Biology and Management of Box Blight Caused by Cylindrocladium Buxicola

Biology and management of box blight caused by Cylindrocladium buxicola

Sarah Elizabeth Healy

A Thesis Presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Environmental Science

Guelph, Ontario, Canada

ABSTRACT

BIOLOGY AND MANAGEMENT OF BOX BLIGHT CAUSED BY CYLINDROCLADIUM BUXICOLA

Sarah Elizabeth Healy Advisor: University of Guelph, 2014 Professor Tom Hsiang

A new fungus, Cylindrocladium buxicola, which causes disease on boxwood was recently observed in Ontario. The fungus, isolated from samples from a nursery in Southern

Ontario, was positively identified by DNA sequence comparisons as the cause of box blight.

Whole boxwood plants required wounding for successful infection, however detached leaves did not. The ‘Green Series’ boxwood cultivar ‘Green Mountain’ was found to be the least susceptible to C. buxicola compared to other cultivars. Survival of C. buxicola in Southern

Ontario was low after the winter, but was higher throughout the fall. Whole genome sequencing of two C. buxicola isolates revealed the presence of the MAT1-1 gene within a German isolate and MAT1-2 in an Ontario isolate, implying the possibility for sexual reproduction. All other 50 isolates tested were MAT1-2. The preventative use of fungicides to control box blight in nurseries, rather than curative use, is likely to provide a better management option for disease.

ACKNOWLEDGEMENTS

First and foremost I would like to thank Dr. Tom Hsiang for his guidance and support throughout my time as a graduate student in his lab. He provided me with the opportunity to conduct novel and interesting research in an area which I am very passionate about. With his encouragement and patience, I have acquired a vast skill set that I am sure will benefit me in future endeavors. I am also appreciative of the opportunities Dr. Hsiang has given me to share my scientific findings at international conferences and at industry meetings. I would also like to thank my advisory committee member, Dr. Goodwin, for his input and to my examination committee for taking the time to be part of my defense. Of course, this project would not have been possible without Mary Jane Ash and the other members of Sheridan Nurseries, thank you for your advice, never ending supply of boxwood plants, and friendly faces.

To the members of the Hsiang lab: Linda you have given me constant support and advice during this project, not to mention a fantastic friendship. Thank you for your skilled script writing abilities, your vegan eating ways, and being my troubleshooting buddy. To Amy, you have been a support system for me since my undergrad and I thank you for your expertise in boxwood, fungicides, statistics and more. You were also the best tour guide of China I have ever had. To Miha, thank you for being my biggest believer and kindest friend. To Anne, you provided me with laughter and happiness every single day, thank you for giving me someone to lean on. To Craig, thank you for all of your help in the lab; and to Vince, thank you for your bioinformatics help.

iii

To my friends and family, thank you for being there for me and sticking with me during all my years of schooling. Especially to my parents, Sonia and Mike, you are the reason I am here today and your love and encouragement keep me going. To my office mates: Phil, Rochelle,

Laura, Xin, and Jon, thank you for not only putting up with me all, but for providing me with friendships which I am sure will last a lifetime. Korri, thank you for being my motivation, best friend, and biggest source of joy.

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... iii

TABLE OF CONTENTS ...... v

LIST OF TABLES ...... xi

LIST OF FIGURES………………………………………………………………………….…xvii

LIST OF APPENDICES ...... xix

LIST OF ABBREVIATIONS AND ACRONYMS ...... xxii

LIST OF ABBREVIATIONS AND ACRONYMS CONTINUED ...... xxiii

Chapter 1 Literature Review ...... 1

1.1 Introduction ...... 1

1.1.1 Boxwood species and their uses ...... 1

1.2 Major fungal diseases on boxwood...... 2

1.2.1 Macrophoma leaf spot...... 2

1.2.2 Phytophthora root rot ...... 3

1.2.3 Boxwood decline ...... 4

1.2.4 Volutella blight ...... 4

1.2.5 Box Blight ...... 6

1.3 Box blight caused by Cylindrocladium buxicola ...... 7

1.3.1 Signs and symptoms of Cylindrocladium buxicola ...... 8

1.3.2 Life cycle of Cylindrocladium buxicola ...... 9

1.3.3 Host range and resistance of Cylindrocladium buxicola ...... 10

1.4 Genetic and molecular analysis of Cylindrocladium buxicola ...... 11

1.4.1 Genetic diversity within Cylindrocladium buxicola ...... 11

1.4.2 Mating type genes and sexual reproduction in Cylindrocladium buxicola...... 12

1.4.3 Pathogen Identification ...... 13

1.5 Cultural and chemical management methods ...... 14

1.6 Hypotheses ...... 16

1.7 Objectives ...... 17

Chapter 2 Pathogenicity, infection process, and survival of Cylindrocladium buxicola on Buxus and Pachysandra terminalis ...... 18

2.1 Introduction ...... 18

2.1.1 Boxwood blight caused by Cylindrocladium buxicola ...... 18

2.1.2 Disease development and survival of Cylindrocladium buxicola ...... 18

2.1.3 Host Range of Cylindrocladium buxicola ...... 20

2.1.4 Causal agent identification ...... 21 vi

2.1.5 Objectives ...... 22

2.2 Materials and methods ...... 23

2.2.1 Collection of Buxus specimens ...... 23

2.2.2 Media preparation and stock cultures ...... 24

2.2.3 Fungal isolation ...... 25

2.2.4 Temperature growth experiment for Cylindrocladium buxicola ...... 26

2.2.5 Survival of Cylindrocladium buxicola under laboratory and field conditions ...... 27

2.2.6 Infection process of Cylindrocladium buxicola on detached ‘Green Mountain’ leaves

...... 29

2.2.7 Pathogenicity on detached leaves of Buxus and Pachysandra terminalis ...... 30

2.2.8 Pathogenicity on whole Buxus and Pachysandra terminalis plants ...... 33

2.2.9 DNA extraction and PCR analysis ...... 34

2.3 Results and discussion ...... 36

2.3.1 Collection of Buxus species and fungal isolation ...... 36

2.3.2 Koch’s postulates ...... 38

2.3.3 Temperature growth analysis ...... 39

2.3.4 Survival and viability of Cylindrocladium buxicola ...... 40

vii

2.3.5 Disease development of Cylindrocladium buxicola on detached ‘Green Mountain’

leaves...... 44

2.3.6 Pathogenicity experiments on Buxus and Pachysandra terminalis ...... 47

2.3.7 Pathogenicity experiments on whole Buxus and Pachysandra terminalis plants ...... 50

2.4 Conclusions ...... 52

Chapter 3 Genome Assembly, Genetic Variation, and Specific Detection of C. buxicola ...... 74

3.1 Introduction ...... 74

3.1.1 Genome assembly and gene prediction...... 74

3.1.2 Specific detection of fungal pathogens ...... 79

3.1.3 Specific detection of Cylindrocladium buxicola...... 80

3.1.4 Genetic diversity of fungal plant pathogens ...... 81

3.1.5 Genetic diversity of Cylindrocladium buxicola ...... 82

3.1.6 Fungal mating type genes and sexual reproduction ...... 83

3.1.7 Sexual reproduction in Cylindrocladium buxicola ...... 85

3.1.8 Objectives ...... 86

3.2 Materials and methods ...... 86

3.2.1 Genome assembly and gene prediction of Cylindrocladium buxicola ...... 86

3.2.2 Specific detection of Cylindrocladium buxicola...... 88 viii

3.2.3 Selection of unique gene primers ...... 90

3.2.4 Co-amplification with unique gene primers ...... 91

3.2.5 ISSR primer screening and analysis ...... 93

3.2.6 Search for mating type genes within Cylindrocladium buxicola ...... 95

3.2.7 Mating type crosses...... 96

3.2.8 Comparison of two different isolates of Cylindrocladium buxicola ...... 97

3.3 Results and discussion ...... 98

3.3.1 Genome assembly and gene prediction...... 98

3.3.2 ITS and unique gene primers for Cylindrocladium buxicola ...... 100

3.3.3 Co-amplification with unique gene primers ...... 104

3.3.4 Genetic variation in Cylindrocladium buxicola ...... 109

3.3.5 Identification of mating type genes for Cylindrocladium buxicola ...... 110

3.3.6 Mating type crosses...... 113

3.3.7 Genomic comparisons of the Ontario and German isolates...... 114

3.3.8 Conclusions ...... 117

Chapter 4 Sensitivity of Cylindrocladium buxicola to fungicides, and chemical management of box blight ...... 123

4.1 Introduction ...... 123 ix

4.1.1 History of fungicide use ...... 123

4.1.2 Fungicides and the ornamental industry ...... 125

4.1.3 Fungicide use on woody ornamentals in Ontario ...... 126

4.1.4 Emergence of box blight caused by Cylindrocladium buxicola ...... 130

4.1.5 Objectives ...... 132

4.2 Materials and methods ...... 132

4.2.1 In-vitro fungicide sensitivity tests on amended PDA ...... 132

4.2.2 Detached leaf fungicide trials ...... 134

4.2.3 Whole plant fungicide trials ...... 135

4.3 Results ...... 137

4.3.1 In-vitro sensitivity on amended PDA ...... 137

4.3.2 Detached leaf fungicide trials ...... 138

4.3.3 Whole plant fungicide trials ...... 139

4.4 Discussion ...... 140

Chapter 5 General Discussion and Conclusions ...... 156

5.1 Major conclusions ...... 156

5.2 General discussion, future research, and conclusions ...... 157

LIST OF TABLES

Table 2.1. Origin of the 10 C. buxicola isolates used in the first temperature growth experiment and the mean mycelial growth (mm/d) of each isolate at each temperature. Each isolate by temperature combination was replicated three times and isolates were incubated in screw cap tubes at 4, 10, 15, 20, 25, and 30°C for 23 d...... 54

Table 2.2. Mean mycelial growth (mm/d) of five isolates of C. buxicola (12001, 12013, 12015,

12018, and 12176) at each temperature for the second temperature growth experiment. Each isolate by temperature combination was replicated 4 times and isolates were incubated in screw cap tubes at 10, 15, 20, and 25 for 29 d...... 55

Table 2.3. Origin of the 5 C. buxicola isolates used in the second temperature growth experiment and the mean mycelial growth (mm/d) of each isolate at each temperature. Each isolate by temperature combination was replicated four times and isolates were incubated in screw cap tubes at 10, 15, 20, and 25 for 29 d...... 56

Table 2.4. Percent viability of boxwood leaves over time infected with C. buxicola from isolate

12031, where the leaves were stored at either 4°C or 23°C on autoclaved sand in Petri plates.

