DOCSLIB.ORG

Chondrichthyes: Chimaeriformes: Chimaeridae), a New Species of Chimaera from New Zealand

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chondrichthyes: Chimaeriformes: Chimaeridae), a New Species of Chimaera from New Zealand Bull Mar Sci. 91(1):63–81. 2015 new taxa paper http://dx.doi.org/10.5343/bms.2014.1042 Chimaera carophila (Chondrichthyes: Chimaeriformes: Chimaeridae), a new species of chimaera from New Zealand 1 * 1 Hollings Marine Lab, Medical Jenny M Kemper University of South Carolina, 331 David A Ebert 2, 3 Fort Johnson Rd., Charleston, 1 South Carolina 29412. Gavin JP Naylor Dominique A Didier 4 2 Pacific Shark Research Center, Moss Landing Marine Laboratories, 8272 Moss Landing Road, Moss Landing, California 95039. ABSTRACT.—A new species of chimaeroid, Chimaera carophila sp. nov., is described from 37 specimens collected 3 South African Institute for from deepwater slopes and seamounts around New Aquatic Biodiversity, Private Bag Zealand. The new species is distinguished from its closest 1015, Grahamstown, 6140, South Africa. congeners, Chimaera fulva Didier et al. 2008, Chimaera macrospina Didier et al. 2008, and Chimaera obscura Didier 4 Department of Biology, et al. 2008, by its uniform pale-brown coloration, geographic Millersville University, PO Box distribution, and a combination of morphological characters, 1002, Millersville, Pennsylvania 17551. including longer dorsal and ventral caudal fin bases, a shorter first dorsal fin height, a shorter dorsal fin spine, and shorter * Corresponding author email: claspers that are divided distally for one-third of their length. <[email protected]>. Chimaera carophila sp. nov. also can be distinguished from closely related species in New Zealand and Australian waters based on DNA sequence divergence of the NADH2 gene. Comparisons of body size in a large sample of specimens show considerable overlap in character ranges among congeners making species distinctions difficult. New combinations of morphometrics are suggested including ratios of head length to eye length and dorsal spine length to head length, to better distinguish among species of chimaeroids that are similar in Date Submitted: 19 May, 2014. overall appearance and size. Also, a key to New Zealand and Date Accepted: 10 November, 2014. Australian Chimaera species is provided. Available Online: 5 December, 2014. The chimaeroids (order Chimaeriformes) are a relatively small group of mainly deep-sea fishes comprised of three distinct families, Callorhinchidae (plow-nose chimaeras), Rhinochimaeridae (long-nose chimaeras), and Chimaeridae (short-nose chimaeras). There are currently 48 recognized species (Didier et al. 2012, Angulo et al. 2014). The most species-rich family, the Chimaeridae (37 species), contains two genera, Chimaera with 15 species and Hydrolagus with 22 species (Didier et al. 2012, Angulo et al. 2014). New technological developments in deep-water exploration including remotely- operated vehicles and manned submersibles along with the emergence of deep-water fisheries and concentrated efforts to survey local fauna have contributed to a recent resurgence in chimaeroid taxonomy (James et al. 2009, Didier et al. 2012). Since 2002, 18 new species have been described, all in the family Chimaeridae, with more species likely awaiting formal description. Of these 18 new species, nine occur in the Bulletin of Marine Science 63 © 2015 Rosenstiel School of Marine & Atmospheric Science of the University of Miami 64 Bulletin of Marine Science. Vol 91, No 1. 2015 southern Pacific Ocean around New Zealand and Australia (Last and Stevens 2009, Didier et al. 2012). In New Zealand waters, all three chimaeroid families occur, comprising 10 valid species: the family Callorhinchidae, with Callorhinchus milii Bory de St. Vincent, 1823; the family Chimaeridae, represented by the species Chimaera lignaria Didier, 2002, Chimaera panthera Didier, 1998, Hydrolagus bemisi Didier, 2002, Hydrolagus homonycteris Didier, 2008, Hydrolagus novaezealandiae (Fowler, 1910), Hydrolagus trolli Didier and Séret, 2002; the family Rhinochimaeridae, including the species Harriotta haeckeli Karrer, 1972, Harriotta raleighana Goode and Bean, 1895, and Rhinochimaera pacifica (Mitsukuri, 1895). Here, we formally describe a new species of Chimaera, previously referred to as Chimaera sp. C (Paulin et al. 1989), from New Zealand, using both morphological and molecular data. With the inclusion of this new species, it brings the number of Chimaera species in New Zealand waters to three and to 16 worldwide. Methods Specimens were collected by bottom trawl from deep-water fishing grounds around New