PHARMACOLOGICAL and NEUROANATOMICAL ANALYSIS of GNTI-INDUCED REPETITIVE BEHAVIOR in MICE

______

A Dissertation Submitted to Temple University Graduate Board

______

In Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY

______

by Saadet Inan May, 2010

Dissertation Examining Committee: Alan Cowan, Pharmacology Nae J. Dun, Pharmacology Lee-Yuan Liu-Chen, Pharmacology Ellen Unterwald, Pharmacology Toby K. Eisenstein, Microbiology and Immunology Barrie Ashby, Pharmacology Richard Ryan, Bristol-Myers Squibb

©

2010

by

Saadet Inan

All Rights Reserved

ii

ABSTRACT

PHARMACOLOGICAL and NEUROANATOMICAL ANALYSIS of GNTI-INDUCED REPETITIVE BEHAVIOR in MICE

Saadet Inan

Doctor of Philosophy

Temple University, 2010

Doctoral Advisory Committee Chairs: Alan Cowan, PhD and Nae J Dun, PhD

This thesis is comprised of two parts. In the first part, we investigated a) the pharmacology of GNTI, a selective kappa opioid receptor antagonist, as a scratch- inducing compound in mice and b) possible mediators and receptors that may be involved in GNTI-induced scratching (itch). We studied if GNTI induces scratching through opioid, histamine, gastrin-releasing peptide (GRP) and/or muscarinic M1 receptors. In the second part, we established similarities and differences between pain and itch using

GNTI-induced scratching and formalin-induced nociception models in mice.

We found that GNTI (0.03-3 mg/kg, s.c., behind the neck) induces compulsive and vigorous scratching behavior in a dose-dependent manner. A standard submaximal dose (0.3 mg/kg) of GNTI caused animals to scratch 500-600 times in a 30 min observation period. Intrathecal (i.t.) or intraperitoneal (i.p.) administration of GNTI did not elicit scratching behavior. Duration of action of GNTI was 60-70 min and tolerance to the repetitive behavior did not develop. C-fos expressing neurons, in response to GNTI injection, were localized on the lateral side of the superficial layers of the dorsal horn of

iii the cervical spinal cord. Compound 48/80, a chemically different pruritogen, evoked c-

fos expression in neurons which are located on the lateral side of the superficial layer of

the dorsal horn. These data suggest that both GNTI and compound 48/80 activate a group

of sensory neurons located on the lateral side of lamina I and II.

Pretreating (at -20 min) and posttreating (at +5 min) mice with the kappa opioid

receptor agonist, nalfurafine (0.001-0.03 mg/kg, s.c.), significantly attenuated scratching induced by GNTI (0.3 mg/kg). These effects were not a consequence of behavioral depression. Tolerance did not develop to the anti-scratch activity of nalfurafine.

Pretreating mice with nalfurafine (0.02 mg/kg) prevented both GNTI- and compound

48/80-provoked c-fos expression. Our c-fos results suggest that the preclinical antipruritic activity of nalfurafine occurs at the spinal level. Moreover, our results reinforce the need to evaluate nalfurafine as a potentially useful antipruritic in human conditions involving itch.

GNTI still elicited excessive scratching in mice lacking mu, delta or kappa opioid receptors, respectively, as well as in mice pretreated with either naloxone or norbinaltorphimine. The H1 receptor antagonist, fexofenadine, or the H4 receptor

antagonist, JNJ 10191584, did not attenuate GNTI-induced scratching. Also, pretreating

mice with the peptide GRPR antagonist, [D-Phe6]bombesin(6-13) methyl ester, or the non-peptide GRPR antagonist, RC-3095, did not antagonize scratching induced by GNTI.

Furthermore, GRPR mRNA levels did not change in response to GNTI injection.

Telenzepine, a standard M1 receptor antagonist, had no marked effect against GNTI- elicited scratching, however (unexpectedly) McN-A-343, an M1 receptor agonist, attenuated this behavior in a dose-dependent manner.

iv In the second part of our studies, we found that pretreating mice with lidocaine

(i.d., behind the neck) inhibits GNTI-induced scratching and prevents GNTI-provoked c- fos expression in the dorsal horn of the spinal cord. Similarly, lidocaine (i.d., hind leg) inhibits formalin-induced nociception as well as formalin-provoked c-fos expression.

While injection (s.c.) of formalin to the face of mice induced only wiping (indicating pain) by forepaws of the injection side, injection (s.c.) of GNTI to the face elicited grooming and scratching (indicating itch). In contrast to formalin, GNTI did not induce c- fos expression in the trigeminal nucleus suggesting that pain and itch sensations are projected differently along the sensory trigeminal pathway.

In short, our main results indicate that a) the scratch-inducing activity of GNTI is not mediated by opioid, histamine or GRP receptors; b) kappa opioid receptors are involved, at least in part, in the inhibition of itch sensation and thus, on the basis of our results, nalfurafine holds promise as a potentially useful antipruritic in human conditions involving itch; and c) agonism at M1 receptors inhibits GNTI-induced scratching therefore the M1 receptor may be a key target for antipruritic drug development.

v

This thesis is dedicated to my family

for their endless support and love.

To my husband, my life and best friend, Dentist Dr. Mehmet Dundar Inan.

Thank you for always being there for me.

To my daughter, my other best friend, Miss Ipek Inan.

vi ACKNOWLEDGEMENTS

I would like to thank my advisors, Dr. Cowan and Dr. Dun for their guidance,

encouragement, and helpful criticism. I would like to thank Dr. Cowan for making me love basic science, for sharing bad days and good days with me, and for his friendship

during my 8 years, including being volunteer, post doctoral fellow, and graduate student

at Temple University. I am very grateful to know him as a human being and a

professional scientist. I would like to thank Dr. Dun for welcoming me into his laboratory

and introducing me to the world of neuroanatomy.

I would like to thank all the members of my graduate research committee: Dr. Liu

Chen, Dr. Unterwald and Dr. Eisenstein for their valuable input on this thesis project, as

well as to thank my external examiner, Dr. Rich Ryan, who agreed to become a member

of my committee. His valuable expertise on bombesin and its receptors is of great benefit

to this thesis and me.

In addition, I am very grateful to Drs. Liu Chen and Unterwald, for collaborating

with me for the studies before I started my thesis project, and for their valuable

friendships. I would like to give special thanks to Dr. Ashby for encouraging me to start

PhD program at Temple University and for his patience answering my questions

regarding to program. Finally, I would like to thank Dr. Tallarida for introducing me to

the world of mathematic in behavioral pharmacology.

I would like to thank my lab mates present and previous in Dr. Cowan’s

laboratory for their friendships: Mark R. Pietras, Drs. George B Kehner, Jennifer L

Werkheiser and Zhe Ding.

vii Also, I would like to thank my lab mates in Dr. Dun’s laboratory for their friendships: Dr. Christina Brailou, Dr. Xin Gao, Fan Yang, and Xiaofang Huang. I would like to give a special thank to Mary Dun for her immunohistochemistry (IHC) expertise and friendship. She answered patiently all my questions about IHC.

I would like to extent my appreciation to Phyllis Beaton, Mary McCafferty and

Carol Dangelmaier for their friendships, supports and technical help. I would like to thank all the professors, past and present graduate students and colleagues, and all members of the Department of Pharmacology. I am very grateful to the department for giving me the opportunity to achieve my educational and professional goals.

viii TABLE OF CONTENTS

Page

ABSTRACT...... ii DEDICATION...... vi ACKNOWLEDGEMENTS...... vii LIST OF TABLES...... xiii LIST OF FIGURES ...... xiv LIST OF ABBREVIATIONS...... xvi

CHAPTER

1. GENERAL INTRODUCTION...... 1

Terminology of itch ...... 4 Classification of itch ...... 5 Clinical-based classification of itch...... 5 Etiological-based classification of itch ...... 5 Neurophysiology of itch ...... 7 Central transmission of itch sensation ...... 11 Peripheral and central sensitization to itch ...... 14 How does scratching relieve itch? ...... 15 Complexity of itch ...... 16 Histamine and histamine receptors ...... 16 Serotonin (5-HT) and 5-HT receptors...... 17 Prostaglandins (PG) ...... 18 Gastrin-releasing peptide (GRP) and GRP receptors...... 19 Transient receptor potential (TRP) channels ...... 20 Cannabinoids...... 21 Opioids...... 22 Tachykinins...... 23 Kinins, kallikreins, and proteases ...... 23 Itch in systemic diseases ...... 25 Itch associated with chronic kidney diseases...... 25 Itch associated with chronic liver diseases ...... 26 Other itch-associated systemic diseases...... 29 Treatment of pruritus ...... 29 Topical capsaicin cream...... 29 Calcineurin inhibitors...... 29 Antihistamines ...... 30 Leukotriene receptor antagonists ...... 31 Cyclosporin A ...... 31 Anticonvulsant, gabapentine...... 31 Mu-opioid receptor antagonist...... 32

ix

Animal models of itch...... 33 Centrally induced itch model...... 33 Mouse model of scratching...... 33 Allergic conjunctivitis-induced itch model...... 34 Intrathecal mu agonist-induced itch model...... 34 Oral contraceptive-induced cholestatic pruritus model ...... 34 Cheek model of mouse scratching ...... 35 Pharmacology of GNTI, a kappa opioid receptor antagonist ...... 35 Summary of objectives ...... 37

2. MATERIALS AND METHODS...... 43

Part I...... 43 Pharmacological analysis of GNTI-induced compulsive scratching...... 43 Animals...... 43 Routes of administration...... 43 Apparatus for behavioral observations ...... 44 GNTI-induced scratching test...... 45 Comparison of scratch-inducing effects of kappa antagonists ...... 46 Duration of action of GNTI-induced scratching...... 47 Possible tolerance against GNTI-elicited scratching ...... 47 Studying anti-scratch activity of nalfurafine...... 47 Possible tolerance against the anti-scratch activity of nalfurafine.47 Measurement of locomotion ...... 48 Effect of naloxone on GNTI-induced scratching...... 48 Effect of norBNI on GNTI-induced scratching ...... 48 Scratching activity of GNTI on mu, delta, or kappa opioid receptor knock out mice...... 48 Determination of c-fos expression in the cervical spinal cord following GNTI and compound 48/80 scratching as well as nalfurafine’s effect on c-fos expression using IHC ...... 50 Determination of c-fos mRNA using the reverse transcriptase- PCR technique ...... 53 Effect of histamine 1 (H1) and 4 (H4) receptor antagonists on GNTI-induced scratching...... 54 Determination of immunoreactive GRP nerve fibers and cells in the skin, spinal cord and DRG of mouse ...... 55 Double staining for c-fos and GRP ir in cervical spinal cord sections...... 55 Determination of GRP mRNA using reverse transcriptase-PCR technique...... 56 Effect of GRPR antagonists on GNTI-induced scratching...... 57 Effect of telenzepine on GNTI-induced scratching ...... 58 Effect of McN-A-343 on GNTI-induced scratching...... 59 x Measurement of locomotion after McN-A-343 ...... 59 Effect of N-desmethylclozapine on GNTI-induced scratching .....59

Part II ...... 60

Similarities and differences between pain and itch using formalin-induced nociception and GNTI-induced scratching models in mice...... 60 Animals...... 60 Routes of administration...... 60 Formalin-induced nociception, rodent model of pain...... 60 GNTI-induced scratching...... 61 Measurement of locomotion after lidocaine injection ...... 62 Determination of c-fos immunoreactivity in spinal cord sections...... 62 Application of pain and itch stimuli to the same site...... 63 Determination of c-fos immunoreactivity in brainstem sections...64 Compounds ...... 65 Data analysis ...... 65

3. RESULTS ...... 66

Part I...... 66 Characteristics of GNTI-induced scratching ...... 66 Nalfurafine attenuates GNTI-induced scratching ...... 72 Antagonism of opioid receptors does not inhibit GNTI-induced scratching ...... 75 Nalfurafine prevents GNTI- and compound 48/80-induced c-fos expression in the cervical spinal cord of mice...... 79 Neither H1 nor H4 receptor antagonists inhibit GNTI-induced scratching ...... 84 Ir GRP is detected in skin, DRG and spinal cord of mice ...... 86 GRP positive nerve fibers are around c-fos expressing neurons in the dorsal horn of mice treated with GNTI...... 87 The GRP mRNA level does not change with GNTI treatment or with nalfurafine pretreatment...... 89 GRPR antagonists, RC-3095 and [D-Phe6]Bombesin(6-13) methyl ester do not attenuate GNTI-induced scratching behavior...... 90 Telenzepine does not inhibit scratching elicited by GNTI ...... 96 McN-A-343 suppresses GNTI-induced scratching in a dose-dependent manner...... 96

xi Part II ...... 99 Lidocaine antagonizes formalin-induced nociception ...... 99 Lidocaine antagonizes GNTI-induced scratching...... 99 Lidocaine has no marked effect on locomotion...... 99 Lidocaine prevents pain-evoked c-fos expression ...... 99 Lidocaine reduces itch-induced c-fos expression ...... 100 GNTI induces only an itch sensation...... 107 C-fos expression in the brainstem following formalin or GNTI...... 107

4. DISCUSSION...... 114

GNTI is a useful pharmacological compound for investigating itch...... 114 Nalfurafine attenuates GNTI-induced scratching ...... 114 Nalfurafine prevents GNTI- and compound 48/80-induced c-fos expression in the cervical spinal cord of mice...... 118 Scratch-inducing effect of GNTI is not through opioid receptors ...... 120 H1 and H4 receptors are not involved in GNTI-induced scratching...... 121 GRPR does not mediate GNTI-induced scratching...... 122 Role of M1 receptor in GNTI-induced scratching...... 126 Inhibitory effect of lidocaine on pain and itch...... 130 Application of pain and itch stimuli to the same site...... 132 Conclusions...... 133

REFERENCES ...... 136

xii LIST OF TABLES

Table Page

1. Dermatological origin of chronic pruritus ...... 6

2. Systemic origin of chronic pruritus...... 6

3. Percent inhibition of receptor binding with GNTI...... 40

4. Percent inhibition of receptor binding with nalfurafine (TRK-820)...... 41

xiii LIST OF FIGURES

Figure Page

1. Pain-related studies in PubMed in a five year period ...... 2

2. Itch-related studies in PubMed in a five year period...... 3

3. Summary of the theories proposed to explain itch sensation...... 9

4. Primary afferent pruriceptive and nociceptive neurons...... 10

5. The supraspinal processing of histamine itch in humans using imaging techniques...... 13

6. Effects of prostanoids...... 19

7. Cross-talk between cutaneous C-fiber terminals and mast cells...... 24

8. Arm of a patient with pruritus...... 25

9. Chemical structure of GNTI...... 36

10. Injection of a pruritogen to a mouse...... 45

11. Observation boxes used...... 46

12. Hind leg scratching of a mouse injected with a pruritogen...... 46

13. A mouse wearing an Elizabethan collar...... 53

14. Subcutaneous injection of a mouse right hind paw with formalin...... 61

15. Cheek model of mouse scratching...... 64

16. Dose-response curve for GNTI-induced scratching...... 66

17. Volume effect on GNTI-induced scratching...... 67

18. No effect with i.t. administered GNTI...... 68

19. Dose-response curves of GNTI, norBNI, and BnorBNI...... 69

20. Duration of action of GNTI-induced scratching ...... 70

xiv 21. Tolerance does not develop to the scratch-inducing effect of GNTI...... 71

22. Effect of pretreatment with nalfurafine on GNTI-induced scratching...... 72

23. Effect of post-treatment with nalfurafine on GNTI-induced scratching...... 73

24. Tolerance does not develop to the anti-scratch activity of nalfurafine...... 74

25. Effect of nalfurafine on locomotion...... 75

26. Effect of naloxone on GNTI-induced scratching...... 76

27. Effect of norBNI on GNTI-induced scratching...... 76

28. Effect of GNTI on mu opioid receptor knock out mice...... 77

29. Effect of GNTI on delta opioid receptor knock out mice ...... 77

30. Effect of GNTI on kappa opioid receptor knock out mice ...... 78

31. A representative picture of prevention of GNTI-and compound 48/80- induced c-fos expression by nalfurafine ...... 80

32. Prevention of GNTI- and compound 48/80-induced c-fos expression by . nalfurafine...... 81

33. A representative picture of -actin and c-fos bands...... 82

34. Effect of GNTI on c-fos mRNA levels...... 82

35. A representative picture of GNTI-induced c-fos expression in mice anesthetized with urethane...... 83

36. A representative picture of GNTI-evoked c-fos expression in mice wearing Elizabethan collars...... 83

37. Effect of fexofenadine on GNTI-induced scratching...... 84

38. Effect of JNJ 10191584 on GNTI-elicited scratching ...... 85

39. A representative picture of a GRP positive nerve fiber in the skin of a mouse ...... 86

40. A representative picture of GRP positive cells in DRG and GRP positive nerve fibers in the spinal cord of a mouse ...... 87

xv 41. A representative picture of c-fos expression and GRP positive nerve fibers in the dorsal horn of the spinal cord...... 88

42. a) Effects of GNTI and nalfurafine on GRP mRNA levels...... 89

42. b) A representative picture of -actin and GRP bands in mice injected with GNTI or nalfurafine ...... 89

43. a) Effect of RC-3095 on GNTI-induced scratching...... 90

43. b) Effect of RC-3095 on GRP18-27-induced scratching...... 91

44. Effect of [D-Phe6]Bombesin(6-13) methyl ester on GNTI-induced scratching....92

45. Effect of [D-Phe6]Bombesin(6-13) methyl ester on GRP18-27-induced scratching ...... 94

46. Effect of [D-Phe6]Bombesin(6-13) methyl ester on GRP18-27-induced grooming...... 95

47. Effect of telenzepine on GNTI-induced scratching ...... 96

48. Time course of McN-A-343 on GNTI-induced scratching...... 97

49. Effect of McN-A-343 on GNTI-induced scratching...... 98

50. Effect of McN-A-343 on locomotion ...... 98

51. Effect of lidocaine on formalin-induced nociception ...... 101

52. Effect of lidocaine on GNTI-induced scratching...... 102

53. Effect of lidocaine on locomotion...... 103

54. A representative picture of prevention of c-fos expression induced by formalin in the dorsal horn of the spinal cord by lidocaine ...... 104

55. A representative picture of prevention of c-fos expression induced by GNTI in the dorsal horn of the spinal cord by lidocaine ...... 105

56. Prevention of c-fos expression induced by formalin and GNTI by lidocaine in the dorsal horn of the spinal cord ...... 106

57. GNTI induces the sensation of itch...... 108

xvi 58. A representative picture of c-fos expression at the junction of cervical spinal cord and medulla after saline, formalin, and GNTI injection...... 109

59. A representative picture of c-fos expression in brainstem sections of mice injected with saline, formalin, and GNTI ...... 110

60. A schematic representation of c-fos expression evoked by GNTI-induced itch and formalin-induced nociception at a higher level of the mid-brain...... 111

61. A representative picture of c-fos expression in the PAG area of mice injected with saline, formalin, and GNTI ...... 112

62. A representative photomicrograph of c-fos expression induced by GNTI and formalin in the parabrachial area of the pons...... 113

63. Chemical structure of nalfurafine ...... 115

64. Pictorial summary of results ...... 135

xvii LIST OF ABBREVIATIONS

ACC anterior cingulated cortex ACE angiotensin converting enzyme Ach acetylcholine AD atopic dermatitis ANOVA analysis of variance AP area postrema BnorBNI benzoyl norbinaltorphimine CB1 cannabinoid receptor 1 CB2 cannabinoid receptor 2 CC central canal CGRP calcitonin gene related polypeptide CMH mechano-heat nociceptor CMi mechanoinsensitive C fiber CNS central nervous system COX-1 cyclooxygenase 1 COX-2 cyclooxygenase 2  delta opioid receptor DRG dorsal root ganglia DLL dorsal nucleus of lateral lemniscus FDA Food and Drug Administration GABA -aminobutyric acid GNTI 5-guanidinonaltrindole GPCR G-protein coupled receptor GRP gastrin-releasing peptide GRPR gastrin-releasing peptide receptor HIV human immunodeficiency virus i.c.v. intracerebroventricular IFSI International Forum for the Study of Itch IHC immunohistochemistry IL interleukin ILL intermediate nucleus of lateral lemniscus i. paw intra paw i.p. intraperitoneal i.t. intrathecal i.v. intravenous  kappa opioid receptor ko knock out LDTgV laterodorsal tegmental nucleus xviii lfp longitudinal fasiculus of pons LPBC central lateral parabrachial nucleus LPBE external lateral parabrachial nucleus ml medial lemniscus MRI magnetic resonance imaging mRNA messenger ribonucleic acid Mo5 motor trigeminal nucleus µ mu opioid receptor NGF nerve growth factor NK-1 neurokinin 1 receptor NMB neuromedin B norBNI norbinaltorphimine OrbitoF orbitofrontal cortex PAG periaquaductal gray area PAR proteinase activating receptor PBC primary biliary cirrhosis PBS phosphate buffered saline PF prefrontal cortex PG prostaglandin PLC3 phospholipase C3 PMA premotor area p.o. per oral PSC primary sclerosing cholangitis RT-PCR reverse transcriptase polymerase chain reaction SEM standard error of the mean s.c. subcutaneous SMA supplementary motor area SP substance P THC delta-9-tetrahydrocannabinol TNF-alpha tumor necrosing factor-alpha Tz nucleus of trapezoid body VGSCs voltage-gated sodium channels VR1 vanilloid receptor 1

xix CHAPTER 1 INTRODUCTION

A classic description of a receptor antagonist in pharmacology is “a type of

receptor ligand or drug that does not provoke a biological response itself upon binding to

a receptor, but blocks or dampens agonist-mediated responses”. An antagonist has

affinity but no efficacy for its receptors, and binding prevents the interaction and inhibits

the function of an agonist or inverse agonist at receptors. Kamei and Nagase (2001)

reported that norbinaltorphimine (norBNI), a novel selective and long-acting kappa opioid receptor antagonist (Portoghese et al., 1987), induces an itch-associated response in mice. Upon s.c. administration of norBNI (1-30 mg/kg, behind the neck), mice scratched this area robustly. The behavior lasted for about 90 min and was of interest to us in two ways. One, how an antagonist precipitates a biological response, and two, whether or not other kappa opioid receptor antagonists induce the repetitive scratching. In short, what is the pharmacological mechanism behind the behavior.

Animal studies are important in drug development for therapeutic use.

Effectiveness and lack of toxicity in animals need to be demonstrated before human clinical trials may be conducted on a new compound. Having a valid animal model for a

targeted disease is a key point. The lack of an appropriate animal model delays

development of therapeutic medications. A major advance in basic research in the

pruritus field occurred after an animal model of scratching was described by Kuraishi and

his colleagues in 1995. Before this publication, research on potential antipruritics was

essentially restricted to studies in humans. Figures 1 and 2 clearly demonstrate a) how

1 research reports on itch are numerically inferior to research reports on pain; b) beginning from 1995, studies using animals in itch research increased, and c) an overall interest in the study of itch is apparent. While the number of pain-related studies published in

PubMed in the 5 year periods beginning from 1980 is counted in thousands, the number of itch-related studies in the same periods is counted in tens and hundreds. The total number of publications in the itch area since 2006 is about two hundred, however, forty of them were published in 2009. This indicates that there is an increased interest in the itch area. The International Forum for the Study of Itch (IFSI), a scientific organization that brings together clinical and preclinical researchers studying itch, was founded in

2005. IFSI holds scientific meetings to discuss advances in this field every other year.

100000 Only human studies 90000 Only animal studies

80000

70000

60000

50000

40000

30000

20000

Number of publication in 5 periods year 10000

0 1980-85 1986-90 1991-95 1996-2000 2001-05 2006-09

Fig. 1. Summary of published pain-related studies in PubMed in a five-year period beginning from 1980 to today. Open bars represent studies that were performed in human subjects. Gray bars represent studies that were conducted in animals.

2 160 Only human studies Only animal studies 140

120

100

80

60

40

20 Number of periods publication in 5 year

0 1980-85 1986-90 1991-95 1996-2000 2001-05 2006-09

Fig. 2. Summary of published itch-related studies in PubMed in a five-year period beginning from 1980 to today. Open bars represent studies that were performed in human subjects. Gray bars represent studies that were conducted in animals.

Itching is a symptom that can be observed in not only dermatological diseases but also in some systemic diseases. It can be very annoying and is associated with negative effects on the quality of life for patients, as mentioned below:

“I am chronically itching from head to toe, literally. Anything that touches my skin makes it worse. This chronic itching has been going on for about 3 years now. My husband holds my hands to keep me from scratching. He has even woke me up numerous times at night because I am doing it in my sleep.”

(www.healthboards.com/boards/archive/index.php/t-475582.html).

“I was never able to sleep through the night. Frequently, I would be standing under a cold shower to make the itching from my eczema bearable. I also suffered from hay fever and was sensitive to many different foods. Also, I could not walk through the

3 detergents aisle in the supermarket without itching like crazy.”

(www.amsterdamklinikek.com/patient comments.html).

Terminology of Itch

The earliest definition of itch goes back to ancient Greece. Socrates described itch as “a mixed sensation of pleasure and pain”. A French 16th century philosopher, Michel

de Montaigne, wrote that “scratching is one of the sweetest gratifications of nature, and

as ready at hand as any. But repentance follows too annoying close at its heels”.

The classic description of itch, made by German physician Samuel Hafenreffer in

1660, is “an unpleasant sensation that elicits the desire or reflex to scratch”. This

description has retained its validity for 349 years. Pruritus and itch are often used as

synonyms; pruritus reflects more severe and intense itch

(www.yourdictionary.com/medical/pruritus).

An acute itch serves as a physiological protective function to prevent the body

from being hurt by harmful external agents. According to the decision made by IFSI

members at the meeting in San Francisco in 2007, if pruritus lasts 6 weeks or more, it is

called chronic pruritus (Ständer et al., 2007). A severe and chronic itch is not only one of

the most common symptoms in dermatology but it may also be a symptom for several

systematic diseases such as chronic renal failure, chronic liver diseases, some

hematologic diseases as well as cancers. Chronic itch is a more common symptom than is

generally thought. The prevalence of itch in chronic renal failure is between 40%-70%

(Zucker et al., 2003; Wikström, 2007; Yosipovitch, 2007); in liver diseases it varies from

5% in patients with hepatitis C to 70% in patients with primary biliary cirrhosis (Bergasa,

4 2008). Atopic dermatitis affects 10-20% of children and 2% of adults worldwide (Ong,

2009).

Classification of itch

In a neuropathophysiologically based clinical classification of itch (Twycross et al,. 2003), this symptom was classified as cutaneous (cutaneous nerves are activated by pruritogens at their sensory endings), neuropathic (diseased or lesioned pruritic neurons cause itch), neurogenic (itch induced by centrally acting mediators without neuronal damage), and psychogenic. A recent classification was described at the IFSI 2007 meeting and two types of classification (clinical- and etiological-based) were suggested

(Ständer et al., 2007):

Clinical-based classification of itch

Group I. Pruritus on primarily diseased, inflamed skin

Group II. Pruritus on primarily normal, non-inflamed skin

Group III. Pruritus with chronic secondary scratch lesions

Etiological-based classification of itch

Category I. Dermatological, diseases of skin (summarized in table I)

Category II. Systemic, diseases of organs other than skin (summarized in table II)

Category III. Neurological, diseases of the central or peripheral nervous system such as multiple sclerosis, neoplasms, abscesses, cerebral or spinal infarcts, notalgia paresthetica, post-herpetic neuralgia, brachioradial pruritus.

Category IV. Psychogenic/psychosomatic, somatoform pruritus with co-morbidity of psychiatric and psychosomatic diseases such as depression, anxiety disorders, obsessive- compulsive disorders, schizophrenia.

5 Category V. Mixed

Category VI. Undetermined origin

Table I. Dermatological origin of chronic pruritus

Inflammatory dermatoses Atopic dermatitis, psoriasis, contact dermatitis, dry skin Infectious dermatoses Mycotic, bacterial and viral infections, scabies, insect bites, pediculosis Autoimmune dermatoses Bullous dermatoses, bullous pemphigoid, dermatomyositis Genodermatoses Darier’s disease, ichthyoses, epidermalysis bullosa Dermatoses of pregnancy Polymorphic eruption of pregnancy, pemphigoid gestationis, prurigo gestationis Neoplasms Cutaneous T-cell and B-cell lymphomas, leukemic infiltrates of the skin Modified from Ständer et al. 2007

Table II. Systemic origin of chronic pruritus

Endocrine and metabolic diseases Chronic renal failure, liver diseases, hyperthyroidism, malabsorption, perimenopausal pruritus Infectious diseases HIV-infection, helminthosis, parasitosis

Hematological and lymphoproliferative Iron deficiency, polycythemia vera, diseases Hodgkin’s disease, Non-Hodgkin’s lymphoma, plasmocytoma Visceral neoplasms Solid tumors of cervix, prostate, and colon; carcinoid syndrome Pregnancy Pruritus gravidarum with and without cholestasis Drug-induced pruritus Opioids, ACE-inhibitors, hydrochlorothiazide, estrogens, allopurinol Modified from Ständer et al. 2007

HIV: human immunodeficiency virus; ACE: angiotensin converting enzyme

6 Neurophysiology of Pruritus

Despite itch and pain being described as two diverse sensations, they share

common properties in relation to neuromediators, receptors and similar mechanisms for

peripheral and central sensitizations. Itch is restricted to the skin and some adjoining

mucosa such as conjunctiva and trachea and is never felt in muscle, joints or inner organs.