There were five replicate plates per temperature, and for each sampling period, four leaf pieces for each of the five replicate plates were surface sterilized in ethanol and bleach before being plated on antibiotic PDA. Viability was rated as a percentage out of 100 for each of the five replicate plates...... 57

Table 2.5. Percent viability by depth of two C. buxicola isolates on infected leaf tissue buried to three different depths at the GTI. Samples were collected 1 month after burial in November of

2012 and after snowmelt in April 2013. Leaves were inoculated with either isolate 12018 (BC) or xi

12176 (Ontario) where there were three replicate plates per depth. After each collection, a total of four leaf pieces for each of the three replicate plates were surface sterilized in ethanol and bleach before being plated onto antibiotic PDA. Viability was rated as a percentage out of 100 for each of the four leaf pieces...... 58

Table 2.6. Percent viability of C. buxicola on infected leaf tissue buried to three different depths,

1, 2, 3, and 4 months after burial in August 2013 at the GTI. Leaves were inoculated with isolate

12031 (Ontario) where there were three replicate plates per depth. After each collection, a total of four leaf pieces for each of the three replicate plates were surface sterilized in ethanol and bleach before being plated onto antibiotic PDA. Viability was rated as a percentage out of 100 for each of the four leaf pieces...... 59

Table 2.7. Mean percentage of germination and penetration of C. buxicola spores from isolate

12031 (Ontario) over a 24 hour period on detached ‘Green Mountain’ leaves. Where the leaves were inoculated with a spore suspension with a concentration of 1.0 x 106 spores/ml and stored at room temperature...... 60

Table 2.8. Mean infection rate of ‘Green Velvet’ boxwood leaves inoculated with mycelial plugs

(5 mm diameter) of an Ontario isolate (12031) of C. buxicola, where the inoculum was placed on either the abaxial or the adaxial surface of detached leaves. There were six replicate plates with four leaves per plate. A total of three plates contained leaves where the abaxial surface was inoculated and the other three plates contained leaves where the adaxial surface was inoculated

The hyphal plugs were removed 4 days post inoculation (dpi), disease severity was measured 5,

7, 10, 13, and 17 dpi, and the plates were stored at 25°C with a 24 h photoperiod at 270

µmol/m2/s...... 61

xii

Table 2.9. Mean infection rate of ‘Green Velvet’ boxwood leaves inoculated with a spore suspension (2.0 x 105 spores/ml) of an Ontario (12031) isolate of C. buxicola, where the inoculum was placed on either the abaxial or the adaxial surface of detached leaves. There were six replicate plates with four leaves per plate. A total of three plates contained leaves where the abaxial surface was inoculated and the other three plates contained leaves where the adaxial surface was inoculated. Disease severity was measured 5, 7, 10, 13, and 17 dpi and the plates were stored at 25°C with a 24 h photoperiod at 270 µmol/m2/s...... 62

Table 2.10. Mean infection rate of ‘Green Gem’ boxwood leaves inoculated with plugs of an

Ontario (12031) isolate of C. buxicola, where the plugs were removed 1, 2, 3, and 4 days post inoculation (dpi). For each time period after plug removal there were three replicate plates with four leaves per plate. Disease severity was measured every other day for two weeks, the average infection was calculated for each time period and the leaves were stored at 23°C with a 24 h photoperiod at 270 µmol/m2/s...... 63

Table 2.11. Comparison of the susceptibility of young and old detached ‘Green Mountain’ boxwood leaves inoculated with plugs of an Ontario isolate (12031) of C. buxicola, where the plugs were removed 1 day post inoculation (dpi). There were three replicate plates of either old or young boxwood leaves with four leaves per plate and disease severity was measured 2, 4, and

6 dpi. Leaves were incubated at 25°C with a 24 h photoperiod at 270 µmol/m2/s...... 64

Table 2.12. Disease severity on detached leaves of four boxwood cultivars, where disease severity was measured 5, 7, 10, 13, and 17 days post inoculation (dpi). Leaves were inoculated with mycelial plugs (5 mm diameter) of an Ontario isolate (12031) of C. buxicola. There were three replicate plates with four leaves per plate for each boxwood cultivar. The plants were incubated with 24 hr photoperiod at 270 µmol/m2/s at 25°C...... 65

xiii

Table 2.13 Disease severity on detached leaves of four boxwood cultivars, where disease severity was measured 5, 7, 10, 13, and 17 days post inoculation (dpi). Leaves were inoculated with a spore suspension (2.0 x 105 spores/ml) of an Ontario isolate (12031) of C. buxicola. There were three replicate plates with four leaves per plate for each boxwood cultivar. The plants were incubated with a 24 hr photoperiod at 270 µmol/m2/s at 25°C. The averages in this table represent the combined means for two replicate experiments using spore suspension as the source of inoculum...... 66

Table 2.14. Average disease severity on detached boxwood leaves at five different temperatures, where disease severity was measured 3, 6, 8, 10, and 16 days post inoculation (dpi). Leaves were inoculated with a spore suspension (2.0 x 105 spores/ml) of an Ontario isolate (12031) of C. buxicola. There were four replicate plates with four leaves per plate for each temperature. The leaves were incubated at 25, 22, 15, 10, and 4°C for 2 weeks with 24 hr photoperiod at 270

µmol/m2/s...... 67

Table 3.1. Top ranking assemblies obtained using SOAPdenovo for C. buxicola genomes 12013 and 12034 based on single lanes of 100 bp paired-end reads...... 118

Table 3.2. Estimate of the amount of fungal tissue present in infected boxwood leaves determined by the ratio of band intensities amplified by fungal and chloroplast primers. DNA was extracted from infected ‘Green Velvet’ leaves 7, 14, and 21 days post inoculation (dpi) representing low, mid, and high levels of infection respectively. Unique fungal gene primers targeted fungal DNA in the 600 bp region and chloroplast primers targeted plant DNA in the

1000 bp region. Image J was used to determine the ratio of fungal DNA present relative to the amount of chloroplast DNA present...... 119

Table 3.3. Isolates of Cylindrocladium tested with both MAT1-1 and MAT1-2 primers ...... 120

xiv

Table 3.4. Number of genes found in one isolate which were not found in the corresponding isolate at three different e-value cut offs of 1e-5, 1e-50, and 1e-100. The two genomes which were compared were of isolate 12013 from Germany and isolate 12034 from Ontario...... 121

Table 4.1. Fungicides used for the in vitro sensitivity tests, detached leaf trials, and whole plant trials. Fungicides were prepared as 1000 ppm stock solutions for the in-vitro sensitivity tests and the fungicides were mixed in 1 L of water according to the recommended application rates for the detached leaf trials and whole plant trials...... 146

Table 4.2. EC50 values for five C. buxicola isolates based on both probit analysis and visual estimations from scatter plots of inhibition vs. log concentration of mycelial growth on PDA amended with Banner Maxx, Phyton-Nova, or Switch at 0.01, 0.1, 1 and 10 µg/ml at 20°C for 21 d. Each isolate by fungicide combination was repeated three times...... 147

Table 4.3. Average amount of infection on detached ‘Green Mound’ boxwood leaves sprayed with six different fungicides and then inoculated with a spore suspension of C. buxicola 1, 3, 5 and 7 days after fungicide application. Leaves were monitored for 7 days where there were three replicate plates for each fungicide with four leaves per plate. The spore suspension had a concentration of 6.0 x10 5 spores/ml. The plants were incubated with a 24 hr photoperiod at 270

µmol/m2/s at 25°C...... 148

Table 4.4. Average amount of infection on detached ‘Green Mound’ boxwood leaves inoculated with a spore suspension of C. buxicola and then sprayed with six different fungicides 1, 3, 5 and

7 days after inoculation. Leaves were monitored for 7 days where there were three replicate plates for each fungicide with four leaves per plate. The spore suspension had a concentration of

6.0 x10 5 spores/ml. The plants were incubated with a 24 hr photoperiod at 270 µmol/m2/s at

25°C...... 149

Table 4.5. Average amount of infection on whole ‘Green Mound’ boxwood plants for both preventative and curative fungicide trials. For the preventative trials, the plants were sprayed with six different fungicides and then inoculated with a spore suspension of C. buxicola 7 days after fungicide application. For the curative trials, plants were inoculated with a spore suspension of C. buxicola and then sprayed with six different fungicides 1 day after inoculation. Plants were monitored for 7 days where there were three replicate plants for each fungicide with 10 leaves cut prior to inoculation with C. buxicola. The spore suspension had a concentration of 5.0 x 105 spores/ml. The plants were incubated with a 24 hr photoperiod at 270 µmol/m2/s at 25°C...... 150

xvi

TABLE OF FIGURES

Figure 2.1. Signs and symptoms of C. buxicola on ‘Green Mountain’ boxwood ...... 68

Figure 2.2. Screw cap tubes were used to assess growth optima for C. buxicola. Each tubes was filled with 5.5 ml of PDA and a hyphal plug was placed at the mouth of each tube. The extent of fungal growth was marked every 3 d…………………………………………………………….69

Figure 2.3. A. Germination of conidia 3 hpi. B. Penetration of germ tube into the stomata of the leaf 21 hpi. C. An incubation period between penetration and the production of sporodochia. D.

Sporulation and production of signs and symptoms on the leaf 72 hpi………………………….70

Figure 2.4. Chlamydospores forming on ‘Green Mountain’ leaves after being incubated with a spore suspension of C. buxicola (2.0 x 105 spores/ml) for 4 weeks………………………….....71

Figure 2.5. Pachysandra terminalis 7 dpi with C. buxicola applied as spore suspension with a concentration of 2.0 x 105 spores/ml. Plants were stored at 20°C under a 24 h photoperiod with a light intensity of 115 µmol/m2/s…………………………………………………………………72

Figure 2.6. ‘Green Mountain’ boxwood cutting 7 dpi with leaves injured prior to inoculation with C. buxicola. Injury was induced by scratching the leaf surface with a sterilized probe and the leaves were then inoculated with a spore suspension with a concentration of 2.0 x 105 spores/ml. Plants were stored at 20°C under a 24 hr photoperiod with a light intensity of 115

µmol/m2/s……………………………………………………………………………………….73

Figure 3.1. ISSR PCR analysis, using primer (ACC)6CCA, for C. buxicola isolates from

Belgium (12001), Germany (12013), Italy (12015), B.C. (12018), and Ontario (12171, 12172), where a polymorphic banding pattern is present for the German isolate indicating that this isolate is genetically different from the rest of the isolates…………………………………………….122 xvii

Figure 4.1. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Banner. A regression analysis was conducted for each fungicide…………………..151

Figure 4.2. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Phyton-Nova. A regression analysis was conducted for each fungicide……………152

Figure 4.3. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Switch. A regression analysis was conducted for each fungicide…………………...153

Figure 4.4. Example of the placement of the 5 different C. buxicola isolates on amended PDA where each fungicide by replicate combination is repeated 3 times (0.01, 0.1, 1, and 10 µg/ml at

20°C for 21d)…………………………………………………………………………………...154

Figure 4.5.Example of a Petri plate with three 1 cm strips of amended PDA with a different C. buxicola isolate on each strip. The reverse image of the plate demonstrates the markings made with permanent marker every other day at the extent of fungal growth at 20°C for 21d………155

xviii

LIST OF APPENDICES

Appendix 2.1 Example of PROC GLM statement…………………………………………….181

Appendix 2.2. Air temperature, total rain, total snow, and total precipiation from November

2012 until April 2013 at the Guelph Turfgrass Institute. Obtained from Environment

Canada………………………………………………………………………………………….182

Appendix 2.3. Air temperature, total rain, total snow, and total precipiation at the Guelph

Turfgrass Insititute from August 2013 until December 2013. Obtained from Environment

Canada…………………………………………………………………………………………..183

Appendix 2.4. Example of the temperature gradient in the soil between 5 cm, 10 cm, and 20 cm.