Zealand as part of the Te Papa Biosystematics of New Zealand’s Exclusive Economic Zone (NZ EEZ) Fishes subcontract within the National Institute of Water and Atmospheric Research’s (NIWA) marine Biodiversity and Biosecurity outcome- based investment (OBI) program. Body measurements were taken point to point on preserved specimens following Compagno et al. (1990) and Didier (2002), and lateral line canal measurements of the head following Didier and Séret (2002). In total, 38 body measurements were tak- en: total length (TL); precaudal length (PCL); body length (BDL); snout-vent length (SVL); trunk length (TRL); pre-second dorsal length (PD2); pre-first dorsal length (PD1); pre-orbital length (POB); pre-oral length (POR); pre-narial length (PRN); sec- ond dorsal fin base (D2B); maximum height of anterior second dorsal fin (D2AH); maximum height of posterior second dorsal fin (D2PH); first dorsal fin base (D1B); dorsal spine length (DSA); maximum height of first dorsal fin (D1H); dorsal caudal margin (CDM); maximum height of dorsal caudal fin (CDH); total caudal fin length including filament (CTL); ventral caudal margin (CVM); maximum height of ventral caudal fin (CVH); head length (HDL); anterior margin of pectoral fin (P1A); ante- rior margin of pelvic fin (P2A); inter-dorsal space (IDS); dorsal-caudal space (DCS); posterior base of pectoral fin to anterior base of pelvic fin (PPS); posterior base of pelvic fin to anterior edge of ventral caudal fin (PCA); anterior edge of first dorsal fin base to anterior edge of pectoral fin base (D1P1); anterior edge of first dorsal fin base to anterior edge of pelvic fin base (D1P2); anterior edge of second dorsal fin base to anterior edge of pectoral fin base (D2P1); anterior edge of second dorsal fin base to anterior edge of pelvic fin base (D2P2); eye length (EYL); eye height (EYH); total length of claspers from pelvic fin base to tip (CLT); length of medial branch of clasper from fork to tip (CLM); length of lateral branch of clasper from fork to tip (CLL); length from anterior tip of frontal tenaculum knob to rear end of base (FTL). In total, eight lateral line canal measurements of the head were taken: distance from ante- rior oronasal fold to center of nasal canal (ONC); length of the rostral canal (LRC); length of the nasal canal measured as the straight line distance from right to left side (LNC); distance between infraorbital and angular canal measured as the straight line Kemper et al.: New species of Chimaera from New Zealand 65 Table 1. Primer sequences used in PCR amplification of NADH2 gene. Primer name Primer sequence ILEM 5΄ –AAGGAGCAGTTTGATAGAGT –3΄ ASNM 5΄ –AACGCTTAGCTGTTAATTAA –3΄ Chimaera F 5΄ –AAGGACTACTTTGATAGAGT –3΄ Chimaera R 5΄ –TAAAGTGTCTGGGTTGCATTCAG –3΄ Chimaera F1 5΄ –CATACCCCAAACACGTTGGTTAA –3΄ Chimaera R1 5΄ –AAGATCRATGCTTACTCACCTAG –3΄ distance from junction of the oral and infraorbital canal to the junction of the oral and angular canal (IOA); distance between preopercular canal and main trunk canal measured from their junction with the infraorbital canal (OTM); distance between the main trunk canal and supratemporal canal measured from their junctions with the infraorbital and postorbital canals (OCL); length of supratemporal canal mea- sured across the head from its junctions with the postorbital canal (STL); distance from anterior base of spine to the center of the supratemporal canal (SPS). Preserved specimens were examined from the following institutions: National Museum of New Zealand Te Papa Tongarewa (NMNZ), Commonwealth Science and Industrial Research Organization (CSIRO), and the Australian Museum, Sydney (AMS), where institutional abbreviations follow Eschmeyer and Fricke (2014). Muscle tissue was taken from representative specimens in the field and stored in 95% ethanol at 4 °C until further processing in the laboratory. Total DNA was ex- tracted using the EZNA® Tissue DNA Kit (Omega Bio-Tek) and stored at −20 °C. Samples were PCR amplified using primers designed to target the complete coding sequence for NADH dehydrogenase subunit 2 (NADH2; Naylor et al. 2005) along with TaKaRa Ex Taq. Primers were either designed to bind to the ASN and ILE tRNA regions of the mitochondrial genome of elasmobranchs or modified to be specific to NADH2 region of chimaeroid fishes (Table 1). PCR was carried out in a 25 μl volume comprising 1× TaKaRa buffer, 2 to 3.5 mM MgCl2, 200 μM of dNTPs, 0.32 μM for- ward and reverse primers, 0.625 units of Taq, 2 μl of undiluted DNA template derived directly from the EZNA kit, and PCR grade water. The initial reaction mix was de- natured at 94 °C for 2 min, then subjected to 30 cycles at 94 °C for 