Molecular Psychiatry (2001) 6, 387–395 2001 Nature Publishing Group All rights reserved 1359-4184/01 $15.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Mutation analysis of SYNJ1: a possible candidate gene for chromosome 21q22-linked bipolar disorder T Saito, F Guan, DF Papolos, S Lau, M Klein, CSJ Fann and HM Lachman Department of Psychiatry, Division of Psychiatry Research, Albert Einstein College of Medicine, Bronx, New York 10461, USA Genes involved in the regulation of synaptic vesicle function are potential candidates for the development of psychiatric disorders. In addition to experimental and theoretical consider- ations, a number of genes involved in synaptic vesicle function map to regions of the genome that have been linked to bipolar disorder (BPD) and schizophrenia (SZ). One is synaptojanin 1(SYNJ1) which maps to 21q22.2, a chromosomal region that has been linked to BPD in a subset of families in several studies. Synaptojanin 1 is an inositol 5-phosphatase that has an important role in synaptic vesicle endocytosis. Mutation screening of 32 exons, intron–exon junctions, and 839 bases of 5Ј-flanking DNA resulted in the identification of 11 mutations of which four were very common and seven were very rare. Of the 11 mutations identified, sev- eral may have functional significance including two coding variants, two that may affect the binding of a transcription factor, and two that involve known splicing regulatory domains. Five bipolar patients out of 149 analyzed were found who have one of the four rare variants that were most likely to have functional significance compared with 0/148 controls. The allele frequencies for three of the four common variants were very similar in bipolar patients and controls. A slight difference in allele frequency was found for an interesting mutation we detected in intron 12 in which two non-adjacent thymidine residues are deleted in a poly-AT tract located near the exon 12 splice donor site (␹2 = 2.45, P = 0.12, 2-tailed). Although we failed to unequivocally identify a specific SYNJ1 allele that could be responsible for putative chromosome 21q22-linked BPD, several interesting variants were found to be increased in bipolar subjects and should be further investigated. Molecular Psychiatry (2001) 6, 387–395. Keywords: SNP; SNARE; polymorphism; candidate gene; chromosome 21; manic depression; manic depressive illness Introduction cal features of ADHD overlap with those found in mania and hypomania. Fifth, altered expression of the Genes involved in the regulation of synaptic vesicle synaptic proteins SNAP-25, synaptophysin, and com- function are good candidates to consider for BPD sus- plexins I and II, have been found in the brains of ceptibility. This idea is based on several observations. 5–9 + schizophrenics and bipolar individuals. Finally, a First, Ca2 and phosphoinositides, which are critical number of genes encoding homologs of SNARE and mediators of synaptic vesicle function, are targets for vesicle proteins, and their regulators, map to regions some of the drugs used to treat BPD.1 Second, of the genome that are suspected to harbor BPD and SZ depletion of vesicle catecholamines by reserpine may susceptibility genes. SNAP29, RAB36, phosphatidyl- cause depression, especially in patients with underly- inositol 4-kinase (Pl4K), synapsin III and synaptogyrin ing mood disorders.2 Third, amphetamine, which 1 map to chromosome 22q11–13,10–16 synapsin I and induces behavioral changes similar to those found in synaptophysin map to Xp11,17 SYBL1 maps to Xq28,18 SZ and in mania, causes the redistribution of cat- syntaxin 7 maps to 6q2119–21 and SYNJ1, which echolamines from vesicles to cytosol.3 Fourth, deletion encodes synaptojanin, a phosphatase enriched in pre- of the gene encoding the SNARE protein SNAP-25 in synaptic terminals, maps to 21q22.2.22–28 the coloboma mouse strain causes behavioral alter- Phosphoinositides are important regulators of vesicle ations that mimic those found in patients with atten- exocytosis and endocytosis.29 The endocytic proteins tion deficit hyperactivity disorder (ADHD).4 The clini- synaptojanin, dynamin 1 and amphiphysin, and synap- totagmin, a synaptic vesicle protein involved in exocytosis through its role as a Ca2+ sensor, all bind Correspondence: HM Lachman, Department of Psychiatry, phosphoinositides.30–34 Synaptojanin regulates endo- Division of Psychiatry Research, Albert Einstein College of Medi- cytosis by dephosphorylating soluble and lipidic phos- cine, 1300 Morris Park Ave, Bronx, New York 10461, USA. E- Ј mail: LachmanȰaecom.yu.edu phoinositides at the 5 position of the inositol ring. Its Received 4 October 2000; revised 11 December 2000; accepted 19 targets include phosphatidylinositol 4,5-bisphosphate December 2000 (Pl(4,5)P2) and