Obtained from the University of Waterloo weather station…………………………………….184

Appendix 2.5. Arrangement of burial samples for the 2012 winter trial at the GTI where there were seven sampling dates with 3 replicate stakes per sampling date. Each stake had 6 bags containing leaf pieces infected with either isolate 12176 or isolate 12018 of C. buxicola. The bags were buried to 0, 10, and 20 cm. Stakes were placed in between four maple trees where the experimental design was completely randomized……………………………………………..185

Appendix 2.6. Arrangement of burial samples for the 2013 fall trial at the GTI where there were four sampling dates with 3 replicate stakes per sampling date. Each stake had 3 bags containing leaf pieces infected with the isolate 12032 of C. buxicola. The bags were buried to 0, 10, and 20 cm. Stakes were placed in between four maple trees where the experimental design was completely randomized………………………………………………………………………..186

Appendix 2.7. BLAST results for ITS PCR product from the DNA extracted from colonies which resembled C. buxicola, isolated from symptomatic boxwood leaves…………………...187 xix

Appendix 3.1. Sample script used to calculate assembly statistics ...... 188

Appendix 3.2. Sample script used to create FASTA sequences from AUGUSTUS output ...... 189

Appendix 3.3. List of 10 closely related ITS sequences from species closely related to C. buxicola, including two isolates of C. buxicola which were aligned to identify unique regions to design ITS specific primers...... 190

Appendix 3.4. List of 34 fungal genomes used to compare to the predicted gene set of C. buxicola to locate unique genes within the C. buxicola genome...... 191

Appendix 3.5. Sample script used to split a multi-record BLAST output file into individual records...... 192

Appendix 3.6. Sample script used to retrieve FASTA files from a list of FASTA headers. .... 193

Appendix 3.7. Sample script used to take specified text formatted BLAST files to then return e- values and bit scores for the top two hits ...... 194

Appendix 3.8. Sample of script used to eliminate sequences which were less than 100 aa or 300 bp from a file...... 195

Appendix 3.9. Primer design #1 from an apparently unique gene from the genome of C. buxicola isolate 12034...... 196

Appendix 3.10. Primer design #2 from an apparently unique gene from the genome of C. buxicola isolate 12034...... 197

Appendix 3.11. Primer design #3 from an apparently unique gene from the genome of C. buxicola isolate 12034 ...... 198

Appendix 3.12. Primer design #4 from an apparently unique gene from the genome of C. buxicola isolate 12034 ...... 199

Appendix 3.13. Primer design from the MAT1-2 region of C. buxicola ...... 200

Appendix 3.14. Primer design from the MAT1-1 region of C. buxicola ...... 201

Appendix 3.15. Sample script used to retrieve genes found only in one C. buxicola isolate but not the other when the predicted genes from two C. buxicola isolates were compared ...... 202

Appendix 3.16. Sample script used to organize BLAST results according to e-value ...... 203

Appendix 3.17. Complete atpB and rbcL genes with the spacer region between for Phoenix dactylifera ...... 204

Appendix 3.18. Alignment of species closely related to Buxus for the redesign of chloroplast primers cp_atpB-1 and cp_rbcL-1 ...... 205

Appendix 3.19. Synteny of genes surrounding the MAT1-1 and MAT1-2 genes ...... 206

Appendix 4.1. Example of SAS PROBIT statement used to analyzed EC50 values for seven different fungicides ...... 207

Appendix 4.2. Example graph of concentration vs. response for the fungicide banner. The 50% inhibition values were visually estimated from this graph...... 209

xxi

LIST OF ABBREVIATIONS AND ACRONYMS

ABySS: Assembly By Short Sequences AFLP: Amplified Fragment Length Polymorphism ANOVA: Analysis Of Variance B.C.: British Columbia BLASTn: Basic Local Alignment Search Tool (nucleotide vs. nucleotides) BLASTp: Basic Local Alignment Search Tool (protein vs. proteins) BLASTx: Basic Local Alignment Search Tool (translated nucleotide vs. proteins) bp: Base Pair(s) CAES: Connecticut Agriculture Experiment Station cm: Centimetre d: day DAS: Days After Sowing DMI: Demethylation Inhibitor DNA: DeoxyriboNucleic Acid dNTP: DeoxyriboNucleotide TriPhosphate dpi: Days Post-Inoculation EDTA: Ethylene Diamine Tetraacetic Acid EF-1α: Elongation Factor-1 α GLM: General Linear Model GTI: Guelph Turfgrass Institute IPM: Integrative Pest Management ISSR: Inter Simple Sequence Repeat ITS: Internal Transcribed Spacer h: Hours HMG: High-Mobility Group hpi: Hours Post Inoculation L: Litre LSD: Least Significant Difference m: metre MAT: Mating Type Mb: MegaBase(s) (i.e. 106 base pairs) min: minute ml: Millilitre mm: Millimetre µl: Microlitre µm: Micrometre N50: the contig size at which 50% of all bases in the assembly are contained in contigs/scaffolds that are larger or smaller than this value NCBI: National Centre for Biotechnology Information

xxii

LIST OF ABBREVIATIONS AND ACRONYMS CONTINUED

NGS: Next-Generation Sequencing NCSU: North Carolina State University NT: Nucleotide ON: Ontario OMAF: Ontario Ministry of Agriculture and Food ORF: Open Reading Frame PCR: Polymerase Chain Reaction PDA: Potato Dextrose Agar PE: Paired End PERL: Practical Extraction and Report Language PMRA: Pest Management Regulatory Agency qPCR: quantitative Polymerase Chain Reaction RAPD: Random Amplified Polymorphic DNA rDNA: Ribosomal DeoxyriboNucleic Acid RFLP: Restriction Fragment Length Polymorphism rpm: Revolutions Per Minute s: Second(s) SBS: Sequence By Synthesis SDS: Sodium Dodecyl Sulfate SOAP: Short Oligonucleotide Analysis Program SSAKE: Short Sequence Assembler by K-mer search and 3’ read Extension TBE: Tris Borate EDTA tBLASTn: Basic Local Alignment Search Tool (protein vs. translated nucleotides) tBLASTx: Basic Local Alignment Search Tool (translated nucleotide vs. translated nucleotide) TE: Tris EDTA x g: Times Gravity (relative centrifugal force) UG: Unique Gene UK: United Kingdom US: United States UV: Ultra Violet VCAKE: Verified Consensus Assembly By K-mer Extension v/v: volume of solute per volume of solvent (percent)

xxiii

Chapter 1 Literature Review

1.1 Introduction

1.1.1 Boxwood species and their uses

Boxwood plants (Buxus species) are historically popular for their extensive use in landscape trades, home gardens, and public grounds. Boxwood has a wide range of uses; as plants alone or in combination with other plant material, they can act as a foundation for homes or public buildings, to separate, enclose or to provide background for other plantings (Relf et al.

2001). Buxus species also have a wide range in potential size and rate of growth and there are also several variations in size of foliage, colour, and texture characteristics (Relf et al. 2001).

There are 90 species of boxwood in various part of the world; however only three boxwood species along with the hybrids of these species are used in nurseries and landscape trades. These species are Buxus microphylla, B. sempervirens, and B. sinica var. insularis (Niemiera 2012).

Littleleaf boxwood or B. microphylla is a slow growing shrub with a compact round form and is rarely more than 0.9 meters tall. B. sempervirens or common boxwood is a wide spreading shrub or small tree with dense evergreen foliage, growing to heights of 1.5 to 3 meters. The last variety B. sinica var. insularis also known as Korean boxwood ranges from 0.6 to 2 meters tall and has similar leaves but a less compact habitat compared to common boxwood. Korean boxwood is also quite hardy and can tolerate low minimum temperatures over the winter (Relf et al. 2001; Niemiera 2012). It is common to cross these species in several different combinations to create unique boxwood cultivars, which possess characteristics desired by the nursery industry.

Boxwood cultivars or varieties can only reproduce by vegetative propagation and they are chosen based on their size, form, and insect or disease resistance (Relf et al. 2001). There are four boxwood cultivars commonly grown in nurseries in Ontario and these are‘Green Mountain,’

‘Green Gem,’ ‘Green Mound,’ and ‘Green Velvet.’ The Green series was introduced in Ontario by Sheridan Nurseries, and are a cross between B. microphylla var. koreana and B. sempervirens

(Pacholko 2012 ). These boxwood cultivars thrive in soils with a neutral to alkaline pH (6.5 to

7.2), which is well mulched with sufficient moisture. The plants also prefer areas in partial shade, away from the dripline of a tree or any area which stays constantly wet. However in general the ‘Green Series’ are more cold hardy and are tolerant to more full sun than most other varieties available (Pacholko 2012 ).

1.2 Major fungal diseases on boxwood

The major diseases of boxwood are caused by several fungal species. These are

Macrophoma leaf spot caused by Macrophoma candollei, Phytophthora root rot caused by

Phytophthora parasitica and P. cinnamomi, boxwood decline caused by Paecilomyces buxi, and

Volutella blight caused by Pseudonectria buxi. Each of these diseases is discussed in the following subsections, except for box blight which follows in its own section (1.3).

1.2.1 Macrophoma leaf spot

Macrophoma leaf spot is caused by the ascomycetous fungus Macrophoma candollei.

Symptoms can vary from spotting to browning and yellowing along with raised black dots, which represent the asexual spore-producing bodies, pycnidia (Jacobi 2003). This fungus is a secondary colonizer of leaves, meaning that if the host is already injured or damaged it is more likely to be infected, while healthy vigorous plants are rarely infected (Moorman 2012).

Therefore an effective control strategy for this disease is correcting other disease or cultural problems to allow plants to prosper. This involves providing water during dry conditions, avoiding overwatering, providing proper nutrition, and thinning shrubs to improve light and air circulation (Jacobi 2003). Macrophoma leaf spot does not cause significant damage to boxwood plants and it is sometimes suggested that no specific controls are needed for this disease

(Malinoski and Bosmans 2012 ).

1.2.2 Phytophthora root rot

This disease is caused by the oomycetes, Phytophthora parasitica and P. cinnamomi, and is common in poorly drained soils with incorrect irrigation and deep planting (Jacobi 2003).