30 s, 50–58 °C for 30 s, and 72 °C for 1 min, followed by 72 °C for 5 min, and a hold at 4 °C. A sample of the PCR product was run on a 1% agarose gel and visualized under UV light to assess the efficacy of the PCR amplification. Those samples that were successfully amplified were sent out for DNA sequencing (Retrogen, San Diego, CA). The software pro- gram Geneious (v.6.1.7) was used to read sequences, assess quality, make nucleotide base calls, and align nucleotide and translated sequences. Aligned sequences were subjected to phylogenetic analysis using PAUP* v.4.0a131 (Swofford 2002) for the general-time reversible (GTR) + invariable sites (I) + gamma model under maximum likelihood. Parameter values for the nucleotide substitution model, the proportion of invariable sites and the alpha value for the gamma distribution used in the GTR likelihood analysis were estimated from the data using an initial tree based on parsi- mony analysis of the sequence data. Specimens used in molecular inference are referred to by a lab code (prefixed by GN) referring to the personal collection of G Naylor, College of Charleston, South Carolina.
Load more

Recommended publications
  • Extinction Risk and Conservation of the World's Sharks and Rays
    RESEARCH ARTICLE elife.elifesciences.org Extinction risk and conservation of the world’s sharks and rays Nicholas K Dulvy1,2*, Sarah L Fowler3, John A Musick4, Rachel D Cavanagh5, Peter M Kyne6, Lucy R Harrison1,2, John K Carlson7, Lindsay NK Davidson1,2, Sonja V Fordham8, Malcolm P Francis9, Caroline M Pollock10, Colin A Simpfendorfer11,12, George H Burgess13, Kent E Carpenter14,15, Leonard JV Compagno16, David A Ebert17, Claudine Gibson3, Michelle R Heupel18, Suzanne R Livingstone19, Jonnell C Sanciangco14,15, John D Stevens20, Sarah Valenti3, William T White20 1IUCN Species Survival Commission Shark Specialist Group, Department of Biological Sciences, Simon Fraser University, Burnaby, Canada; 2Earth to Ocean Research Group, Department of Biological Sciences, Simon Fraser University, Burnaby, Canada; 3IUCN Species Survival Commission Shark Specialist Group, NatureBureau International, Newbury, United Kingdom; 4Virginia Institute of Marine Science, College of William and Mary, Gloucester Point, United States; 5British Antarctic Survey, Natural Environment Research Council, Cambridge, United Kingdom; 6Research Institute for the Environment and Livelihoods, Charles Darwin University, Darwin, Australia; 7Southeast Fisheries Science Center, NOAA/National Marine Fisheries Service, Panama City, United States; 8Shark Advocates International, The Ocean Foundation, Washington, DC, United States; 9National Institute of Water and Atmospheric Research, Wellington, New Zealand; 10Global Species Programme, International Union for the Conservation
    [Show full text]
  • Updated Checklist of Marine Fishes (Chordata: Craniata) from Portugal and the Proposed Extension of the Portuguese Continental Shelf
    European Journal of Taxonomy 73: 1-73 ISSN 2118-9773 http://dx.doi.org/10.5852/ejt.2014.73 www.europeanjournaloftaxonomy.eu 2014 · Carneiro M. et al. This work is licensed under a Creative Commons Attribution 3.0 License. Monograph urn:lsid:zoobank.org:pub:9A5F217D-8E7B-448A-9CAB-2CCC9CC6F857 Updated checklist of marine fishes (Chordata: Craniata) from Portugal and the proposed extension of the Portuguese continental shelf Miguel CARNEIRO1,5, Rogélia MARTINS2,6, Monica LANDI*,3,7 & Filipe O. COSTA4,8 1,2 DIV-RP (Modelling and Management Fishery Resources Division), Instituto Português do Mar e da Atmosfera, Av. Brasilia 1449-006 Lisboa, Portugal. E-mail: [email protected], [email protected] 3,4 CBMA (Centre of Molecular and Environmental Biology), Department of Biology, University of Minho, Campus de Gualtar, 4710-057 Braga, Portugal. E-mail: [email protected], [email protected] * corresponding author: [email protected] 5 urn:lsid:zoobank.org:author:90A98A50-327E-4648-9DCE-75709C7A2472 6 urn:lsid:zoobank.org:author:1EB6DE00-9E91-407C-B7C4-34F31F29FD88 7 urn:lsid:zoobank.org:author:6D3AC760-77F2-4CFA-B5C7-665CB07F4CEB 8 urn:lsid:zoobank.org:author:48E53CF3-71C8-403C-BECD-10B20B3C15B4 Abstract. The study of the Portuguese marine ichthyofauna has a long historical tradition, rooted back in the 18th Century. Here we present an annotated checklist of the marine fishes from Portuguese waters, including the area encompassed by the proposed extension of the Portuguese continental shelf and the Economic Exclusive Zone (EEZ). The list is based on historical literature records and taxon occurrence data obtained from natural history collections, together with new revisions and occurrences.
