts of interest. Dr. Saunders-Pullman has no conflicts of interest. She is funded in part through NIH the latter indicating that it may be regulated by either K02NS073836. Dr. Paisań-Ruiz has no conflicts of interest.

123 2422 J Neurol (2014) 261:2411–2423

References Barbot C, Carrilho I, Santos M, Malik I, Gitschier J, Hayflick SJ (2008) Neurodegeneration associated with genetic defects in 1. Boucher BJ, Gibberd FB (1969) Familial ataxia, hypogonadism phospholipase A(2). Neurology 71:1402–1409. doi:10.1212/01. and retinal degeneration. Acta Neurol Scand 45:507–510 wnl.0000327094.67726.28 2. Neuhauser G, Opitz JM (1975) Autosomal recessive syndrome of 16. Paisan-Ruiz C, Bhatia KP, Li A, Hernandez D, Davis M, Wood cerebellar ataxia and hypogonadotropic hypogonadism. Clin NW, Hardy J, Houlden H, Singleton A, Schneider SA (2009) Genet 7:426–434 Characterization of PLA2G6 as a locus for dystonia-parkinson- 3. Ling H, Unnwongse K, Bhidayasiri R (2009) Complex movement ism. Ann Neurol 65:19–23. doi:10.1002/ana.21415 disorders in a sporadic Boucher–Neuhauser syndrome: pheno- 17. Krebs CE, Paisan-Ruiz C (2012) The use of next-generation typic manifestations beyond the triad. Mov Disord sequencing in movement disorders. Front Genet 3:75. doi:10. 24:2304–2306. doi:10.1002/mds.22831 3389/fgene.2012.00075 4. Limber ER, Bresnick GH, Lebovitz RM, Appen RE, Gilbert- 18. Song Y, Wang M, Mao F, Shao M, Zhao B, Song Z, Shao C, Barness EF, Pauli RM (1989) Spinocerebellar ataxia, hypogo- Gong Y (2013) Knockdown of PNPLA6 protein results in motor nadotropic hypogonadism, and choroidal dystrophy (Boucher– neuron defects in zebrafish. Dis Model Mech 6:404–413. doi:10. Neuhauser syndrome). Am J Med Genet 33:409–414. doi:10. 1242/dmm.009688 1002/ajmg.1320330325 19. Read DJ, Li Y, Chao MV, Cavanagh JB, Glynn P (2009) Neu- 5. Tojo K, Ichinose M, Nakayama M, Yamamoto H, Hasegawa T, ropathy target esterase is required for adult vertebrate axon Kawaguchi Y, Sealfon SC, Sakai O (1995) A new family of maintenance. J Neurosci 29:11594–11600. doi:10.1523/JNEUR Boucher–Neuhauser syndrome: coexistence of Holmes type cer- OSCI.3007-09.2009 ebellar atrophy, hypogonadotropic hypogonadism and retino- 20. Margolin DH, Kousi M, Chan YM, Lim ET, Schmahmann JD, choroidal degeneration: case reports and review of literature. Hadjivassiliou M, Hall JE, Adam I, Dwyer A, Plummer L, Aldrin Endocr J 42:367–376 SV, O’Rourke J, Kirby A, Lage K, Milunsky A, Milunsky JM, 6. Synofzik M, Gonzalez MA, Lourenco CM, Coutelier M, Haack Chan J, Hedley-Whyte ET, Daly MJ, Katsanis N, Seminara SB TB, Rebelo A, Hannequin D, Strom TM, Prokisch H, Kernstock (2013) Ataxia, dementia, and hypogonadotropism caused by C, Durr A, Schols L, Lima-Martinez MM, Farooq A, Schule R, disordered ubiquitination. N Engl J Med 368:1992–2003. doi:10. Stevanin G, Marques W Jr, Zuchner S (2014) PNPLA6 mutations 1056/NEJMoa1215993 cause Boucher–Neuhauser and Gordon–Holmes syndromes as 21. Quinton R, Barnett P, Coskeran P, Bouloux PM (1999) Gordon– part of a broad neurodegenerative spectrum. Brain 137:69–77. Holmes spinocerebellar ataxia: a gonadotropin deficiency syn- doi:10.1093/brain/awt326 drome resistant to treatment with pulsatile gonadotropin-releasing 7. Kate MP, Kesavadas C, Nair M, Krishnan S, Soman M, Singh A hormone. Clin Endocrinol (Oxf) 51:525–529 (2011) Late-onset Boucher–Neuhauser syndrome (late BNS) 22. Santos AV, Saraiva PF, Breia PN (2003) Significance of neuro- associated with white-matter changes: a report of two cases and imaging in the diagnosis of Boucher–Neuhauser syndrome. Acta review of literature. J Neurol Neurosurg Psychiatry 82:888–891. Med Port 16:193–195 doi:10.1136/jnnp.2009.196790 23. Erdem E, Kiratli H, Erbas T, Varli K, Eldem B, Akalin S, Tan E, 8. Rainier S, Bui M, Mark E, Thomas D, Tokarz D, Ming L, Del- Topaloglu H, Gedikoglu G (1994) Cerebellar ataxia associated aney C, Richardson RJ, Albers JW, Matsunami