Abundant moisture allows the motile spores of Phytophthora to move in the soil, infecting new roots on the same or adjacent plants (Hansen 2009). Some of the initial symptoms of this disease include an overall loss of plant luster while leaves transition from dark to light green as the plant experiences dieback. The leaves turn upward and lateral leaf margins roll inward, symptoms may be present on one branch or throughout the entire plant while the leaves become light and straw coloured upon plant death (Jacobi 2003; Hansen 2009). The source of infection is located in the roots of the host, affected roots are often dark brown with visible signs of rotting, and the outer layer of rotted roots breaks off easily leaving the raw portion of the roots exposed (Jacobi 2003).

Often in severe cases, the bark at the base of infected plants just above the soil line appears dark and discoloured. Chemicals have often been found to be ineffective in controlling this disease especially after aboveground symptoms become apparent; however soil drenching of fungicides can be used to prevent disease on plants which do not have severe root rot (Hansen

2009; Benson 2000). Some cultural practices which can help prevent root rot include purchasing disease-free plants and avoiding plants which lack normal green colour and appear wilted in the 3

morning. Placing plants which are more susceptible to root rot in well drained areas and ensuring the plants are not deeper than the soil level in the container are cultural controls for this disease

(Benson 2000).

1.2.3 Boxwood decline

Boxwood decline can be described as a slow but progressive deterioration, typically in large plants which are 20 years or more in age (Hansen 2009). A complex of fungi is responsible for the decline, but the fungus Paecilomyces buxi is believed to be the primary pathogen.

Symptoms include loss of colour along with the foliage turning grey-green then yellow or bleaching out. The result is death of entire branches usually in the middle portion of the crown, where the branches separate from the stem, leaving brown streaks on the stems (Baniecki 2012 ).

The symptoms are similar to those of root rot; however root rot is primarily an issue in moist or wet soils whereas boxwood decline usually occurs following a drought event (Hansen 2009). In terms of disease control, efforts should be made to maintain healthy vigorous plants because drought stress is known to be one of the main causal factors that predispose plants to disease

(Hansen 2009). Some other important cultural practices include well drained soils, watering plants only when necessary, providing protection from winter injury and shade from the sun in a hot summer (Baniecki 2012 ).

1.2.4 Volutella blight

Volutella blight is caused by the fungus Pseudonectria buxi (previously known as

Volutella buxi) and it is most common on non-vigorous or wounded boxwood plants, however it can also occur on healthy plants (Jacobi 2003). Symptoms of Volutella blight range from yellow leaves on green stems to entirely dead shoots, including cream to light pink fruiting bodies of the

fungus on leaves and twigs, where the leaves turn from dark green to orange or bronze (Shi and

Hsiang 2013). The infected leaves will turn upward and lie close to the stem instead of spreading out like healthy leaves (Jacobi 2003). Sporodochia which are 50-240 µm in diameter form on the abaxial surface of recently killed leaves. Conidia are ellipsoid with rounded ends, 4.4- 5.8 x 2.1 x

2.9 µm in size, hyaline and smooth (Rossman et al. 1993). After 5 days in culture on PDA, the colonies are 2.2-2.4 cm in diameter with aerial white mycelium and pale salmon masses of slimy conidia (Rossman et al. 1993). To prevent and control Volutella blight, good sanitation practices such as removing diseased branches and leaf litter are essential. Promoting plant vigor is also important such as preventing plants from unnecessary wounds or winter injury (Jacobi 2003).

Volutella stem blight can easily be confused with box blight caused by C. buxicola because the symptoms are similar superficially. Similar to C. buxicola, P. buxi causes dieback of individual shoots, does not infect the roots, and both fungi cause black streaking to occur on the stems of boxwood plants. P. buxi is an opportunistic fungus common on boxwood stems and foliage following spring frost injury (Dart 2011). However, P. buxi requires wounds to infect host plants and is often considered a secondary pathogen, whereas C. buxicola does not appear to need a wound to infect but can penetrate directly through the cuticle (Ivors 2011). There is a high frequency of P. buxi found on dead tissue which indicates that this pathogen is a secondary invader. However, P. buxi was also found to be capable of primary invasion after wounding, meaning the occurrence of Volutella blight did not seem to require pre-existing infection by other pathogens (Shi and Hsiang 2013).

Both of these fungi can occur together on the same host. In contrast to the white stellate spore clusters of C. buxicola, P. buxi forms salmon coloured, amorphous spore masses on the leaves (Dart 2011) Both of these spore masses are visible to the naked eye on the lower surface

of boxwood leaves. Unlike C. buxicola, P. buxi typically does not cause brown circular leaf spot, and Volutella blight typically blights one branch at a time, whereas box blight will blight out the bottom foliage first and moves up the plant gradually giving the host a top heavy appearance (Ivors 2011).

The distinguishing morphological feature which separates P. buxi from C. buxicola is the shape of the conidia. C. buxicola is characterized by having hyaline, cylindrical conidia, which are multicellular, uniseptate with obtuse ends, mostly enclosed in an irregular mucilaginous matrix in contrast to the conidia of P. buxi , which are single celled, ellipsoid with rounded ends

(Crous et al. 1991). The shape of the conidiophores of C. buxicola is also unique with diamond shaped vesicles forming at the tip of the conidiophores compared to P. buxi whose conidiophores are un-branched monophialidic, slender, tapering to an apex, and septate only at the base

(Rossman et al. 1993).

1.2.5 Box Blight

A new fungus, Cylindrocladium buxicola, which causes severe disease on boxwood plants has recently been discovered in North America and is causing concerns for nursery growers in Canada, specifically in British Columbia and in Ontario where the fungus has recently been identified (Elmhirst et al. 2013). The blight disease can seriously impact the appearance and aesthetics of boxwood because the entire foliage can become blighted which means the plants are no longer commercially viable (Ivors et al. 2012). This disease differs from

Volutella blight in being much more aggressive, attacking, infecting and killing unwounded plants. However both diseases can be found together on the same plant tissues and the fungal growth and spores of both can be mixed together.

1.3 Box blight caused by Cylindrocladium buxicola

The fungus was first found in the United Kingdom (UK) in 1994 causing blight disease on Buxus species (Ivors 2011). No new cases were reported until 1997, and by that time, the disease was considered to be widespread throughout Europe (Henricot and Culham 2002).

The fungus was first isolated and initially indentified as Cylindrocladium scoparium which causes disease on a wide range of hosts worldwide (Henricot and Culham 2002). The symptoms reported included root rot, stem lesions, stem cankers, stem dieback and leaf spots. However, this fungus is one of the most commonly misidentified species of the genus because of variability in some of its morphological characteristics (Henricot and Culham 2002). In 1998, the fungus was identified as C. spathulatum in New Zealand (Ridley 1998). Henricot and Culham (2002) conducted phylogenetic analyses using DNA from many related species and identified the fungus as C. buxicola. During the same year, Crous et al. (2002) studied the fungus and named it C. pseudoviculatum, and since Crous et al. published their paper prior to Henricot and Culham, this is the proper name for the disease even though most researchers still refer to it as C. buxicola.

Recently, Henricot et al. (2012) proposed that the name Cylindrocladium buxicola be conserved over C. pseudonaviculatum. Additionally, C. buxicola has been mentioned 121 times compared to 32 times for C. pseudonaviculatum on scholar.google.com as of 11 March 2014.

After several reports began to appear in the literature from areas all over Europe:

Belgium (Crepel and Inghelbrecht 2003), Northwest Germany (Brand 2005), Italy(Saracchi et al.

2008), Switzerland (Vincent 2009), Spain (Varela et al. 2009), Croatia (Cech et al. 2010), the

Georgian Republic (Gorgiladze et al. 2011), Czech Republic (Åafrankova et al. 2012), and

Turkey (Akilli et al. 2012). Most recently C. buxicola was discovered in North America in

November 2011 first in North Carolina and then other USA states, in British Columbia in

December of 2011, and in Ontario in March of 2012 (Elmhirst et al. 2013; Ivors et al. 2012). In all of these locations in North America, the recommendation has been to destroy infected and possibly infected plants to contain the outbreak. This disease has spread rapidly throughout

Europe, has caused extensive damage, and is expected to do the same in North America unless extensive efforts are made to halt the spread (Ivors 2011).

1.3.1 Signs and symptoms of Cylindrocladium buxicola

According to Ivors (2011) the symptoms of boxwood blight include dark or light brown spots on leaves with dark borders, black streaks or cankers on stems, bronzed foliage as well as severe defoliation. Sporulation can be seen in high humidity on the underside of the leaves revealing white fuzzy spore masses called sporodochia containing a large number of conidia

(Douglas 2011). This fungus infects all aboveground portions of boxwood and black lesions can be found along stems from shoot tips to the soil line. However, it does not infect the roots like other Cylindrocladium species have been found to do (Douglas 2011). This characteristic of C. buxicola allows time for roots to regenerate after an attack and to support growth after a severe infection (Dart 2011).

Cylindrocladium is characterized by having species with hyaline, cylindrical conidia, septate with obtuse ends, mostly enclosed in an irregular mucilaginous matrix (Crous et al.

1991). C. buxicola has conidiophores comprised of a penicilliate arrangement of fertile branches, the conidiogenous phialide, a stipe, a sterile elongation and a vesicle (Anonymous 2011). The stipe is septate ranging in length from 95-155 µm long, and is hyaline terminating in a broadly ellipsoidal vesicle with a pointed or papillate apex (Anonymous 2011). The vesicle is 6.5-11 µm in diameter, the primary phialide branches are aseptate 15-41 x 3-5 µm, and the secondary phialide branches are aseptate as well, each terminal branch contains 2-5 hyaline, non-septate 8

phialides. Conidia are rounded at both ends, straight, hyaline, asepetate, 42-68 x 4-6 µm, held in cylindrical clusters by a clear slime like matrix (Anonymous 2012a).

Resting spores of C. buxicola or chlamydospores have been identified on carnation leaf agar as dark brown, thickened, and formed in moderate numbers. These chlamydospores eventually aggregate to form microsclerotia. However, neither microsclerotia nor chlamydospores have been observed on host tissues in nature. The colony characteristics include amber brown colonies with a pale luteous outer margin, the reverse colony is fuscous black at the middle which fades to sienna, and the growing mycelium margin is white (Crous et al. 2002).

The growth temperature range is from 5°C to 30°C, the suggested optimum temperature is 25°C, while the fungus is killed after 7 days at 33°C (Anonymous 2011). Thus far, there has been no evidence of the formation of sexual spores on host tissue under lab conditions or in nature.

Additionally, the optimal growth temperature of Ontario isolates of C. buxicola is not known.

1.3.2 Life cycle of Cylindrocladium buxicola

The pathogen has a rapid disease cycle that can be completed within one week; infection can spread quickly in warm, humid conditions (Anonymous 2011; Henricot et al. 2008). High humidity levels or free water are required for infection to occur, and this is why box blight can potentially be a serious problem in a commercial setting where the conditions are especially conducive for infection (Douglas 2011). This disease thrives in nurseries where susceptible plants are often grown in close proximity in the field or in a green house. The levels of humidity are often high and overhead irrigation is the preferred watering method which creates an environment favourable for disease development (Douglas 2011).