    [Show full text]
  • New Zealand Fishes a Field Guide to Common Species Caught by Bottom, Midwater, and Surface Fishing Cover Photos: Top – Kingfish (Seriola Lalandi), Malcolm Francis
    New Zealand fishes A field guide to common species caught by bottom, midwater, and surface fishing Cover photos: Top – Kingfish (Seriola lalandi), Malcolm Francis. Top left – Snapper (Chrysophrys auratus), Malcolm Francis. Centre – Catch of hoki (Macruronus novaezelandiae), Neil Bagley (NIWA). Bottom left – Jack mackerel (Trachurus sp.), Malcolm Francis. Bottom – Orange roughy (Hoplostethus atlanticus), NIWA. New Zealand fishes A field guide to common species caught by bottom, midwater, and surface fishing New Zealand Aquatic Environment and Biodiversity Report No: 208 Prepared for Fisheries New Zealand by P. J. McMillan M. P. Francis G. D. James L. J. Paul P. Marriott E. J. Mackay B. A. Wood D. W. Stevens L. H. Griggs S. J. Baird C. D. Roberts‡ A. L. Stewart‡ C. D. Struthers‡ J. E. Robbins NIWA, Private Bag 14901, Wellington 6241 ‡ Museum of New Zealand Te Papa Tongarewa, PO Box 467, Wellington, 6011Wellington ISSN 1176-9440 (print) ISSN 1179-6480 (online) ISBN 978-1-98-859425-5 (print) ISBN 978-1-98-859426-2 (online) 2019 Disclaimer While every effort was made to ensure the information in this publication is accurate, Fisheries New Zealand does not accept any responsibility or liability for error of fact, omission, interpretation or opinion that may be present, nor for the consequences of any decisions based on this information. Requests for further copies should be directed to: Publications Logistics Officer Ministry for Primary Industries PO Box 2526 WELLINGTON 6140 Email: [email protected] Telephone: 0800 00 83 33 Facsimile: 04-894 0300 This publication is also available on the Ministry for Primary Industries website at http://www.mpi.govt.nz/news-and-resources/publications/ A higher resolution (larger) PDF of this guide is also available by application to: [email protected] Citation: McMillan, P.J.; Francis, M.P.; James, G.D.; Paul, L.J.; Marriott, P.; Mackay, E.; Wood, B.A.; Stevens, D.W.; Griggs, L.H.; Baird, S.J.; Roberts, C.D.; Stewart, A.L.; Struthers, C.D.; Robbins, J.E.