The location of nerve terminals responsible for itch sensation is limited to uppermost skin layers of the epidermis and the epidermal/dermal transition. Removal of the upper skin layers abolishes the ability to perceive itch (Shelley and Arthur, 1957).

Prickle and tickle are relatively close but different sensations from itch and pain.

Prickle normally describes a sensation limited to a point and reflects more sharp pain.

Prickle stimuli cause low levels of firing in peripheral nociceptors. Tickle is considered more as a sensation somewhere between touch and itch and is mediated by low threshold mechanosensitive afferent neurons (McMahon and Koltzenburg, 1992; Stante et al.,

2005). While humans can easily distinguish between these sensations, many mammals respond with a similar stereotyped behavior which makes it hard to define an animal model for itch.

Historically, itch was not regarded as a cutaneous sensation in early experimental studies. Later studies suggested that itch spots in the skin coincide with pain spots. For a long time, itch was thought of as a weak variant of pain. Weak stimulation of nociceptors results in itch whereas stronger stimulation results in a weak pain (intensity theory) (Fig.

3). During the 1950s, the role of chemicals in itch sensation was reported. Shelley and

Arthur (1955) showed that introduction of cowhage (Mucuna pruriens) spicules to human skin causes itch. In another human study, Arthur and Shelley (1955) reported that

7 application (intradermal, ointment or introduction of spicules) of histamine, trypsin or papain induces itching. Histamine has become a standard, experimental itch-inducing compound in both human and animal studies.

Another theory proposed to explain itch was the “specificity theory” that suggests that different neurons modulate itch and pain. Identification of primary afferent C-fibers that only respond to histamine stimulation in humans (Schmelz et al., 1997) and description of spinothalamic histamine-sensitive projection neurons on the dorsal horn of the spinal cord of anesthetized cats (Andrew and Craig, 2001) were breakthrough findings and supported the specificity theory (Fig. 3). The primary afferent neurons for histamine-induced itch in humans are mechano-insensitive unmyelinated C fibres. Itch- selective spinal neurons project from lamina I of the dorsal horn of the spinal cord to the ventrocaudal part of the nucleus medialis dorsalis of thalamus and from thalamus to the anterior cingulate and dorsal insular cortex (Schmelz et al., 1997; Andrew and Craig,

2001). Schmelz et al. (2003) showed that histamine-responsive C-fibers are also activated by capsaicin, an algogen. Simone et al. (2004) studied activation of spinothalamic neurons in response to histamine and capsaicin in monkeys. In their study, spinothalamic neurons activated by histamine also responded to noxious stimuli. The results of these studies suggest that C-fibers are not specific but selective for stimuli. The selectivity theory is accepted as more applicable to explain itch sensation (McMahon and

Koltzenburg, 1992; Binder et al., 2008; Handwerker, 2009). This theory proposes that a subset of afferent nociceptors responds to pruritogenic stimuli, has different central connections and activates separate central neurons. Noxious chemical stimuli such as mustard oil and capsaicin also activate this subset of nociceptors as well as other

8 nociceptors (Fig. 3). Overall activation of the nociceptive system can mask itch signaling

pathways. Selectivity theory also explains why a) in the presence of pain, itch is not

experienced, b) painful scratching inhibits itch, and c) inhibition of pain may reduce the

inhibitory effect on itch and even enhance itch (example of spinally applied µ opioid

agonists).

(McMahon and Koltzenburg, 1992)

Fig. 3. Summary of the theories proposed to explain itch sensation. H: histamine; M: mustard oil.

The most common type of C-fiber, mechano-heat nociceptors (CMH) or

polymodal nociceptors, has been extensively studied in human and animal skin. These

polymodal nociceptors were not sensitive to histamine or they were activated only

weakly by histamine application in the skin. However, Schmelz et al. (1997) reported that only mechano-insensitive C fibers (CMi) respond to histamine iontophoresis in human 9 subjects. Later on, Andrew and Craig (2001) showed that histamine-specific spinal

neurons project to the thalamus in cats. Also, these neurons were mechanoinsensitive and

had a very low peripheral and central conduction velocity (Fig. 4). These results support the presence of a subpopulation of chemonociceptors responsible for itch processing.

Binder et al. (2008)

Fig. 4. Primary afferent pruriceptive and nociceptive neurons. The majority of primary afferents are mechano-sensitive and are involved in pain sensation. Only 5% of primary afferents are mechano-insensitive and are involved in itch signaling.

Johanek et al. (2007) compared histamine- and cowhage-induced itch in humans.

Cowhage did not produce flare reaction as much as histamine. Previously, Schmelz et al.

(2000) showed that histamine-sensitive CMi fibers are also responsible for histamine- induced axon-reflex erythema. Another result from the Johanek study was while topical application of an antihistaminic relieved only histamine-induced itch, topical application

of capsaicin alleviated only cowhage-induced itch. While urticaria, allergic conditions

10 and insect bites respond to treatment with histamine-1 (H1) receptor blockers, such compounds are ineffective against pruritus in systemic diseases (Cheigh, 2003; Twycross et al., 2003). Taken together, the presence of histamine-independent primay afferents are required to explain other itch conditions.

Namer et al. (2008) provide evidence, using cowhage, for at least two different and non-overlapping peripheral C-fiber pathways for the sensation of itch in human skin.

These fibers are a) histamine-sensitive mechano-insensitive CMi nociceptors, and b) histamine-insensitive, mechanoresponsive polymodal nociceptors.

Central transmission of itch sensation

Andrew and Craig (2001) reported that neurons sensitive to histamine are located on the superficial part of the dorsal horn lamina I spinothalamic tract. Later, c-fos activation with different pruritogens in rodents supported this result (Nojima et al., 2003b and 2003c). C-fos is one of the fos family of transcription factors. This family comprises a class of early immediate genes whose expression is induced within minutes of exposure to a stimulus (Herrera and Robertson, 1996; Basbaus et al., 2007). C-fos expression in neurons has been used extensively in studying the pathophysiology of depression, memory and learning, pain and seizure states (Herrera and Robertson, 1996). Nojima et al. showed c-fos activation of neurons localized on the lateral side of the superficial layer of the dorsal horn of rats in response to a) spontaneous scratching due to dry skin (2003b) and, b) intradermal injection of serotonin (2003c). Recently, Nakano et al. (2008) studied c-fos activation evoked by injection of histamine, SLIGRL-NH2 (a protease-activated receptor 2 agonist), or mosquito allergen. Histamine, in contrast to the other stimuli, activated neurons localized on the inner side of lamina II. SLIGRL-NH2- and mosquito

11 allergen induced c-fos activation in neurons located on the lateral side of lamina II. These data suggest the presence of histamine-dependent and independent neurons on the dorsal horn of the spinal cord.

Using positron emission tomography (PET) and functional magnetic resonance imaging (MRI) techniques, there is an increased activation in the thalamus, presupplementary motor area, anterior insular, inferior parietal and dorsolateral prefrontal cortex, and decreased activation in the orbitofrontal, mid-cingulate and primary motor cortex areas of the brain in response to histamine-induced itch in humans (Mochizuki et al., 2003; Valet et al., 2007). Additionally, Yosipovitch et al. (2008) showed activation of cerebellum in humans during spontaneous scratching. Figure 5 summarizes the areas activated during itch as well as during pain (Paus et al., 2006). The itch-selective spinal neurons form a pathway that projects to the ventrocaudal part of the nucleus medialis thalamus and from there projects to the anterior cingulate (ACC) and insular cortex.

Premotor (PMA) and supplementary motor areas (SMA), cerebellum, primary and secondary somatosensory cortices (SI and SII) are the areas co-activated during histamine-induced itch. Sensation may be processed in the somatosensory cortex for localization, PMA and supplementary motor cortices for scratching, and ACC and insula for affective and motivational aspects. During a PET study investigating the effect of painful cold stimulus on itch, the periaquaductal gray (PAG) was activated (Mochizuki et al., 2003). Simultaneously, it was noticed that activity in the ACC, prefrontal cortex and parietal cortex was decreased. These data suggest a possible inhibitory role of the PAG on itch sensation (as in pain sensation).

12

Fig. 5. The supraspinal processing of histamine-itch in humans using imaging techniques. ACC, anterior cingulate cortex; SMA, supplementary motor area; PMA, premotor area; PF, prefrontal cortex; OrbitoF, orbitofrontal cortex; PAG, periaquaductal gray.

13 Peripheral and central sensitization to itch

Sensitization of nerve endings is a well-known characteristic of inflammatory

pain. Classic inflammatory mediators such as bradykinin, serotonin, prostaglandins and

leukotriens may sensitize nociceptors and lower the receptor threshold for mediators such

as histamine and capsaicin. Urashima and Mihara (1998) showed that intradermal nerve

fiber density is higher in patients with atopic dermatitis (AD) compared to controls. Also,

Toyoda et al. (2002) reported increases in plasma substance P (SP) as well as nerve

growth factor (NGF) in AD patients. NGF is essential for the survival, development,

differentiation and function of peripheral sympathetic and sensory neurons and basal

forebrain cholinergic neurons in the central nervous system. NGF acts as a neurotrophic

molecule in the skin. It stimulates the sprouting nerve fibers and may act as a peripheral sensitizer. The expression of NGF is high in injured and inflamed tissues. NGF injections to rodents result in long-lasting mechanical and thermal hyperalgesia. Blocking NGF activity is one of the targets in current analgesic research (Hefti et al., 2006). An increase in fiber density and local NGF levels has been reported in patients with contact dermatitis

(Kinkelin et al., 2000). Collectively, this evidence suggests that peripheral sensitization to itch is dependent on similar mechanisms to peripheral sensitization to pain.

There is also a similarity for central sensitization between pain and itch.

Activation of chemonociceptors causes acute pain as well as sensitizing second-order neurons in the spinal cord. This results in increased sensitivity to pain and is known as hyperalgesia. Two types of mechanical hyperalgesia have been described. In allodynia, also known as touch- or brush-evoked hyperalgesia, touch that is normally painless in the uninjured surroundings of trauma can trigger painful sensations. This phenomenon is

14 mediated by myelinated mechanoreceptor units, however, it requires ongoing activation

of primary afferent C-fibers. In the second type, known as punctate hyperalgesia, a

slightly painful pinprick stimulation is felt more painful around a focused area of inflammation. The later does not require continuing firing of primary afferents and lasts longer. The sensation of itch, touch- or brush-evoked pruritus around an itchy site has been named “itchy skin” or “alloknesis”. It is elicited via low threshold mechanoreceptors and it requires continuing activity of primary afferents (Simone et al.,

1991; Heyer et al., 1995). Hyperknesis (synonymous with punctate hyperalgesia in pain) sensations are felt more intensely in the surrounding areas, and has been reported following histamine iontophoresis in healthy volunteers (Atanassoff et al., 1999).

How does scratching relieve itch?

While pain induces withdrawal reflexes, itch provokes the scratching reflex. This

has developed as a nocifensive system for removal of irritating objects and agents (such

as parasites, insects, irritants and allergens) that have passed the epidermal barrier and

have invaded skin. In this kind of situation, withdrawal would not be enough. Most of the

time scratching relieves itch sensation. However, when itch is associated with skin and

systemic diseases, it can be severe and the desire to scratch can be overwhelming.

Constant scratching may be harmful and may cause secondary skin infections since the

epidermal barrier has been damaged.

Yosipovitch et al. (2008) studied the central effects of scratching using a blood

oxygen level-dependent functional MRI technique in healthy human subjects. During

repetitive scratching, somatosensory cortex, insular cortex, prefrontal cortex, inferior

parietal lobe and cerebellum were activated bilaterally. Also, deactivation of anterior and

15 posterior cingulate cortices occurred. Recently, Davidson et al. (2009) investigated if

scratching would inhibit spinothalamic tract neurons activated by histamine at spinal cord

level in primates. For every animal, they first recorded (using electrophysiological

techniques) spinothalamic tract neurons in lumbar dorsal horn and functionally

characterized responses of neurons to initial scratching of the receptive field with a hand-

held metal edge. Then histamine was injected intradermally into the receptive field and

activated neurons were recorded. During this activation, receptive field was scratched for

10 seconds. Immediately following scratching, the mean discharge of neurons was

reduced about 62%. Their data suggest that supraspinal activity and itch-related sensation

can be modulated by changes in activity at the spinal cord level. However, whether this inhibition is through local inhibitory neurons or through a descending pathway from the

brain remains elusive. Further studies are still needed to answer how scratching inhibits

itch.

Complexity of itch

It would have been too easy if, indeed, there was a common itch mediator acting

on itch receptors in all pruritic conditions and an available antagonist against this

mediator. Many neurotransmitters and receptors, other than the classic itch mediator histamine, and its receptors, are involved in pruritus. These are summarized as follows:

Histamine and histamine receptors

Broadbent (1953) reported that cowhage-induced pruritus is due to liberation of

histamine in the skin. Histamine is stored in mast cells and its release results in mast cell

disruption (Riley and West, 1952). Experimentally, intradermal injection of histamine to

16 humans and mice induces scratching behavior (Simone et al., 1991; Bell et al., 2004;

Dunford et al., 2007).

There are four established histamine receptors (H1-H4). The H3 receptor is found

in peripheral and central tissues and works as an autoreceptor and regulates histamine

release. Agonism at this receptor inhibits histamine release, but antagonism at this

receptor induces histamine release (Parsons and Ganellin, 2006). Intradermal (behind the

neck) injection of a H3 receptor antagonist to mice elicits scratching behavior (Hossen et

al., 2006). Dunford et al. (2007) reported that a H4 receptor antagonist is more effective

than a H1 receptor antagonist in inhibiting histamine-induced scratching in mice. They also showed that a H2 receptor agonist does not induce scratching and that a H2 receptor

antagonist does not attenuate scratching induced by histamine. H4 receptor antagonism is

of potential therapeutic value for the treatment of allergic diseases (Daugherty, 2004).

Serotonin (5-HT) and 5-HT receptors

Intracerebroventricular administration of serotonin to rats (Berendsen and

Broekkamp, 1991) and intradermal (behind the neck) injection of serotonin to mice and

rats induce hindlimb scratching behavior (Yamaguchi et al., 1999; Thomsen et al., 2001;

Takuba et al., 2006). Yamaguchi et al. (1999) and Nojima and Carstens (2003a) reported

that serotonin induces scratching behavior through 5-HT2 receptors.

Clinically, ondansetron (a 5-HT3 antagonist) (Gulhas et al., 2007) as well as

mirtazapine (a noradrenergic and 5-HT2/5HT3 antagonist) (Sheen et al., 2008) relieved itch induced by intrathecal fentanyl and morphine, respectively. In a pilot study, sertraline, a serotonin reuptake inhibitor, was effective and safe against cholestatic pruritus suggesting serotonergic pathway involvement in this kind of itch (Mayo et al.,

17 2007). Murphy et al. (2003), however, reported that ondansetron did not relieve itch due to chronic renal failure in a double blind, placebo-controlled study.

Prostaglandins (PG)

Prostanoids (PGE2, PGD2, PGI2, PGF2α and tromboxane A2) are products

(produced via cyclooxygenases, COX-1 and COX-2) of the arachidonic acid pathway which is involved in inflammation, reproduction, nociception, platelet aggregation, renal blood flow and vascular homeostasis (Honma et al, 2007). The effects of PGs are summarized in Figure 6. Among these prostaglandins, only PGD2 has an antipruritic effect. Hashimoto et al. (2005) showed that PGD2 inhibits immunglobulin E-mediated scratching through suppressing histamine release from mast cells. A low cutaneous prostaglandin D2 level was detected in NC/Nga mice, accepted as an animal model for

AD (Takaoka et al., 2007). NC/Nga mice spontaneously scratch and develop severe dermatitis, similar to AD with high levels of serum IgE as well as inflammatory cell infiltration of the skin under conventional conditions (Matsuda et al., 1997). The antipruritic effect of the prostanoid DP1 receptor agonist, TS-022, in these mice has been reported (Arai et al., 2007; Sugimoto et al., 2007). Also, inhibition of COX-1 activity, either pharmacologically (Sugimoto et al., 2006) or genetically (Inoue et al., 2007), increases scratching behavior in NC/Nga mice.

18

Honma et al. 2007

Fig. 6. Effects of prostanoids

Gastrin releasing peptide (GRP) and mammalian bombesin receptors

GRP is a mammalian homologue of the amphibian tetradecapeptide, bombesin,

isolated from the skin of the European frog Bombina bombina. Neuromedin-B (NMB) is

another mammalian bombesin-like peptide. GRP binds with high affinity to GRPR (BB2)

and NMB binds with high affinity to NMB (BB1) receptors. Two additional BN-like

receptors have been cloned (BB3 and BB4) (Fathi et al., 1993; Nagalla et al., 1995;

Mantey et al., 1997). These are G-protein coupled receptors (GPCRs) and activation stimulates phospholipase C.

GRP and NMB have a broad spectrum of pharmacological and biological effects.

GRP stimulates smooth muscle contraction in both the gastrointestinal tract and

urogenital system; stimulates release of hormones/neurotransmitters from pancreas,

stomach and colon; promotes growth effects in both normal tissues and tumors; has

potent CNS effects, including regulation of circadian rhythm, thermoregulation, 19 regulation of anxiety and fear responses and regulation of food intake (Kamichi et al.,

2005; Jensen et al., 2007). Centrally administered bombesin induces scratching and

grooming behaviors in mice, rats, guinea pigs, rabbits and monkeys (Cowan et al., 1985).

Sun and Chen (2007) reported that GRPR mutant mice elicited fewer scratches induced

by three chemically different pruritogens (compound 48/80, chloroquine and PAR-2,

proteinase activated receptor, agonist) compared to wild-type littermates. Also,

intrathecal administration of a GRPR antagonist, [D-Phe6]bombesin (6-13), inhibited

such scratching induced by these compounds. Recently, Sun et al. (2009) suggested that

GRPR positive spinothalamic neurons are responsible for transmission of itch sensation

at the spinal level. Ablation of these neurons resulted in decreased scratching to different

pruritogens. However, ablation of these neurons did not affect pain transmission.

Transient Receptor Potential (TRP) channels

TRP channels comprise seven groups: the canonical (TRPC), the vanilloid

(TRPV), the melastatin (TRPM), the polycystin (TRPP), the mucolipin (TRPML), the ankyrin (TRPA) and the nomp (TRPN). These channels act as calcium-permeable sensory transduction channels sensitive to temperature changes, taste and osmotic/mechanical stress (Nilius et al., 2007). Of these channels, TRPV1-4 and TRPM8 have gained credibility in the pathogenesis of itch. TRPV1 is located on C-type sensory neurons and capsaicin is the best known ligand. Certain itch mediators such as eicosanoids, bradykinin, prostaglandins, and various neurotrophins can activate TRPV1 channels (Zhang et al., 2005; Paus et al., 2006; Steinhoff et al., 2006). Activation of this receptor results in excitation of neurons and release of substance P. At higher doses and longer times, capsaicin induces desensitization.

20 Shim et al. (2007) reported that histamine-induced itch is mediated by TRPV1 via

activation of phospholipase A2 and lipoxygenase. Recently, Imamachi et al. (2009)

concluded that there are at least three different molecular pathways in the transduction of

itch sensation by trying eight different pruritogen agents in phospholipase Cβ3 (PLCβ3)

ko and TRPV1 ko mice and their wild-type littermates. They found that a) both PLCβ3

and TRPV1 are required for histamine-induced itch; b) only PLCβ3 is required for

serotonin- and α-methyl-serotonin-induced itch; and c) neither PLCβ3 nor TRPV1 is

required for endothelin-1-induced scratching. Furthermore, Sun and Chen (2007)

demonstrated that about 80% GRP positive neurons express TRPV1 receptors in the

DRG. TRPM8 is activated by coolness and cold as well as icilin and menthol (Behrenth

et al., 2004). Colburn et al. (2007) reported a lack of cold sensitivity in TRPM8 null mice.

Application of 2% icilin lotion decreased scratching due to erythematous maculopapulous

rash induced by low magnesium diet in mice (Paus et al., 2006).

Cannabinoids

The best recognized cannabinoid is Δ9-tetrahydrocannabinol (THC), a key

psychoactive component of marijuana. Analgesic, muscle relaxant, appetite stimulant,

anticonvulsant and anti-inflammatory effects of marijuana have been established. Today,

cannabinoids are also suggested for arthritis, inflammatory bowel diseases and vascular inflammation (sepsis, multiple organ failure) (Klein, 2005). The broad distribution of cannabinoid receptors 1 (CB1) and 2 (CB2) in human skin has been reported (Ständer et al., 2005). CB1 and CB2 immunoreactivity was observed in cutaneous nerve fiber bundles, mast cells, macrophages, epidermal keratinocytes, epithelial cells of hair

follicules, sebaceous glands and sweat glands. Dvorak et al. (2003) reported an 21 attenuation of histamine-induced scratching and flare reaction by administration (via skin

patch or dermal microdialysis) of HU210, a cannabinoid receptor agonist in humans.

Opioids

It is well known that intrathecal (i.t.) or epidural administration of morphine

induces scratching in humans (Baraka et al., 1981; Chaney, 1995; Sheen et al, 2008). Mu-

opioid receptor (MOR) antagonists have antipruritic effects in experimentally induced

itch in primates and in patients. Scratching induced by i.t. morphine in monkeys is

abolished after intravenously or s.c. administered nalmefene (Ko and Naughton, 2000).

When naloxone is administered s.c. to cholestatic patients, there is a reduction of itching

as well as an induction of morphine withdrawal-like reactions, suggesting upregulation of

endogenous opioids (Jones et al., 2002). Bigliardi et al. (1998) showed that mu opioid

receptors are expressed in human epidermis and keratinocytes. These data suggest that

mu opioid receptors are involved in peripherally originated itch. Bigliardi et al. (2007)

reported that topical application of 1% naltrexone to patients with AD reduced itching

and upregulation of epidermal MOR. Loperamide, a peripherally restricted mu-opioid

receptor agonist, inhibits compound 48/80-induced scratching in mice (DeHaven-

Hudkins et al., 2002).

Kamei and Nagase (2001) reported for the first time that norBNI, a kappa opioid

antagonist, elicits scratching in mice. Pretreatment with the kappa opioid agonist,

U50,488H, decreased this behavior. Gmerek and Cowan (1988) had reported previously

that kappa agonists attenuate bombesin-induced grooming in rats. Both centrally and

peripherally acting kappa agonists reduce compound 48/80-induced scratching in mice

(Cowan and Kehner, 1997; Kehner et al., 1999). Nalfurafine, a 4,5-epoxymorphinan

22 derivative, was initially synthesized as a kappa agonist analgesic (Nagase et al., 1998).

Nalfurafine is a full agonist on kappa receptors and a partial agonist on mu receptors

(Seki et al., 1999). Togashi et al. (2002) were first to describe the antipruritic activity of

nalfurafine against SP- and histamine-induced scratching in mice. Nalfurafine is effective

against morphine-induced scratching in monkeys (Wakasa et al., 2004); as well as

chloroquine- (Inan and Cowan, 2004) and agmatine-induced (Inan and Cowan, 2006a)

scratching in mice. Furthermore, nalfurafine was found to be an effective and safe

antipruritic in patients with uremic pruritus in a double-blind, placebo-controlled clinical

study (Wikström et al., 2005). Downregulation of the kappa opioid system in the

epidermis of AD patients has been detected (Tominaga et al., 2007).

Tachykinins

Once C-fibers are activated via a stimulus, neuropeptides such as SP and

calcitonin gene related polypeptide (CGRP) are released. SP causes release of histamine,

tumor necrosis factor (TNF-α), leukotriene B4, and PGD2 by binding to the neurokinin 1

(NK1) receptor on mast cells (Steihoff et al., 2006). Intradermal injection of SP elicits

scratching in mice (Andoh and Kuraishi, 2003). Remröd et al. (2007) reported that the

number of SP and NK1 receptor positive inflammatory cells is increased in psoriatic skin

compared to normal skin.

Kinins, kallikreins and proteases

Schmelz et al. (2003) reported that bradykinin can induce itch by activating

histamine-sensitive C-fibers. Arthur and Shelley (1955) showed that exogenous or

endogenous proteases, which break down proteins, elicit an itch sensation in humans.

From four proteinase activating receptors (PAR), only PAR2 is involved in itch

23 pathophysiology (Vergnolle et al., 2003). The endogenous PAR2 receptor agonist, tryptase, was increased four fold and PAR2 expression was enhanced on primary afferent nerve fibers of diseased skin in AD patients (Steinoff et al., 2006). Possible interactions between primary afferents and mast cells in the skin are summarized in Figure 7.

Yosipovitch et al. 2003

Fig. 7. Cross-talk between cutaneous C-fiber terminals and mast cells. TNF, tumor necrosis factor; TNFR, TNF receptor; H1, histamine receptor 1; PAR, proteinase activated receptor; NK1, neurokinin receptor 1; SP, substance P; VR1, vanilloid receptor 1.

Among the interleukins (IL), IL-2 has been thought of as an itch inducer via clinical observations. Application of recombinant IL-2 to cancer patients induces vasodilation, flush and pruritus (Steinhoff et al., 2006).

In summary, a variety of potential mediators seem to be involved in the pathogenesis of itch.

24 Itch in Systemic Diseases

Itch associated with chronic kidney diseases (uremic pruritus)

Itch may be localized or generalized, but 20-50% of patients with chronic kidney

diseases suffer from generalized pruritus (Kuypers, 2009). The areas most commonly

affected are the back, limbs, chest and head. The intensity of itch increases in the summer.

Skin changes like extensive excoriations, lichenification (thickening of the skin) secondary to chronic scratching can be observed (Fig. 8) (Szepietowski and Schwartz,

1998).

Szepietowski and Schwartz, 1998

Fig. 8. Arm of a patient with pruritus. Scars, excoriations, color changes, and lichenification are apparent.

The underlying reason for pruritus in chronic renal failure is unclear. Xerosis,

extra dryness of the skin, occurs in a high percent of end-stage renal disease patients and

its presence contributes to pruritus. Even though the number of skin mast cells and the

serum level of histamine were increased in uremic, pruritic patients (Mettang et al., 1990),

pruritus can still occur in patients with no change in histamine serum level and mast cell number (Klein et al., 1988).

25 Two hypotheses have been postulated for the pathophysiology of uremic pruritus.

One is the immunohypothesis, which considers uremic pruritus as an inflammatory skin disease. It was shown that an increase in interleukin 2 as well as CD4+ cells in renal

failure patients with pruritus compared to ones without pruritus. Additionally, levels of

inflammatory markers such as C-reactive protein and interleukin 6 are increased in

patients with pruritus. Second is the opioid hypothesis, which proposes that overactivity

of mu opioid receptors, together with downregulation of kappa opioid receptor activity, is

responsible for uremic pruritus. Activation of the kappa opioid system by administrating

nalfurafine, as well as use of naltrexone, the mu receptor antagonist, reduce pruritus

suggesting that the opioid system is involved in the pathogenesis of uremic pruritus.

Parathyroid hormone and divalent ions such as calcium, phosphate and magnesium also

play a role in uremic pruritus. Secondary hyperparathyroidism and an elevation in

calcium-phosphate products have been shown in uremic patients with pruritus (Kuypers,

2009). However, the pathophysiology of uremic pruritus is still unclear.

It is important to keep the skin hydrated by using topical emollients in uremic

pruritus. Also, topical capsaicin cream and tacrolimus, a calcineurin receptor antagonist,

are helpful in relieving itch. Systemic treatment options include ultraviolet light,

gabapentin, opioid receptor agonists and antagonists (e.g., nalfurafine, naltrexone),

antihistamines, activated charcoal, serotonin receptor antagonists (e.g, ondansetron,

granisetron) and immunomodulators (Kuypers, 2009).

Itch associated with chronic liver diseases

Pruritus is the most common extrahepatic symptom in chronic liver diseases,

especially with cholestasis. Chronic liver diseases can be divided as cholestatic and non-

26 cholestatic. Cholestasis refers to a situation where bile cannot flow from the liver to the duedonum, the initial part of the small intestine. It results from either a mechanical obstruction, as seen in gallstones or malignancies, or a metabolic dysfunction due to genetic defects or certain medications (e.g., oral contraceptives, erythromycin, carbamazepine).