When spores are dispersed they can be carried short distances through water, contaminated tools and possibly by birds or other animals, however they are unlikely to travel 9

long distances by wind due to the sticky nature of the spores (Anonymous 2011). Germination of spores can occur 3 hours after inoculation with penetration occurring in as little as 5 hours.

Hyphae have the ability to actively penetrate plant cuticles without appressorial formation or the hyphae can enter passively through leaf stomata (Anonymous 2011). Fungal growth can occur intercellularly in the plant mesophyll producing conidia on conidiophores on the underside of the leaf after 7 days. Infested litter has been shown to carry live C. buxicola propagules for up to five years in the soil in the UK (Henricot and Culham 2002). Infected plant material is the primary method for long distance dispersal, and a major factor for the unintentional spread of this disease is the movement of asymptomatic boxwood plants with few visible symptoms (Douglas 2011).

The complete infection cycle from germination to sporulation has not been observed on boxwood cultivars commonly grown in Ontario (“Green Mountain,” “Green Gem,” “Green

Velvet,” and “Green Mound”) and not for Canadian isolates of C. buxicola. Similarly, survival of

Ontario C. buxicola isolates in soil and debris under local conditions has not been tested.

1.3.3 Host range and resistance of Cylindrocladium buxicola

This fungus has been observed on leaves and stems of Buxus spp. under natural conditions and there does not appear to be any resistance to this pathogen among the commercial boxwood species available (Anonymous 2011). Henricot et al. (2008) found that none of the 10 boxwood species and cultivars tested were immune to the disease; however Buxus balearica and

Sarcococca spp. showed significantly lower levels of infection. Experiments have shown that the host range within the genus is quite extensive which means that the consequences could be very detrimental if the disease is accidentally introduced to a new region (Henricot et al. 2008). Some varieties of boxwood have been found to be more susceptible than others and this is most likely due to specific physical features of the cultivar such as water-retaining foliage. For example, 10

Buxus sempervirens ‘Suffructicosa’ (English Boxwood) and Buxus sempervirens (American

Boxwood) appear to be particularly susceptible to box blight (Henricot et al. 2008).

Previously it was not known whether other members of the Buxaceae family were susceptible to this disease until a recent report from the Connecticut Agricultural Research

Station demonstrated that Pachysandra terminalis could be infected with C. buxicola.

Pachysandra terminalis also belongs in Buxaceae, and when detached leaves were inoculated with C. buxicola, lesions developed making Pachysandra a potential new host for box blight

(Anonymous 2012b). Anonymous (2011) from NSCU, reports Buxus balearica was the most resistant cultivar when tested among other experimental hosts, such as Buxus bodinieri, Buxus glomerata, and Buxus harlandii. It is not known whether there are any differences in susceptibility between the different boxwood cultivars commonly grown in Ontario, or if there are any differences in susceptibility when comparing young and old boxwood tissue.

1.4 Genetic and molecular analysis of Cylindrocladium buxicola

1.4.1 Genetic diversity within Cylindrocladium buxicola

Aside from studies in the U.K. and in New Zealand (Henricot and Culham 2002;

Henricot et al. 2008), there have been very few studies which have focused on genetic analyses for the fungus C. buxicola, and in the studies that have been reported, there have been none focusing on genetic analyses of North American isolates of C. buxicola. Henricot and Culham

(2002) sequenced variable regions of the C. buxicola genome such as portions of the -tubulin,

ITS, and MAT1-2 genes to better understand the phylogeny of Cylindrocladium. The authors used amplified fragment length polymorphism (AFLP)-fingerprinting to identify any genetic variation between 18 C. buxicola isolates from different geographic regions. They found that the

C. buxicola isolates from the UK and New Zealand showed identical banding patterns with the exception of one isolate (Henricot and Culham 2002). Since the AFLP analysis showed little genetic variation between the isolates, the authors concluded that these isolates could have been clonal originating from a single genotype. This study examined isolates primarily from the U.K., and it is not known whether C. buxicola isolates from a wider range of geographic locations may have genetic differences.

1.4.2 Mating type genes and sexual reproduction in Cylindrocladium buxicola

Heterothallic ascomycetes have single-locus, two idiomorph mating systems which means that mating must occur between strains of opposite mating type. Identifying the presence of both mating type genes within a fungal population is an essential first step towards developing disease management strategies to predict the prospects of sexual reproduction and the production of airborne inoculum (Kronstad and Staben 1997; McCartney et al. 2003). Henricot and Culham

(2002) conducted mating experiments and cloned and sequenced the MAT1-2 gene along with the corresponding HMG box for C. buxicola. A total of 19 isolates of C. buxicola from the UK and New Zealand were mated in all possible combinations and then examined for the production of perithecia. No perithecia were produced in the duration of the experiment, however Henricot and Culham (2002) state that it may be possible that perithecia are produced under different environmental conditions, but the lack of a MAT1-1 gene precluded this.

Perithecia of Cylindrocladium have not been found in controlled lab experiments nor on host tissue in nature (Henricot and Culham 2002; Crous et al. 2002; Anonymous 2011). The teleomorph of C. buxicola remains unknown; however it is possible that MAT1-1 exists in isolates of this species. A wider range of isolates from different geographic regions, including

North America, could provide more insight into whether isolates with the opposite mating type exist.

1.4.3 Pathogen Identification

Advances in molecular based techniques have made the identification of fungi responsible for plant diseases much more efficient and specific (Martin et al. 2000, McCartney et al. 2003). The benefits of molecular identification to control and manage the dispersal of plant pathogens include a significant reduction in time required for testing as well as heightened sensitivity (Martin et al. 2000). This rapid detection is essential for disease control and enables more informed decisions to be made regarding cultivar choice and the timing for the application of chemicals (Ward et al. 2004). Traditional methods rely on interpretation of visual symptoms along with the isolation and culturing of fungi in a laboratory setting, where accuracy depends mainly on the skill of the individual making the diagnosis (McCartney et al. 2003, Ward et al.

2004). Polymerase chain reaction (PCR) provides a simple method for amplifying specific DNA sequences, where the specificity derives from the synthetic oligonucleotide primers (Henson and

French 1993). Both narrow and broad selectivities are possible and depend on the choice of primers, which can either be used to detect a specific pathogen or many organisms in a group of related pathogens (Henson and French 1993).

Important benefits of using molecular-based techniques to control and regulate the movement of pests include significant reduction of time required for testing and the increased sensitivity and specificity gained (Martin et al. 2000). Quantification of phytopathogens in diseased plants is also desirable, especially with ubiquitous phytopathogens that are present on healthy plants or in healthy soils, and disease is related to degree of infection or infestation

(Henson and French 1993). Developing an assay for the identification and quantification of C. buxicola from infected plant tissue is extremely important because this pathogen can be present on apparently innocuous plant ‘carriers’ (Henricot 2006). Therefore, a highly specific detection assay could potentially confirm the presence of this fungus at very low levels of inoculum.

1.5 Cultural and chemical management methods

Recommendations for management of boxwood blight include the following: Pathogen- free material should be obtained from reputable suppliers or nurseries, and once plants and cuttings arrive they should immediately be inspected for symptoms of disease. Newly received plants and cuttings should also be isolated from existing boxwood planting areas for at least one month to ensure that diseases will not be introduced into sterile areas (Douglas 2011). Overhead watering or irrigation should be avoided since water and humidity are essential for the spread of box blight; it is also beneficial to refrain from working with plants when they are wet because this creates conditions conducive for pathogen dissemination (Douglas 2011; Anonymous 2011).

Increasing spaces between plants can also help to reduce humidity and create sufficient air circulation within a production area (Dart 2011). Sanitation methods suggested for this disease include pruning of infected twigs, and removal and destruction of fallen leaves, crop debris and topsoil which may help to reduce the amount of inoculum (Anonymous 2011) . Sanitation of pruning equipment is essential between blocks of host plant material with an effective disinfectant as well as weekly inspections of host plant production areas to scout for infection and to minimize plant debris (Anonymous 2012c). If host plants do become infected, plants should immediately be removed and destroyed.

Cylindrocladium buxicola is very difficult to control with fungicides and masking the problem with fungicides rather than incorporating strict eradication efforts could be problematic. 14

However fungicides can be used in conjunction with other methods to create best management practices. Due to the tight nature of boxwood foliage, it may be difficult to achieve sufficient fungicidal coverage within the plant canopy; therefore it is suggested to apply fungicides to both sides of the leaves which also prevents germination and penetration of the fungus (Anonymous

2011). There are no fungicides specifically labeled for the control of the genus Cylindrocladium on Buxus species, but there are approved commercial products that can be used on boxwood in nurseries (Anonymous 2012d). Henricot et al. (2008) tested the effectiveness of fungicides available to the public as well as to the commercial nursery industry in controlling box blight disease, and found that C. buxicola was more sensitive to the systemic fungicides than to the protectants. The fungicide Stroby (kresoximmethyl) and the fungicide mixtures in Opponent

(epoxiconazole + kresoxim-methyl + pyraclostrobin), Opera (epoxiconazole + pyraclostrobin), and Signum (boscalid + pyraclostrobin) were the most effective at inhibiting mycelial growth and conidial germination based on the 50% inhibition values. Henricot et al. (2008) tested a variety of fungicides in the lab on media and found differences in their ability to inhibit growth of C. buxicola. However many of the fungicides tested in this study are not available in Canada

(e.g. none of the Trade names mentioned above are available for nursery growers in Canada, nor have any fungicides registered for use in Canada been tested against boxwood blight.

Many fungicide tests have been conducted in vitro, but there is a lack of published field or greenhouse test results. An obstacle to successful field tests is the lack of information on the epidemiology of the disease. Henricot et al. (2008) stress the importance of understanding the epidemiology of a disease before attempting to control it using a mixture of chemical and cultural methods. To achieve this understanding, infection tests should be conducted to provide insight on the nature of the pathogen. In 2012, two fungicides were registered for emergency use

in Ontario by the Pest Management Regulatory Agency (PMRA); these fungicides are Switch

62.5 WG (37.5% cyprodinil, 25% fludioxinil) and Daconil 2787 (40% chlorothalonil). Use of these fungicides was approved until December of 2013, and they are recommended to be used in rotation to prevent the development of resistance (Anonymous 2012d) .

1.6 Hypotheses

1. Boxwood varieties commonly grown in Ontario (“Green Gem,” “Green Mountain,” “Green

Velvet,” and “Green Mound”) are equally susceptible to infection by C. buxicola under nursery growth conditions since these derive from genetically similar stock.