N, Stevens J, with hypogonadotropic hypogonadism and chorioretinopathy: a Coon H, Leppert M, Fink JK (2008) Neuropathy target esterase poorly recognized association. Clin Neurol Neurosurg 96:86–91 gene mutations cause motor neuron disease. Am J Hum Genet 24. Baroncini A, Franco N, Forabosco A (1991) A new family with 82:780–785. doi:10.1016/j.ajhg.2007.12.018 chorioretinal dystrophy, spinocerebellar ataxia and hypogonado- 9. Rainier S, Albers JW, Dyck PJ, Eldevik OP, Wilcock S, Rich- tropic hypogonadism (Boucher–Neuhauser syndrome). Clin ardson RJ, Fink JK (2011) Motor neuron disease due to neu- Genet 39:274–277 ropathy target esterase gene mutation: clinical features of the 25. Jbour AK, Mubaidin AF, Till M, El-Shanti H, Hadidi A, Ajlouni index families. Muscle Nerve 43:19–25. doi:10.1002/mus.21777 KM (2003) Hypogonadotropic hypogonadism, short stature, 10. Synofzik M, Kernstock C, Haack TB, Schols L (2014) Ataxia cerebellar ataxia, rod-cone retinal dystrophy, and hyperseg- meets chorioretinal dystrophy and hypogonadism: Boucher– mented neutrophils: a novel disorder or a new variant of Bou- Neuhauser syndrome due to PNPLA6 mutations. J Neurol Neu- cher–Neuhauser syndrome? J Med Genet 40:e2 rosurg Psychiatry. doi:10.1136/jnnp-2014-307793 26. Emerick GL, Peccinini RG, de Oliveira GH (2010) Organo- 11. Bendl J, Stourac J, Salanda O, Pavelka A, Wieben ED, Zendulka phosphorus-induced delayed neuropathy: a simple and efficient J, Brezovsky J, Damborsky J (2014) PredictSNP: robust and therapeutic strategy. Toxicol Lett 192:238–244. doi:10.1016/j. accurate consensus classifier for prediction of disease-related toxlet.2009.10.032 mutations. PLoS Comput Biol 10:e1003440. doi:10.1371/journal. 27. Zaccheo O, Dinsdale D, Meacock PA, Glynn P (2004) Neurop- pcbi.1003440 athy target esterase and its yeast homologue degrade phosphati- 12. Lehtonen MS, Moilanen JS, Majamaa K (2003) Increased vari- dylcholine to glycerophosphocholine in living cells. J Biol Chem ation in mtDNA in patients with familial sensorineural hearing 279:24024–24033. doi:10.1074/jbc.M400830200 impairment. Hum Genet 113:220–227. doi:10.1007/s00439-003- 28. Wilson PA, Gardner SD, Lambie NM, Commans SA, Crowther 0966-9 DJ (2006) Characterization of the human patatin-like phospho- 13. Thomas AW, Edwards A, Sherratt EJ, Majid A, Gagg J, Alcolado lipase family. J Lipid Res 47:1940–1949. doi:10.1194/jlr. JC (1996) Molecular scanning of candidate mitochondrial tRNA M600185-JLR200 genes in type 2 (non-insulin dependent) diabetes mellitus. J Med 29. Yu SI, Kim JL, Lee SG, Kim HW, Kim SJ (2008) Ophthalmo- Genet 33:253–255 logic findings of Boucher–Neuhauser syndrome. Korean J Oph- 14. Exome Variant Server (2014) NHLBI Exome Sequencing Project thalmol 22:263–267. doi:10.3341/kjo.2008.22.4.263 (ESP), Seattle, WA. (http://evs.gs.washington.edu/EVS/) [09/2014] 30. Rizzi R, Carelli V, Monari L, Mochi M, Liguori R, Sensi M, 15. Gregory A, Westaway SK, Holm IE, Kotzbauer PT, Hogarth P, Cocozza S, Filla A, Montagna P (1998) Cerebellar ataxia, Sonek S, Coryell JC, Nguyen TM, Nardocci N, Zorzi G, Rodri- hypogonadism and chorioretinopathy: molecular analysis of an guez D, Desguerre I, Bertini E, Simonati A, Levinson B, Dias C, Italian family. Ital J Neurol Sci 19:41–44

123 J Neurol (2014) 261:2411–2423 2423

31. Rump P, Hamel BC, Pinckers AJ, van Dop PA (1997) Two sibs 33. Fok AC, Wong MC, Cheah JS (1989) Syndrome of cerebellar with chorioretinal dystrophy, hypogonadotropic hypogonadism, ataxia and hypogonadotropic hypogonadism: evidence for pitui- and cerebellar ataxia: Boucher–Neuhauser syndrome. J Med tary gonadotrophin deﬁciency. J Neurol Neurosurg Psychiatry Genet 34:767–771 52:407–409 32. Salvador F, Garcia-Arumi J, Corcostegui B, Minoves T, Tarrus F (1995) Ophthalmologic ﬁndings in a patient with cerebellar ataxia, hypogonadotropic hypogonadism, and chorioretinal dystrophy. Am J Ophthalmol 120:241–244

123