Primary biliary cirrhosis (PBC) and primary sclerosing cholangitis (PSC) are cholestatic liver diseases that cause itching in the majority of patients. Nearly 70% of

PBC patients suffer from pruritus (Mela et al., 2003). Also, intrahepatic cholestasis of pregnancy and oral contraceptive-induced intrahepatic cholestasis are cholestatic diseases associated with pruritus. About 0.5-1% of pregnant women, especially in the third trimester, develop cholestasis associated with pruritus (pruritus gravidorum). This situation can lead to lack of sleep, anorexia, malnutrition, early labor and miscarriage.

Itch resolves after delivery.

Patients with PBC have two common symptoms: fatigue and pruritus. The onset of pruritus is usually earlier than jaundice and it is not correlated with the progression of the disease. Sometimes it may start during the pregnancy and continues postpartum. Itch can be persistent or intermittent, generalized or localized to specific body parts usually the palms and the soles. Itch often occurs at night time and in hot, humid weather.

Pruritus may cause sleep deprivation and suicidal ideation. Chronic, vigorous scratching can result in cutaneous complications like excoriations, folliculitis, prurigo nodularis and lichenification (Mela et al., 2003). Previously, it was proposed that pruritus results from increased serum and skin tissue concentrations of bile acids. However, bile acid levels are similar in all cholestatic patients with or without pruritus (Ghent et al., 1977). Previous

27 reports suggested that increased endogenous opioidergic tone contributes to pruritus in

cholestasis. Oral administration of opioid antagonists induce morphine-like withdrawal symptoms in patients with cholestatic pruritus (Thornton and Losowsky, 1988). Also, in a rat model of cholestasis, plasma total opioid activity was increased, the density of mu opioid receptors was decreased (Swain et al., 1992), and naloxone-reversible analgesia was detected (Bergasa et al., 1994).

Autoimmune hepatitis, alcoholic cirrhosis, hepatitis A, B and C are counted as non-cholestatic liver diseases with pruritus (Mela et al., 2003). However, whether it is of cholestatic or non-cholestatic origin, the underlying pathophysiology of pruritus in liver diseases remains elusive.

The most frequently used treatment in cholestatic pruritus is anion exchange resins like cholestyramine and colestipol hydrochloride. These non-absorbent agents bind to bile acids and prevent their absorbtion from the terminal ileum through the enterohepatic circulation (Mela et al., 2003). In the majority of patients pruritus is relieved within two weeks from the beginning of treatment, however, in a substantial proportion of patients the response is transient. Cholestyramine causes constipation, abdominal discomfort, fat malabsorption and the drug has an unpleasant taste. The next treatment option is rifampicin, a semi-synthetic antibiotic. Rifampicin acts as a rapid inducer of enzymes of the microsomal drug-oxidizing system, and hence increases the metabolism of pruritogen agents (Mela, 2003). However, the effectiveness of rifampicin for treating pruritus in liver diseases is controversial. Use of opioid receptor antagonists such as nalmefene and naltrexone is still at the clinical trial stage.

28 Other itch associated systemic diseases

Itch may occur in both hyper- and hypothyroidism. Itch in hypothyroidism is due

to dry skin. Pruritus can be a symptom in lymphoreticular type malignancies such as

lymphoma, polycythemia vera and leukemia. Also, patients with human

immunodeficiancy virus infection can suffer from pruritus (Greaves, 2005).

Treatment of Pruritus

Topical capsaicin cream:

Capsaicin is a ligand for TRPV1 and application of capsaicin causes release of

neuropeptides such as SP and CGRP from C-fibers. Repeated application induces

desensitization of nerve fibers, inhibition of neuropeptide accumulation and suppression

of pain or pruritic sensations. Capsaicin cream is mostly used for localized forms of

pruritus like notalgia paresthetica (local burning and itching with pigmentation on the

medial scapular border), postherpetic neuralgia, brachioradial prutitus, and prurigo

nodularis (Ständer et al., 2007).

Calcineurin inhibitors:

By inhibiting phosphatase calcineurin, these agents interrupt cytokine gene

expression and prevent proinflammatory cytokine production, thus leading to the

downregulation of T-cell activity. Calcineurin inhibitors, tacrolimus and pimecrolimus

are nonsteroidal immunomodulator agents and are approved for topical use. Systemic

absorption of these compounds is minimal, and unlike the corticosteroids they do not

cause skin atrophy. Long-term treatment with calcineurin inhibitors is well tolerated in

adults and children (Simpson and Noble, 2005). Use of pimecrolimus up to 1 year and

29 use of tacrolimus up to 4 years have been reported as effective and safe in AD (Breuer et al., 2005). They are also used for prurigo nodularis, chronic hand dermatitis, rosacea, graft-versus-host disease, lichen sclerosis, genitoanal pruritus, and for unknown origin pruritus (Ständer et al., 2006).

Antihistamines:

H1-antihistamines are among the most widely used of all medications in pruritus treatment. Antihistamines act principally to prevent histamine-receptor interactions by competition with histamine for histamine receptors on tissues. H1-antihistamines are useful in treating histamine-mediated allergic conditions like allergic rhinitis, conjunctivitis, contact dermatitis, urticaria, insect bites, and anaphylactic reactions. The first antihistamine successfully used to treat humans, N-diethyl-aminoethyl-N-benzyl- aniline (Antergan), was developed in 1942 in France (Bovet, 1950).

The first generation of H1-antihistamines (e.g., chlorpheniramine, hydroxyzine, and diphenhydramine) had central side effects such as sedation, delirium and seizures. To avoid central side effects, second generation H1-antihistamines only affected peripheral

H1 receptor. Fexofenadine, loratadine, desloratadine, astemizole, cetirizine, and levocetirizine are considered second generation H1-antihistamines (Simons, 2002).

Elevated plasma histamine levels were detected in uremic pruritus (Francos et al.,

1991) and cholestatic pruritus (Gittlen et al., 1990) however antihistamines were not successful in relieving itch in patients with chronic renal failure and cholestatic liver disease. Combination of low doses of antihistamines (e.g., chlorpheniramine + loratadine) are helpful in relieving itch in patients with AD and prurigo nodularis (Ständer et al.,

2007).

30 Leukotriene receptor antagonists:

Leukotrienes are fatty compounds that cause inflammation and are produced by the immune system. Leukotriene receptor antagonists prevent leukotrienes from binding

to receptors and from initiating inflammation. Zafirlukast and montelukast block the

actions of cysteinyl leukotrienes (LTC4, LTD4, and LTE4) at the CysLT1 receptor on

target cells like bronchial smooth muscle. Zileuton inhibits the 5-lipoxygenase

leukotriene metabolism pathway. These compounds are prescribed to treat asthma and some allergies (O′Byrne et al., 2009). They have been evaluated for alleviating itch in

AD and urticaria and adults treated with these compounds for 4-6 weeks showed improvement in objective skin scores (Kontou-Fili, 2000; Pua and Barnetson, 2006).

Cyclosporin A:

Cyclosporin A is a potent immunosuppressant that acts directly on cells of the

immune system with an inhibitory effect on T-cells. It is widely used after organ

transplantations to prevent rejection. Cyclosporin inhibits lymphokine transcription and

lymphocyte activation and proliferation. It is effective in relieving itch in AD and prurigo

nodularis in human studies (Wahlgren et al., 1990; Lee and Shumack, 2005).

Anticonvulsant, gabapentin:

Gabapentin was designed to mimic the inhibitory neurotransmitter γ-aminobutyric acid (GABA) in the brain. Although it is called a GABA derivative or analog, this compound does not demonstrate GABA-related pharmacology. It does not have affinity to GABAA, GABAB, GABAC or allosteric GABA receptor sites (Lanneau et al., 2001;

Sills et al., 2003; Taylor, 2009). Gabapentin is a ligand for voltage-gated calcium

channels (Taylor, 2009). It binds to α2-δ proteins at the calcium channel and reduces 31 neurotransmitter release stimulated by nociceptive stimulus. Binding of these proteins is necessary and sufficient for the analgesic activity of gabapentin.

Gabapentin was approved by the Food and Drug Administration (FDA) in 1993 for treatment of epileptic seizures and later on it was approved for chronic neuropathic pain. Gabapentin was found effective against pain in postherpetic neuralgia, diabetic neuropathic pain, and trigeminal neuralgia (Scheinfeld, 2003). Gabapentin was recommended for pruritus in renal diseases, brachioradil pruritus and notalgia paresthetica (Manenti and Vaglio, 2005; Kanitakis, 2006; Ständer et al., 2007).

Mu-opioid receptor antagonists:

Among the mu-opioid receptor antagonists, only naloxone and naltrexone have been approved by the FDA for use in some clinical conditions. Therapetic use of naloxone includes reversal of opioid analgesic-, opioid overdose-, or post operative opioid activity-induced adverse reactions such as respiratory or circulatory depression.

Naltrexone is used as an adjuvant in alcohol dependence and as a safe narcotic antagonist in the treatment of narcotic dependence (Goodman et al., 2007).

In placebo-controlled clinical trials, the oral administration of nalmefene and naltrexone to patients with chronic cholestatic pruritus relieved itch and caused morphine-like withdrawal symptoms in patients (Thornton and Losowsky, 1988; Bergasa et al., 1999; Mansour-Ghanaei et al., 2006). Nalmefene was effective against itch in urticaria and AD (Monroe, 1989). Topical application of naltrexone cream was found effective in AD patients (Bigliardi et al., 2007). While Peer et al. (1996) reported that i.v. naltrexone possesses short-term efficacy against pruritus in uremic patients, Pauli-

Magnus et al. (2000) concluded that naltrexone does not relieve pruritus in these patients.

32 Animal models of itch

Experimental animal models for human diseases are crucial to study the

pathophysiology of the disease and to develop and screen possible drug treatments.

Attempts to develop an experimental animal model for itch were not successful until

Arthur and Shelley (1955) screened and reported pruritogenic agents in humans.

Joglekar et al. (1963) used topically applied cowhage (5% mixture with paraffin)

ointment in dogs to induce scratching. Dogs started to scratch in about 2 min and the

behavior ended around 16 min later. When dogs were pretreated with ergotamine (for

possible mediation of itch via adrenergic, serotonergic and dopaminergic fibers), the

animals did not scratch after cowhage application. Ergotamine caused vomiting.

Centrally induced itch model

Gmerek and Cowan (1983) introduced a rodent animal model which allowed the

quantitative measurement of scratching behavior. Intracerebroventricular (0.001-10 µg,

icv) administration of bombesin elicited scratching and grooming in rats and investigators were able to screen certain antipruritic agents that are used clinically.

Mouse model of scratching

In 1995, Kuraishi and his colleagues in Japan described an easily applicable

experimental model in mice. They injected either a pruritogen or an algesic i.d. behind

the neck of mice and observed the animals for scratches directed to the neck with

hindlegs. Investigators used histamine, compound 48/80 (which releases histamine from

mast cells) and substance P as pruritogens and formalin and capsaicin as algesic agents.

While pruritogenic compounds induced scratching behavior, algesiogenic agents did not.

This model has been used widely in pruritus research since it was described.

33 Allergic conjunctivitis-induced itch model

Woodward et al. (1995) described a conjuctival itch model in guinea pigs. A pruritogen was applied topically to one eye and vehicle was applied to the other eye of a guinea pig. Hindleg scratches directed to the application site were counted. Among the pruritogenic agents, histamine, platelet activating factor, and PGE2 elicited scratching

behavior.

Intrathecal mu agonist-induced itch model

Ko and Naughton (2000) developed a scratching model in monkeys, which is very

similar to the human condition. They administered morphine intrathecally to the animals

which were observed for 6 h and the scratches were counted.

Oral contraceptive-induced cholestatic pruritus model

Injection of ethynylestradiol (5 mg/kg, s.c.), a synthetic estrogen analog, for 5

days induces cholestasis in rats. This model mimics oral contraceptive-induced

cholestatsis and cholestasis of pregnancy in humans. However, neither this model of

cholestasis nor other rodent models of cholestasis elicit scratching behavior in rodents

(Trauner et al., 2005). Inan and Cowan (2006b) injected ethynylestradiol (2 mg/kg) once

a day for 14 consecutive days to rats to mimic chronic cholestasis in humans. Serum bile

acid levels, which are a marker for cholestasis, were high in rats injected with

ethynylestradiol compared to rats injected with vehicle. Also, scratching behavior was

observed in cholestatic rats. Inan and Cowan (2006b) demonstrated the antipruritic

activity of nalfurafine in cholestatic rats.

Cheek model of mouse scratching

34 Shimada and LaMotte (2008) described an experimental mouse model which enabled them to differentiate pain-induced behavior from itch-induced behavior. In this model, a pruritogenic or an algesiogenic agent was injected i.d. into the cheek of the mouse and the animal was observed for wiping of the injected site with forepaw (pain), scratching of the injected site with hindpaw (itch), or grooming the face with both forepaws (itch).

In this thesis, the experimental mouse models of scratching described by Kuraishi et al. (1995) and Shimada and LaMotte (2008) were used. One part of this thesis focuses on behavioral and neuroanatomical comparisons of pain and itch in mice. We used formalin-induced nociception as the experimental animal model of pain.

.

Pharmacology of 5′-guanidinonaltrindole (GNTI), a kappa opioid receptor

antagonist

GNTI (Fig. 9) was synthesized using the indole moiety of the δ opioid receptor antagonist naltrindole as a scaffold to hold a C5′-guanidinyl, with enhanced binding and selectivity at the cloned κ receptor (Jones et al., 1998). GNTI was reported as a highly selective, and potent κ opioid receptor antagonist (5-fold more potent than norBNI) using guinea-pig ileal longitudinal muscle and mouse vas-deferens smooth muscle preparations as well as using human cloned opioid receptors expressed in Chinese hamster ovary

(CHO) cells (Jones et al., 1998; Jones and Portoghese, 2000).

35

Fig. 9. Chemical structure of GNTI.

Central administration of GNTI to rats reduced food intake induced by U50, 488H

(a kappa opioid receptor agonist), DAMGO (a peptide mu opioid receptor agonist), and

food deprivation (Jewett et al., 2001). This report suggested that GNTI has an anorectic effect like norBNI. Negus and his colleagues (2002) showed that the kappa opioid receptor antagonistic activity of GNTI has a slow onset (24 h) and long duration (until 14 days) in rhesus monkeys. Loacker et al. (2007) reported that systemic administration of

GNTI to mice before U50,488H injection antagonizes the seizure inhibitory effect of

U50,488H.

GNTI also inhibited diuresis, a well known effect mediated through activation of kappa opioid receptors. Systemic administration of GNTI to lambs significantly decreased U50,488H-induced diuresis (Wei et al., 2007). Similarly, Inan et al. (2009) reported that pretreatment with GNTI (at -30 min) inhibits diuresis elicited by nalfurafine and U50,488H in rats.

36 Summary of Objectives

This thesis comprises two parts. The first part investigates a) GNTI as a scratch- inducing compound in mice and b) possible mediators and receptors that may be involved in the pathogenesis of GNTI-induced scratching (itch). The second part focuses on similarities and differences between pain and itch using GNTI-induced scratching and formalin-induced nociception models in mice. The original aims of this thesis are summarized as follows:

Part I

1. To characterize GNTI-induced scratching in mice.

Different routes of administration (s.c., i.p., i.t.), time course, and development of tolerance will be studied. The scratch-inducing activity of GNTI will be compared to the corresponding activity of two other kappa opioid receptor antagonists: norBNI and benzoylnorBNI.

We will investigate neurons activated following the vigorous scratching induced by GNTI in mouse spinal cord using c-fos expression as a marker. Localization of c-fos expressed neurons will be compared with neurons activated following scratching elicited by compound 48/80, a chemically different pruritogen.

2. To investigate the neurotransmitter/neuromodulator systems involved in GNTI- induced scratching.

We will examine whether or not the scratch-inducing activity of GNTI is through opioid, histamine, GRP, and/or M1 muscarinic receptors.

1) Investigating opioid receptors

a) To determine if nalfurafine antagonizes GNTI-induced scratching.

37 We will conduct experiments to answer the following questions:

Does pretreatment with nalfurafine inhibit scratching elicited by GNTI?

Does nalfurafine antagonize scratching behavior when it is injected after

scratching has been induced by GNTI?

Does tolerance develop to a possible antipruritic effect of nalfurafine?

Is the potential antipruritic activity of nalfurafine due to sedation.

Does pretreatment with nalfurafine decrease c-fos expression induced by

compound 48/80 or GNTI?

b) To study if GNTI induces scratching in mice lacking opioid receptors. GNTI

will be injected in mu, kappa or delta opioid receptor knock out mice. We will

also pretreat mice with either naloxone, a non-selective opioid receptor antagonist,

or norBNI and investigate if GNTI elicits scratching behavior.

2) Investigate histamine and its receptors

We will pretreat mice with either H1 or H4 receptor antagonists before injection of

GNTI.

3) Investigating GRP and its receptor

Sun et al. (2009) described GRP as a common mediator for transmitting itch sensation in the dorsal horn of the spinal cord. We will conduct experiments pretreating mice with the peptide GRPR antagonist used by Sun and Chen (2007), as well as the non- peptide GRPR antagonist, RC-3095, to potentially antagonize GNTI-induced scratching.

Does nalfurafine inhibit scratching via GRP? For this aim, GRP mRNA level will be measured after injection of GNTI, as well as nalfurafine.

4) Investigating the M1 receptor

38 Caliper Life Sciences screened receptors and mediators against which GNTI

might have an affinity. Screening included neurotransmitters, steroids, ion channels,

second messengers, PGs, growth factors as well as hormones, brain/gut peptides (except

bombesin), and enzymes. Binding affinity to opioid receptors by 99% and binding

affinity to the muscarinic M1 receptors by 52% decreased by GNTI (Table 3).

Furthermore, Nakao et al. (2008) reported that nalfurafine has affinity against the muscarinic M1 receptor (Table 4). Since both GNTI and nalfurafine have an affinity for the M1 receptor, we will include M1 receptor ligands (agonist and antagonist) in our studies.

39 Table 3. Percent inhibition of receptor binding with GNTI. Fifty percent or greater inhibition was accepted to qualify a compound as active.

40 Table 4. Percent inhibition of receptor binding with nalfurafine (TRK-820) Nakao et al. (2008).

41 Part II

To study similarities and differences between pain and itch using GNTI-

induced scratching and formalin-induced nociception models in mice.

First, we will study if a local anesthetic agent, lidocaine, which inhibits pain sensation, will also block itch sensation and second, we will investigate transmission of

pain and itch stimuli (using c-fos expression as a marker) after application of pain and

itch stimuli to the same area of mice. For this aim, we will use the mouse model

described by Shimada and LaMotte (2008). Either a pain or an itch stimulus will be

applied to the cheek of a mouse and then behavior observed and c-fos IHC performed.

42 CHAPTER 2 MATERIALS AND METHODS

Part I

Pharmacological Analysis of GNTI-Induced Compulsive Scratching

Animals

In all experiments, unless otherwise mentioned, male Swiss-Webster mice (Ace

Laboratories, Boyertown, PA) weighing 25-30 g were used. All animals were drug-naïve

and were used only once, except where noted. Mice were housed five per cage with food

and water freely available until acclimation to the observation boxes was begun. Newly acquired mice from outside vendors were kept in the Central Animal Facility for at least

3-4 days before use. A 12 h light/12 h dark cycle (7 AM/ 7 PM) was used. Room temperature was maintained at 22 ± 2°C with a relative humidity of 50 ± 10%.

Experiments were performed only during the light phase, between 11:00 AM and 6:00

PM. All animals (except the ones used for immunohistochemistry) were euthanized immediately after the completion of experiment by asphyxiation with carbon dioxide. All protocols were approved by the Temple University Institutional Animal Care and Use

Committee and all studies were carried out in accordance with the Guide for the Care and

Use of Laboratory Animals by the National Institutes of the Health.

Routes of Administration

Systemic drug injections were carried out using standard techniques for the

following routes of administration: subcutaneous (s.c.), intraperitoneal (i.p.), and oral

(p.o.). All injections were made in hand-held, conscious mice. Either test agent or vehicle

control was administered by the same route, unless otherwise mentioned. 43 Subcutaneous injections were made either behind the neck (for the mouse model

of scratching) or under the skin of the flank area of mice. Intraperitoneal injections were

made through the abdominal wall of mice. A 26G x 3/8 inch needle was used for s.c. and i.p. injections. For oral administration, a curved, ball-tipped 20G x 1.5 inch stainless steel gavage tube (Perfectum, Popper & Sons Inc., New Hyde Park, NY) was used. Injection

volume s of compounds were 0.1 ml per 10 g mouse body weight. Drugs were dissolved

in a volume of vehicle where the test agent was expressed in mg per ml. These solutions

were prepared to be one tenth the desired dose in mg per ml. For example, to give a dose

of an agent at 10 mg/kg to a 25 g mouse, 0.25 ml of a 1 mg/ml solution would be injected.

Some compounds were injected using the intrathecal (i.t.) route of administration.

Acute i.t. injection was made according to the method described by Hylden and Wilcox

(1980). A 30 gauge needle connected to a Hamilton syringe was inserted through the skin

and into the spinal subarachnoid space at the level of the fifth or sixth lumbar vertebrae.

The correct puncture of the dura was demonstrated by a flick of the tail. Either vehicle or

compound was injected in a volume of 5 µl.

Apparatus for Behavioral Observations

During behavioral experiments, the mice were acclimated to individual Plexiglas

observation boxes (19 x 23 x 24 cm) (Fig 11). The lids were ventilated and no food or

water was available after placement in the boxes. Each box contained a thin layer of fresh

wood-chip bedding and was optically shielded (red) on all sides except the side facing the

observer.

44 A Digiscan D Micro System (AccuScan, Columbus, OH) system was used to monitor locomotor activity. Individual cages (27 cm x 48 cm x 20 cm) were located in an isolated room for the locomotion studies.

GNTI-Induced Scratching Test

The mouse model of scratching described by Kuraishi et al. (1995) was used. In

this model, a pruritogen agent is injected into the rostral back of the neck (Fig. 10) and

the number of scratches directed to the neck with hind legs is counted. Groups of 8-10

mice were used. Mice were brought to the laboratory in the morning of the experiment.

One to two h later, animals were weighed and placed individually into observation boxes for a m inimum of 1 h for acclimation (Fig. 11).

Fig. 10. Injection of a pruritogen to a mouse

Each mouse was injected s.c. behind the neck with either saline or GNTI (0.03-3

mg/kg). Immediately after injection, the mice were returned to their observation boxes.

After a 1 min re-acclimation, bouts of scratching were observed and counted for 30 min

(Fig. 12).

45

Fig. 11. Observation boxes used.

Fig. 12. Hind leg scratching of a mouse injected with a pruritogen. (Courtesy of Dr. George B Kehner)

Individual itch-scratch responses to the neck of a mouse were counted. Scratching of

other sites such as the ears and nose were ignored. Front leg responses were also

excluded because of confusion with general body grooming.

To establish if GNTI induces scratching when administered intrathecally, mice were injected (i.t., 5 µl) with either saline or GNTI (0.3-1.5 µg) and the number of scratches directed to the neck with hind legs was counted for 30 min.

Comparison of Scratch-Inducing Effects of Kappa Opioid Receptor Antagonists

Mice were acclimated individually to the observation boxes. Animals were injected (s.c., behind the neck) with either GNTI (0.03-3 mg/kg), norBNI (0.3-30 mg/kg), or a benzoyl derivative of norBNI (3-50 mg/kg). The number of scratches was counted for 30 min. 46 Duration of Action of GNTI-Induced Scratching

After acclimation in their observation boxes, mice were injected s.c. behind the

neck with 0.3 mg/kg GNTI and the number of scratches in every 10 min was recorded

until scratching was essentially over.

Possible Tolerance Against GNTI-Elicited Scratching

Mice were injected with a standard dose of GNTI (0.3 mg/kg, s.c., behind the

neck) and then the number of scratches was counted for 30 min every day over 8 days.

Investigation of the Possible Role of Opioid Receptors in GNTI-Induced Scratching

Studying anti-scratch activity of nalfurafine

Anti-scratch activity of nalfurafine was studied using two different time points

(pretreatment and posttreatment). In the pretreatment group, after acclimation in

individual observation boxes, mice were injected with either saline or nalfurafine (0.001-

0.03 mg/kg, s.c., flank area) and 20 min later, the animals were administered GNTI (0.3

mg/kg). In the posttreatment group, mice were first injected with GNTI (0.3 mg/kg) and,

5 min l ater, they were administered either saline or nalfurafine (0.005-0.03 mg/kg, s.c.,

flank area). Mice were observed for 30 min and the number of scratches was recorded.

Possible tolerance to the anti-scratch activity of nalfurafine

A standard dose of nalfurafine (0.02 mg/kg) and a standard dose of GNTI (0.3

mg/kg) were chosen to study possible tolerance to the anti-scratch effect of nalfurafine.

Every day for 8 consecutive days, after acclimation in the observation boxes, mice were

injected first with nalfurafine and then, 20 min later, with GNTI. Animals were observed

for 30 min and the number of scratches during this time was recorded.

47 Measurement of locomotion

Locomotor activity after nalfurafine was measured to establish if the anti-scratch

effect of nalfurafine is a consequence of behavioral depression. In the morning of the

experiment, mice were placed individually into cages (27 cm x 48 cm x 20 cm) located in a quiet room for locomotor activity measurement and acclimated for at least 1 h. Mice were injected (s.c., flank area) with either saline or two different doses of nalfurafine 0.02 and 0.04 mg/kg. The 0.02 mg/kg dose is our standard anti-scratch dose of nalfurafine whereas the 0.04 mg/kg dose is a high dose that we never use for anti-scratch activity.

Mice were returned to the original cages and monitored for total distance traveled over 1 h using a Digiscan D Micro System (AccuScan, Columbus, OH).

Effect of naloxone on GNTI-induced scratching

After acclimation in the observation boxes, mice were injected (i.p.) with either

saline or naloxone (10 mg/kg) and, 10 min later, were administered GNTI (0.3 mg/kg).

The number of scratches was recorded for 30 min.

Effect of norBNI on GNTI-induced scratching

Mice were injected (i.p.) with either saline or norBNI (20 mg/kg) 18-20 h before

GNTI injection. The next day, after acclimation, animals were administered GNTI (0.3

mg/kg, s.c.) and scratches were counted for 30 min.

Scratching activity of GNTI in mu (µ), delta (δ) or kappa (κ) opioid receptor knock out

(ko) mice

µ, δ, or κ opioid receptor ko male, C57BL/6J background mice (20-25 g) and wild

type littermates were used. All ko mice were supplied through Temple University Center

for Substance Abuse Research. 48 µ ko mice were developed by disruption of exon-1 of the MOR-1 gene through

homolo gous recombination as described by Schuller et al. (1999). δ ko mice were developed by altering the DOR-1 gene via replacing exon 2 with a neomycin resistance cassette (Zhu et al., 1999). κ opioid deficient mice were generated by a targeting

construct by replacing the initiation codon region and the N-terminal coding region of the

mKOR gene by a neomycin resistance cassette (Simonin et al., 1998). Both µ opioid

receptor ko mice and wild type littermates were injected with GNTI (0.3 mg/kg) and the

number of scratches in 30 min was recorded. The same experimental procedure was

applied for the δ opioid receptor ko and their wild type littermates and the κ opioid

receptor ko and wild type littermates. Animals received GNTI (0.3 mg/kg) and the

number of scratches was counted for 30 min.

49 Determination of c-Fos Expression in the Cervical Spinal Cord Following GNTI and

Compound 48/80 Scratching as well as Nalfurafine’s Effect on c-Fos Expression

Using Immunohistochemistry

Immunohistochemistry

Immunohistochemistry (IHC) allows for the localization of antigens or proteins in

tissue sections using labeled antibodies as specific reagents through antigen (Ag)-

antibody (Ab) interactions that are visualized by a marker fluorescent dye, enzyme, or

colloidal gold. Coons and Kaplan (1950) used fluoresceny dye, Nakane and Pierce (1966)

used peroxidase, and Faulk and Taylor (1971) used colloidal gold for the first time. Faulk

and Taylor (1971) also introduced use of the electron microscope for IHC.

A good tissue preparation is essential for IHC. To preserve the tissue architecture and cell morphology, quick and enough time for fixation is crucial. There is no universal fixative for all tissue types, however, many antigens are successfully shown in formalin- fixed paraffin-embedded tissue sections. Vertebrate tissues are usually fixed through transcardial perfusion. Tissue sectioning is accomplished by using either vibrotome or cryostat.