    [Show full text]
  • Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from the Gulf of Aden
    Zootaxa 3881 (1): 001–016 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2014 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3881.1.1 http://zoobank.org/urn:lsid:zoobank.org:pub:809A2B3B-2C2C-4D26-A50F-6D5185D3BD6A Apristurus breviventralis, a new species of deep-water catshark (Chondrichthyes: Carcharhiniformes: Scyliorhinidae) from the Gulf of Aden JUNRO KAWAUCHI1,4, SIMON WEIGMANN2 & KAZUHIRO NAKAYA3 1Chair of Marine Biology and Biodiversity (Systematic Ichthyology), Graduate School of Fisheries Sciences, Hokkaido University, 3- 3-1 Minato-cho, Hakodate Hokkaido 041-8611, Japan. E-mail: junro@ frontier.hokudai.ac.jp 2Biocenter Grindel and Zoological Museum, University of Hamburg, Section Ichthyology, Martin-Luther-King-Platz 3, D-20146 Hamburg, Germany. E-mail: [email protected] 3Hokkaido University, 3-1-1 Minato-cho, Hakodate, Hokkaido 041-8611, Japan. E-mail: [email protected] 4Corresponding author Abstract A new deep-water catshark of the genus Apristurus Garman, 1913 is described based on nine specimens from the Gulf of Aden in the northwestern Indian Ocean. Apristurus breviventralis sp. nov. belongs to the ‘brunneus group’ of the genus and is characterized by having pectoral-fin tips reaching beyond the midpoint between the paired fin bases, a much shorter pectoral-pelvic space than the anal-fin base, a low and long-based anal fin, and a first dorsal fin located behind pelvic-fin insertion. The new species most closely resembles the western Atlantic species Apristurus canutus, but is distinguishable in having greater nostril length than internarial width and longer claspers in adult males.
    [Show full text]
  • Life History Aspects and Taxonomy of Deep-Sea Chondrichthyans in the Southwestern Indian Ocean Paul Joseph Clerkin San Jose State University
    San Jose State University SJSU ScholarWorks Master's Theses Master's Theses and Graduate Research Fall 2017 Life History Aspects and Taxonomy of Deep-Sea Chondrichthyans in the Southwestern Indian Ocean Paul Joseph Clerkin San Jose State University Follow this and additional works at: https://scholarworks.sjsu.edu/etd_theses Recommended Citation Clerkin, Paul Joseph, "Life History Aspects and Taxonomy of Deep-Sea Chondrichthyans in the Southwestern Indian Ocean" (2017). Master's Theses. 4869. DOI: https://doi.org/10.31979/etd.ms3e-x835 https://scholarworks.sjsu.edu/etd_theses/4869 This Thesis is brought to you for free and open access by the Master's Theses and Graduate Research at SJSU ScholarWorks. It has been accepted for inclusion in Master's Theses by an authorized administrator of SJSU ScholarWorks. For more information, please contact [email protected]. LIFE HISTORY ASPECTS AND TAXONOMY OF DEEP-SEA CHONDRICHTHYANS IN THE SOUTHWESTERN INDIAN OCEAN A Thesis Presented to the Faculty of Moss Landing Marine Laboratories and San José State University In Partial Fulfilment of the Requirements for the Degree Master of Science by Paul J. Clerkin December 2017 © 2017 Paul J. Clerkin ALL RIGHTS RESERVED The Designated Thesis Committee Approves the Thesis Titled LIFE HISTORY ASPECTS AND TAXONOMY OF DEEP-SEA CHONDRICHTHYANS IN THE SOUTHWESTERN INDIAN OCEAN by Paul J. Clerkin APPROVED FOR THE DEPARTMENT OF MARINE SCIENCE SAN JOSÉ STATE UNIVERSITY December 2017 Dr. David A. Ebert Moss Landing Marine Laboratories Dr. Scott Hamilton Moss Landing Marine Laboratories Dr. Kenneth H. Coale Moss Landing Marine Laboratories ABSTRACT ASPECTS OF THE LIFE HISTORY AND TAXONOMY OF DEEP-SEA CHONDRICHTHYANS IN THE SOUTHWESTERN INDIAN OCEAN by Paul J.