2. Isolates of C. buxicola from a world-wide collection are only of a single mating type, congruent with other studies showing only a single mating type in this species

3. Spores and mycelium of C. buxicola can survive for long periods in host tissue or in soil and debris under Southern Ontario conditions, similar to what has been found in other locations

4. Isolates of C. buxicola from Canada show genetic homogeneity, as a result of recent introduction from few sources.

5. Fungicides available in Canada are effective against boxwood blight in controlled environment and field tests.

6. C. buxicola is a mesophilic organism and grows faster at moderate temperature ranges such as

25°C than at low (10°C) or high (35°C) temperatures.

1.7 Objectives

1. Elucidate the susceptibility of different boxwood cultivars and other potential host species, and the growth stage and growth conditions under which tissues are most susceptible

2. Analyze the infection process of C. buxicola

3. Characterize the pathogen C. buxicola for its ability to grow at different temperatures and survive in infected host tissues in control temperature tests

4. Generate primers for specific detection of C. buxicola

5. Examine genetic variation in isolates of C. buxicola

6. Establish effective chemical control methods for box blight

Chapter 2 Pathogenicity, infection process, and survival of Cylindrocladium buxicola on

Buxus and Pachysandra terminalis

2.1 Introduction

2.1.1 Boxwood blight caused by Cylindrocladium buxicola

Box blight, caused by the ascomycete fungus Cylindrocladium buxicola, results in severe dieback and defoliation of Buxus species. The disease was first discovered on boxwood plants in a nursery in Hampshire, UK in 1994 (Henricot 2006). The fungus was initially identified as

Cylindrocladium scoparium, a plant pathogen which causes a disease on a wide range of hosts around the world and is the most misidentified species in the genus because its morphological characteristics resemble those of other species (Henricot 2006). Similarly, leaf and twig blight of boxwood caused by species of Cylindrocladium reported in New Zealand in 1998 were misidentified as C. spathulatum and C. ilicicola (Henricot 2006). The novel species status of C. buxicola was confirmed by Henricot and Culham in (2002) using both morphological characteristics and DNA sequencing data. Since the mid 1990s the disease has spread throughout

Europe, was detected in the U.S. in November of 2011, and reached Ontario in 2012 (Ivors et al.

2012; Henricot et al. 2012).

2.1.2 Disease development and survival of Cylindrocladium buxicola

Boxwood blight also sometimes called box blight causes spots on the leaves, with defoliation occurring from the bottom branches upward, creating a top heavy look for the plant

(Ivors et al. 2012). Diseased plants do not necessarily die completely, but their appearance and aesthetic value is greatly reduced which is why this disease is of serious economic concern for

the nursery industry (Ivors et al. 2012). Symptoms of box blight include brown circular spots on the leaves with dark borders, stem cankers which appear as black streaks, bronzed coloured foliage, and leaf drop (Figure 2.1) (Douglas 2011; Ganci et al. 2013). Leaf spots often coalesce to cover the entire underside of the leaf which will then develop white fuzzy masses called sporodochia containing large numbers of spores (Ganci et al. 2013). Infection caused by C. buxicola is rapid in wet and humid conditions with optimal temperatures between 18 to 25°C. In

2011, during a particularly wet year, there were several examples of established boxwood plantings in Connecticut landscapes that were killed in one season following the introduction of infected plants (Douglas 2011).

Primary infection is unlikely to occur from wind-borne spores due to their sticky nature, and hence the source of primary inoculum is most likely water splashed spores or spores from infected plants (Henricot 2006). The infection process of C. buxicola can be completed in less than one week with spore germination beginning 3 hours post inoculation and penetration occurring 5 hours post inoculation through stomata on the lower surface of leaves or directly through the cuticle on the upper surface (Henricot 2006). No penetration or feeding structures such as haustoria or appressoria have been observed during the infection process, and the leaves will eventually die most likely due to stress from the colonization of intercellular spaces and the deregulation of stomata (Henricot 2006).

Box blight can become a very serious problem in commercial production settings because the conditions are highly conducive for infection: many susceptible plants are grown and propagated in close proximity, and the levels of humidity are often high (Douglas 2011). Once C. buxicola becomes established in production nurseries, regular fungicide sprays are required to control the disease to produce a marketable product which can significantly increase production 19

costs (Dart 2011). This fungus has been described as a low temperature fungus since it is able to grow below 10°C; however growth is inhibited at 30°C, and it is killed at 33°C (Henricot 2006).

C. buxicola also produces resting spores called chalmydospores or microsclerotia which can survive in the soil in the absence of a susceptible host; however these resting structures have not been observed in nature, but only in culture in a laboratory setting (Douglas 2011). Henricot

(2006) reported that the fungus can survive on decomposing leaf material for at least five years even after plant material decomposes.

2.1.3 Host Range of Cylindrocladium buxicola

Box blight has been detected on the three most common Buxus species grown in the nursery industry (B. sempervirens, B. microphylla, and B. sinica var. insularis) and on many cultivars. It is not known if these species are particularly susceptible to the disease or if they are most likely to become infected because of their widespread use as ornamentals (Henricot 2006).

Pathogenicity experiments were carried out on detached boxwood stems demonstrating an extensive host range within the genus Buxus including: B. glomerata, B. balearica, B. bodinieri,

B. glomerata, B. harlandii, B. macowanii, B. riparia, all of which occur naturally in South

America, Asia, Europe and Africa but are not found naturally in Canada or the U.S.

Additionally, Sarcococca, which is in the same family as Buxaceae was found to be susceptible to box blight; however it has never been found to be naturally infected (Henricot 2006).

Similarly, a recent report from the Connecticut Agricultural Research Station demonstrated that

Pachysandra terminalis could be infected with C. buxicola. Pachysandra terminalis is a species in the Buxaceae family, and when detached leaves were inoculated with C. buxicola, lesions developed making pachysandra a potentially important host for box blight (Anonymous 2012b).

Even though no Buxus species has been found to be immune to the disease, there have been reports stating that there is some variation in susceptibility to the pathogen. Based on leaf symptoms and the number of conidia produced by the fungus, B. balearica was the most resistant and B. sempervirens ‘Suffructicosa’ was the most susceptible (Henricot 2006). The apparent resistance seen for B. balearica may be due to the thick, leathery texture of the leaves which would create a disadvantage for a fungus which penetrates directly through the cuticle.

Ganci et al. (2013) also report varying levels of tolerance to C. buxicola in some commercial boxwood taxa and that other members of the Buxaceae family, including

Pachysandra terminalis, are also susceptible. In general Ganci et al. (2013) concluded that B. sempervirens ‘Suffructicosa’ and B. sempervirens ‘American’ were especially susceptible to box blight. More specifically, three of the members of the "Green Series" were rated in the following order from most susceptible to least susceptible: ‘Green Mound,’ ‘Green Mountain,’ and then

‘Green Gem’ (Ganci et al. 2013). These three cultivars are among the most commonly grown cultivars in nurseries in Ontario and the U.S., and are a cross between Buxus microphylla var. koreana and Buxus sempervirens (Pacholko 2012 ).

2.1.4 Causal agent identification

To identify a causal agent from a diseased plant, it is possible to make a tentative diagnosis based on documented literature or by recognition of typical signs and symptoms.

However to demonstrate the causal agent of a disease with no previous reports, one often fulfills the rules developed by Robert Koch in 1884. These rules are as follows: first, the pathogen must be found associated with the disease in the diseased plants examined. Second, the pathogen must be isolated and grown in pure culture or nutrient media, and its characteristics described or it must be grown on a susceptible plant and its appearance and effects recorded. Third, the 21

pathogen from pure culture must be inoculated on healthy plants of the same species or variety on which the disease appears and it must produce the same symptoms on the inoculated plants.

Lastly, the pathogen must be isolated in pure culture again, and its characteristics must be exactly like those described in the second step (Agrios 2005). If all of the Koch’s postulates are fulfilled, then the isolated pathogen is confirmed as the causal agent of the disease (Agrios

2005).

As genome sequencing technology and molecular tools have become more widely available, it has become easier to study plant microbial interactions (Schneider and Collmer

2010). Now in addition to fulfilling the original Koch’s postulates, it has become important to identify plant pathogens using sequencing and molecular techniques as well as to gain a broader understanding of genetic and molecular pathogenicity (Schneider and Collmer 2010). Correct and accurate identification of fungal plant pathogens is necessary for research regarding the biology of the pathogen and to control the diseases they cause (McCartney et al. 2003). A positive identification of C. buxicola within nurseries across Ontario may lead to further negative consequences and to severe economic losses if this disease does become established.

2.1.5 Objectives

The objectives and goals of this study were as follows:

1) To identify C. buxicola as the causal agent of box blight on boxwood plants from specimens obtained in Canada. There are preliminary diagnoses from diagnostic labs or single occurrences of this pathogen on boxwood in nurseries, but these have resulted from morphological examination, and not a thorough application of Koch's postulates.

2) To examine the ability of the pathogen to grow at different temperatures. Canadian isolates of the pathogen have not been characterized.

3) To investigate the ability of the pathogen to survive in infected host tissues in controlled environments at different temperatures and in the field. This will aid our understanding of whether the pathogen may survive in harsher winters of southern Ontario compared to the U.S. and the U.K. main nursery areas.

4) To study the infection process of C. buxicola and how long the infection process takes to complete. This will provide information on whether the host requires injury for infection to occur and can give nursery growers a disease timeline from pathogen inoculation to propagule dissemination which should be considered in developing management protocols.

5) To examine the susceptibility of different boxwood cultivars and other potential host species such as Pachysandra terminalis. Examining whether there are varying susceptibilities between the four boxwood cultivars commonly grown in Ontario will reveal whether certain cultivars are more resistant to box blight. This study will confirm whether Ontario isolates of C. buxicola show pathogenicity on pachysandra.

2.2 Materials and methods

2.2.1 Collection of Buxus specimens

Samples of boxwood both infected and uninfected were collected from nurseries in southern Ontario. Because nurseries have been on high alert for the presence of box blight since the outbreak was reported in March 2012, requests were made to the nursery industry to provide disease samples when available. Requests were also made to European and B.C. researchers to provide isolates of C. buxicola. Samples of symptomatic boxwood variety ‘Green Mountain’ 23

were received from a nursery near Strathroy, Ontario in March 2012, and attempts were made to isolate C. buxicola from these samples. In April 2012 and May 2012. Symptomatic boxwood plants were stored in a walk in fridge at 5°C with black garbage bags covering the entire pots.

For inoculation and fungicide studies, flats of healthy boxwood plants were collected from Sheridan Nurseries comprised of the cultivars ‘Green Mountain,’ ‘Green Gem,’ ‘Green

Velvet,’ and ‘Green Mound’ along with a flat of Pachysandra terminalis plants in May 2012 and then again in April and September 2013. Healthy boxwood plants were held in a walk in incubator room at 22°C with a 16 h light (475 µmol/m2/s), 8 h dark cycle with 50% relative humidity. The healthy plants were watered three times a week with tap water obtained from the greenhouses in the Bovey Building (University of Guelph). Boxwood plants were planted in a soil mix called Coir Evergreen (Gro-Bark Ontario, Waterloo, Ontario). The soil consists of 30% composted pine bark, 5% compost, 25% peat moss, 30% coir, and 10% perlite, along with the amendments Plantacote Pluss (14-9-15) and a surfactant.