The Abs used for specific Ag detection can be polyclonal or monoclonal.

Polyclonal Abs are made by injecting animals with peptide Ag, and then after a secondary immune system is stimulated, Abs are isolated from whole serum. Therefore, polyclonal Abs are mix of Abs that recognize several epitops. Monoclonal Abs are considered more specific. Abs are also classified as primary or secondary reagents.

Primary Abs are against an Ag of interest, and secondary Abs are raised against primary

50 Abs. Secondary Abs recognize immunglobulins of a particular species and are conjugated to either biotin, enzyme (alkaline phosphatase or horseradish peroxidase), or fluorescent agents.

IHC is performed using either direct or indirect methods. The direct method uses only one labeled Ab directed to the Ag. Even though this method is simple and can be done in a shorter time, the indirect method is preferred. The indirect method involves both primary Ab and a labeled secondary Ab and is more sensitive compared to the direct method. A biotinylated secondary Ab is usually coupled with streptavidin-horseradish peroxidase. This is reacted with 3,3-diaminobenzidine (DAB) to produce a brown staining wherever primary and secondary Abs are attached and this is called DAB staining.

Two or more Ags can be stained in one tissue section. This can be achieved using an immunofluorescence method using different fluorescent dyes.

IHC is not only a useful tool in research but also a diagnostic procedure in diseases.

Mice (n=6) were acclimated for at least 1 h individually in observation boxes.

They were injected (s.c., flank area) with either saline or nalfurafine and, 20 min later, were administered (s.c., behind the neck) saline, GNTI (0.3 mg/kg), or a standard dose of compound 48/80 (50 µg/ 100 µl). Six different treatment groups were established. Saline- saline, saline-GNTI, saline-compound 48/80, nalfurafine-saline, nalfurafine-GNTI and nalfurafine-compound 48/80. Two h after the saline or nalfurafine injections, mice were deeply anesthetized with urethane (1.2 g/kg, i.p.) and perfused intracardially with ice- cold 0.1 M phosphate buffer saline (PBS) followed by 4% paraformaldehyde/0.2% picric

51 acid in 0.1 M PBS. The cervical spinal cords were removed and postfixed in 4%

paraformaldehyde solution overnight at 4ºC. Tissue samples were transferred to 30% sucrose solution for at least 3-4 days before sectioning. Cervical spinal cord (C5-C7) sections (35 µm) were cut at -19ºC using a cryostat. Free floating sections were kept in

PBS solution at 4ºC until immunohistochemistry was performed. Ten cervical spinal cord sections were randomly selected and utilized to conduct immunohistochemistry.

Tissues were processed for c-fos immunoreactivity by the avidin-biotin complex procedure as described previously (Brailoiu et al., 2005). They were first treated with 3%

H2O2 to reduce endogenous peroxidase, washed two times for 10 min with PBS, and

blocked with 20% normal goat serum (1:20) at room temperature for 2 h. The sections

were then incubated on a shaker for 2 days at 4ºC with rabbit c-fos antibody 1:4000

dilution (F7799, Sigma, St. Louis, MO). After thorough rinsing, sections were incubated

in biotinylated anti-rabbit immunoglobulin G secondary antibody (1:300 dilution, Vector

Laboratories, Burlingame, CA) for 2 h at room temperature. Following two 10 min rinses

with PBS, sections were incubated in avidin-biotin-peroxidase complex at room

temperature for 90 min (1:150 dilution, Vectastain ABC Elite kit, Vector Laboratories).

Following three 10 min washes in Tris-buffered saline, sections were reacted with 0.05%

diaminobenzidine (Sigma, St. Louis, MO)/ 0.001% H2O2 solution for 5-7 min and washed

three times for 10 min with Tris-buffered saline. Sections were mounted on slides with

0.25% gel alcohol, air-dried, dehydrated with absolute alcohol (50%, 70%, 95%, 100%,

100% for 10 min) followed by xylene (two times for 10 min) and coverslipped with

Permount. C-fos positive nuclei were observed under a light microscope and counted at

40x magnification.

52 To establish if the c-fos expression is a result of itch sensation and not a consequence of scratching behavior, we used two different approaches. In the first method, we first anesthetized mice (n=3) using urethane (1.2 g/kg, i.p.) and then injected

GNTI behind the neck. In the second method, mice (n=3) were fitted with an Elizabethan collar (Kent Scientific Corp., Torrington, CT) and allowed to acclimate for 6 h (Fig. 13).

The animals were then injected s.c. with either saline and GNTI. In both methods, 2 h after the injections, mice were perfused intracardially and cervical spinal cord sections removed as mentioned above.

Fig. 13. A mouse wearing an Elizabethan collar.

Determination of c-fos mRNA using the reverse transcriptase-PCR technique

We measured c-fos mRNA levels in mice injected s.c. with either saline or GNTI

(0.3 mg/kg) using the RT-PCR technique. Two h after the injections, each mouse was decapitated and the cervical spinal cord was dissected out. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. First-strand cDNA was synthesized using the SuperScript II first-strand synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). PCR was performed with a 5′ primer (AAACCGCATGGAGTGTGTTGTTCC) and a

3′ primer (TCAGACCACCTCGACAATGCATGA) for c-fos, and a 5′

53 primer (TCGTACCACAGGCATTGTGATGGA) and a 3′ primer

(ACTCCTGCTTGCTGATCCACATCT) for β-actin under the following conditions:

94°C for 2 min, 30 cycles at 94ºC for 30 sec, 55°C for 45 sec and 72ºC for 45 sec and

finally 72°C for 10 min for c-fos and 94°C for 2 min, 29 cycles at 94ºC for 30 sec, 55°C

for 45 sec and 72ºC for 1 min and finally 72°C for 10 min for β-actin. The amplified

products were subjected to electrophoresis in a 1% agarose gel and stained with ethidium bromide. The image was acquired with a FujiFilm Las-1000 imaging system (FujiFilm

Medical Systems, Stamford, CT). The digital images were quantified with Image Gauge software (FujiFilm Medical Systems, Stamford, CT).

Effects of Histamine 1 (H1) and 4 (H4) Receptor Antagonists on GNTI-Induced

Scratching

Mice were acclimated in the observation boxes at least for 1 h. The animals were

injected (p.o.) with vehicle (1% Tween 80), a H1 receptor antagonist, fexofenadine HCl

(20-60 mg/kg), or a H4 receptor antagonist, JNJ 10191584 (10-60 mg/kg). Forty five min

later, GNTI (0.3 mg/kg) was injected s.c. behind the neck of mice and the number of

scratches was counted for 30 min.

54 Study of the Involvement of GRP on GNTI-Induced Scratching and Anti-scratch

Activity of Nalfurafine

Detection of immunoreactive (ir) GRP nerve fibers and cells in the skin, spinal cord and

DRG of mouse

Mice (n=3) deeply anesthetized and perfused intracardially as mentioned previously. Cervical spinal cord, cervical DRG and 0.5 x 0.5 cm skin from behind the neck of mice were removed and processed for IHC study. Cervical spinal cord sections

(C5-C7) were cut at 35 µm thickness and DRG as well as skin sections were cut at 15 µm thickness at -19ºC using a cryostat. Free floating sections were kept in PBS solution at

4ºC until IHC was performed.

Tissues were processed for c-fos ir by the avidin-biotin complex procedure as described previously. The sections were incubated on a shaker for 2 days at 4ºC with rabbit anti-gastrin releasing peptide antibody 1:1000 dilution (H-027-07, Phoenix

Pharmaceuticals, Burlingame, CA). After a thorou gh rinsing, sections were incubated in biotinylated anti-rabbit immunoglobulin G secondary antibody and then incubated in avidin-biotin-peroxidase complex as mentioned above. GRP ir was observed under a light microscope.

Double staining for c-fos and GRP ir in the cervical spinal cord sections

After acclimation, mice (n=3) were injected (s.c., behind the neck, midline) with

either saline or a submaximal dose of GNTI (0.3 mg/kg). Two h later, animals were

deeply anesthetized and perfused intracardially as mentioned earlier. Cervical spinal cord

sections (15 µm) were cut at -19ºC. Free floating sections were kept in PBS solution at

4ºC until IHC was performed.

55 Tissues were first blocked with 20% normal goat serum (1:20) at room temperature for 2 h. The sections were then incubated on a shaker for 2 days at 4ºC with

rabbit c-fos antibody 1:1000 dilution. After several washes with PBS, sections were

incubated with biotinylated antirabbit IgG (1:50, Vector Laboratories, Burlingame, CA)

for 2 h and then (after being washed with PBS several times) incubated with fluorescein

avidin D (1:50, Jackson ImmunoResearch Laboratories, Inc, West Grove, PA) for 3 h at

room temperature. After rinsing with PBS, sections were blocked with normal donkey

serum (1:30, Jackson ImmunoResearch Laboratories, Inc, West Grove, PA) for 1 h and

incubated with rabbit anti-gastrin releasing peptide antibody 1:500 dilution for 2 days in a

cold room. Following several washes with PBS, sections were incubated with rabbit IgG

Texas red antibody (1:50, Jackson ImmunoResearch Laboratories, Inc, West Grove, PA)

for 4 h. After several washes with PBS, tissues were mounted in Citifluor and

coverslipped. Sections were examined under a confocal scanning laser microscope (TCS

SL; Leica Microsystems Inc., Exton, PA) with excitation/emission wavelengths set to

488/520 nm for fluorescein isothiocyanate and 543/620 nm for Texas Red both in the

sequential mode.

Determination of GRP mRNA using the reverse transcriptase-PCR technique

Mice (n=8) were pretreated with either saline or a fixed anti-scratch dose of nalfurafine (0.02 mg/kg, s.c., flank area). Twenty min later, animals were administered saline or GNTI (0.3 mg/kg, s.c., behind the neck). Two h after the injections, each mouse was decapitated and the cervical spinal cord was dissected out. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. First-strand cDNA was synthesized using the SuperScript II first-strand

56 synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). PCR was performed with a 5′ primer (TCACTGGGCTGTGGGACACTTAAT) and a

3′ primer (CCAGCAAATCCCTTGCAGCTTCTT) for gastrin releasing peptide, and a 5′ primer (TCGTACCACAGGCATTGTGATGGA) and a 3′ primer

(ACTCCTGCTTGCTGATCCACATCT) for β-actin under the following conditions:

94°C for 2 min, 35 cycles at 94ºC for 30 sec, 60°C for 30 sec and 72ºC for 30 sec and finally 72°C for 10 min for GRP and 94°C for 2 min, 29 cycles at 94ºC for 30 sec, 55°C for 45 sec and 72ºC for 1 min and finally 72°C for 10 min for β-actin. The amplified products were subjected to electrophoresis in a 2% agarose gel and stained with ethidium bromide. The image was acquired with a FujiFilm Las-1000 imaging system. The digital images were quantified with Image Gauge software.

Effect of GRPR antagonists on GNTI-induced scratching behavior

We studied both non-peptidic and peptidic antagonists of GRPR. As non-peptidic antagonist, we used RC-3095 (Pinski et al., 1992). Mice (n=5) were pretreated with either saline or RC-3095 (s.c., flank area). The choice of dose of RC-3095 (10 and 30 mg/kg) was based on a previous report (Meller et al., 2004). Fifteen min later, animals were given GNTI (0.3 mg/kg, s.c., behind the neck) and 1 min after the injections the number of scratches directed to the neck with hind legs was counted for 30 min. To have a positive control group, and to be certain that the antagonist blocked GRPRs, we conducted another set of experiment using the antagonist. Sun and Chen (2007) showed that pretreating mice with [D-Phe6]bombesin(6-13) methyl ester (i.t., 2 nmoles/5 µl), diminished the number of scratches induced by GRP18-27 (i.t., 2 nmoles/5 µl), a peptidic

57 GRPR agonist. We used the same dose of agonist. Mice were pretreated with RC-3095

(10 mg/kg, s.c.) and then 15 min later, animals were injected with GRP18-27 (i.t., 2

nmoles/5 µl). The number of scratches was counted for 30 min.

[D-Phe6]bombesin(6-13) methyl ester was used as the peptidic GRPR antagonist.

Sun and Chen (2007) reported that pretreating mice with this antagonist (2nmoles, i.t.)

diminished compound 48/80-, PAR2-, and chloroquine-induced scratching in this species.

Mice (n=6-8) were injected i.t. with either antagonist (2-100 nmoles/5 µl) or saline (i.t., 5

µl) and, 10 min later, the animals were challenged with either saline or GNTI (0.3 mg/kg,

s.c., behind the neck). The number of scratches was recorded for 30 min. To have a

positive control group, and to be certain that the antagonist blocked GRPRs, we

conducted another set of experiment using the antagonist. We followed the same protocol

described by Sun and Chen (2007). Mice were pretreated with either saline (i.t., 5 µl) or

[D-Phe6]bombesin(6-13) methyl ester (i.t., 2 nmoles/5 µl) and, 10 min later, the animals were injected with GRP18-27 (i.t., 2 nmoles/5 µl). The number of scratches was counted

for 30 min.

Study of Possible Role of Muscarinic 1 (M1) Receptors in GNTI-Induced Scratching

The main reason to study a possible role of M1 receptors in GNTI-induced

scratching was the results from receptor binding screening studies conducted by the

Caliper company. Among a total of 63 receptors, neurotransmitters and enzymes studied,

GNTI (1 µM) decreased binding affinity to M1 receptors (52%).

Effect of telenzepine, a M1 receptor antagonist, on GNTI-elicited scratching

58 After acclimation in their individual observation boxes, mice were injected s.c.

(flank area) with either saline or telenzepine (1-30 mg/kg). Thirty min later, the animals were challenged with GNTI (0.3 mg/kg) and the scratches directed to the neck with hind legs were counted for 30 min.

Effect of McN-A-343, a M1 receptor agonist, on GNTI-induced scratching

After acclimatization, mice were administered (i.t., 5 µl) either saline or McN-A-

343 (1.5-15 µg/5 µl). Ten min after the injections, mice were injected behind the neck

with GNTI (0.3 mg/kg). One min later, the number of scratching bouts in each 5 min was

recorded over 30 min.

Measurement of locomotion after McN-A-343

Locomotor activity was measured using an AccuScan monitoring system as

mentioned before. Mice were acclimated in their individual cage for at least 1 h. The

animals were injected (i.t., 5 µl) with either saline or McN-A-343 (15 µg/5 µl) and total

distance traveled over 1 h was measured.

59 Part II

Similarities and Differences between Pain and Itch Using Formalin-Induced

Nociception and GNTI-Induced Scratching Models in Mice

Animals

Male, Swiss Webster mice (25-30 g) were brought to the laboratory on the morning of the experimental day for acclimation, and placed in individual observation boxes (18 cm x 23 cm x 25 cm).

Routes of Administration

Intradermal (i.d.) injections were made using a 30-gauge needle fitted to a 25 µl

Hamilton syringe.

Effect of Locally Administered Lidocaine on Pain and Itch

Formalin-induced nociception, an experimental rodent model of pain

Formalin causes a persistent (tonic, continuing) pain which is different from the

transient pain associated with the hot plate and tail flick tests. Injection of diluted

formalin (usually 5%) into the paw of mouse or rat induces local inflammation and

causes a persistent noxious stimulus (Dubuisson and Dennis, 1977; Murray et al., 1988;

Wheeler-Aceto et al., 1990).

Formalin causes two types of behavior in response to the pain: a)

flinching/shaking and b) licking/biting of the injected paw. While rats exhibit both

behavioral responses (Wheeler-Aceto et al., 1990), mice only display licking and biting

of the paw (Murray et al., 1988). A biphasic response is obtained. An initial acute phase

(0-10 min) is followed by a quiet period which lasts for about 10 min, which is then

60 followed by a prolonged tonic, late phase (20-45 min). The acute phase represents a

direct effect of formalin on sensory receptors and the late phase is a result of

inflammation and central sensitization.

In this thesis, persistent (tonic), inflammato ry pain was used as the nociceptive

stimulu s. After acclimatization for at least 1 h in the observation boxes, mice were

injected i.d. to the dorsal side of the right hind leg (to block sensation on the dorsal side

of the hindpaw) with either saline or 2% lidocaine (0.1 ml). Ten min later, the animals received saline or formalin (5%, 20 µl, s.c.) to the dorsal side of the right hindpaw (Fig.

14). Time 0 is defined as the instant after the formalin injection. Following the formalin

injection, the animals were returned to their cages. The time spent licking the injected

paw was recorded at 0-10 min and 20-35 min using a stopwatch. Mice were perfused as

described previously, 2 h after the saline or formalin injection, for c-fos IHC.

Fig. 14 Subcutaneous injection of a mouse right hind paw with formalin.

GNTI-induced scratching

After acclimatization in their observation box for at least 1 h, mice were injected i.d. to the back of the neck with either saline or 2% lidocaine (0.1 ml). Ten min later, they were administered saline or GNTI (0.3 mg/kg, s.c.) behind the neck and the number of

61 hind leg scratches directed to the neck was counted for 30 min. Two h after the saline or

GNTI injection, the mice were perfused for c-fos IHC.

Measurement of locomotor activity

Mice were placed in individual cages (27 cm x 48 cm x 20 cm) and acclimated for

1 h. They were injected i.d. behind the neck with either saline or 2% lidocaine (0.1 ml) and monitored for total distance traveled over 30 min using a Digiscan D Micro System.

Determination of c-fos immunoreactivity in spinal cord sections

Two h after administration of saline, GNTI or formalin, the mice were deeply anesthetized with urethane (1.2 g/kg, i.p.) and perfused intracardially as mentioned previously. The fixed cervical spinal cords (for scratching) and lumbar spinal cords (for pain) were removed and post fixed in 4% paraformaldehyde solution overnight at 4ºC.

Tissue samples were transferred to 30% sucrose solution for at least 3-4 days before sectioning. Cervical spinal cord (C5-C7) and lumbar spinal cord (L3-L5) were cut at 35

µm thickness at -19ºC using a cryostat. Free floating sections were kept in PBS solution at 4ºC until IHC was performed. Ten cervical or ten lumbar spinal cord sections from each mouse were randomly chosen to conduct IHC.

Tissues were processed for c-fos ir by the avidin-biotin complex procedure as described previously. The sections were incubated for 2 days at 4ºC with rabbit c-fos antibody 1:4000 dilution, then they were incubated in biotinylated anti-rabbit immunoglobulin G secondary antibody 1:300 dilution and in avidin-biotin-peroxidase complex 1:150 dilution. Sections were mounted on slides with 0.25% gel alcohol, air- dried, dehydrated with absolute alcohol (50%, 70%, 95%, 100%, 100% for 10 min each)

62 followed by xylene (two times for 10 min each) and coverslipped with Permount. C-fos

positive nuclei were observed under a light microscope and counted at 40x magnification.

Application of pain and itch stimuli to the same site

We used a recently described mouse model for administering itch and pain stimuli

(Shimada and LaMotte, 2008). After acclimatization in their individual observation boxes,

each mouse was injected s.c. with saline, GNTI (30 µg in 10 µl) or 5% formalin (10 µl) into the right cheek and observed under blind conditions for 10 min. We preferred the s.c.

route, rather than the intradermal route, for consistency with the experiments described

above. Since both pain and itch stimuli elicited their behavioral effects within the first 10

min of Shimada and LaMotte’s original study (2008), we also observed mice for 10 min.

Animals were scored for wiping (indicating pain), grooming and scratching (indicating

itch) of the injected cheek (Fig. 15). Only unilateral wipes with the forelimb that were not

part of general grooming behavior were counted. Grooming behavior consisted of

simultaneous wipes starting from behind the ears and followed through over the cheek

with both forelimbs. Animals scratched the injected cheek using their hind paws. Two h

after the injections, 3 mice from each group were perfused intracardially (described

previously) and brains were removed to investigate (using c-fos immunohistochemistry)

whether pain and itch stimulate different neurons in brainstem sections.

63

Fig. 15. Wiping of the cheek with the forelimb (a), grooming with forelimbs (b), and scratching of the cheeck with hind leg (c) (Shimada and LaMotte, 2008).

Determination of c-fos immunoreactivity in brainstem sections

Mice (n=3) were injected s.c. in the right cheek with saline, formalin or GNTI.

Two h later, the animals were deeply anesthetized with urethane (1.2 g/kg, i.p.) and

perfused intracardially. Brains were removed and postfixed in 4% paraformaldehyde

solution overnight at 4ºC. Tissue samples were transferred to 30% sucrose solution for at

least 3-4 days before sectioning. Brainstem sections (50 µm) were cut at -19ºC using a

cryostat. Free floating sections were kept in PBS solution at 4ºC until

immunohistochemistry was performed. Every third brainstem section was utilized to

conduct immunohistochemistry.

Tissues were processed for c-fos ir by the avidin-biotin complex procedure as

described previously. The sections were incubated for 2 days at 4ºC with rabbit c-fos

64 antibody 1:4000 dilution then incubated in biotinylated anti-rabbit immunoglobulin G secondary antibody (1:300 dilution) and avidin-biotin-peroxidase complex at room temperature for 90 min (1:150 dilution). Sections were mounted on slides with 0.25% gel alcohol, air-dried, dehydrated with absolute alcohol (50%, 70%, 95%, 100%, 100% for

10 min) followed by xylene (two times for 10 min) and coverslipped with Permount. C- fos positive nuclei were observed under a light microscope and counted at 40x magnification.

Compounds

GNTI, fexofenadine HCl and JNJ 10191584 were purchased from Tocris

(Ellisville, MO). NorBNI, naloxone, RC-3095, telenzepine, McN-A-343, formalin, urethane, lidocaine N-ethyl bromide and GRP18-27 were purchased from Sigma (St. Louis,

MO). [D-Phe6]bombesin(6-13) methyl ester was synthesized by Phoenix Pharmaceuticals

(Burlingame, CA). Nalfurafine was a generous gift from Adolor (Exton, PA). BnorBNI

was provided courtesy of Drs. Husbands and Lewis, University of Bath, UK.

. All compounds were dissolved in saline except for fexofenadine HCl and JNJ

10191584 which were suspended in 2% tween 80.

Data Analysis

Data are expressed as mean ± S.E.M. One way and two way ANOVA followed by Neuman-Keuls test and Student’s t-test as well as the Mann-Whitney U test were used to compare groups (PharmToolsPro). P<0.05 was accepted as statistically significant.

65 CHAPTER 3

RESULTS

Part I

Characteristics of GNTI-Induced Scratching

The mice injected with GNTI displayed face and body grooming 2-3 min after the injection. The mice then compulsively scratched the injection side with their hind paws during the 30 min observation time. GNTI induced scratching behavior in a dose- dependent manner as shown in Figure 16.

700 GNTI Saline 600

500 S.E.M.in 30 min

+ s 400

300 s he

er ofer cratc 200

100

Mean numb Mean 0 0.03 0.1 0.3 1 3 Dose (mg/kg, s.c.)

Fig. 16. Dose-response curve for GNTI-induced scratching. Each data point represents the mean ± s.e.m. for 8-10 mice.

66 GNTI elicited intense scratching in mice. The maximum effect was obtained with 1

mg/kg of GNTI. A submaximally effective dose (0.3 mg/kg) of GNTI was chosen as a standard dose for all subsequent experiments. Mice injected with saline scratched only 25

± 5 times during 30 min observation time. We investigated if the injection volume has an effect on scratching behavior induced by GNTI. We prepared GNTI solutions that would

give 0.3 mg/kg when injected in a volume of either 0.1 ml or 0.30 ml/30 g mouse. The

injection volume did not affect the extent of scratching behavior (Fig. 17). In all

subsequent experiments with GNTI, the compound was prepared in a solution of 0.1 ml

for 10 g body weight.

600

500

400 S.E.M. in 30 min in S.E.M.

300

200

100 Mean number of scratches + scratches number of Mean 0 GNTI (0.3 mg/kg) GNTI (0.3 mg/kg) (s.c., 0.3 ml) (s.c., 0.1 ml)

Fig. 17. GNTI (0.3 mg/kg, s.c., behind the neck) was given to mice (28-30 g, n=10-12) either in a volume of 0.3 ml or in a volume of 0.1 ml. The number of scratches was recorded for 30 min.

67 Also, as shown in Figure 18 the i.t. administration of GNTI (0.3-1.5 µg) did not induce dose-related scratching behavior in mice. Further, GNTI did not elicit scratching when administered i.p. (data not shown).

30

25 in 3 n M. 0 mi 20 S.E.

15

10

5

0

Mean number of scratches+ GNTI GNTI saline GNTI (0.3 μg) (0.75 μg) (1.5 μg)

Fig. 18. Mice (n=6-8) were injected with either saline (i.t., 10 µl) or GNTI (i.t., 0.3-1.5 µg/10 µl) and were observed for 30 min. I.t. administration of GNTI does not induce dose-related scratching in mice.

68 Compulsive scratching began within 5 min of injection of norBNI and BnorBNI, similar to GNTI. The rank order for both potency and efficacy was GNTI > norBNI >

BnorBNI (Fig. 19). Potencies (and 95% confidence limits) were 0.16 (0.08-0.30) mg/kg

for GNTI and 7.0 (5.5-9.8) mg/kg for norBNI. The A50 of BnorBNI could not be

calculated.

700 GNTI norBNI BnorBNI 600

500 S.E.M. in 30 min

400

300

200

100 Mean number of scratches + scratches of number Mean 0

0.03 0.1 0.3 1 3 10 30 50 Dose (mg/kg, s.c.)

Fig. 19. Mice (n=8) were administered (s.c.) GNTI, norBNI, or BnorBNI and the number of scratches was counted for 30 min. GNTI is more potent and efficacious than norBNI and BnorBNI.

69 Using the standard dose of GNTI (0.3 mg/kg), peak scratching occurred between

10 and 30 min and gradually decreased between 30-80 min as shown in Figure 20.

180

160

140

S.E.M.in 30 min 120

100

80

60

40

20

Mean numberMean of scratches+ 0 10 20 30 5040 60 70 80 Time (min)

Fig. 20. Mice (n=8) were injected with GNTI (0.3 mg/kg) and the number of scratches was recorded every 10 min over 80 min.

Tolerance to the scratch-inducing action of GNTI did not develop (Fig 21). When mice were injected with GNTI (0.3 mg/kg) once every day for eight consecutive days, the number of scratches was similar.

70 600

in 30 min 500

S.E.M. 400

300

200

100

Mean numberMean of scratches+ 0 1 32 4 5 6 87

Day

Fig. 21. Tolerance does not develop to GNTI-induced scratching in mice. The animals (n=8) were injected with GNTI (0.3 mg/kg) once a day and observed for 30 min daily for 8 days.

71 Nalfurafine Attenuates GNTI-Induced Scratching

Mice pretreated with saline gave 578 ± 78 scratches in 30 min. Pretreatment (at -

20 min) with nalfurafine (0.001-0.03 mg/kg) significantly decreased GNTI (0.3 mg/kg)- induced scratching in a dose-dependent manner (F [4, 35] = 14.83; Fig. 22). Furthermore, post treatment (at +5 min) with nalfurafine (0.02 and 0.03 mg/kg) significantly decreased the number of scratches by 50% compared to the control group (F [4, 34] = 6.93; Fig. 23).

700

600 S.E.M. + 500 * 400

in 30 min 300 r of scratches

200 * * 100 * * Mean numbe 0 saline nalfurafin e nalfurafine nalfurafine nalfurafine + (0.001) (0.01) (0.02) (0.03) GNTI + + + + GNTI GNTI GNTI GNTI

Fig. 22. Pretreatment of mice (n=8) with nalfurafine (0.01-0.03 mg/kg) inhibits GNTI (0.3 mg/kg)-induced scratching in a dose-dependent manner (*p<0.05, **p<0.01 compared to control) (One-way ANOVA followed by Newman-Keuls test).

72 900

800 .M 700 S.E . 600

500 * * m 400 * * in 30 in 300

num r of s atche200 +

100 Mean be cr s 0 GNTI GNTI GNTI GNTI GNTI

+ + + + + saline nalfurafine nalfurafine nalfurafine nalfurafine (0.001) (0.01) (0.02) (0.03)

Fig. 23. Post-treatment of mice (n=8) with nalfurafine (0.02-0.03 mg/kg) reverses GNTI (0.3 mg/kg)-induced scratching (**p<0.01, one-way ANOVA followed by Newman- Keuls test)

Tolerance did not develop to the antiscratch activity of nalfurafine over a period of 10 days. The mean number of scratches recorded on day 1 was 32 ± 14 and on day 10 was 16 ± 7 (Fig. 24).

73 160

140

120

S.E.M. S.E.M. in 30 min 100

80

60

40

20

Mean numberMean of scratches+ 0 21 3 4 5 76 8 9 10 Day

Fig. 24. Tolerance does not develop to the antiscratch activity of nalfurafine. Mice (n=8) were pretreated with either saline or nalfurafine (0.02 mg/kg) and then with GNTI (0.3 mg/kg) and the number of scratches was counted for 30 min for 10 consecutive days.