phosphatidylinositol 3,4,5-trisphos- Mutation analysis of SYNJ1 T Saito et al 388 29–32 phate (Pl(3,4,5)P3. The dephosphorylation of and AP000277). Primers were derived from intron Pl(4,5)P2 by synaptojanin is a critical step in the sequences and were designed to amplify exons and uncoating of clathrin from endocytic vesicles. intron–exon junctions. Overlapping primers were used The SYNJ1 gene encodes 170-kDa and 145-kDa syn- to amplify the 5Ј-flanking region. The primers used in aptojanin isoforms that are generated by alternative this study are shown in Table 1. The SYNJ1 gene is splicing; synaptojanin-170 is expressed at low concen- cloned in the opposite orientation in all of the genomic trations in many tissues and fetal brain whereas synap- clones in GenBank. However, the polymorphisms tojanin-145 is primarily found in nerve terminals.33–35 reported in this study are reported from the perspective The SYNJ1 gene encodes three distinct functional of the sense strand. domains. The central portion encodes the inositol 5- PCR-amplified genomic DNA fragments were phosphatase activity. The 5Ј-region is homologous to screened for polymorphisms using a modification of the cytosolic portion of the yeast Sac1 protein, which the single strand conformation polymorphism (SSCP) has been implicated in the regulation of vesicular traffic. The Sac1-like homology has been shown to have an intrinsic polyphosphoinositide phosphatase activity Table 1 Primers used to amplify SYNJ1 exons and intron separate from that encoded by the central 5-phospha- exon junctions tase domain.36,37 The 3Ј end encodes a proline-rich region that is involved in binding synaptojanin to Exon Forward primer Reverse primer Size amphiphysin and other proteins found on endocytic vesicles.33,34,37,38 1 ggcgcaatgcggaagagatg gacgctgcggaggcagagac 200 Based on its role in vesicle recycling, as well as its 2 atgctttgcagtccttgctg ggttgcatctgaattgtttcaa 283 location on 21q22.2, a region of the genome mapped 3 gaatccaatgtttcaggtca ctctcaaatccttagaattac 206 in a subset of families with BPD, we viewed SYNJ1 as 4 aggtgcaagaagaaatggaa actgaacaactgctgaacat 400 5 catactttgttacttagtat tgttattctagtattttctgtg 350 a credible candidate gene for BPD. 6 gtaagtgtaacaacttttct actatccagaaagtttagaa 210 7 gtgtgttcagcaaagaaatt gaagtgaatcagtaaataca 240 Methods 8 attgaaaaaattgggcttc aataccattctaggggtcca 210 9 ttagatggatatttgccttt atgttccaattcaaagaaca 270 Subjects 10 cctcaattattcactgtttg ttaaagaggcagatgataca 203 Patients with BPD were diagnosed on the basis of 11 tctggtagttcttaaaagcc ggccatttaaaagctttatgaag 299 either a SADS-L interview or by unstructured clinical 12 aaaacctaatgagtaaaatcag gtttacatttacctcttggcc 291 interview modified from SADS-L that yielded diagnos- 13 ttttgtcactatactcaacattt ccaattatatggctttatttgt 195 tic information enabling the diagnosis of BPD using 14 tttataaatggtttgatgcagc acacagtcaggatttattaac 290 RDC criteria.39,40 Patients with either bipolar disorder 15 gttggatggggttgctattt agtttccctcaactggcaaa 201 I (BPI) (n = 95) or bipolar disorder II (BPII) (n = 54) were 16 ttgtcataaaataggctattgt tttcttgttatttaatggtagg 263 17 tcttgaaatttcaaatctgcga tatatttcaaagctttatcttc 284 included in the study. The patients were recruited from 18 aagcatatctcaggcaaaga cgacccaaaatcttaatgca 291 clinics and private practices affiliated with the Albert 19 tgtctgaatgaaaacagaac tcataagtttacattagttcatt 272 Einstein College of Medicine. Forty-three subjects were 20 tcctgcttatacagcttctc caaacaatttcaaacactatta 219 unrelated patients with BPI obtained from the Coriell 21 gaaatttgtttgaaatacacc cccaaataaggtgatttcta 358 Institute in conjunction with the The National Insti- 22 gcttgttatgtctatggtat agataatcttgctgcatgtc 220 tutes of Mental Health Bipolar Genetics Initiative. 23 gtcagcctctttattccaaa cagattggaagaaaacatatc 292 Patients signed an informed consent approved by the 24 tggagttatctctgatcaag catcaagcacattggccaca 300 local Committee on Clinical Investigation. Control sub- 25 atcttcttacctcctgtgcg gagtgaagaattttacatctagc 220 jects were students, anonymous blood bank donors, 26 atactatagcaatctttgac ctttcaggtgtaaaacattaat 181 27 gtttactatggaaattgtct gggcgctgacactgagaaa 199 anonymous DNA samples obtained from liver biopsies 28/29 agcaagctgatgttatgcaa tagtagtaaacaggacttag 370 in consenting patients undergoing abdominal surgery, 30 agaattttacctgtggaagg aaattttctgggctcaagtgatc 220 and hospital, medical school, and clinic staff. No for- 31 cttccttcattataccacaa ggtatgttcaaagactaaatc 425 mal testing procedure was used to screen controls for 32 aaagcattttgttgactgaa ttcatacatctaatgtgttg 180 underlying psychiatric illness. All patients and con- trols were Caucasian. There were 79 female and 70 5Ј-flanking male controls (mean age 45.5 ± 15.2 female, 44.3 ± 15.7 male), and 83 female and 66 male patients with BPD pro1