    [Show full text]
  • Fossil Chimaeroid Remains (Chondrichthyes: Holocephali) from Williamsburg County, South Carolina, Usa
    Paludicola 8(1):37-48 September 2010 © by the Rochester Institute of Vertebrate Paleontology FOSSIL CHIMAEROID REMAINS (CHONDRICHTHYES: HOLOCEPHALI) FROM WILLIAMSBURG COUNTY, SOUTH CAROLINA, USA David J. Cicimurri Campbell Geology Museum, Clemson University, Clemson, South Carolina 29634 <[email protected]> ABSTRACT Three fossil holocephalian tooth plates have been recovered in Kingstree, Williamsburg County, South Carolina. All of the fossils were collected from a lag deposit containing a temporally mixed vertebrate assemblage. Two specimens, an incomplete left mandibular tooth plate and an incomplete left palatine tooth plate, are Edaphodon and compare favorably to E. mirificus. The third specimen is an incomplete and highly abraded right mandibular tooth plate from a very young individual that is questionably referred to Edaphodon. The tooth plates were associated with Cretaceous shark and dinosaur teeth, Paleocene shark and crocodilian teeth and turtle bones, and Plio-Pleistocene shark teeth and terrestrial mammal remains. The source of the Cretaceous fossils is arguably from Maastrichtian (late Cretaceous) strata (i.e., Peedee or Steel Creek formations), whereas Paleocene fossils are likely derived from the Danian (lower Paleocene) Rhems Formation. These fossils were probably concentrated together during Plio- Pleistocene sea level highstand, at which time the younger vertebrate material was deposited. INTRODUCTION Fossils from Clapp Creek came to the attention of Rudy Mancke (then Curator of Natural History at the Some of the geologic history of the South South Carolina State Museum) in the mid 1980s, and Carolina Coastal Plain is preserved as a complex soon thereafter he alerted Bruce Lampright (then of stratigraphic sequence that is far from completely Coastal Carolina University) to the fossil deposits to be understood.
    [Show full text]
  • Biomechanics of Locomotion in Sharks, Rays, and Chimaeras
    5 Biomechanics of Locomotion in Sharks, Rays, and Chimaeras Anabela M.R. Maia, Cheryl A.D. Wilga, and George V. Lauder CONTENTS 5.1 Introduction 125 5.1.1 Approaches to Studying Locomotion in Chondrichthyans 125 5.1.2 Diversity of Locomotory Modes in Chondrichthyans 127 5.1.3 Body Form and Fin Shapes 127 5.2 Locomotion in Sharks 128 5.2.1 Function of the Body during Steady Locomotion and Vertical Maneuvering 128 5.2.2 Function of the Caudal Fin during Steady Locomotion and Vertical Maneuvering 130 5.2.3 Function of the Pectoral Fins during Locomotion 134 5.2.3.1 Anatomy of the Pectoral Fins 134 5.2.3.2 Role of the Pectoral Fins during Steady Swimming 136 5.2.3.3 Role of the Pectoral Fins during Vertical Maneuvering 138 5.2.3.4 Function of the Pectoral Fins during Benthic Station-Holding 139 5.2.3.5 Motor Activity in the Pectoral Fins 139 5.2.4 Routine Maneuvers and Escape Responses 140 5.2.5 Synthesis 141 5.3 Locomotion in Skates and Rays 142 5.4 Locomotion in Holocephalans 145 5.5 Material Properties of Chondrichthyan Locomotor Structures 146 5.6 Future Directions 147 Acknowledgments 148 References 148 5.1.1 Approaches to Studying 5.1 Introduction Locomotion in Chondrichthyans The body form of sharks is notable for the distinctive Historically, many attempts have been made to under- heterocercal tail with external morphological asymme- stand the function of the median and paired fins in try present in most taxa and the ventrolateral winglike sharks and rays, and these studies have included work pectoral fins extending laterally from the body (Figure with models (Affleck.
    [Show full text]
  • Chondrichthyes: Holocephali: Chimaeridae) in the Northeastern Pacific Revista Mexicana De Biodiversidad, Vol
    Revista Mexicana de Biodiversidad ISSN: 1870-3453 [email protected] Universidad Nacional Autónoma de México México González-Acosta, Adrián F.; Castro-Aguirre, José Luis; Didier, Dominique A.; Vélez-Marín, Rafael; Burnes-Romo, Luis A. Occurrence of Hydrolagus macrophthalmus (Chondrichthyes: Holocephali: Chimaeridae) in the northeastern Pacific Revista Mexicana de Biodiversidad, vol. 81, núm. 1, abril, 2010, pp. 197-201 Universidad Nacional Autónoma de México Distrito Federal, México Available in: http://www.redalyc.org/articulo.oa?id=42515998026 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Revista Mexicana de Biodiversidad 81: 197- 201, 2010 Research note Occurrence of Hydrolagus macrophthalmus (Chondrichthyes: Holocephali: Chimaeridae) in the northeastern Pacifi c Presencia de Hydrolagus macrophthalmus (Chondrichthyes: Holocephali: Chimaeridae) en el Pacífi co nororiental Adrián F. González-Acosta1*, José Luis Castro-Aguirre1, Dominique A. Didier2, Rafael Vélez-Marín3 and Luis A. Burnes-Romo1 1Centro Interdisciplinario de Ciencias Marinas, Intituto Politécnico Nacional, Colección Ictiológica, Avenida Instituto Politécnico Nacional s/n, Col. Playa Palo de Santa Rita, 23096, La Paz, Baja California Sur, México. 2Department of Biology, Millersville University, P.O. Box 1002, Millersville, PA 17551, USA. 3Centro Regional de Investigación Pesquera, Manzanillo. Apartado postal 591, 28200, Manzanillo, Colima, México. *Correspondent: [email protected] Abstract. The southeastern Pacifi c chimaeroid Hydrolagus macrophthalmus De Buen, 1959, is reported for the fi rst time in the northeastern Pacifi c on the basis of 1 male specimen (945 mm TL) caught on 13 April 1995 off Manzanillo, Colima (Mexico: 18º 30’N, 104º 15’W) at the surface above deep water (2 000 m).