Ambulation was not suppressed in mice injected with our standard dose of nalfurafine (0.02 mg/kg) compared to saline-injected animals. A higher dose of nalfurafine (0.04 mg/kg) significantly reduced locomotion (F [2, 23] = 12.70, Fig. 25).

74 1000

800

600 S.E.M. (cm) in 1 h

400 * *

200 Mean total distance + distance total Mean 0 saline nalfurafine nalfurafine (0.02) (0.04)

Fig. 25. Antiscratch dose of nalfurafine has no effect on locomotion. Nalfurafine (0.02 mg/kg) does not markedly affect locomotion of mice (n=8) whereas the higher dose of nalfurafine (0.04 mg/kg) reduces locomotion significantly (p<0.01 compared to control and 0.02 mg/kg of nalfurafine).

Antagonism of opioid receptors does not inhibit GNTI-induced scratching

Neither pretreatment with naloxone nor pretreatment with norBNI inhibited GNTI elicited scratching (Figs 26 and 27). Also, GNTI induced equal levels of intense scratching in µ, δ, and κ knock out mice and their wild-type littermates (Figs 28, 29, and

30).

75

450

400

350

S.E.M. in 30 min S.E.M. 300

250

200

150

100

50

Mean number of scratches+ 0 saline naloxone (3) + + GNTI (0.3) GNTI (0.3)

Fig. 26. Naloxone has no marked effect on GNTI-induced scratching (n=8).

700 min

30 600

.M. in.M. 500 S.E 400

300 scratches + scratches

200

100 Mean number of number Mean 0 saline norBNI (20) + + GNTI (0.3) GNTI (0.3)

Fig. 27. Antagonism of kappa opioid receptors by norBNI did not attenuate GNTI induced scratching (n=8).

76 400 + / + - / -

300 S.E.M. in 30 min S.E.M.

200

100 Mean numberMean of scratches+ 0 GNTI GNTI (0.3) (0.3)

Fig. 28. GNTI induces scratching in µ opioid receptor ko mice and their wild-type littermates (n=6-8).

600 - / -

500 + / +

400 S.E.M. in 30 min 30 in S.E.M.

300

200

100 Mean number of scratches + of scratches number Mean 0 GNTI GNTI

(0.3) (0.3)

Fig. 29. GNTI induces scratching in δ opioid receptor ko mice as well as their wild-type littermates (n=6-8).

77 450 + / + - / - 400

350

300 S.E.M. in 30 min S.E.M.

250

200

150

100

50 Mean number of scratches + scratches number of Mean 0 GNTI GNTI

(0.3) (0.3)

Fig. 30. GNTI elicits vigorous scratching in both kappa ko mice and their wild-type littermates (n=7).

78 Nalfurafine prevents GNTI- and compound 48/80-induced c-fos expression in the

cervical spinal cord of mice

GNTI and compound 48/80, two chemically different scratch-inducing agents, significantly increased the number of c-fos positive nuclei in the lateral side of the superficial layers of the dorsal horn of cervical spinal cord sections (p<0.01, compared to saline + saline and nalfurafine + saline control groups) (Figures 31 and 32). GNTI caused more c-fos expression than compound 48/80. While nalfurafine by itself had no effect on c-fos expression, pretreatment with nalfurafine (0.02 mg/kg) significantly reduced the number of c-fos cells induced by both GNTI and compound 48/80 (F [5, 35] = 55.80, p<

0.01, Figures 31 and 32). A representative picture of c-fos bands from cervical spinal cord for saline or GNTI mice are shown in Figure 33. The C-fos mRNA level was significantly higher in cervical spinal cord tissue from mice injected with GNTI compared to mice injected with saline (t (12) = 14.07; Fig. 34).

79

Fig. 31. Representative photomicrographs of c-fos expression in the spinal cord. C-fos is not detected in the superficial layers of the dorsal horn following saline injection (A and B). GNTI (C, D) and compound 48/80 (E, F) induce c-fos expression on the lateral side of the superficial lamina of the dorsal horn of cervical spinal cord. Nalfurafine inhibits c- fos expression induced by GNTI (I, J) and compound 48/80 (K, L). Injection of nalfurafine does not evoke c-fos expressin (G, H). (Scale bars: for A, C, E, G, I and K 100 µm; for B, D, F, H, J and L 25 µm).

80 40 # # * * 35 S.E.M.

30 # # 25 * * 20

15 * * * * 10

5 Mean number of c-fos positive nuclei + nuclei of c-fos number positive Mean 0 e e lin a line 0 rafine s a 8 u e salin+ s + lf + TI a + lin nalfurafine N nalfurafine a + line + n s a G s GNTI

comp. 48/ comp. 48/80

Fig. 32. The number of c-fos positive nuclei was counted and averaged from 10 randomly chosen cervical sections for each animal in each group (n=6) (**p<0.01 represents significance compared to saline-saline and nalfurafine-saline, ##p<0.01 represents significance between saline-GNTI and nalfurafine-GNTI, as well as saline-compound 48/80 and nalfurafine-compound 48/80).

81

Fig. 33. A representative picture of mRNA of β-actin and c-fos bands in cervical spinal cord of mice (n=6) injected with either saline or GNTI (0.3 mg/kg).

600 ***

500

400

300 level (% of control)

200

100 c-fos mRNA

0 saline GNTI

Fig. 34. GNTI significantly increases c-fos mRNA level in cervical spinal cord compared to saline (***p<0.001, Student’s t-test) (n=6 mice).

Similarly, c-fos expression was observed on the lateral side of the dorsal horn in anesthetized mice injected with GNTI (Fig. 35). The animals did not move or scratch during the 2 h period. Also, GNTI-provokes c-fos expression in the lateral side of the superficial layer of the dorsal horn in mice wearing an Elizabethan collar suggesting that

GNTI-induced c-fos activation is a result of itch sensation (Fig. 36).

82

Fig. 35. A representative picture of c-fos expression induced by GNTI in mice (n=2) anesthetized with urethane before GNTI injection. Localization of c-fos expressing neurons in urethane anesthetized mice is similar to the localization of c-fos expressing neurons in awake animals (Scale bar for A is 50 µm and for B is 25 µm).

Fig. 36. GNTI-provokes c-fos expression in the lateral side of the superficial layer of the dorsal horn in mice wearing an Elizabethan collar suggesting that GNTI-induced c-fos activation is a result of itch sensation (scale bars: A, B and C 100 µm; D, E and F 50 µm). 83 Neither H1 Nor H4 Receptor Antagonists Inhibit GNTI-Induced Scratching

Pretreatment (p.o. at -45 min) with either H1 receptor antagonist, fexofenadine

HCl (20-60 mg/kg) or H4 receptor antagonist, JNJ 10191584 (10-60 mg/kg) had no significant effect on GNTI-induced scratching (Figs 37 and 38).

600

500 in 30 min

400 S.E.M.

300 atches + atches

200

100 Mean number of scr number Mean 0 Vehicle Fexof (20) Fexof (40) Fexof (60) + + + + GNTI GNTI GNTI GNTI

Fig. 37. Mice preated with either vehicle or fexofenadine HCl and then, challenged with GNTI. Fexofenadine did not antagonize GNTI-induced scratching (n=8).

84 600

500

S.400 n i E.M. 30 min es + es 300

200

100 Mean number of scratch number Mean 0 vehicle JNJ (10) JNJ (30) JNJ (60) + + + + GNTI GNTI GNTI GNTI

Fig. 38. Pretreating mice (n=8) with JNJ 10191584 has no significant effect on GNTI-induced scratching.

85 Effects of GRP on Scratching Induced by GNTI

Ir GRP is detected in skin, DRG and spinal cord sections

Ir GRP positive nerve fibers were detected in skin sections (Fig. 39). GRP is expressed in DRG medium and small sized cell bodies as well as cell processors in the superficial layer of the dorsal horn of the cervical spinal cord (Fig. 40).

Fig. 39. A representative picture of GRP positive nerve fiber in epidermal and dermal layers of skin (Scale A: 250, B: 100 and C: 50 µm)

86

Fig. 40. GRP immunoreactive small and medium sized DRG cells are shown (A). GRP positive nerve fibres are located in the superficial layer of the dorsal horn of the cervical spinal cord (B) (Scale for A and B: 100 µm).

GRP positive nerve fibers are around the c-fos expressed neurons in the dorsal horn of

mice treated with GNTI

As shown in Figure 41, c-fos expressing neurons are detected in the same area of

the dorsal horn (on the lateral side of the superficial layer of the dorsal horn, c-fos

positive nuclei are green). GRP positive nerve fibers are localized in the superficial layer

of the dorsal horn as expected (shown as red). When images are merged, GRP positive

nerve fibers were found near the c-fos expressing neurons in sections obtained from mice

treated with GNTI. However, c-fos positive nuclei were not observed in mice injected

with saline. GRP ir in the dorsal horn was similar in mice injected with saline in mice

injected with GNTI (Fig. 41).

87

c-fos GRP merged

saline

GNTI

Fig. 41. Ir GRP nerve fibers are near c-fos expressing neurons in response to GNTI- induced scratching (Scale for top two rows is 40 µm and for bottom row is 20 µm).

88 GRP mRNA Level does not Change with GNTI Treatment or with Nalfurafine

Pretreatment

The GRP mRNA level (presented as % of control) in the cervical spinal cord did not change in mice treated with either GNTI or pretreated with nalfurafine (Fig. 42a). β- actin bands and GRP bands (136 bp) were observed and were similar in four treatment groups (saline-saline, saline-GNTI, nalfurafine-saline and nalfurafine-GNTI). A representative picture of the bands is shown in Figure 42b. a) b)

140

120

100

80

60

40 GRP mRNA level (% of control) 20

0 saline saline nalfurafine nalfurafine

+ + + + saline GNTI saline GNTI

Fig.42. a) GRP mRNA levels in the cervical spinal cord were similar in mice (n=8) injected with saline-saline, saline-GNTI, nalfurafine-saline and nalfurafine-GNTI (One- way ANOVA followed by Newman-Keuls). b) A representative picture of β-actin mRNA and GRP mRNA bands from mice is shown on the right.

89 GRPR antagonists RC-3095 or [D-Phe6]bombesin(6-13) methyl ester do not attenuate

GNTI-induced scratching behavior

Pretreating mice with RC-3095 (10 or 30 mg/kg) had no marked effect against

GNTI (0.3 mg/kg)-induced scratching behavior (Fig. 43a). The number of scratches in 30 min was similar in mice pretreated with vehicle and in mice pretreated with RC-3095.

Pretreating mice with [D-Phe6]bombesin(6-13) methyl ester (2-100 nmoles, i.t.) 10 min before GNTI (0.3 mg/kg) also did not markedly reduce scratching induced by GNTI (Fig.

44).

700

600

500 S.E.M. in 30 min

400

300

200

100

Mean numberMean of scratches+ 0 Saline RC-3095 (10) RC-3095 (30) + + + GNTI (0.3) GNTI (0.3) GNTI (0.3)

Fig. 43a. Mice were injected with either saline or RC-3095 and 15 min later challenged with GNTI (0.3 mg/kg). RC-3095 did not markedly affect GNTI- induced scratching behavior.

Pretreating mice with RC-3095 (10 mg/kg) inhibited GRP18-27-induced scratching in mice (Fig. 43b, U(12)=8.00, p<0.05).

90 100

in 30 min 80 S.E.M. 60 *

40 f s

20 ean number o cratches+ M 0 Saline (s.c.) RC-3095 + (10 mg/kg, s.c.) GRP + 18-27 GRP (2 nmoles/5 μl, i.t.) 18-27 (2 nmoles/5 μl, i.t.)

Fig. 43b. Mice (n=7) were injected with either saline or RC-3095 (10 mg/kg) and 15 min later administered GRP18-27 (i.t., 2nmoles/5 µl). Pretreating mice with RC-3095 attenuated significantly GRP18-27-induced scratching (p<0.05, Mann Whitney U test).

91 500

450 S.E.M. 400

350

300

250

200

150

100

50 Mean + number of scratches in 30 min Mean 0 _ Saline (i.t., 5 μl) _ _ _ (s.c. ) Antagonist _ 2 20 50 100 100 (nmoles/5 μl, i.t.) _ GNTI 0.3 0.3 0.3 0.3 0.3 (mg/kg, s.c.)

Fig. 44. Mice were pretreated i.t. with either saline (5 µl) or the peptide GRPR antagonist [D-Phe6]bombesin(6-13) methyl ester (2-100 nmoles/5 µl). Ten min later, they were administered s.c. either saline or GNTI (0.3 mg/kg). [D-Phe6]bombesin(6-13) methyl ester did not significantly attenuate GNTI- elicited scratching.

92 [D-Phe6]bombesin(6-13) methyl ester inhibited scratching induced by the GRP

receptor agonist GRP18-27 in mice (Fig 45, U(14)= 6.00; p<0.01). Immediately after

GRP18-27 injection, mice in both groups started body grooming and licking of the tail.

Scratching behavior was observed for about 10-15 min after the injection. We conducted

another set of experiments to examine if [D-Phe6]bombesin(6-13) methyl ester inhibits

GRP18-27-induced grooming behavior. Mice were pretreated (i.t.) with either saline (5 µl)

or [D-Phe6]bombesin(6-13) methyl ester (2 nmoles/5 µl) and then 10 min later with either saline (i.t., 5 µl) or GRP18-27 (i.t., 2 nmoles/5 µl). Upon injection, mice were placed into

the observation boxes and observed for specifically grooming behavior for 20 min. Using

a stopwatch, the time spent grooming and tail licking was recorded. Mice treated with

GRP18-27 significantly induced grooming behavior compared to mice injected with saline

(F [2, 21] = 7.04; p<0.01). [D-Phe6]bombesin(6-13) methyl ester did not affect grooming

behavior induced by GRP18-27 (Fig 46).

93 250

200 E.M. 30 mi S. in n 150 ch

100 * *

50 Mean number of scratMean + es 0 Saline (5 μl, i.t.) Antagonist + (2 nmoles/5 μl, i.t.) GRP 18-27 + GRP (2 nmoles/5 μl, i.t.) 18-27 (2 nmoles/5 μl, i.t.)

Fig. 45. Mice (n=8-10) were injected with either saline (i.t.) or [D-Phe6]bombesin(6-13) (i.t., 2 nmoles) and then 10 min later, they were challenged with GRP18-27 (i.t., 2 nmoles). Pretreating mice with 6 [D-Phe ]bombesin(6-13) methyl ester attenuated significantly GRP18-27-induced scratching (p<0.01, Mann Whitney U test).

94 1100

1000

900

800

S.E.M. in 20 min in 20 S.E.M. 700

600

500

400

300 * * 200

100 Mean time spent grooming + grooming time spent Mean 0 Saline (5 μl, i.t.) Saline (5 μl, i.t.) Antagonist + + (2 nmoles/5 μl, i.t.) Saline (5 μl, i.t.) GRP 18-27 + GRP (2 nmoles/5 μl, i.t.) 18-27 (2 nmoles/5 μl, i.t.)

Fig. 46. Mice (n=6-7) were pretreated with either saline (i.t.) or [D-Phe6]bombesin(6-13) methyl ester (i.t., 2 nmoles) and then 10 min later, the animals were injected with either saline or GRP18-27 (i.t., 2 nmoles). Mice treated with GRP18-27 groomed significantly more often than mice treated with saline (F [2, 21] = 7.04, p<0.01, ANOVA followed by Newman-Keuls test). Pretreating mice with [D-Phe6]bombesin(6-13) methyl ester did not affect GRP18-27-induced grooming behavior.

95 Effects of M1 Receptor Ligands on GNTI-Induced Scratching

Telenzepine does not inhibit scratching elicited by GNTI

Pretreating (at -30 min) mice with telenzepine (1-30 mg/kg) did not decrease the number of scratches induced by GNTI as shown in Figure 47.

600

500

400 S.E.M. in 30 min + s

300

200

100 an number of scratche an Me 0 Saline Tel (1) Tel (3) Tel (10) Tel (30) + + + + + GNTI GNTI GNTI GNTI GNTI

Fig. 47. Mice (n=8) were pretreated with either saline (s.c.) or telenzepine (s.c., 1-30 mg/kg) and 30 min later, they were challenged with GNTI (s.c., behind the neck, 0.3 mg/kg). Pretreating mice with telenzepine had no marked effect on GNTI-induced scratching.

McN-A-343 suppresses GNTI-induced scratching in a dose-dependent manner

Injection of McN-A-343 (1.5-15 µg) before GNTI administration significantly

decreased scratching behavior induced by GNTI. Figure 48 shows a time-course anti-

scratch effect of McN-A-343 and figure 49 shows the cumulative number for scratches

96 over 30 min (F [3, 32] = 16.06; *p<0.05 and **p<0.01 represent significance compared

to saline group; ##p<0.01 represents significance McN-A-343 15 µg compared to 1.5 and

5 µg).

We measured locomotor activity using the highest dose of McN-A-343 to

establish if anti-scratch activity of McN-A-343 is a consequence of behavioral depression.

Figure 50 clearly shows that the suppressing effect of McN-A-343 is not due to

behavioral depression.

160 saline (5 μl, i.t.) + GNTI (0.3 mg/kg, s.c.) McN-A-343 (1.5 μg/ 5 μl, i.t.) + GNTI McN-A-343 (5 μg/ 5 μl, i.t.) + GNTI S.E.M. 140 McN-A-343 (15 μg/ 5 μl, i.t.) + GNTI

120

100 * 80 * * * 60 * * * * 40 ber of scratches in 5 min bouts + bouts 5 min scratches in of ber # # 20 * * # # * * * * *# #* * * # # *# #*

Mean num Mean 0 5 1015202530 Time (min)

Fig. 48. Time course of McN-A-343 on GNTI-induced scratching. Mice (n=8-10) were pretreated i.t. with either saline or McN-A-343 (1.5-15 µg) and then injected with GNTI. (*p<0.05, **p<0.01 represent significance compared to saline group; ##p<0.01 represents McN-A-343 15 µg compared to McN-A-343 1.5 and 5 µg) (Two way-ANOVA followed by Newman-Keuls test).

97 800

700 S.E.M.

600 * 500 * *

tch400+ min 30

300 # # * * 200 nu 100 Meanof scra mber in es 0 Saline McN-A-343 (1.5) McN-A-343 (5) McN-A-343 (15) + + + + GNTI GNTI GNTI GNTI

Fig. 49. The cumulative number of scratches induced by GNTI (0.3 mg/kg) over 30 min. Pretreating mice with McN-A-343 significantly attenuated GNTI-elicited scratching (F [3, 32] = 16.06,*p<0.05 and **p<0.01 represent significance compared to saline group; ##p<0.01 represents significance McN-A-343 15 µg compared to 1.5 and 5 µg) (One way-ANOVA followed by Newman-Keuls test).

2400 2200 2000 1800 1600 S.E.M. 1400 1200 1000 800 600 Mean total activity + activity total Mean 400 200 0 Saline McN-A-343

(5 μl, i.t.) (15 μg/ 5 μl, i.t.)

Fig. 50. McN-A-343 (15 µg, i.t.) does not affect locomotion suggesting that the anti- scratch activity of McN-A-343 in mice is not a result of behavioral depression.

98 Part II

Inhibitory Effect of Lidocaine on Pain and Itch

Lidocaine antagonizes formalin-induced nociception

Mice pretreated with saline and then challenged with formalin produced a typical biphasic licking response (Murray et al., 1988; Choi et al., 2001), whereas mice

challenged with saline rarely licked their paws. Pretreating animals with lidocaine

antagonized significantly (F [3, 39] = 9.67; p<0.001) formalin-induced licking in the first

phase of the test. Licking in the second phase was also diminished by lidocaine but not to

a statistically significant extent (Fig. 51).

Lidocaine antagonizes GNTI-induced scratching

Mice pretreated with saline and then injected with GNTI scratched 595 ± 71 times

in 30 min. Pretreating mice with lidocaine significantly antagonized this excessive

scratching (64 ± 34), (F [3, 24] = 61.53; p<0.001) (Fig. 52). Mice pretreated with either

saline or lidocaine and then challenged with saline did not scratch.

Lidocaine has no marked effect on locomotion

Locomotor activities of saline-injected and lidocaine-injected mice were similar

(Fig. 53), suggesting that lidocaine caused no marked behavioral depression.

Lidocaine prevents pain-evoked c-fos expression

A representative picture of c-fos positive neurons activated by a pain stimulus and inhibition of activation of these neurons by lidocaine pretreatment is shown in Figure 54.

Formalin induced an increase in c-fos expression on the medial side of the superficial and

deeper layers of the dorsal horn of the lumbar spinal cord in mice pretreated with saline.

C-fos expression was not observed in sections obtained from mice pretreated with saline 99 and then injected with saline. Similarly, no c-fos activation was detected in sections from

mice pretreated with lidocaine and then challenged with saline (picture not shown).

Pretreating animals with lidocaine significantly reduced the number of c-fos positive nuclei induced by formalin (Fig. 56) (t (10) = 3.29; P<0.001).

Lidocaine reduces itch-evoked c-fos expression

A representative picture of c-fos positive nuclei activated by an itch stimulus and

prevention of activation of these neurons by lidocaine pretreatment is shown in Figure 55.

C-fos positive nuclei were detected on the lateral side of the superficial lamina of the

dorsal horn of the cervical spinal cord in mice treated with saline followed by GNTI. The

number of c-fos positive nuclei induced by an itch stimulus significantly decreased in

mice pr etreated with lidocaine (Fig. 56) (t (10)= 8.35; P<0.001).

100 200 saline (i.d.) + saline (i.paw) # # # 180 lidocaine (i.d.) + saline (i.paw)

E saline (i.d.) + formalin (i.paw) lidocaine (i.d) + formalin (i.paw)

S. .M. 160

c 140 120 # # # * * * 100 licking (se+ )

nt 80

60 i 40

20 Mean tspe me

0 0-10 min 20-35 min

Fig. 51. Mice (n=10) were pretreated with either saline or lidocaine (i.d., hind leg at -10 min) and then injected with either saline or 5% formalin solution (s.c., i.paw). The time spent licking the injected paw was measured using a stop watch for 0-10 min and 20-35 min. Formalin induced licking behavior during both phases compared to saline (###P<0.001). Paw licking was significantly decreased (***P<0.001) in mice pretreated with lidocaine (i.d.) compared to mice pretreated with saline over 0-10 min, but not over 20-35 min (i.paw; intrapaw). (One way ANOVA followed by Newman-Keuls test).

101 700 saline (i.d.) + saline (s.c.) saline (i.d.) + GNTI (s.c.) lidocaine (i.d.) + saline (s.c.) 600 lidocaine (i.d.) + GNTI (s.c.)

500 S.E.M. in 30 min

400

300

200

100 * * * * * * * * * Mean number of scratches+ 0

Fig. 52. Mice (n=8) were injected (i.d., behind the neck) with either saline or lidocaine and then, 10 min later, they were administered (s.c., behind the neck) either saline or GNTI (0.3 mg/kg). The number of scratches was counted for 30 min. Mice injected with saline then GNTI scratched significantly more often than mice injected with saline then saline (P<0.001). Pretreating mice with lidocaine significantly inhibited scratching behavior elicited by GNTI (***P<0.001). (One way ANOVA followed by Newman- Keuls test).

102 2500

S.E.M. 2000

1500

1000

500 Mean total distance traveled (cm) traveled + distance total Mean 0 saline (i.d.) 2% lidocaine (i.d.)

Fig. 53. Lidocaine has no marked effect on spontaneous locomotion. Distance traveled in 30 min in mice (n=8) injected with lidocaine was similar to that in mice given saline (Student’s t-test) .

103

Fig. 54. Mice (n=6) were pretreated with either saline or lidocaine (i.d., hind leg) and then treated with either saline or 5% formalin (s.c., i.paw). C-fos positive nuclei were detected on the medial side of the superficial and deeper layers of the dorsal horn of the mice treated with formalin. Markedly fewer c-fos expressed nuclei were observed in the lumbar spinal cord sections obtained from mice pretreated with lidocaine compared to mice pretreated with saline (scale bars: for A, C and E 100 µm; B, D and F 50 µm). (i.paw; intrapaw).

104

Fig. 55. Mice (n=6) were injected with either saline or lidocaine (i.d., behind the neck) and 10 min later they were administered either saline or GNTI (0.3 mg/kg, s.c., behind the neck). C-fos positive nuclei were localized on the lateral side of the superficial layer of the dorsal horn in mice injected with saline and GNTI. Markedly fewer c-fos expressed nuclei were observed in cervical spinal cord sections obtained from mice pretreated with lidocaine compared to mice pretreated with saline (scale bars: A, C and E 100 µm; B, D and F 50 µm).

105 35 *** ***

S.E.M. 30

25

20

15

10

5 Mean number of c-fos positive nuclei + nuclei c-fos number positive of Mean 0 saline lidocaine saline lidocaine

+ + GNTI formalin

Fig. 56. The number of c-fos positive nuclei was counted and averaged from 10 randomly chosen cervical (for scratch) and lumbar (for nociception) sections from each animal in each group (saline + GNTI; lidocaine + GNTI; saline + formalin and lidocaine + formalin, n=6). Lidocaine administration before either GNTI or formalin significantly decreased the number of c-fos positive nuclei (***P<0.001, Student’s t-test).

106 Application of pain and itch stimuli to the same site

GNTI induces only an itch sensation

Mice given saline did not wipe or scratch the injected cheek. Animals injected with formalin wiped with the ipsilateral forelimb (F [2, 23] = 21.97; p<0.01).

Administration of GNTI induced scratching and grooming but not wiping (F [2, 23] =

3.49); p<0.05, Fig. 57).

C-fos expression in the brainstem following formalin or GNTI

Formalin induced c-fos expression in the superficial layer of the dorsal horn of the junction sections between the cervical spinal cord and medulla. However, c-fos expression was not observed in sections obtained from mice injected with saline or GNTI

(Fig. 58). Similarly, only formalin provoked c-fos expression in the trigeminal nucleus

(Fig. 59) (Paxinos and Franklin, 2001, Fig. 93). Both formalin and GNTI elicited c-fos

expression in the periaquaductal grey (PAG); dorsal and intermediate nucleus of the

lateral lemniscus (DLL, ILL); peritrigeminal zone (P5) and motor trigeminal nucleus

(Mo5); medial lemniscus (ml); longitudinal fasiculus of pons (lfp) and nucleus of

trapezoid body (Tz). Figure 60 shows a schematic diagram representative of c-fos

expression induced by formalin and GNTI (modified from Paxinos and Franklin, 2001,

Fig. 71). Saline did not evoke c-fos expression (Fig. 59). A representative picture of c-fos

expression in the PAG area is shown in figure 61. Additionally, both GNTI and formalin

induced c-fos expression in the central (LPBC) and external (LPBE) areas of the lateral

parabrachial nucleus. Saline did not provoke c-fos expression in these areas (Fig. 62)

(Paxinos and Franklin, 2001, Fig. 73). Since we aimed to investigate whether itch and

pain sensations follow the same pathway when both stimuli are applied, separately, but to

107 the same area, we used only 3 mice (would be enough for neuroanatomical localization) for each group for brain stem sections and did not obtain quantitative data.

40 wiping scratching # # min 35 grooming in 10

.30

25 S.E.M

20

of + bouts 15

10 *

ean number 5 M

0 Saline Formalin GNTI

Fig. 57. GNTI injection (s.c.) to the right cheek of mice induced grooming (*p<0.05 compared to saline and formalin) and scratching to the injected side. Wiping behavior was not observed. Formalin elicited wiping (# #p<0.01 compared to saline and GNTI).

108

Fig. 58. Representative pictures of c-fos expression in sections, from the junction of cervical spinal cord and medulla, obtained from mice given saline, formalin and GNTI, respectively. Formalin induced c-fos expression in the superficial layer of the dorsal horn (n=3) (Scale: 250 and 50 µm) .

109

Fig. 59. Representative pictures of c-fos expression in brain stem sections of mice injected with saline, formalin and GNTI. C-fos expressed nuclei were observed in trigeminal nucleus in sections obtained from mice injected with formalin (n=3) (AP: area postrema; CC: central canal, 12N: 12th cranial nerve (hypoglossal), Paxinos and Franklin, Fig. 93) (Scale: 250 and 50 µm).