2.2.2 Media preparation and stock cultures

Potato dextrose agar (PDA) was prepared to 2% by adding 19.5 g of PDA to 500 ml of deionized water and autoclaving at 120°C for 15 min. To deter bacterial growth, the PDA was amended with 0.05 g/10 ml tetracycline and 0.1 g/ 10 ml streptomycin when the PDA had cooled to 55°C, to avoid deactivation of the antibiotics. The media was poured in 15 ml aliquots into 9 cm diameter Petri plates and allowed to cool. These media were used for growing C. buxicola isolates, for isolation experiments, pathogenicity experiments, and infection process experiments.

Boxwood agar was also prepared and used to trigger sporulation among the isolates as follows. ‘Green Mountain’ boxwood leaves were cut into 5 mm pieces, dried in an oven at 70°C

for 3-4 h, and the leaves were then autoclaved and added to 9 cm Petri plates into which molten

1% water agar was poured and allowed to cool. A 5-mm-diameter PDA plug from the actively growing margin of C. buxicola colonies was placed onto the boxwood agar and allowed to grow for up to three weeks to induce sporulation. Sporulation was not seen consistently with the boxwood agar, however when 1 cm diameter plugs of the actively growing colonies on boxwood agar were placed onto water agar and left for up to three weeks, sporulation at the edges of the plugs was common.

Stock cultures of fungal isolates were made for longer term storage. For seed cultures, half a screw cap lid full of wheat seeds was placed into 15 ml vials and 1.5 ml of deionized water was added to make wheat seed tubes. The wheat seed tubes were autoclaved three times with 24 h intervals in-between each autoclave session. Water tubes were made by placing 5 ml of deionized water into 15 ml vials and were autoclaved twice with a 24 h interval in between each autoclave session. The actively growing margins of mycelial colonies were cut to make 5 mm squares where 10 squares were placed into each water tube and one square was placed into wheat seed tubes.

2.2.3 Fungal isolation

Once infected boxwood samples were received, they were processed to isolate C. buxicola from infected tissue. Boxwood cuttings with dark necrotic spots on the leaves and black streaks on the stems were chosen for fungal isolation. These infected boxwood leaves and stems were cut into 5 mm pieces and were surface sterilized in 75% ethanol for 5 s and then cut into 1 mm pieces and placed in a 1% bleach solution for 35 s. Four, 1 mm long pieces were plated onto each antibiotic-amended PDA plate, and allowed to grow for up to a week at 25°C. For isolates

tentatively identified as C. buxicola based on gross cultural morphology, stock cultures were made for longer term storage.

Single-spore cultures were made to ensure purity. To obtain single spore isolates, spore suspensions were prepared to a concentration of 1.0 x 103 spores/ml by dispensing 2 ml of autoclaved water onto water agar plates containing the incubated plugs of boxwood agar. A sterilized L-shaped glass rod was used to disrupt the spores on the surface of the agar, and a pipette was used to obtain the spore suspension, which was then stored at 4°C for up to 48 hours.

A hemocytometer was used to count the spore concentration under the microscope and to adjust the final concentration to 1.0 x 103 spores/ml.

To obtain single-spore colonies, fresh water agar plates were inoculated by spreading 20

µl aliquots of the spore suspension onto the plate using a sterilized L-shaped glass rod. After 24 h, the plates were observed under the microscope at 100 x magnification and single spores or single colonies which had begun to germinate were marked with a permanent marker. The single spores were transferred using a sterilized glass needle onto another PDA plate and allowed to grow.

2.2.4 Temperature growth experiment for Cylindrocladium buxicola

Ten isolates of C. buxicola representing different geographic regions were tested for growth at six temperatures (Table 2.1). Screw cap test tubes (12 x 150 mm) were filled with 5.5 ml of 1% Potato Dextrose Agar (PDA), autoclaved, and placed horizontally for the PDA to set.

A 5-mm-diameter plug from the edge of an actively growing colony of C. buxicola was placed near the mouth of each test tube (Figure 2.2). The mouth of each tube and the lid were flamed both before and after the placement of the inoculum plug, and the lid was then screwed back on.

Immediately after inoculation, the tubes were placed in an incubator room at 25ºC and allowed to establish for 3 days before placing the tubes at the appropriate temperatures (4, 10, 15, 20, 25, and 30°C) for the next two weeks. Three replicate tubes were made for each temperature by isolate combination, and the extent of fungal growth was marked on the tubes with permanent markers of alternating colours every 3 days, starting on day 5 until the growth reached the end of the tube. Measurements were taken on day 5 to ensure none of the tubes were contaminated.

After day 23 all the markings made every 3 days on the tubes were measured, and the data were recorded. Mycelial growth rates were calculated by taking the measurements on day 5, subtracting these from the measurements on day 23 or when mycelial growth reached the full tube length, and dividing by the total number of days. These growth rates were then subjected to analysis of variance using PROC GLM in SAS 9.1 (SAS 2003). When significant treatment effects were found, means were separated using Fisher’s least significant difference test (LSD, p=0.05) (Appendix 2.1).

2.2.5 Survival of Cylindrocladium buxicola under laboratory and field conditions

The viability and survival of C. buxicola isolate 12031 from Ontario was investigated with growth room survival experiments using infected boxwood leaves. Detached ‘Green

Mountain’ boxwood leaves were inoculated with 15 µl of a spore suspension of C. buxicola with a concentration of 1 x 106 spores/ml, and the leaves were then incubated for a week at 23°C. The leaves were then placed onto dry autoclaved sand in Petri plates with five plates per temperature and four leaves per plate. The plates were sealed with Parafilm and incubated at 4°C and at room temperature (23°C). The leaves were sampled monthly for fungal viability by cutting a 2 mm slice from one leaf in each of the five replicate plates and then surface sterilizing the leaf piece

with 70% ethanol for 5 s and 1% bleach for 30 s, before placing onto antibiotic PDA. The leaves were sampled and tested for viability for over a year.

To assess how long select isolates of C. buxicola can survive on infected leaves buried to different depths, field experiments were initiated at the Guelph Turf grass Institute (GTI),

Guelph, Ontario, beginning in November 2012 and in August 2013. For the winter trial beginning in November 2012, ‘Green Mountain’ boxwood leaves were inoculated with mycelial plugs from two different C. buxicola isolates: 12176 (Ontario) and 12018 (BC). There were four replicate plates per isolate, with five leaves per plate to ensure that there would be enough leaf fragments for burial. After two weeks when the leaves demonstrated significant indications of infection, the leaves were cut into small pieces and placed into 15 cm x 15 cm square nylon bags of 0.5 mm mesh, which were held in place with staples along with a plastic identification tag.

The identification tag included the sampling number, the isolate number and the depth. There were 126 nylon bags in total with three leaf pieces in each bag. These bags were attached to 30 cm high wooden stakes, with 21 stakes and six bags per stake. The nylon bags were buried to three different depths (0, 10, or 20 cm) underneath 2-m-tall planted maple trees.

For the winter trials, bags were collected after 1 month and again at snowmelt for the succeeding 7 months. A total of three stakes were collected every month for seven months completely randomized design (Appendix 2.5). When the leaves were recovered they were surface sterilized in 70% ethanol for 5 s and 1% bleach for 45 s and were then plated onto antibiotic amended PDA. The growth on the plates was monitored for a week to observe the growth of C. buxicola.

The fall burial trial was initiated August 2013 to examine the viability of C. buxicola over the fall months. For the fall burial trial, bags were collected after every month beginning in

September and ending in December. ‘Green Velvet’ boxwood leaves were inoculated with the

Ontario isolate 12031, and were buried at the GTI following the same protocol used in the winter trial stated above. In total there were 12 wooden stakes with 3 bags per stake for the second burial experiment (Appendix 2.6). Every month when the samples were collected, they were stored at 5°C for two weeks before being surface sterilized and plated onto antibiotic PDA as described above.

2.2.6 Infection process of Cylindrocladium buxicola on detached ‘Green Mountain’ leaves

To observe the infection process of C. buxicola, a spore suspension was made from the C. buxicola isolate 12013 (Saxony-Anhalt, Germany) grown for up to three weeks on boxwood agar and then for two weeks on water agar. The spore suspension was made according to the protocol stated earlier. A hemocytometer was used to adjust the concentration of the spore suspension to

2.0 x 105 spores/ml. Nine detached ‘Green Mountain’ boxwood leaves were placed in three plates onto filter paper soaked with 2 ml of autoclaved water. The abaxial surface of each leaf was inoculated with 20 µl of 2.0 x 105 spores/ml spore suspension. The plates were then wrapped with Parafilm, and kept under constant light exposure (273 µmol/m2/s) at 25°C.

To observe the infection process on the leaf underneath the microscope, the abaxial surface was peeled back using a sterilized scalpel blade to reveal the stomata, and these leaf pieces were then placed onto a microscope slide. The leaf pieces were soaked in 95% acetic alcohol (95% ethanol: 1:3 glacial acetic acid) and heated over a flame briefly for approximately

20 s to reduce chlorophyll pigmentation. A drop of 0.05% trypan blue in lactophenol (20% phenol, 20% lactic acid, 40% glycerine and 20% water) was then added to the leaf fragment and 29

heated over a flame to dye the spores, stomata, and hyphae, making the infection process easier to visualize. The leaves were collected and processed every hour for 6 h and subsequently after

24, 48, 72, 96, and 120 h, where three replicate slides were made for each time interval the leaves were monitored. The leaf fragments were observed underneath a microscope at 400 x magnification. The percentage of germination/penetration was calculated in three different fields of view for each of the three replicate slides, where the field of view was 390.4 µm in diameter.

Good quality slides were preserved for future reference by allowing the excess lactophenol to evaporate from the edges of the cover slip and then sealing with clear nail polish. The germination and penetration percentages were subjected to analysis of variance with PROC

GLM in SAS 9.1. When significant treatment effects were found, means were separated using

Fisher’s least significant difference test (LSD, p=0.05).

2.2.7 Pathogenicity on detached leaves of Buxus and Pachysandra terminalis

Pathogenicity tests were conducted by inoculating healthy boxwood leaves with C. buxicola to induce infection and to demonstrate Koch’s postulates. Detached leaves of ‘Green

Gem’ were rinsed with deionized water and placed onto moist filter papers soaked with 2 ml of sterilized water in Petri plates. Isolate 12031 from Strathroy, Ontario of C. buxicola, obtained from a symptomatic ‘Green Mountain’ plant, was inoculated onto the abaxial surfaces of the leaves as 5-mm-diameter hyphal plugs. There were six replicate plates in total with four ‘Green

Gem’ leaves in each. The plates were stored at 25°C under constant light with an intensity of 270

µmol/m2/s. The plugs were removed 5 days post inoculation (dpi) and observed every other day for signs of infection using a scale of 0-4, where 0=0%, 1=0-25%, 2=25-50%, 3=50-75%, 4=75-

100% (Henricot et al. 2008) Leaves with signs of infection were surface sterilized in ethanol and

bleach following earlier stated protocols, and colonies which resembled C. buxicola were re- isolated onto antibiotic PDA.