    [Show full text]
  • The Shark's Electric Sense
    BIOLOGY CREDIT © 2007 SCIENTIFIC AMERICAN, INC. LEMON SHARK chomps down on an unlucky fish. THE SHARK’S SENSE An astonishingly sensitive detector of electric fields helps sharks zero in on prey By R. Douglas Fields menacing fin pierced the surface such as those animal cells produce when in KEY CONCEPTS and sliced toward us. A great blue contact with seawater. But how they use ■ Sharks and related fish can shark—three meters in length— that unique sense had yet to be proved. We sense the extremely weak homed in on the scent of blood like a torpe- were on that boat to find out. electric fields emitted by animals in the surrounding do. As my wife, Melanie, and I watched sev- Until the 1970s, scientists did not even water, an ability few other eral large sharks circle our seven-meter Bos- suspect that sharks could perceive weak organisms possess. ton Whaler, a silver-blue snout suddenly electric fields. Today we know that such elec- ■ This ability is made possible thrust through a square cutout in the boat troreception helps the fish find food and can by unique electrosensory deck. “Look out!” Melanie shouted. We operate even when environmental condi- structures called ampullae both recoiled instinctively, but we were in tions render the five common senses—sight, of Lorenzini, after the 17th- no real danger. The shark flashed a jagged smell, taste, touch, hearing—all but useless. century anatomist who first smile of ivory saw teeth and then slipped It works in turbid water, total darkness and described them. back into the sea.
    [Show full text]
  • Bio 209 Course Title: Chordates
    BIO 209 CHORDATES NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF SCIENCE AND TECHNOLOGY COURSE CODE: BIO 209 COURSE TITLE: CHORDATES 136 BIO 209 MODULE 4 MAIN COURSE CONTENTS PAGE MODULE 1 INTRODUCTION TO CHORDATES…. 1 Unit 1 General Characteristics of Chordates………… 1 Unit 2 Classification of Chordates…………………... 6 Unit 3 Hemichordata………………………………… 12 Unit 4 Urochordata………………………………….. 18 Unit 5 Cephalochordata……………………………... 26 MODULE 2 VERTEBRATE CHORDATES (I)……... 31 Unit 1 Vertebrata…………………………………….. 31 Unit 2 Gnathostomata……………………………….. 39 Unit 3 Amphibia…………………………………….. 45 Unit 4 Reptilia……………………………………….. 53 Unit 5 Aves (I)………………………………………. 66 Unit 6 Aves (II)……………………………………… 76 MODULE 3 VERTEBRATE CHORDATES (II)……. 90 Unit 1 Mammalia……………………………………. 90 Unit 2 Eutherians: Proboscidea, Sirenia, Carnivora… 100 Unit 3 Eutherians: Edentata, Artiodactyla, Cetacea… 108 Unit 4 Eutherians: Perissodactyla, Chiroptera, Insectivora…………………………………… 116 Unit 5 Eutherians: Rodentia, Lagomorpha, Primata… 124 MODULE 4 EVOLUTION, ADAPTIVE RADIATION AND ZOOGEOGRAPHY………………. 136 Unit 1 Evolution of Chordates……………………… 136 Unit 2 Adaptive Radiation of Chordates……………. 144 Unit 3 Zoogeography of the Nearctic and Neotropical Regions………………………………………. 149 Unit 4 Zoogeography of the Palaearctic and Afrotropical Regions………………………………………. 155 Unit 5 Zoogeography of the Oriental and Australasian Regions………………………………………. 160 137 BIO 209 CHORDATES COURSE GUIDE BIO 209 CHORDATES Course Team Prof. Ishaya H. Nock (Course Developer/Writer) - ABU, Zaria Prof. T. O. L. Aken’Ova (Course
    [Show full text]
  • Sharks, Skates, Rays, and Chimaeras