110

Fig. 60. A schematic representation of c-fos expression evoked by GNTI-induced itch and formalin-induced nociception in the higher level of the mid brain (DMPAG: dorsomedial periaqueductal gray; DLPAG: dorsolateral periaqueductal gray; LPAG: lateral periaqueductal gray; VLPAG: ventrolateral periaqueductal gray; DRD; dorsal raphe nucleus, dorsal part; DLL: dorsal nucleus of lateral lemniscus; ILL: intermediate nucleus of lateral lemniscus; P5: peritrigeminal zone; Mo5: motor trigeminal nucleus; LVPO: lateroventral periolivary nucleus; MVPO: medioventral periolivary nucleus; Tz: nucleus of trapezoid body; ml: medial lemniscus; lfp: longitudinal fasciculus of pons (modified from Paxinos and Franklin, 2001, Fig. 71).

111

Fig.61. A representative picture of c-fos expression in the PAG area in sections obtained from mice injected with saline, formalin and GNTI (Scale: 250 and 100 µm).

112

Fig. 62. A representative photomicrograph of c-fos expression induced by GNTI and formalin in the parabrachial area of pons (LPBC: lateral parabrachial nucleus, central; LPBE: lateral parabrachial nucleus, external; LDTgV: laterodorsal tegmental nucleus, ventral) (Paxinos and Franklin, 2001, Fig. 73) (Scale: 100 and 50 µm).

113 CHAPTER 4

DISCUSSION

GNTI is a useful pharmacological compound for investigating itch

GNTI has scratch-inducing activity in a dose-dependent manner in mice, as does

norBNI. GNTI is a potent pruritogen that induces vigorous and compulsive scratching

behavior in this species. This effect was observed only when GNTI was administered

behind the neck of mice. I.p. or i.t. injection of GNTI did not induce scratching behavior.

The scratch-inducing effect of GNTI lasts for about an h and tolerance did not develop to

this behavior. Kamei and Nagase (2001) reported that the scratch-inducing activity of

norBNI lasts about 90 min.

Nalfurafine Attenuates GNTI-Induced Scratching

Pharmacology of nalfurafine, a kappa opioid receptor agonist

Nalfurafine is 17-cyclopropylmethyl-3,14β-dihydroxy-4,5α-epoxy-6β-[N-methyl-

trans-3-(3-furyl)acrylamido]morphinan hydrochloride. It was called TRK-820 when

synthesized by Nagase and his colleagues at Toray Industries in Japan in 1998 (Nagase et

al., 1998) (Fig. 63).

114

Fig. 63. Chemical structure of nalfurafine (TRK-820).

Nalfurafine is different from prototypical kappa opioid agonists such as U50,488 by having a 4,5-epoxymorphinan structure with a tyrosine-glycine moiety. Nagase et al.

(1998) reported that nalfurafine is a highly selective and highly potent kappa ligand in in vitro preparations of guinea-pig ileum and mouse vas deferens. Using mouse acetic acid writhing and tail-flick assays, Nagase and his colleagues (1998) showed that nalfurafine is 85-140 times more potent than morphine and 85-350 times more potent than U50,488H as an antinociceptive agent. Using CHO cells expressing human mu, delta and kappa

receptors in radioligand binding as well as inhibition of forskolin-stimulated cAMP

assays, Seki et al. (1999) and Wang et al. (2005) showed that nalfurafine is a full agonist on kappa receptors and a partial agonist on mu opioid receptors.

Analgesic activity for nalfurafine was established in mice, rats, and monkeys

(Endoh et al., 1999; 2000; 2001). Other effects of nalfurafine were reported by Tsuji et al.

(2000) and Mori et al. (2002). Nalfurafine dose-dependently suppressed naloxone- precipitated signs of physical dependence on morphine in mice and low doses of

115 nalfurafine attenuated cocaine-induced place preference (CPP) in rats, respectively,

suggesting a possible target for drug dependence. Nalfurafine by itself caused no aversion

or preference in the CPP test. Also, nalfurafine inhibited icilin-induced wet-dog shaking

as well as icilin-induced glutamate release in the dorsal striatum of rats (Werkheiser et al.,

2006, 2007).

Recently, Yoshikawa et al. (2009) reported that nalfurafine inhibits

phencyclidine-induced stereotyped behaviors (head-weaving, sniffing, rotation; a model

for schizophrenia) and causes dopamine and serotonin level changes in the prefrontal

cortex in rats. An interesting finding was reported lately by Ikeda et al. (2009). Using a hemi-parkinsonian disease model via one side injection of 6-hydroxydopamine (6-

OHDA) into rat striatum, they found that, first, one injection of nalfurafine to these rats

increases spontaneous ipsilateral rotational behavior, and second, nalfurafine attenuates

dyskinesia induced by L-3,4-dihydroxyphenylalanine (L-DOPA) treatment over three

weeks in parkinsonian rats. Dopamine levels measured via in vivo microdialysis also

showed a correlation with the behavioral data. Injection of L-DOPA increased striatal

dopamine levels and one injection of nalfurafine reduced dopamine levels induced by L-

DOPA. According to these results, it was concluded that nalfurafine may be a useful

agent to relieve dyskinesia in patients with Parkinson’s disease.

Anti-scratching activity of nalfurafine was shown, for the first time, by Togashi et

al. (2002) against substance P- and histamine-induced scratching in mice. Further studies

using animal models of scratching showed that nalfurafine was also active against

scratching induced by chloroquine (an antimalarial agent) (Inan and Cowan, 2004),

compound 48/80 (Wang et al., 2005) and agmatine (Inan and Cowan, 2006a) in mice;

116 scratching secondary to cholestasis in rats (Inan and Cowan, 2006b); and intravenous and

i.t. administered morphine in monkeys (Wakasa et al., 2004; Ko and Husbands, 2009).

Nalfurafine is not only different from prototypical kappa opioid agonists by its chemical structure but also in having been tested in human clinical trials. Antipruritic activity of nalfurafine in humans was shown, for the first time, in patients suffering from pruritus due to chronic renal failure in a multicenter, randomized, double-blind, placebo- controlled clinical trial (Wikström et al., 2005). Oral caplets of nalfurafine (2.5, 5, and 10

µg; Toray Industries) were approved by the Japanese Ministry of Health in 2009.

Recently, oral nalfurafine caplets were undergoing a Phase II clinical trial for pruritus in cholestatic liver disease in the USA (ClinicalTrialsgov, NCT00638495).

GNTI elicits intense scratching in mice. We found that this scratching is inhibited by over 80% when the mice are pretreated with nalfurafine (0.02 and 0.03 mg/kg).

Importantly, administering the same doses of nalfurafine after scratching has started still

decreased the stereotyped behavior by 50%, a finding of direct relevance for clinical

dermatology. Additionally, the antiscratch activity of nalfurafine is not due to behavioral

depression. Our standard dose of nalfurafine (0.02 mg/kg) did not markedly affect

locomotor activity. Previously, Suzuki et al. (2004) reported, in agreement with our

results, that behavioral depression was associated only with a higher dose of nalfurafine

(0.04 mg/kg) on wheel running in mice.

The repeated administration of opioids often causes tolerance to the agonist effect being measured. Efficacy of the compound is decreased over time. In our study, the subchronic injection of nalfurafine did not diminish the anti-scratch activity. This result is potentially important regarding the clinical development of nalfurafine as an antipruritic.

117 Kamei and Nagase (2001) also reported that U50,488, which is a kappa opioid receptor agonist, inhibits norBNI-induced scratching in mice. Furthermore, Cowan and

Kehner (1997) showed that both enadoline and asimadoline, selective kappa opioid receptor agonists, attenuated scratching induced by compound 48/80 in mice. Previous results and our results indicate that kappa opioid agonists are a key target for antipruritic drug development.

Nalfurafine prevents GNTI- and compound 48/80-induced c-fos expression in the

cervical spinal cord of mice

Our results show that GNTI and compound 48/80 induce c-fos expression in the lateral part of the superficial layer of the dorsal horn of the spinal cord suggesting that both compounds activate a group of sensory neurons located on the lateral side of lamina I and II. Nakano et al. (2008) reported that histamine, SLIGRL-NH2 (protease- activated receptor-2 agonist), as well as mosquito allergen, provoke c-fos expression in different neurons in the dorsal horn of lamina II. While histamine activated neurons towards the inner side of lamina II, SLIGRL-NH2 and mosquito allergen activated neurons are located more towards the outer side of the dorsal horn of lamina II. Similar to our results, stimulation of the group of neurons located on the lateral side of the superficial layer of the dorsal horn was also associated with serotonin- (Nojima et al.,

2003a) and dry skin- (Nojima et al., 2003b) induced scratching in rats. These results suggest that different pruritogens stimulate different neuron groups in the dorsal horn.

GNTI injection to mice anesthetized with urethane also induced c-fos expression in the lateral side of the dorsal horn. A few c-fos positive nuclei were observed in anesthetized

118 animal s in comparison to awake animals. However, it should be noted that Buritova and

Besson (2001) reported that pretreatment with urethane significantly reduced (70%) the

number of c-fos positive nuclei associated with the intraplantar injection of carrageenan

in rats. Also, administration of urethane before cocaine blocked c-fos expression induced

by cocaine in rat striatum (Kreuter et al., 2004). In our experiment, urethane reduced c-

fos expression induced by GNTI. However, GNTI still evoked c-fos expression on the lateral side of the superficial layer of the dorsal horn. The demonstration of c-fos immunoreactivity in mice wearing an Elizabethian collar indicates that c-fos activation is a consequence of itch sensation induced by GNTI.

We report here for the first time that nalfurafine, a kappa opioid receptor agonist with antiscratch activity against several chemically diverse pruritogens, inhibits c-fos expression elicited by both GNTI and compound 48/80 in mice. Our data show that nalfurafine attenuates scratching behavior and prevents neuronal activation by both pruritogens. Our c-fos results suggest that the potential antipruritic activity of nalfurafine potentially occurs at the spinal level.

To our knowledge, nalfurafine is the first clinically tested antipruritic to demonstrate an acute inhibitory effect at the neuronal level. Chronic daily injection of

olopatadine (an antihistamine used clinically for allergic rhinitis and eczema) to mice

suppressed both scratching and spinal c-fos expression induced by contact dermatitis due

to repeated application of diphenylcyclopropenone (Hamada et al., 2006). Naltrexone has

been studied for antiscratch activity along with inhibition of c-fos immunoreactivity

elicited by serotonin in rats (Nojima et al., 2003b). Pretreatment with naltrexone inhibited

119 scratching behavior but this opioid antagonist had no marked effect on c-fos expression induced by serotonin.

Scratch-Inducing Effect of GNTI is not through Opioid Receptors

GNTI was active both in mice pretreated with either naloxone or norBNI as well

as in mice lacking mu, delta or kappa opioid receptors. Naloxone is a non-selective

opioid antagonist and blocks µ, δ, and κ opioid receptors with different potencies. At

very low doses (0.05-0.2 mg/kg) µ opioid receptors (Ankier, 1974); at moderate doses

(0.05-1 mg/kg) δ opioid receptors (Cowan et al., 1986) and at higher doses (3 mg/kg and

up) κ opioid receptors (Vonvoigtlander et al., 1983) are antagonized by naloxone. In our

experiment, pretreating mice with 3 mg/kg of naloxone, which is a dose that is sufficient

to antagonize all three opioid receptors, did not attenuate GNTI-induced scratching.

NorBNI (10-20 mg/kg, s.c. or i.p.) selectively blocks kappa opioid receptors 18-

20 h after its administration (Sofuoglu et al., 1992). We injected GNTI 20 h after norBNI

administration. The mice pretreated with norBNI scratched to a similar extent as mice

pretreated with saline. Therefore, overall, these results suggest that scratch-inducing

activity of GNTI is not through opioid receptors.

120 H1 and H4 Histamine Receptors are not Involved in GNTI-Induced Scratching

Pretreating mice with either the H1 receptor antagonist, fexofenadine, or the H4

receptor antagonist, JNJ 10191584, did not attenuate GNTI-induced scratching. In contrast, norBNI-induced scratching was significantly diminished in response to

pretreatment with chlorpheniramine (0.3-3 mg/kg, p.o.), an H1 receptor antagonist

(Kamei and Nagase, 2001). These workers also administered chlorpheniramine against

compound 48/80-induced scratching and reported antagonism which suggests that

norBNI induces scratching by releasing histamine from mast cells.

Yamaura et al. (2009) treated mice with either fexofenadine (30 and 150 mg/kg,

p.o) or JNJ 7777120 (3-30 mg/kg, p.o.), a selective H4 receptor antagonist, before

histamine or SP. While fexofenadine only antagonized histamine-induced scratching by

30%, JNJ 7777120 inhibited scratching induced by both histamine and SP by 63% and

46%, respectively. In our experiments, mice received fexofenadine p.o. and in the dose

range (20-60 mg/kg) that Yamaura et al. (2009) administered. If GNTI causes scratching

by releasing histamine from mast cells, we would have observed a decrease in scratching

behavior induced by GNTI. In our case, we used a different H4 receptor antagonist and

JNJ 10191584 which did not diminish scratches. Since JNJ 7777120 inhibited SP-

induced scratching, we may interprete that GNTI-elicited scratching is not via SP release

either.

121 GRPR does not Mediate GNTI-Induced Scratching

Despite Sun et al. (2009) describing GRPR as a common itch mediator, our

results show that GRPR is not involved in scratching elicited by GNTI in mice. First, antagonism of GRPRs did not have a remarkable effect on GNTI-induced scratching and second, injection of GNTI did not alter GRP mRNA levels.

In addition to [D-Phe6]bombesin(6-13) methyl ester, which is the GRPR

antagonist that Sun and Chen (2007) used in their experiments to inhibit compound

48/80-, PAR2 agonist- and chloroquine-induced scratching, we also pretreated mice with

another systemically injected GRPR antagonist, RC-3095. For i.t. administration of [D-

Phe6]bombesin(6-13) methyl ester, we followed the same protocol that Sun and Chen

(2007) used in their experiments. They pretreated mice with only one dose (2 nmoles) of

[D-Phe6]bombesin(6-13) methyl ester. We developed our dose-response starting with 2 nmoles and inceased the dose up to 100 nmoles. However, we did not observe any marked inhibition of scratching behavior elicited by GNTI. Sun and Chen (2007) also

6 reported that [D-Phe ]bombesin(6-13) methyl ester inhibits GRP18-27-induced scratching.

In our experiments, to be sure that [D-Phe6]bombesin(6-13) methyl ester is active and

blocks GRPRs, we additionally tried this compound against GRP18-27-induced scratching.

6 [D-Phe ]bombesin(6-13) methyl ester significantly diminished GRP18-27-elicited

scratching behavior. However, during our observations, we noticed that GRP18-27 causes

intense body grooming and tail licking in addition to scratching. Cowan et al. (1985) described the same behaviors after bombesin (i.t. or i.c.v.) injection and excessive grooming also is accepted as itch-related behavior. Interestingly, in our experiments, [D-

Phe6]bombesin(6-13) methyl ester only inhibited scratching behavior induced by

122 GRP18-27. Moody et al. (1988) reported that the peptidergic bombesin receptor antagonist,

spantide, reduces BN-induced grooming. However, another BN antagonist, ICI 216140,

did not antagonize this behavior (Cowan et al., 1990). Sun and Chen (2007) did not

mentioned if GRP18-27 causes body grooming or tail licking in mice and they only

monitored scratching. GNTI-induced scratching differs from GRPR agonist-induced scratching by having scratching as the main behavior and not having much body

grooming and tail licking.

RC-3095, a synthetic, well known GRPR antagonist was used in a clinical phase I

trial for treating solid malignancies in humans. Twenty five patients with solid

malignancy were treated daily with escalating doses of RC-3095. The results of this study

were not conclusive, however, no systemic toxicity was observed and only established

side effect was local discomfort at the injection side (Schwartsmann et al., 2006). This

compound was not only studied in animal models of cancer (Kiaris et al., 1999; Kang et

al., 2007) but also it was examined in animal models of neuropsychiatric disorders

(Meller et al., 2004), learning and anxiety (Martins et al., 2005) and sepsis (Dal-Pizzol et

al., 2006). Kiaris et al. (1999) reported that treating mice with RC-3095 inhibits the

growth of glioblastomas. Similarly, inhibition of angiogenesis and neuroblastoma growth

induced by bombesin in human neuroblastoma cell lines by RC-3095 was showed by

Kang et al. (2007). Meller et al. (2004) demonstrated that pretreating mice with RC-3095

attenuates apomorphine-induced stereotyped behavior (animal model of schizophrenic

psychosis). Administration of RC-3095 to mice impaired habituation to open field and

increased time spending in closed arms of plus maze (Martins et al., 2005). Dal-Pizzol et

al. (2006) reported that RC-3095 attenuates release of TNF-alpha, IL-beta and nitric

123 oxide from cultured macrophages as a consequence of sepsis induced by

lipopolysaccaride (LPS) injection as well as cecal ligation and puncture in mice. Also,

RC-3095 improved survival and diminished lung damage in mice with sepsis. Our study is the first one to examine the anti-scratch activity of RC-3095. We injected RC-3095 15 min before GNTI. Szepeshazi et al. (1997) reported that the peak level of RC-3095 in blood was detected at 15 min after s.c. injection to rats. The doses of RC-3095 in our experiments were chosen based upon previous behavioral study in mice by Meller et al.

2004. However, we found that pretreating mice with RC-3095 had no marked effect on

GNTI-induced scratching behavior. However, RC-3095 inhibited GRP agonist-induced

scratching in our experiment. Our results indicate that RC-3095 may be a good candidate

antipruritic for GRP mediated itch.

Another negative result for us was no change in GRP mRNA levels after GNTI

injection. We chose the 2 h period after GNTI injection to measure GRP mRNA levels in

the cervical spinal cord. Since animals begin to scratch a few minutes after GNTI

injection and the effect lasts for about 60-70 min, the 2 h time period was reasonable. We

did not come across any reported study that examines GRP mRNA levels for an acute

behavior. Ladenheim et al. (2009) reported an increase in GRP mRNA level 4 h after

melatonin II, a melanocortin 3/4 receptor agonist, and a decrease after 38 h food

deprivation in the hypothalamic paraventricular nucleus in rats. However, food intake is a

different behavior. Also, species and the area of interest are different.

Previously, GRPR immunoreactivity (ir) was detected in isocortex, hippocampal

formation, amygdala, hypothalamus (arcuate, periventricular, paraventricular, supraoptic,

and suprachiasmatic nuclei) and brain stem (Kamichi et al., 2005) as well as lamina I

124 layer of the dorsal horn of the spinal cord of mouse (Sun and Chen, 2007). Hypothalamus,

nucleus tractus solitarius, caudate, hypocampus, cingulate cortex (Moody et al., 1981) and superficial layer of the dorsal horn of the spinal cord as well as dorsal root ganglia

(Sun and Chen, 2007) are the areas rich in BN-like peptides. We have shown here, for the

first time, GRP positive nerve fibers in the epidermis and dermis of the skin of mice. Sun

and Chen (2007) showed that ir GRP positive nerve fibers, located on the superficial

layer of the dorsal horn of the spinal cord, were diminished after dorsal rhizotomy

suggesting that there are primary afferents for GRP. Our finding of GRP positive nerve

fibers in skin supports this result. These primary nerve endings may play a role in

transmission of itch sensation from the periphery to the spinal cord. Previously, Sun and

Chen (2007) showed that GRP positive neurons are colocalized with TRPV1 receptors in

the DRG of mouse and Imamachi et al. (2009) suggested that TRPV1 receptors are

required for transmission of histamine-induced itch sensation. It may be interpreted that

GRP positive nerve fibers conduct histamine-induced itch sensation to the dorsal horn of

the spinal cord via TRPV1 receptors.

In our double-staining study, GRP positive nerve fibers were located near the c-

fos positive nuclei activated in response to GNTI administration in the spinal cord

sections. However, it should be kept in mind that substance P positive nerve fibers in the

spinal cord are also located on lamina I and II of the dorsal horn and colocalized with

bombesin-like ir nerve terminals (Fuxe et al., 1983). SP exerts its effects on spinal cord

neurons primarily via NK-1 receptors and secondarily via NK-2 receptors. NK-1 receptor

immunoreactivity is densely localized to the middle part and lateral fourth of lamina I. In

lamina II, in the middle and medial part, and in lamina IV, mainly in the lateral part, there

125 is NK-1 receptor immunoreactivity (Polgár et al., 1999). In our results, the localization of

c-fos expressed neurons in response to GNTI administration is similar to the localization of NK-1 expressing neurons.

Role of M1 Receptor in GNTI-Induced Scratching

There are two pharmacologically distinguished acetylcholine receptors: nicotinic receptors which form an ion channel and the muscarinic receptors which act via G proteins and activate second messengers. Based on pharmacological and cloning studies, muscarinic receptors have been classified into five subtypes and named in chronological

order of their discovery as M1, M2, M3, M4 and M5 (Bonner, 1989). While M1, M3 and

M5 stimulate phosphatidyl-inositol pathway and stimulate cAMP, M2 and M4 inhibit

cAMP response. M2 and M3 are found more in smooth muscle tissues. All receptors are

distributed in the brain. While M1 is found mostly in the cortex, M2 is most abundant in

thalamus-hypothalamus and pontine-medullary ares. The M4 is found mainly in the

striatum, and M3 and M5 are expressed throughout the brain. Additionally, all five receptors have been reported in the spinal cord (Wei et al., 1994). Muscarinic Ach

receptors are concentrated in the superficial layers of the dorsal horn, especially in

laminae I and II.

We found that the selective M1 receptor agonist, McN-A-343 (4-3-clorophenyl-

carbamoyloxy-2-butynyltrimethyl-ammonium), inhibits GNTI-induced scratching in a

dose-dependent manner. Previously, it was reported that spinal muscarinic receptors play

a role in nociception and antinociception in mice. Pan et all. (1999) reported that the i.t.

clonidine-induced antiallodynic effect is abolished by pretreatment with the muscarininc

126 receptor antagonists, atropine and scopolamine, and is partially antagonized by the

nicotinic receptor antagonists, mecamylamine and hexametonium. Ghelardini et al.

(2000) showed that inactivation of the M1 gene by an antisense oligodeoxyribonucleotide

(i.c.v.) inhibits antinociception induced by the muscarinic receptor agonists,

oxotremorine and McN-A-343, in the hot plate test in mice. Honda et al. (2004) reported

that i.t. administration of atropine and pirenzepine (a M1/M4 receptor antagonist) inhibit

morphine-induced antinociception in thermal stimulation. McN-A-343 (i.t.)-induced

antinociception in the tail flick test in mice was antagonized by pretreatment (i.t.) with

atropine, pirenzepine, himbacine (a M4 receptor antagonist) and bicuculline (a GABAA

antagonist) but not with the GABAB antagonist, CGP35348 (Honda et al., 2008). The

conclusion of this study was that McN-A-343 produces its antinociceptive effect through

M1 receptors and, at least in part, spinal GABAA receptors in mice.

Previous studies have suggested that there are some interactions between kappa

opioid receptors and muscarinic receptors. For example, Ukai et al (1995) reported that pretreating mice with the kappa opioid receptor agonists, dynorphin A (dyn A) (1-13) and

U50, 488, inhibit pirenzepine-induced disturbance of spontaneous alternation

performance (indicates working memory) measured using the Y-maze test. Treating mice

with norBNI, before kappa opioid receptor agonists, antagonized the memory

improvement action of dyn A (1-13) as well as U50,488. Later, Ukai et al. (1997)

reported that i.c.v. administration of dyn A (1-13) to mice improves memory and learning

dysfunction induced by scopolamine and pirenzepine. Pretreating mice with norBNI

reversed the antagonistic effect of dyn A. Hiramatsu et al. (1998) showed that carbachol,

a muscarinic receptor agonist, injected into the hippocampus of mice induces learning

127 and memory impairment and causes a decrease in acetylcholine (Ach) release.

Impairment in memory and learning was improved when dyn A (1-13) was injected 5 min after carbachol injection. Also pretreatment with dyn A reversed decreases in Ach release induced by carbachol. The antagonistic effect of dyn A was ameliorated when mice were pretreated with norBNI. Moreover, Wall and Messier (2000) showed that microinjection of U-69,593, a selective kappa opioid receptor agonist, into the infralimbic cortex of mice enhances spontaneous memory and reduces anxiety.

Additionally, interactions between muscarinic receptors and kappa opioid receptors were reported in the gastrointestinal system. Fox and Burks (1987) studied the effects of mu, delta and kappa opioid receptors on gastric acid secretion in rats. They found that a) agonism at mu opioid receptors decreases gastric acid secretion, b) agonism at delta opioid receptors has no marked effect on gastric acid secretion and c) the kappa agonist, U50,488 (i.v., but not i.c.v.), increases gastric acid secretion. The U50,488- induced gastric acid secretion effect was blocked by pretreating rats with naloxone, atropine or pirenzepine. Pretreating rats with hexamethonium, the H2 receptor antagonist metiamide, reserpine, or the alpha and beta adrenergic receptor antagonists propranolol and phentolamine had no marked antagonistic effect on U50,488-induced gastric acid secretion. Fox and Burks (1987) concluded that U50,488-induced increase in gastric acid secretion is through M1 receptors on the parietal cells. Poonyachoti et al. (2001) reported the existence of kappa opioid receptors in myenteric neurons as well as inhibition of electrically evoked contractions of circular muscle from porcine ileum by U50,488 and

U69,593. Furthermore, the results of clinical trials with asimadoline for irritable bowel

128 syndrome showed that this kappa agonist decreased pain and improved abnormal bowel function in humans (Delgado-Aros et al., 2003).

Our results with M1 receptor ligands were unexpected. We studied M1 receptor ligands as a consequence of the receptor binding study. GNTI (1 µM) decreases binding affinity to M1 receptors only 52%. This result was obtained with only one concentration of GNTI. We do not know if the affinity of GNTI to M1 receptors is dose-related. Of course, our first step was to pretreat mice with an M1 receptor antagonist and then challenge with GNTI. Telenzepine (s.c., flank area) had no marked effect on GNTI- induced scratching. Interestingly, behind the neck injection of telenzepine to a few mice induced scratching behavior (personnel observation, data not shown). Therefore, we decided to pretreat mice with an M1 receptor agonist. Unexpectedly, McN-A-343 attenuated GNTI scratching induced by GNTI in a dose-dependent manner and this effect was not a consequence of behavioral depression. This compound is the second compound, after nalfurafine, to inhibit GNTI-elicited vigorous scratching. More studies are required to answer these questions: a) how agonism at muscarinic receptors inhibits scratching; b) if the pathway for the scratch inhibiting effect of McN-A-343 is similar to the pathway for the antinociceptive effect of McN-A-343 at the spinal cord level and if activated neurons are the same for both stimuli; c) if McN-A-343 is active against scratching induced by different pruritogens such as compound 48/80, serotonin and GRPR agonists; d) if agonism on this muscarinic receptor can be a target for antipruritic drug development, e) if affinity of GNTI against the M1 receptor is dose-related and f) GNTI an inverse agonist for the M1 receptor.

129 Inhibitory Effect of Lidocaine on Pain and Itch

The major findings of this study are 1) lidocaine antagonizes GNTI-induced scratching behavior in mice, and 2) lidocaine prevents neuronal activity evoked by both pain and scratch stimuli in the dorsal horn of the spinal cord by blocking excitatory inputs to the neurons.

To our knowledge, this is the first study to demonstrate anti-itch activity after local injection of lidocaine in an animal model of pruritus. Previously, Wheeler and colleagues (1988) reported that the topical application of 4% lidocaine to the neck of mice diminished peripherally, but not centrally, given bombesin-induced scratching. In our study, lidocaine almost completely inhibited scratching induced by GNTI. Lidocaine blocks voltage-gated sodium channels (VGSCs) which are responsible for the increase in sodium permeability during the rapid phase of the action potential in excitable cells like neurons, cardiac and muscle cells (Strichartz 1976; Sandtner et al., 2004). VGSCs are important for pain sensation. From nine distinct sodium channels, animal studies indicate that Nav1.7, Nav1.8 and Nav1.9 are crucial for transmission of inflammatory pain and

Nav1.3 may play a role in neuropathic pain (Wood et al., 2004; Cummins et al., 2007).

Taken together, antagonism of the GNTI-induced behavioral and neuronal responses by locally administered lidocaine is a result of suppression of peripheral nerve firing. This antagonistic effect is through inhibition of VGSCs, which are required for action potentials.

After a bolus intravenous injection of lidocaine to patients suffering from pruritus due to chronic liver disease, there is a decrease in the severity of this behavior (Fishman et al., 1997; Villamil et al., 2005). Also, a 1:1 mixture of lidocaine and prilocaine (EMLA

130 cream) relieves cowhage- and papain-induced pruritus (Shuttleworth et al., 1988) and is reportedly a safe and effective treatment of postburn pruritus in pediatric patients

(Kopecky et al., 2001). This cream may relieve the itch of notalgia paresthetica, which is a chronic sensory neuropathy causing itch, pain and paresthesia (Layton and Cotterill,

1991). Transient drowsiness during i.v. injection of lidocaine to counter neuropathic pain has been reported as a side effect (Tremont-Lukats et al., 2005). We studied the peripherally restricted analog of lidocaine (QX-314) (Taylor et al., 1995; Abbadie et al.,

1997; Binshtok et al., 2007; Lim et al., 2007). Nevertheless, we measured locomotion to discover if the anti-itch activity of lidocaine is a consequence of behavioral depression.

Lidocaine did not markedly affect the spontaneous locomotion of mice suggesting that the anti-itch activity of lidocaine is not linked to behavioral depression.

The patch form of lidocaine has been found effective in neuropathic pain conditions such as post herpetic neuralgia and carpal tunnel syndrome in humans

(Wasner et al., 2005; Nalamachu et al., 2006; Vadalouca et al., 2006; Geha et al., 2008).

In the present study, pretreating mice with lidocaine antagonized licking in the first phase of the formalin test and decreased (but not to a significant extent) this behavioral response in the second phase. The first phase is caused by activation of peripheral nociceptors. The second phase is associated with ongoing activity in primary afferents and increased sensitivity of dorsal horn neurons (Murray et al., 1988; Taylor et al., 1995).

In some previous reports, pretreatment with lidocaine (10-30 mg/kg, i.p.) antagonized the behavioral response in both phases of the test in mice (e.g., Bittencourt and Takahashi,

1997; Sahebgharani et al., 2006). However, Hitosugi et al. (1999) found that pretreating mice with the same doses of lidocaine (i.p.) only inhibited the behavioral response in the

131 second phase. The choice of route of administration of lidocaine may be critical; i.e.,

intraperitoneal vs. intradermal. We also described an inhibitory effect of lidocaine on c-

fos expression evoked by the nociceptive stimulus. Yashpal et al. (1998) reported that

lidocaine, given intrathecally before formalin, inhibits c-fos expression on the dorsal horn

of the spinal cord in rats. In our study, formalin-induced nociception activated neurons

located on the medial side of the superficial and deeper layers of the dorsal horn. Similar

c-fos expression patterns were reported following the formalin test in mice (Bon et al.,

2002; Zhao et al., 2003) as well as in different pain models in mice (acetic acid writhing)

and rats (plantar incision) (de los Santos-Artega et al., 2003; Sun et al., 2004).

In summary, we demonstrated here, for the first time, that pretreating mice with locally administered lidocaine (a) antagonizes excessive scratching induced by GNTI and

(b) prevents c-fos expression evoked by both pain and scratching, indicating that

lidocaine blocks peripheral neuronal activity. Our results argue for the comprehensive

clinical testing of lidocaine as an antipruritic against itch in regional skin conditions

caused by poison ivy, notalgia paresthetica, bites and sunburn.

Application of pain and itch stimuli to the same site

In order to examine any overlap or difference in the projection of pain and itch,

we applied either an algogen or a pruritogen to the right cheek of mice using a recently

described model which differentiates pain and itch behaviorally (Shimada and LaMotte,

2008). Our results revealed that mice injected with GNTI only groomed and scratched but

did not wipe the injected cheek suggesting that GNTI is a pure pruritogen. Also, our

132 results show that when GNTI is administered locally, a higher dose of GNTI, compared

to systemic administration, is required to evoke a mild scratching effect (30 µg vs. 8-9

µg/mouse). This might be a reason why GNTI did not induce c-fos expression in the superficial layer of the dorsal horn around the junction of the cervical spinal cord and medulla. Also, the itch stimulus might not reach the threshold to induce c-fos expression in this area. GNTI and formalin both induced c-fos expression in brain areas that are involved in ascending and descending sensory processing (parabrachial nucleus and

PAG). Since formalin-provoked c-fos expression in the trigeminal nucleus is similar to

that following experimental tooth movement in rats (Yamashiro et al., 1997) and c-fos

expression in the PAG area is similar to that following noxious stimulation of the

superior sagittal sinus in the cat (Knight et al., 2005), it may be proposed that pain and

itch sensations are projected differently in the brain stem.

CONCLUSIONS

Overall conclusions from this thesis are summarized as follows:

1. GNTI, a kappa opioid receptor antagonist, induces vigorous scratching

behavior in a dose-dependent manner in mice. Inhibition of scratching behavior

and prevention of c-fos expression by locally administered lidocaine as well as

the ineffectiveness of i.t. administered GNTI suggest that GNTI is effective

peripherally (Inan et al., Eur J Pharmacol, 2009).

2. The chemically diverse pruritogens, GNTI and compound 48/80, increase c-fos

expression in the lateral side of the superficial layer of the dorsal horn

133 suggesting that both compounds activate a group of sensory neurons located on

the lateral side of lamina I and II.

3. Nalfurafine attenuates GNTI-elicited scratching behavior and prevents itch-

induced neuronal activity at the spinal level. This suggests that kappa opioid

receptors are involved, at least in part, in the inhibition of itch sensation. On the

basis of our results, nalfurafine holds promise as a potentially useful antipruritic

in human conditions involving itch (Inan et al., Neurosci, 2009).

4. GNTI elicits scratching in mu, delta or kappa opioid receptor ko mice as well

as in mice preteated with either naloxone or norBNI. These findings suggest

that scratch-inducing effect of GNTI is mediated via receptors other than opioid

receptors.

5. Histamine does not play an apparent role in scratching induced by GNTI in

mice.

6. GRP and its receptor do not mediate GNTI-elicited scratching in mice.

7. The muscarinic M1 receptor is involved, at least in part, in the pathogenesis of

scratching induced by GNTI. On the basis of our work, agonism at M1

receptors may be a key target for antipruritic drug development.

8. Lidocaine inhibits spinal c-fos expression and behavior induced by both pain

and itch stimuli (Inan et al., 2009, Eur J Pharmacol). These findings suggest

that peripheral transmission of both pain and itch stimuli to the spinal cord is

inhibited by locally injected lidocaine.

9. GNTI and formalin both induce c-fos expression in brain areas that are

involved in ascending and descending sensory processing (parabrachial nucleus

134 and PAG). Since formalin provokes c-fos expression in the trigeminal nucleus, it is proposed that pain and itch sensations are projected differently in the brain stem in mice (Inan et al., 2009, Neurosci).

Fig. 64. Pictorial summary of results.

135 REFERENCES

Abbadie C, Taylor BK, Peterson MA, Basbaum AI (1997). Differential contribution of the two phases of the formalin test to the pattern of c-fos expression in the rat spinal cord: studies with remifentanil and lidocaine. Pain 69: 101-110.

Andoh T, Kuraishi Y (2003). Nitric oxide enhances sunstance P-induced itch- associated responses in mice. Br J Pharmacol 138: 202-208.

Andrew D, Craig AD (2001). Spinothalamic lamina I neurons selectively sensitive to histamine: a central neural pathway for itch. Nature Neurosci 4: 72-77.

Ankier SI (1974). New hot plate tests to quantify antinociceptive and narcotic antagonist activities. Eur J Pharmacol 27: 1-4.

Arai I, Takaoka A, Hashimoto Y, Honma Y, Koizumi C, Futaki N, Sugimoto M, Takahashi N, Inoue T, Nakanishi Y, Sakurai T, Tanami T, Yagi M, Ono N, Nakaike S (2007). Effects of TS-022, a newly developed prostanoidDP1 receptor agonist, on experimental pruritus, cutaneous barrier disruptions and atopic dermatitis in mice. Eur J Pharmacol 556: 207-214.

Arthur RP, Shelley WB (1955). The role of proteplytic enzymes in the production of pruritus in man. J Invest Dermatol 25: 341-346.

Atanassoff PG, Brull SJ, Zhang J, Greenquist K, Silverman DG, LaMotte RH (1999). Enhancement of experimental pruritus and mechanically evoked dysesthesia with local anesthesia. Somatosens Mot Res 16: 291-298.

Baraka A, Noueihid R, Hajj S (1981). Intrathecal injection of morphine for obstetric analgesia. Anesthesiology 54: 136-140.

Basbaus J, Jariel-Encontre I, Gomard T, Bossis G, Piechaczyk M (2007). Ubiquitine- independent versus ubiquitine-dependent proteozomal degradation of the c-fos and Fra-1 transcription factors: Is there a unique answer? Biochimine 90: 1-10.

Behrentd HJ, Germann T, Gillen C, Hatt H, Jostock R (2004). Characterization of the mouse cold-menthol receptor TRPM8 and vanilloid receptor type-1 VR1 using a fluorometric imaging plate reader (FLIPR) assay. Br J Pharmacol 141: 737-745.

Bell JK, McQueen D S, Rees J L (2004). Involvement of histamine H4 and H1 receptors in scratching induced by histamine receptor agonists in BalbC mice. Br J Pharmacol142: 374-380. 136 Berendsen HHG, Broekkamp CLE (1991). A peripheral 5-HT1D-like receptor involved in serotonergic induced hindlimb scratching in rats. Eur J Pharmacol 194: 201-208.

Bergasa NV, Alling DW, Vergalla J, Jones EA (1994). Cholestasis in the male rat is associated with naloxone-reversible antinociception. J Hepatol 20: 85-90.

Bergasa NV, Alling DW, Talbot TL, Wells MC, Jones EA (1999). Oral nalmefene therapy reduces scratching activity due to the pruritus of colestasis: a contr o lled study. J Am Acad Dermatol 41: 431-434.

Bergasa NV (2008). Pruritus in primary biliary cirrhosis: pathogenesis and therapy. Clin Liver Dis 12: 19-34.

Bigliardi PL, Bigliardi-Qi M, Buechner S, Rufli T (1998). Expression of mu-opiate receptor in human epidermis and keratinocytes. J Invset Dermatol 111: 297-301.

Bigliardi PL, Stammer H, Jost G, Rufli T, Büchner S, Bigliardi-Qi M (2007). Treatment of pruritus with topically applied opiate receptor antagonist. J Am Acad Dermatol 56: 979-988.

Binder A, Koroschetz J, Baron R (2008). Disease mechanisms in neuropathic itch. Nat Clin Pract Neurol 4: 329-337.

Binshtok AM, Bean BP, Woolf CJ (2007). Inhibition of nociceptors by TRPV1- mediated entry of impermeant sodium channel blockers. Nature 449: 607-610.

Bittencourt AL, Takahashi RN (1997). Mazindol and lidocaine are antinociceptives in the mouse formalin model: involvement of dopamine receptor. Eur J Pharmacol 330: 109-113.

Bon, K, Wilson SG, Mogil JS, Roberts WJ (2002). Genetic evidence for the correlation of deep dorsal horn Fos protein immunoreactivity with tonic formalin pain behavior. J Pain 3: 181-189.

Bonner TI (1989). The molecular basis of muscarininc receptor diversity. Trends Neurosci 12: 148-151.

Bovet D (1950). Introduction to antihistamine agents and antergan derivative. Ann N Y Acad Sci 50: 1089-1126.

Brailoiu GC, Dun SL, Ohsawa M, Yin D, Yang J, Chang JK, Brailoiu E, Dun NJ (2005). Kiss-1 expression and metastatin-like immunoreactivity in the rat brain. J Comp Neurol 481: 314-329.

137 Breuer K, Werfel T, Kapp A (2005). Safety and efficacy of topical calcineurin inhibitors in the treatment of childhood atopic dermatitis. Am J Clin Dermatol 6: 65-77.

Broadbent JL (1953). Observations on itching produced by cowhage, and on the part played by histamine as a mediator of the itch sensation. Br J Pharmacol Chemother 8: 263-270.

Buritova J, Besson JM (2001). Urethane anaesthesia could partly mask antinociceptive effects of non-steroidal anti-inflammatory drugs: a spinal c-fos protein study. Brain Res 891: 281-284.

Chaney MA (1995). Side effects of intrathecal and epidural opioids. Can J Anaesth 42: 891-903.

Cheigh NH (2003). Managing a common disorder in children: Atopic dermatitis. J Pediatr Health Care 17: 84-88.

Colburn RW, Lubin ML, Stone DJ, Wang Y, Lawrence D, D’Andrea MR, Brandt MR, Liu Y, Flores CM, Qin N (2007). Attenuated cold sensitivity in TRPM8 nu ll mice. Neuron 54: 379-386.

Coons AH, Kaplan MH (1950). Localization of antigen in tissue cells: improvements in a method for the detection of antigen by means of fluorescent antibody. J Exp Med 91: 1-13.

Cowan A, Khunawat P, Zhu XZ, Gmerek DE (1985). Effects of bombesin on behavior. Life Sci 37: 135-145.

Cowan A, Rance MJ, Blackburn TP (1986). In vivo studies on delta opioid receptors. NIDA Res Monogr 75: 473-476.

Cowan A, Daniel JL, Ryan RR, Wheeler-Aceto H (1990). Pharmacological profile of ICI 216140, a novel bombesin antagonist. Eur J Pharmacol 183: 235-236.

Cowan A, Kehner GB (1997). Antagonism by opioids of compound 48/80-induced scratching in mice. Br J Pharmacol 122: 169P (Suppl).

Cummins TR, Sheets PL, Waxman SG (2007). The roles of sodium channels in nociception: implications for mechanism for pain. Pain 131: 243-257.

Dal-Pizzol F, Di Leone LP, Ritter C, Martins MR, Reinke A, Gelain DP, Zanotto- Filho A, Souza LF, Andrades M, Barbeiro DF, Bernard EA,Cammarota M, Bevilaqua LRM, Soriano FG, Cláudio J, Moreira F, Roesler R, Schwartsmann G (2006). Gastrin-releasing peptide receptor antagonist effects on an animal model of sepsis. Am J Respir Crit Care Med 173: 84-90.

138 Daugherty BL (2004). Histamine H4 antagonism: a therapy for chronic allergy? Br J Pharmacol 142: 5-7.

Davidson S, Zhang X, Khasabov S, Simone DA, Giesler GJ (2009). Relief of itch by scratching: state-dependent inhibition of primate spinothalamic tract neurons. Nat Neurosci 12: 544-546.

DeHaven-Hudkins DL, Cowan A, Burgos LC, Daubert JD, Cassel JA, De-Haven RN, Kehner GB, Kumar V (2002). Antipruritic and antihyperalgesic actions of loperamide and analogs. Life Sci 71: 2787-2796.

Delgado-Aros S, Chial HJ, Camilleri M, Szarka LA, Weber FT, Jacob J, Ferber I, McKinzie S, Burton DD, Zinsmeister AR (2003). Effects of a kappa-opioid agonist, asimadoline, on satiation and GI motor and sensory functions in humans. Am J Physiol Gastrointest Liver Physiol 284: G558-G566. De los Santos-Artega M, Sierra-Dominguez SA, Fontenalla GH, Dalgado-Garcia JM, Carrión AM (2003). Analgesia induced by dietary restriction is mediated by the kappa-opioid system. J. Neurosci 23: 11120-11126.

Dubuis son D, Dennis SG (1977). The formalin test: a quantitative study of the analgesic effects of morphine, meperidine, and brain stem stimulation in rats and cats. Pain 4: 161-174.

Dunford P J, Williams K N, Desai P J, Karlsson L, McQueen D, Thurmond R L (2007). Histamine H4 receptor antagonists are superior to traditional anti- histamines in the attenuation of experimental pruritus. J Allergy Clin Immunol 119: 176-183.

Dvorak M, Watkinson A, McGlone F, Rukwied R (2003). Histamine induced responses are attenuated by a cannabinoid receptor agonist in human skin. Inflamm Res 52: 238-245.

Endoh T, Matsuura H, Tajima A, Izumimoto N, Tajima C, Suzuki T, Saitoh A, Suzuki T, Narita M, Tseng L, Nagase H (1999). Potent antinociceptive effects of TRK-820, a novel kappa-opioid receptor agonist. Life Sci 65: 1685-1694.

Endoh T, Tajima A, Suzuki T, Kamei J, Narita M, Tseng L, Nagase H (2000). Charecterization of the antinociceptive effects of TRK-820 in the rat. Eur J Pharmacol 387: 133-140.

Endoh T, Tajima A, Izumimoto N, Suzuki T, Saitoh A, Suzuki T, Narita M, Kamei J, Tanaka T, Nahase H (2001). TRK-820, a selective kappa-opioid agonist, prodeces potent antinociception in cynomolgus monkeys. Jpn J Pharmacol 85: 282-290.

139 Fathi Z, Corjay MH, Shapira H, Wada E, Benya R, Jensen R, Viallet J, Sausville E A, Batley JF (1993). BRS-3: a novel bombesin receptor subtype selectively expressed in testis and lung carcinoma cells. J Biol Chem 268: 5979-5984.

Faulk WP, Taylor GM (1971). An immunocolloidal method for the electron microscope. Immunochemistry 8: 1081-1083.

Fishman SM, Caneris OA, Stojanovic MP, Borsook D (1997). Intravenous lidocaine for treatment-resistant pruritus. Am J Med 102: 584-585.

Fox DA, Burks TF (1988). Roles of central and peripheral mu, delta and kappa opioid receptors in the mediation of gastric acid secretory effects in the rat. J Pharmacol Exp Ther 244: 456-244.

Francos GC, Kauh YC, Gittlen SD, Schulman ES, Besarab A, Goyal S, Burke JF (1991). Elevated plasma histamine in chronic uremia: effects of ketotifen on pruritus. Int J Dermatol 30: 884-889.

Fuxe K, Agnati LF, McDonald T, Locatelli V, Hökfelt T, Dalsgaard CJ, Battistini N, Yanaihara N, Mutt V, Cuello AC (1983). Immunohistochemical indications of gastrin releasing peptide–bombesin-like immunoreactivity in the nervous system of the rat. Co distribution with substance P-like immunoreactive nerve terminal systems and coexistence with substance P- like immunoreactivity in dorsal root ganglion cell bodies. Neurosci Lett 37: 17-22.

Geha PY, Baliki MN, Wang X, Harden RN, Paice JA, Apkarian AV (2008). Brain dynamics for perception of tactile allodynia (touch-induced pain) in postherpetic neuralgia. Pain 138: 641-656.

Ghelardini C, Galeotti N, Bartolini A (2000). Loss of muscarinic antinociception by antisense inhibition of M1 receptors.

Ghent CN, Bloomer JR, Klatskin G (1977). Elevations in skin tissue levels of bile acids in human cholestasis: relation to serum levels and to pruritus. Gastroenterology 73: 1125-1130.

Gittlen SD, Schulman ES, Maddrey WC (1990). Raised histamine concentrations in chronic cholestatic liver disease. Gut 31: 96-99.

Gmerek DE, Cowan A (1983). An animal model for preclinical screening of systemic antipruritic agents. J Pharmacol Methods 10: 107-112.

Gmerek DE, Cowan A (1988). Role of opioid receptors in bombesin-induced grooming. Ann N Y Acad Sci 525: 291-300.

140 Goodman AJ, Le Bourdonnec B, Dolle RE (2007). Mu opioid receptor antagonists: recent developments. ChemMedChem 2: 1552-1570.

Greaves MW (2005). Itch in systemic disease: therapeutic options. Dermatol Ther 18: 323-327.

Gulhas N, Erdil FA, Sagir O, Gedik E, Togal T, Begec Z, Ersoy MO (2007). Lornoxicam and ondansetron for the prevention of intrathecal fentanyl-induced pruritus. J Anesth 21: 159-163.

Hamada R, Seike M, Kamijima R, Ikeda M, Kodama H, Ohtsu H (2006). Neuronal conditions of spinal cord in dermatitis are improved by olopatadine. Eur J Pharmacol 547: 45-51.

Handwerker HO (2009). Microneurography of pruritus. Neurosci Lett (Epub ahead of print).

Hashimoto Y, Arai I, Tanaka M, Nakaike S (2005). Prostaglandin D2 inhibits IgE- mediated scratching by suppressing histamine release from mast cells. J Pharmacol Sci 98: 90-93.

Hefti FF, Rosenthal A, Walicke PA, Wyatt S, Vergara G, Shelton DL, Davies AM (2006). Novel class of pain drugs based on antagonism of NGF. Trends Pharmacol Sci 27:85-91.

Herrera DG, Robertson HA (1996). Activation of c-fos in the brain. Prog Neurobiol 50: 83-107.

Heyer G, Ulmer FJ, Schmitz J, Handwerker HO (1995). Histamine-induced itch and allokinasis (itchy skin) in atopic eczema patients and controls. Acta Derm Venereol 75: 348-352.

Hiramatsu M, Murasawa H, Mori H, Kameyama T (1998). Reversion of muscarinic autoreceptor agonist-induced acetylcholine decrease and learning impairment by dynorphin A (1-13), an endogenous κ-opioid receptor agonist. Br J Pharmacol 123: 920-926.

Hitosugi H, Kashiwazaki T, Ohsawa M, Kamei J (1999). Effects of mexiletine on algogenic mediator-induced nociceptive responses in mice. Methods Find Exp Clin Pharmacol 21: 409-413.

Honda K, Ando S, Koga K, Takano Y (2004). The spinal musarinic receptor subtypes contribute to the morphine-induced antinociceptive effects in thermal stimulation in mice. Neurosci Lett 371: 235-238.

141 Honda K, Horikawa K, Ando S, Koga K, Kawata S, Migita K, Takano Y (2008). The spinal muscarinic M1 receptors and GABAA receptors contribute to the McN-A-343-induced antinociceptive effects during thermal stimulation of mice. J Pharmacol Sci 108: 472-479.

Honma Y, Arai I, Futaki N, Hashimoto Y, Sugimoto M, Sakurai T, Nakaike S (2007). Cyclooxygenase-1 inhibition delays recovery of the cutaneous barrier disruption caused by mechanical scratching in mice. Br J Dermatol 156: 1178-1187.

Hossen MA, Inoue T, Shinmei Y, Fujii Y, Watanabe T, Kamei C (2006). Role of substance P on histamine H3 antagonist-induced scratching behavior in mice. J Pharmacol Sci 100: 297-302.

Ikeda K, Yoshikawa S, Kurokawa T, Yuzawa N, Nakao K, Mochizuki H (2009). TRK- 820, a selective kappa opioid receptor agonist, could effectively ameliorate L-DOPA-induced dyskinesia symptoms in a rat model of Parkinson’s disease. Eur J Pharmacol 620: 42-48.

Imama chi N, Park GH, Lee H, Anderson DJ, Simon MI, Basbaum AI, Han SK (2009). TRPV1-expreesing primary afferents generate behavioral responses to pruritogenic via multiple mechanisms. Proc Natl Acad Sci 106: 11330-11335.

Inan, S, Cowan A (2004). Kappa opioid agonists suppress choloroquine-induced scratching in mice. Eur J Pharmacol 502: 233-237.

Inan S, Cowan A (2006a). Agmatine-induced stereotyped scratching in mice is antagonized by nalfurafine, a kappa opioid agonist. Pharmacologist 48, 38.

Inan S, Cowan A (2006b). Nalfurafine, a kappa opioid receptor agonist, inhibits scratching behavior secondary to cholestasis induced by chronic ethynylestradiol injections in rats. Pharmacol Biochem Behav 85: 39-43.

Inan S, Lee DY, Liu-Chen LY, Cowan A (2009). Comparison of the diuretic effects of chemically diverse kappa opioid agonists in rats: nalfurafine, U50,488H, and salvinorin A. Naunyn Schmiedebergs Arch Pharmacol 379: 263-270.

Inoue T, Sugimoto M, Sakurai T, Saito R, Futaki N, Hashimoto Y, Honma Y, Arai I, Nakaike S (2007). Modulation of scratching behavior by silencing an endogenous cyclooxygenase-1 gene in the skin through the administration of siRNA. J Gene Med 9: 994-1001.

Jensen RT, Battey JF, Spindel ER, Berya RV (2007). International union of pharmacology LXVIII. Mammalian bombesin receptors: nomenclature, distribution, pharmacology, signaling, and functions in normal and disease states. Pharmacol Rev 60: 1-42.

142 Jewett DC, Grace MK, Jones RM, Billington CJ, Portoghese PS, Levine AS (2001). The kappa-opioid antagonist GNTI reduces U50,488H-, DAMGO-, and deprivation- induced feeding, but not butorphanol- and neuropeptide Y-induced feeding in rats. Brain Res 909: 75-80.

Joglekar GV, Bhide MB, Balwani JH (1963). An experimental method for screening antipruritic agents. Br J Dermatol 75: 117-119.

Johanek LM, Meyer RA, Hartke T, Hobelmann JG, Maine DN, LaMotte RH, Ringkamp M (2007). Psychophysical and physiological evidence for parallel afferent pathways mediating the sensation of itch. J Neurosci 27: 7490-7497.

Jones RM, Hjorth SA, Schwartz TW, Portoghese PS (1998). Mutational evidence for a common κ antagonist binding pocket in the wild-type κ and mutant µ[K303E] opioid receptors. J Med Chem 41: 4911-4914.

Jones RM, Portoghese PS (2000). 5′-Guanidinonaltrindole, a highly selective and potent κ-opioid receptor antagonist. Eur J Pharmacol 396: 49-52.

Jones EA, Neuberger J, Bergasa NV (2002). Opiate antagonist therapy for the pruritus of cholestasis the averdance of opioid withdrawal-like reactions. OJM 95: 547-552.

Kamei J, Nagase H (2001). Norbinaltorphimine, a selective κ-opioid receptor antagonist, induces an itch-associated response in mice. Eur J Pharmacol 418: 141-145.

Kamichi S, Wada E, Aoki S, Sekiguchi M, Kimura I, Wada K (2005). Immunohistochemical localization of gastrin-releasing peptide receptor in the mouse brain. Brain Res 1032: 162-170.

Kang JH, Ishola AI, Baregamian N, Mourot JM, Rychahou PG, Evers BM, Chung DH (2007). Bombesin induces angiogenesis and neuroblastoma growth. Cancer Lett 253: 273-281.

Kanitakis J (2006). Brachioradial pruritus: report of a new case responding to gabapentin. Eur J Dermatol 16: 311-312.

Kehner GB, Gaul F, Zang WY, Daubert JD, Cassel JA, DeHaven RN, DeHaven-Hudkins D L, Cowan A (1999). Stereoselective antipruritic effects of enadoline and GR 94839 in mice. FASEB J 13: A801.

Kiaris H, Schally AV, Sun B, Armatis P, Groot K (1999). Inhibition of growth of human malignant glioblastoma in nude mice by antagonists of bombesin/gastrin-releasing peptide. Oncogene 18: 7168-73. 143

Kinkelin I, Mötzing S, Koltzenburg M, Bröcker EB (2000). Increase in NGF content and nerve fiber sprouting in human allergic contact eczema. Cell Tissue Res 302: 31-37.

Klein LR, Klein JB, Hanno R, Callen JP (1988). Cutaneous mast cell quantity in pruritic and nonpruritic hemodialysis patients. Int J Dermatol 27: 557-559.

Klein TW (2005). Cannabinoid-based drugs as anti-inflammatory therapeutics. Nat Rev Immunol 5: 400-411.

Knight YE, Classey JD, Lasalandra MP, Akerman S, Kowacs F, Hoskin KL, Goadsby PJ (2005). Pattrens of fos expression in the rostral medulla and caudal pons evoked by noxious craniovascular stimulation and periaqueductal gray stimulation in the cat. Brain Res 1045: 1-11.

Ko MCH, Naughton NN (2000). An experimental itch model in monkeys. Characterization of intrathecal morphine-induced scratching and antinociception. Anesthesiology 92: 795-805.

Ko MC, Husbands SM (2009). Effects of atypical kappa-opioid receptor agonists on inrathecal morphine-induced itch and analgesia in primates. J Pharmacol Exp Ther 328: 193-200.

Kontou-Fili K (2000). Clinical advantages of dual activity in urticaria. Allergy 55: 28-33.

Kopecky EA, Jacobson S, Hubley P, Palozzi L, Clarke HM, Koren G (2001). Safety and pharmacokinetics of EMLA in the treatment of postburn pruritus in pediatric patients: a pilot study. J Burn Care Rehabil 22: 235-242.

Kreuter JD, Mattson BJ, Wang B, You Z-B, Hope BT (2004). Cocaine-induced fos expression in rat striatum is blocked by chloral hydrate or urethane. Neurosci 127: 233-242.

Kuraishi Y, Nagasawa T, Hayashi K, Satoh M (1995). Scratching behavior induced by pruritogenic but not algesiogenic agents in mice. Eur J Pharmacol 275: 229-232.

Kuypers DRJ (2009). Skin problems in chronic kidney disease. Nat Clin Pract Nephrol 5: 157-170.

Ladenheim EE, Behles RR, Bi S, Moran TH (2009). Gastrin-releasing peptide messenger ribonucleic acid expression in the hypothalamic paraventricular nucleus is altered

144 by melanocortin receptor stimulation and food deprivation. Endocrinology 150: 672-678.