    SHARKS, SKATES, RAYS, AND CHIMAERAS UNITED STATES DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE SERVICE BUREAU OF COMMERCIAL FISHERIES Circular 228 TABLE 1. -- tiximum sizes of camnon species of sharks Species Traditional Mucimum length Muimum length maximum size (measure<l--U. S. coa.ts) (recorde<l--world) Scientific na.rr;e from literature SixgL. st.ark .... 1 Hexanchus sp. .•..•••••••. 15 feet 5 inches 26 feet 5 inches nd hary... ..... Carcharias taurus... 10 feet 5 inches 12 feet 3 inches 15 feet 11 inches Porbeagle •....... 1 LamTUl TUlSUS........... ... 10 feet 12 feet 12 feet Sall10n shark. .... LamTUl ditropis . 8 feet 6 inches 8 feet 6 inches 12 feet L 0 .•.••.•.•.... Isurus oxyrinchus ...... ... 10 feet 6 inches 12 feet 12 feet - 13 feet 'hi te sr.ark. ..... Carcharodan carcharias. 18 feet 2 inches 21 feet 36 feet 6 inches Basking shar".... Cetorhinus maximus . 32 feet 2 inches 45 feet 40 feet - 50 feet Thresher shark... Alopias vulpinus . 18 feet 18 feet 20 feet rse shark...... Ginglymostoma cirraturn.. 9 feet 3 inches 14 feet Whale shark. ..... Rhincodan typus........ .•. 38 feet 45 feet 45 feet - 50 feet Olain dogfish.... Scyliorhinus retifer. ... .. 1 foot 5 inches 2 feet 6 inches Leopard shark.... Triakis semifasciata... 5 feet 5 feet Smooth dogfish ... Alustelus canis ......... ... 4 feet 9 inches 5 feet rieer shark...... Galeocerdo cuvieri..... ... 13 feet 10 inches 18 feet 30 feet Soupfin shark.... Galeorhinus zyopterus . .. 6 feet 5 inches 6 feet 5 inches 6 feet 5 inches Blue shark. ...... Prionace glauca ....... 11 feet 12 feet 7 inches 25 feet Bul .. shark. ...... Carcharhinus leucas. .. 9 feet 10 inches 10 feet Whi tetip shark.
    [Show full text]
  • Phylum Chordata with Its Characters
    Classification of phylum Chordata with its characters: TIG The chordates form a large heterogeneous group of members differing widely from one another in many respects. Due to great diversity in chordate forms, different schemes of classification have been proposed by a number of taxonomists from time to time. The classification followed is simplified and is a synthesis of most recent classifications. Table 1.2 gives an outline classification of the phylum Chordata. Phylum Chordata: Widely diversified (differing) in size, habits and habitat, bilaterally symmetrical, metamerically segmented, triploblastic, coelomate deuterostomes. All the chordates possess a supporting skeletal rod or notochord, a hollow dorsal nerve cord and paired gill-slits at some stage of their life history which may persist, change or disappear in adults. Cambrian to Recent. About 50,000 species. Phylum Chordata can be divided into two groups: A. Acrania (Protochordata) and B. Craniata (Euchordata) which show contrasting characters. Group A. Acrania (Protochordata): (Gr., a = absent; kranion = head or Gr., protos = first; chorde = cord). All are marine, small, primitive or lower chordates. No cranium, jaws, vertebral column, paired appendages. About 2,000 species. The Acrania is divided into three subphyla- Hemichordata, Urochordata and Cephalochordata. Subphylum I. Hemichordata: Gr., hemi = half; chorde = cord). Body divided into 3 regions- proboscis, collar and trunk. Notochord doubtful, short confined to proboscis and non-homologous with that of chordates. Class 1. Enteropneusta: (Gr., enteron = gut; pneustos = breathed). Body large and worm-like. Gill-slits numerous and paired. Alimentary canal straight. Acorn or tongue worms. Enteropneusts include 3 families, 15 genera and 70 species. Examples- Balanoglossus, Saccoglossus, Ptychodera.
    [Show full text]