Lanneau C, Green A, Hirst WD, Wise A, Brown JT, Donnier E, Charles KJ, Wood M, Davies CH, Pangalos MN (2001). Gabapentin is not a GABAB receptor agonist. Neuropharmacology 41: 965-975. Layton AM, Cotterill JA (1991). Notalgia paraesthetica: report of three cases and their treatment. Clin Exp Dermatol 16:197-198.

Lee MR, Shumack S (2005). Prurigo nodularis: a review. Australas J Dermatol 46: 211-218.

Lim TK Y, MacLeod BA, Ries CR, Schwarz SKW (2007). The Quaternary lidocaine derivative, QX-314, produces long-lasting local anesthesia in animal models in vivo. Anesthesiology 107: 305-311.

Loacker S, Sayyah M, Wittmann W, Herzog H, Schwarzer C (2007). Endogenous dynorphin in epileptogenesis and epilepsy: anticonvulsant net effect via kappa opioid receptors. Brain 130: 1017-1028.

Manenti L, Vaglio A (2005). Gabapentin for ureamic pruritus. Nephrol Dial Transplant 20: 1278-1279.

Mansour-Ghanaei F, Taheri A, Froutan H, Ghofrani H, Nasiri-Toosi M, Bagherzadeh AH, Farahvash MJ, Mirmomen S, Ebrahimi-Dariani N, Farhangi E, Pourrasouli Z (2006). Effect of oral naltrexone on pruritus in cholestatic patients. World J Gastroenterol 12: 1125-1128.

Mantey SA, Weber HC, Sainz E, Akeson M, Ryan RR, Pradhan TK, Searles RP, Spindel ER, Battey JF, Coy DH, Jensen RT (1997). Discovery of a high affinity radioligand for the human orphan receptor, bombesin receptor subtype 3, which demonstrates that it has unique pharmacology compared with other mammalian bombesin receptors. J Biol Chem 272: 26062-26071.

Martins MR, Reinke A, Valvassori SS, Machado RA, Quevedo J, Schwatsmann G, Roesler R (2005). Non-associative learning and anxiety in rats treated with a single systemic administration of the gastrin-releasing peptide receptor antagonist RC-3095. Peptides 12: 2525-9.

Matsuda H, Watanabe N, Geba GP, Sperl J, Tsudzuki M, Hiroi J, Matsumoto M, Ushio H, Saito H, Askenase PW, Ra C (1997). Development of atopic dermatitis-like skin lesion with IgE hyperproduction in NC/Nga mice. Int Immunol 9: 461-466.

Mayo MJ, Handem I, Saldana S, Jacobe H, Getachew Y, Rush AJ (2007). Sertraline as a first-line treatment for cholestatic pruritus. Hepatology 45: 666-674.

145

McMahon SB, Koltzenburg M (1992). Itching for an explanation. Trens Neurosci 15: 497-501.

Mela M, Mancuso A, Burroughs AK (2003). Pruritus in cholestatic and other liver diseases. Aliment Pharmacol Ther 17: 857-870.

Meller CA, Henriques JAP, Schwartsmann G, Roesler R (2004). The bombesin/gastrin releasing peptide receptor antagonist RC-3095 blocks apomorphine but not MK- 801-induced stereotypy in mice. Peptides 25: 585-588.

Mettang T, Fritz P, Weber J, Machleidt C, Hubel E, Kuhlmann U (1990). Uremic pruritus in patients on hemodialysis or continuous ambulatory peritoneal dialysis (CAPD): the role of plasma histamine and skin mast cells. Clin Nephrol 34: 136-141.

Mochizuki H, Tashiro M, Kano M, Sakurada Y, Itoh M, Yanai K (2003). Imaging of central itch modulation in the human brain using positron emission tomography. Pain 105: 339-346.

Monroe EW (1989). Efficacy and safety of nalmefene in patients with severe pruritus caused by chronic urticaria and atopic dermatitis. J Am Acad Dermatol 21: 135-136.

Moody TW, O’Donohue TL, Jacobowitz DM (1981). Biochemical localization and characterization of bombesin-like peptides in discrete regions of rat brain. Peptides 2: 75-79.

Moody TW, Merali Z, Crawley JN (1988). The effects of anxiolytics and other agents on rat grooming behavior. Ann NY Acad Sci 525: 281-290

Murphy M, Reaich D, Pai P, Finn P, Carmichael AJ (2003). A randomized, placebo- controlled, double-blind trial of ondansetron in renal itch. Br J Dermatol 148: 314-317.

Murray CW, Porreca F, Cowan A (1988). Methodological refinements to the mouse paw formalin test. An animal model of tonic pain. J Pharmacol Methods 2: 175-186.

Nagalla SR, Barry BJ, Creswick KC, Eden P, Taylor JT, Spindel E R (1995). Cloning of a receptor for amphibian [Phe13]bombesin distinct from the receptor for gastrin-releasing peptide: identification of a fourth bombesin receptor subtype (BB4). Proc Natl Acad Sci 92: 6205-6209.

Nagase H, Hayakawa J, Kawamura K, Kawai K, Takezawa Y, Matsuura H, Tajima C, Endo T (1998). Discovery of a structurally novel opioid kappa- agonist derived from 4,5-epoxymorphinan. Chem Pharm Bull 46: 366-369.

146 Nakane PK, Pierce GB (1966). Enzyme-labeled antibodies: preparation and application for the localization of antigens. J Histochem Cytochem 14: 929-931.

Nakano T, Andoh T, Lee J, Kuraishi Y (2008). Different dorsal horn neurons responding to histamine and allergic itch stimuli. Neuroreport 19: 723-726.

Nakao K, Ikeda K, Kurokawa T, Togashi Y, Umeuchi H, Honda T, Okano K, Mochizuki H (2008). Effect of TRK-820, a selective kappa opioid receptor agonist, on scratching behavior in an animal model of atopic dermatitis. Nihon Shinkei Seishin Yakurigaku Zasshi 28: 75-83.

Nalamachu S, Cockett RS, Gammaitoni AR, Gould EM (2006). A comparison of the lidocaine patch 5% vs naproxen 500 mg twice daily for the relief of pain associated with carpal tunnel syndrome: a 6-week, randomized, parallel-group study. Med Gen Med 8: 33-42.

Namer B, Carr R, Johanek LM, Schmelz M, Handwerker HO, Ringkamp M (2008). Separate peripheral pathways for pruritus in man. J Neurophysiol 100: 2062-2069.

Negus SS, Mello NK, Linsenmayer DC, Jones RM, Portoghese PS (2002). Kappa opioid antagonist effects of the novel kappa antagonist 5′-guanidinonaltrindole (GNTI) in an assay of schedule-controlled behavior in rhesus monkeys. Psychopharmacology 163: 412-419.

Nilius B , Owsianik G, Voets T, Peters JA (2007). Transient receptor potential cation channels in disease. Physiol Rev 87: 165-217.

Nojima H, Carstens E (2003a). 5-Hydroxytryptamine (5-HT)2 receptor involvement in acute 5-HT-evoked scratching but not in allergic pruritus induced by dinitrofluorobenzene in rats. J Pharmacol Exp Ther 306: 245-252.

Nojima H, Carstens MI, Carstens E (2003b). C-fos expression in superficial dorsal horn of cervical spinal cord associated with spontaneous scratching in rats with dry skin. Neurosci Lett 347: 62-64.

Nojima H, Simons CT, Cuellar JM, Carstens MI, Moore JA, Carstens E (2003c). Opioid modulation of scratching and spinal c-fos expression evoked by intradermal serotonin. J Neurosci 23: 10784-10790.

O′Byrne PM, Gauvreau GM, Murphy DM (2009). Efficacy of leukotriene receptor antagonists and synthesis inhibitors in asthma. J Allergy Clin Immunol 124: 397-403.

147 Ong PY (2009). Emerging drugs for atopic dermatitis. Expert Opin Emerg Drugs 14: 165-179.

Pan HL, Chen SR, Eisenach JC (1999). Intrathecal clonidine alleviates allodynia in neuropatic rats: interaction with spinal muscarinic and nicotinic receptors. Anesthesiol 90: 509-514.

Parsons ME, Ganellin CR (2006). Histamine and its receptors. Br J Pharmacol 147: S127-S135.

Pauli-Magnus C, Mikus G, Alscher DM, Kirschner T, Nagel W, Gugeler N, Risler T, Berger ED, Kuhlmann U, Metteng T. Naltrexone does not relieve uremic prueitus: results of a randomized, double-blind, placebo-controlled crossover study. J Am Soc Nephrol 11: 514-519.

Paus R, Schmelz M, Bíró T, Steinhoff M (2006). Frontiers in pruritus research: scratching the brain for more effective itch therapy. J Clin Invest. 116: 1174-1185.

Peer G, Kivity S, Agami O, Fireman E, Silverberg D, Blum M, Laina A (1996). Randomized crossover trial of naltrexone in ureamic pruritus. The Lancet 348: 1552-1554.

Pinski J, Yano T, Rekasi Z, Cai RZ, Radulovic S, Schally AV (1992). High potency of a new bombesin antagonist (RC-3095) in inhibiting serum gastrin levels; comparison of different routes of administration. Regul Pept 41: 185-193.

Polgár E, Szücs P, Urbán L, Matesz K, Nagy I (1999). Immunohistochemical localization of neurokinin-I receptor in the lumbar spinal cord of young rats: morphology and distribution. Somatosens Mot Res 16: 361-368.

Portoghese PS, Lipkowski AW, Takemori AE (1987). Binaltorphimine and nor- binaltorphimine, potent and selective kappa-opioid receptor antagonists. Life Sci 40: 1287-1292.

Poonyachoti S, Portoghese PS, Brown DR (2001). Charecterization of opioid receptors modulating neurogenic contractions of circular muscle from porcine ileum and evidence that δ- and κ-opioid receptors are coexpressed in myenteric neurons. J Pharmacol Exp Ther 297: 69-77.

Pua V, Barnetson R (2006). Recent developments in the treatment of adult atopic dermatitis. Australas J Dermatol 47: 84-89.

Riley JF, West GB (1952). Histamine in tissue mast cells. J Physiol 117: 72.

148 Remröd C, Lonne-Rahm S, Nordlind K (2007). Study of substance P and its receptor neurokinin-1 in psoriasis and their relation to chronic stress and pruritus. Arch Dermatol Res 299: 85-91.

Sahebgharani M, Hossein-Abad AA, Zarrindast MR (2006). On the mechanism of carbamazepine-induced antinociception in the formalin test. Int J Neurosci 116: 1097-1113.

Sandtner W, Szendroedi J, Zarrabi T, Zebedin E, Hilber K, Glaaser I, Fozzard HA, Dudley SC, Todt H (2004). Lidocaine: a foot in the door of the inner vestibule prevents ultra-slow inactivation of a voltage-gated sodium channel. Mol Pharmacol 66: 648-657.

Scheinfeld N (2003). The role of gabapentin in treating diseases with cutaneous manifestations and pain. Int J Dermatol 42: 491-495.

Schme lz M, Schmidt R, Bickel A, Handwerker HO, Torebjörk HE (1997). Specific C- receptors for itch in human skin. J Neurosci 17: 8003-8008.

Schmel z M, Michael K, Weidnar C, Schmidt R, Torebjork HE, Handwerker HO (2000). Which nerve fibers mediate the axon reflex flare in human skin? Neuroreport 11: 645-648.

Schmel z M, Schmidt R, Weidner C, Hilliges M, Torebjork HE, Handwerker HO (2003). Chemical response pattern of different classes of C-nociceptors to pruritogens and algogens. J Neurophysiol 89: 2441-2448.

Schuller AGP, King MA, Zhang J, Bolan E, Pan YX, Morgan D, Chang A, Czick ME, Unterwald EM, Pasternak GW, Pintar JE (1999). Retention of heroin and morphine-6β-glucuronide analgesia in a new line of mice lacking exon 1 of MOR-1. Nat Neurosci 2: 151-156.

Schwartsmann G, DiLeone LP, Horowitz M, Schunemann D, Cancella A, Pereira AS, Richter M, Souza F, daRocha AB, Souza FH, Pohlmann P, De Nucci G (2006). A phase I trial of the bombesin/gastrin-releasing peptide (BN/GRP) antagonist RC3095 in patients with advanced solid malignancies. Invest New Drugs 24: 403-412.

Seki T, Shinichiro A, Chiaki K, Soichiro I, Sakano K, Minami M, Nagase H, Satoh M (1999). Pharmacological properties of TRK-820 on cloned µ-, δ- and κ- opioid receptors and nociceptin receptor. Eur J Pharmacol 376: 159-167.

Sheen MJ, Ho ST, Lee CH, Tsung YC, Chang FL, Huang ST (2008). Prophylactic mirtazapine reduces intrathecal morphine-induced pruritus. Br J Anaesth 101: 711-715.

149 Shelley WB, Arthur RP (1955). Studies on cowhage (Mucuna pruriens) and its pruritogenic proteinase, mucunain. AMA Arch Derm 72: 399-406.

Shelley WB, Arthur RP (1957). The neurohistology and neurophysiology of the itch sensation in man. AMA Arc Dermatol 76: 296-323.

Shim WS, Tak MH, Lee MH, Kim M, Kim M, Koo JY, Lee CH, Kim M, Oh U (2007). TRPV1 mediates histamine-induced itching via the activation of phospholipase A2 and 12-lipoxygenase. J Neurosci 27: 2331-2337.

Shimad a SG, LaMotte RH (2008). Behavioral differentiation between itch and pain in mouse. Pain 139: 681-687.

Shuttleworth D, Hill S, Marks R, Connelly DM (1988). Relief of experimentally induced pruritus with a novel eutectic mixture of local anesthetic agents. Br J Dermatol 119: 535-540.

Sills GJ, Butler E, Forrest G, Ratnaraj N, Patsalos PN, Brodie MJ (2003). Vigabatrin, but not gabapentin or topiramate, produces concentration-related effects on enzymes and intermediates of the GABA shunt in rat brain and retina. Epilepsia 44: 886-892.

Simone DA, Alreja M, LaMotte RH (1991). Psychophysical studies of the itch sensation and itchy skin (“alloknesis”) produced by intracutaneous injection of histamine. Somatosens Mot Res 8: 271-279.

Simone DA, Zhang X, Li J, Zhang JM, Honda CN, LaMotte RH, Giesler GJ (2004). Comparison of responses of primate spinothalamic tract neurons to pruritic and algogenic stimuli. J Neurophysiol 91: 213-222.

Simonin F, Valverde O, Smadja C, Slowe S, Kitchen I, Dierich A, Le Meur M, Roques BP, Maldonado R, Kieffer BL (1998). The EMBO Journal 17: 886-897.

Simons FER (2002). Comparative pharmacology of H1 antihistamines: clinical relevance. Am J Med 113: 38S-46S.

Simpson D, Noble S (2005). Tacrolimus ointment: a review of its use in atopic dermatitis and its clinical potential in other inflammatory skin conditions. Drugs 65: 827- 858.

Sofuoglu M, Porteghese PS, Takemori AE (1992). Maintenance of acute morphine tolerance in mice by selective blockage of κ opioid receptors with norbinalthorphimine. Eur J Pharmacol 210: 159-162.

150 Ständer S, Schmelz M, Metze D, Luger T, Rukwied R (2005). Distribution of cannabinoid receptor 1 (CB1) and 2 (CB2) on sensory nerve fibers and adnexal structures in human skin. J Dermatol Sci 38: 177-188.

Ständer S, Schürmeyer-Horst F, Luger TA, Weisshar E (2006). Treatment of pruritic diseases with topical calcineurin inhibitors. Therapeut Clin Risk Management 2: 213-218. Ständer S, Weisshar E, Luger TA (2007). Neurophysiological and neurochemical basis of modern pruritus treatment. Exp Dermatol 17: 161-169.

Ständer S, Weisshaar E, Mettang T, Szepietowski JC, Carstens E, Ikoma A, Bergasa NV, Gieler U, Misery L, Wallengren J, Darsow U, Streit M, Metze D, Luger TA, Greaves MW, Schmelz M, Yosipovitch G, Bernhard JD (2007). Clinical classification of itch: a position paper of the International Forum for the Study of Itch. Acta Derm Venereol 87: 291-294.

Stante M, Hanna D, Lotti T (2005). Itch, pain, and metaesthetic sensation. Dermatologic Therapy 18: 308-313.

Steinhoff M, Bienenstock J, Schmelz M, Maurer M, Wei E, Bíró T (2006). Neurophysiological, neuroimmunological, and neuroendocrine basis of pruritus. J Invset Dermatol 126: 1705-1718.

Strichartz G (1976). Molecular mechanisms of nerve block by local anesthetics. Anesthesiology 4: 421-441.

Sugimoto M, Arai I, Futaki N, Hashimoto Y, Honma Y, Nakaike S (2006). COX-1 inhibition enhances scratching behavior in NC/Nga mice with atopic dermatitis. Exp Dermatol 15: 582-588.

Sugimoto M, Arai I, Futaki N, Hashimoto Y, Sakurai T, Honma Y, Nakaike S (2007). The anti-pruritic efficacy of TS-022, a prostanoid DP1 receptor agonist, is dependent on the endogenous prostaglandin D2 level in the skin of NC/Nga mice. Eur J Pharmacol 564: 196-203.

Sun X, Yokoyama M, Mizobuchi S, Kaku R, Nakatsuka H, Takahashi T, Morita K (2004). The effects of pretreatment with lidocaine and bupivacaine on the spatial and temporal expression of c-fos protein in the spinal cord caused by plantar incision in the rat. Anesth Analg 98: 1093-1098.

Sun YG, Chen ZF (2007). A gastrin-releasing peptide receptor mediates the itch sensation in the spinal cord. Nature 448: 700-703.

Sun YG, Zhao ZQ, Meng XL, Yin J, Liu XY, Chen ZF (2009). Cellular basis of itch sensation. Science 325: 1531-1534.

151 Suzuki T, Izumimoto N, Takezawa Y, Fujimura M, Togashi Y, Nagase H, Tanaka T Endoh T (2004). Effect of repeated administration TRK-820, a kappa-opio id receptor agonist, on tolerance to its antinociceptive and sedative actions. Brain Res 995: 167-175.

Swain MG, Rothman RB, Xu H, Vergalla J, Bergasa NV, Jones EA (1992). Endogenous opioids accumulate in plasma in a rat model of acute cholestasis. Gastroenterology 103: 630-635.

Szepeshazi K, Schally AV, Halmos G, Lamharzi N, Groot K, Horvath JE (1997). A single in vivo administration of bombesin antagonist RC-3095 reduces the levels and mRNA expression of epidermal growth factor receptors in MXT mouse mammary cancers. Proc Natl Acad Sci 94: 10913-10918.

Szepietowski JC, Schwartz RA (1998). Uremic pruritus. Int J Dermatol 37: 247-253.

Takaoka A, Arai I, Sugimoto M, Futaki N, Sakurai T, Honma Y, Nakaike S (2007). Role of scratch-induced cutaneous prostaglandin D2 production on atopic-like scratching behavior in mice. Exp Dermatol 16: 331-339.

Takubo M, Ueda Y, Yatsuzuka R, Jiang S, Fujii Y, Kamei C (2006). Characteristics of scratching behavior induced by some chemical mediators in hairless mice. J Pharmacol Sci 100: 285-288.

Taylor BK, Peterson MA, Basbaum AI (1995). Persistent cardiovascular and behavioral nociceptive responses to subcutaneous formalin require peripheral nerve input. J Neurosci 15: 7575-7584.

Taylor CP (2009). Mechanism of analgesia by gabapentin and pregabalin-Calcium channel α2-δ [Ca vα 2-δ] ligands. Pain 142:13-16.

Thoms en JS, Petersen MB, Benfeldt E, Jensen SB, Serup J (2001). Scratch induction in the rat by intradermal serotonin: a model of pruritus. Acta Derm Venereol 81: 250-254.

Thornton JR, Losowsky MS (1988). Opioid peptides and primary biliary cirrhosis. BMJ 297: 1501-1504.

Togashi Y, Umeuchi H, Okano K, Ando N, Yoshitaka Y, Honda T, Kawamura K, Endoh T, Utsumi J, Kamei J, Tanaka T, Nagase H (2002). Antipruritic activity of the κ-opioid receptor agonist, TRK-820. Eur J Pharmacol 435: 259-264.

Tominaga M, Ogawa H, Takamori K (2007). Possible roles of epidermal opioid systems in pruritus of atopic dermatitis. J Inves Dermatol 127: 2228-2235.

152 Toyoda M, Nakamura M, Makino T, Hino T, Kagoura M, Morohashi M (2002). Nerve growth factor and substance P are useful plasma markers of disease activity in atopic dermatitis. Br J Dermatol 147: 71-79.

Trauner M (2005). When bile ducts say NO: the good, the bad, and the ugly. Gastroenterology 124: 847-851.

Tremon t-Lukats IW, Challapalli V, McNicol ED, Lau J, Carr DB (2005). Systemic administration of local anesthetics to relieve neuropathic pain: a systematic review and meta-analysis. Anesth Analg 101: 1738-1749.

Tsuji M, Takeda H, Matsumiya T, Nagase H, Yamazaki M, Narita M, Suzuki T (2000). A novel kappa-opioid receptor agonist, TRK-820, blocks the development of physical dependence on morphine in mice. Life Sci 66: PL353-PL358.

Twycross R, Greaves MW, Handwerker H, Jones EA, Libretto SE, Szepietowski JC, Zylicz Z (2003). Itch: scratching more than the surface. QJM 96: 7-26.

Ukai M, Shinkai N, Kameyama T (1995). κ-opioid receptor agonists improve pirenzepine-induced disturbance of spontaneous alternation performance in the mouse. Eur J Pharmacol 281: 173-178.

Ukai M , Itoh J, Kobayashi T, Shinkai N, Kameyama T (1997). Effects of the κ-opioid dynorphin A (1-13) on learning and memory in mice. Behav Brain Res 83: 169-172.

Urashima R, Mihara M (1998). Cutaneous nerves in atopic dermatitis: A histological, immunohistocemical and electron microscopic study. Virchows Arch 432: 363-370.

Vadalouca A, Siafaka I, Argyra E, Vrachnou E, Moka E (2006). Therapeutic management of chronic neuropathic pain. Ann NY Acad Sci 1088: 164-186.

Valet M, Pfab F, Sprenger T, Wöller A, Zimmer C, Behrendt H, Ring J, Darsow U, Tölle T R (2007). Cerebral processing of histamine-induced itch using short- term alternating temperature modulation-an fMRI study. J Invest Dermatol 128: 426-433.

Vergnolle N, Ferazzini M, D’Andrea MR, Buddenkotte J, Steinhoff M (2003). Proteinase-activated receptors: novel signals for peripheral nerves. Trends Neurosci 26: 496-500.

Villamil AG, Bandi JC, Galdame OA, Gerano S, Gadano AC (2005). Efficacy of lidocaine in the treatment of pruritus in patients with chronic cholestatic liver diseases. Am J Med 118: 1160-1163.

153 Vonvoigtlander PF, Lahti RA, Ludens JH (1983). U-50,488: a selective and structurally novel non-mu (kappa) opioid agonist. J Pharmacol Exp Ther 224: 7-12.

Wahlgren CF, Scheynius A, Hagermark O (1990). Antipruritic effect of oral cyclosporin A in atopic dermatitis. Acta Derm Venereol 70: 323-329.

Wakasa Y, Fujiwara A, Umeuchi H, Endoh T, Okano K, Tanaka T, Nagase H (2004). Inhibitory effects of TRK-820 on systemic skin scratching induced by morphine in rhesus monkeys. Life Sci 75: 2947-2957.

Wang Y, Tang K, Inan S, Siebert D, Holzgrabe U, Lee DY, Huang P, Li JG, Liu-Chen LY (2005). Comparison of pharmacological activities of three distinct kappa ligands (Salvinorin A, TRK-820 and 3FLB) on kappa opioid receptors in vitro and their antipruritic and antinociceptive activities in vivo. J Pharmacol Exp Ther 312: 220-230.

Wasner G, Kleinert A, Binder A, Schattschneider J, Baron R (2005). Postherpetic neuralgia: topical lidocaine is effective in nociceptor-deprived skin. J Neurol 252: 677-686.

Wei J, Walton EA, Milici A, Buccafusco JJ (1994). M1-M5 muscarininc receptor distribution in rat CNS bt RT-PCR and HPLC. J Neurochem 63: 815-821.

Werkheiser JL, Rawls SM, Cowan A (2006). Mu and kappa opioid receptor agonists antagonize icilin-induced wet-dog shaking in rats. Eur J Pharmacol 10: 101-105.

Werkheiser JL, Rawls SM, Cowan A (2007). Nalfurafine, the kappa opioid agonist, inhibits icilin-induced wet-dog shakes in rats and antagonizes glutamate release in the dorsal striatum. Neuropharmacology 52: 925-930.

Wheeler H, Blackburn TP, Russell NJW, Cowan A (1988). Effects of lidocaine or capsaicin on scratching and grooming induced in mice by centrally or peripherally injected bombesin. Ann NY Acad Sci 525: 433-434.

Wheeler-Aceto H, Porreca F, Cowan A (1990). The rat paw formalin test: comparison of noxious agents. Pain 40: 229-238.

Wei Q, Kumar E, Samhan MA, Smith FG (2007). Renal responses to the κ-opioid- receptor agonist U-50488H in conscious lambs. Am J Physiol Integr Comp Physiol 293: !263-R168.

Wikström B, Gellert R, Ladefoged SD, Danda Y, Akai M, Ide K, Ogasawara M, Kawashima Y, Ueno K, Mori A, Ueno Y (2005) Kappa-opioid system in uremic pruritus: multicenter, randomized, double-blind, placebo-controlled clinical studies. J Am Soc Nephrol 16: 3742-3747.

154 Wikström B (2007). Itchy skin-a clinical problem for haemodialysis patients. Nephrol Dial Transplant 22 (Suppl 5): v3-v7. Wood JN, Boorman JP, Okuse K, Baker MD (2004). Voltage-gated sodium channels and pain pathways. J Neurobiol 61: 55-71.

Woodward DF, Nieves AL, Spada CS, Williams LS, Tuckett RP (1995). Characterization of a behavioral model for peripherally evoked itch suggests platelet-activating factor as a potent pruritogen. J Pharmacol Exp Ther 272: 758-765.

Yamaguchi T, Nagasawa T, Satoh M, Kuraishi Y (1999). Itch-associated response induced by intradermal serotonin through 5-HT2 receptors in mice. Neurosci Res 35: 77-83.

Yamas hiro T, Nakagawa K, Satoh K, Moriyama H, Takada K (1997). C-fos expression in the trigeminal sensory complex and pontine parabrachial areas following experimental tooth movement. NeuroReport 8: 2351-2353.

Yamau ra K, Oda M, Suwa E, Suzuki M, Sato H, Ueno K (2009). Expression of histamine H4 receptor in human epidermal tissues and attenuation of experimental pruritus using H4 receptor antagonist. J Toxicol Sci 34: 427-431.

Yashpal K, Mason M, McKenna JE, Sharma SK, James HL, Coderre TJ (1998). Comparison of the effects of treatment with intrathecal lidocaine given before and after formalin on both nociception and fos expression in the spinal cord dorsal horn. Anesthesiology 88: 157-164.

Yoshikawa S, Hareyama N, Ikeda K, Kurokawa T, Nakajima M, Nakao K, Mochizuki H, Ichinose H (2009). Effects of TRK-820, a selective kappa opioid receptor agonist, on rat schizophrenia models. Eur J Pharmacol 606: 102-108.

Yosipovitch G, Greaves MW, Schmelz M (2003). Itch. The Lancet 361: 690-694.

Yosipovitch G (2007). Epidemiology of itch and its effect on quality of life. Acta Derm Venereol 87: 462 (OP3).

Yosipovitch G, Ishiuji Y, Patel T S, Hicks M I, Oshiro Y, Kraft R A, Winnicki E, Coghill R C (2008). The brain processing of scratching. J Invest Dermatol 128: 1806-1811.

Zhang X, Huang J, McNaughton PA (2005). NGF rapidly increases membrane expression of TRPV1 heat-gated ion channels. EMBO J 24: 4211-4223.

Zhao CS, Tao YX, Tall JM, Donovan DM, Meyer RA, Raja SN (2003). Role of micro- opioid receptors in formalin-induced pain behavior in mice. Exp Neurol 184: 839-845.

155

Zhu Y, King MA, Schuller AGP, Nitsche JF, Reidi M, Elde RP, Unterwald EM, Pasternak GW, Pintar JE (1999). Neuron 24: 243-252.

Zucker I, Yosipovitch G, David M, Gafter U, Boner G (2003). Prevalence and characterization of uremic pruritus in patients undergoing hemodialysis: uremic pruritus is still a major problem for patients with end-stage renal disease. J Am Acad Dermatol 49: 842-846.

156