The abaxial and the adaxial surfaces of leaves were tested for susceptibility. Both hyphal plugs and spore suspension were used as inocula with 12 plates containing four leaves per plate, half for hyphal plugs and half for spore suspensions. Half of the plates contained leaves with abaxial side up and the other half with adaxial side up. The leaves were rated on a scale of 0-4 mentioned above. The data were analyzed using PROC GLM in SAS 9.1. When significant treatment effects were found, means were separated using Fisher’s least significant difference test (LSD, p=0.05).

To assess inoculation period, inoculum plugs were removed from inoculated leaves at set intervals. Three replicate plates with four leaves per plate per day of ‘Green Gem’ were inoculated with an Ontario isolate of C. buxicola. The leaves were observed for signs of infection after the plugs were removed at 1, 2, 3, and 4 dpi. The data were analyzed using PROC GLM in

SAS 9.1 (SAS 2003). When significant treatment effects were found means were separated using

Fisher’s least significant difference test (LSD, p=0.05).

In addition, a comparison was made of the susceptibility of young and old leaf tissue by inoculating three replicates of young ‘Green Mountain’ leaves and three replicates of older

‘Green Mountain’ leaves with an Ontario isolate of C. buxicola where the plugs were removed after one day (Table 2.11). Pathogenicity tests were also conducted using Pachysandra terminalis to assess whether pachysandra could be a potential host for box blight. Pachysandra leaves were rinsed with deionized water and placed into Petri plates containing filter paper to which 2 mL of autoclaved water was added. The leaves were then inoculated with 5-mm-

diameter hyphal plugs of Ontario isolate 12034 of C. buxicola. The leaves were observed for signs of infection after the plugs were removed at 5 dpi. Isolations were done from symptomatic pachysandra leaves following the general isolation protocol, and the growth on PDA was monitored for colonies resembling C. buxicola. The inoculation process was repeated three times for the pachysandra leaves, with spore suspension as the source of inoculum. The spore suspension had a concentration of 2.0 x 105 spores/ml and was dispensed onto the abaxial surface of the pachysandra leaves in 20 µl aliquots. All plates were stored at 25°C in Tupperware containers.

Pathogenicity tests were also conducted to compare the susceptibilities of the different boxwood cultivars commonly grown in Ontario: ‘Green Mound,’ ‘Green Mountain,’ ‘Green

Gem,’ and ‘Green Velvet.’ The boxwood leaves were rinsed with deionized water and placed into Petri plates with filter paper to which 2 mL of autoclaved water were added Both hyphal plugs and spore suspension were tested separately as sources of inoculum for this experiment.

The spore suspension was made to a concentration of 2.0 x 105 spores/ml and then dispensed onto the abaxial surface of the boxwood leaves in 20 µl droplets, with one droplet per leaf.

In a separate experiment, 5-mm-diameter hyphal plugs taken from actively growing colonies of C. buxicola were placed on the abaxial surface of the boxwood leaves. In both experiments, there were three replicate plates per cultivar with four leaves per plate and the leaves were rated every other day for signs of infection. The leaves were stored at 25°C under constant light with an intensity of 270 µmol/m2/s, and after three weeks, the data were analyzed in SAS 9.1 using PROC GLM. When significant treatment effects were found means were separated using Fisher’s least significant difference test (LSD, p=0.05).

Pathogenicity tests were also done on detached ‘Green Mountain’ boxwood leaves at 32

various temperatures to assess if infection is achieved more often under specific conditions. The

‘Green Mountain’ boxwood leaves were rinsed with deionized water and placed into Petri plates with filter paper to which 2 mL of autoclaved water was added. The leaves were then inoculated with a spore suspension with a concentration of 2.0 x 105 spores/ml. There were a total of five different temperatures: 4, 10, 15, 22, and 25°C with four replicate plates per temperature, and four leaves per plate. For 15, 10, and 4°C the plates were stored in fridge incubators while the leaves at 25 and 22°C were stored in walk-in incubators. All plates were placed in sealed plastic

Tupperware containers and placed at the appropriate temperature. The leaves were monitored every other day for signs of infection for three weeks where the amount of infection was recorded as a percentage out of 100. The data were analyzed using PROC GLM in SAS 9.1.

When significant treatment effects were found, means were separated using Fisher’s least significant difference test (LSD, p=0.05).

2.2.8 Pathogenicity on whole Buxus and Pachysandra terminalis plants

The pathogenicity of C. buxicola was also observed on whole plants of Buxus and

Pachysandra terminalis with spore suspension as the source of inoculum. Testing pathogenicity of C. buxicola on whole plants was a preliminary experiment necessary before investigating the efficacy of fungicides. Initially, rooted cuttings of ‘Green Mountain’ were inoculated with spore suspension with a concentration of 5.0 x 105 spores/ml. The inoculum was applied using a 50 mL plastic spray bottle where the plants were sprayed until runoff was seen. The plants were placed in sealed Ziploc bags and stored in a growth room at 25°C and in incubators at 22º, and 20°C under constant light at intensities of 273, 250, and 115 µmol/m2/s respectively. A pachysandra plant was also inoculated with spore suspension with a concentration of 5.0 x 105 spores/ml and stored at 20°C under constant light with an intensity of 115 µmol m2/s. All plants were observed 33

for signs of infection for up to two weeks. ‘Green Mountain’ rooted cuttings were also injured prior to inoculation with a 2.0 x 105 spores/ml spore suspension, by scratching the surface of leaves with a sterilized probe. The injured boxwood plant was stored in the 20°C fridge until signs of infection were seen. When signs of infection were observed, both symptomatic and non- symptomatic leaves were surface sterilized according to the protocol in section 2.2.2 and then plated onto antibiotic PDA.

2.2.9 DNA extraction and PCR analysis

To confirm Koch’s postulates, ‘Green Mountain’ boxwood leaves were inoculated with mycelial plugs (5 mm diameter) from isolates obtained from the infected plants received from a nursery in Ontario which were tentatively identified as C. buxicola. The plugs were removed at 5 dpi, and leaves were monitored for signs of infection. Symptomatic leaves were surface sterilized following stated protocols, and the isolates obtained were subjected to DNA extraction and PCR analysis to confirm identity. The isolates were cultured for up to two weeks on antibiotic PDA with cellophane square overlays, and were incubated at 25°C. DNA was extracted (Edwards al.

(1991) from the 52 isolates of C. buxicola, including those sent from Belgium, Italy, Germany, and British Columbia (Table 2.1). Approximately 100 mg of mycelium was collected for each isolate of C. buxicola from cellophane squares on PDA with a sterilized spatula. Approximately

100 mg of autoclaved, acid-washed sea sand was added to the fungal tissue in each 1.5 mL tube for grinding.

An aliquot of 200 µl of extraction buffer (Tris-HCl 200 mM pH 8.5, EDTA 25 mM, NaCl

250 mM, sodium dodecyl sulfate 0.5%) was added to each 1.5 mL tube. An electric screwdriver was used to disrupt the fungal cells for 1 min at 220 rpm. Another 200 µl of extraction buffer was added and mixed by finger vortexing. The tubes were then incubated at 65°C for 30 min and 34

centrifuged at 12 000 x g in an Eppendorf Centrifuge 5415D (Mississauga, Ontario) for 10 min.

The supernatant was transferred to a clean 1.5 mL tube, centrifuged at 12, 000 x g for 5 min, and then transferred to another clean 1.5 mL tube. An equal volume of cold isopropanol (stored at -

20°C) was added to the tubes to precipitate the DNA, and the tube was finger vortexed immediately. This precipitated DNA mixture was then stored at -20°C for 10 min, centrifuged at

12 000 x g for 10 min, and then the resulting supernatant was discarded. The remaining pellet was washed with 200 µl of cold 70% ethanol and was allowed to dry upside down in a fume hood for up to 2 h. After the pellet was completely dry, 100 µl of PCR water (nuclease free water, Fisher Scientific, Ottawa, Canada) was added to the tubes and a pipette tip was used to gently break up the pellet. The tubes were placed at 4°C overnight to allow the DNA to dissolve in the PCR water. The DNA was then ready for downstream use or was stored at -20°C.

The Internal Transcribed Spacer (ITS) region of fungal DNA was amplified using primers ITS1 (5’-TCCGTAGGTGAACCTGCGG) and ITS4 (5'-CCTCCGCTTATTGATATGC) which target the region between the 18s and 28s ribosomal genes (White et al. 1990). The PCR

Master Mix included a total volume of 15µl containing 1xPCR buffer (50 mm Tris-HCl, pH 8.5),

2.5 mM MgSO4, 0.2 mM dNTP, 0.5 µM of each primer separately, 0.6 U Tsg DNA polymerase, and 1 µl of DNA which were all mixed by finger vortexing. Amplifications were performed in a

Bio-Rad MycyclerTM Thermal Cycler 580BR10964 with an initial denaturation step of 94°C for

2 min followed by 35 cycles of 94°C for 30 s, 55°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min.

The PCR product was run through 1% agarose gels (Agarose A, BioBasic, Markham,

Ontario) where 3 µl aliquots of the PCR product were mixed with 1µl of 6x loading dye

(Appendix 3.1) and a 6 µl aliquot of DNA marker (DNA Logic-Ladder 100 bp -10 kb, BioBasic,

Markham, Ontario) was used to measure band sizes. Electrophoresis was done at 100 V in a

Mupid-2plus submarine electrophoresis system (Helixx Technologies, Toronto, Ontario,

Canada). Gels were stained with ethidium bromide (EtBr) for 5 min and observed on a UV transilluminator from Syngene (Synoptics, Cambridge, Cambridgeshire, U.K.) for DNA band visualization. To examine the gels, a GBC video camera CCTV (South Hackensack, New

Jersery, USA) was used. Electronic pictures were saved on a desktop computer using VidCap32 video capturing program (Native American Technologies). The PCR products were sent to

Laboratory Services at the University of Guelph and once the sequencing results were received they were compared using the Basic Local Alignment Tool (BLAST) (Altschul et al. 1990) to databases in the National Center for Biotechnology Information (NCBI http://www.ncbi.nlm.nih.gov/).

2.3 Results and discussion

2.3.1 Collection of Buxus species and fungal isolation

In April 2012, two potted ‘Green Mountain’ plants were obtained from a nursery near

Strathroy, Ontario with symptoms of disease. Symptomatic leaves and stems from these ‘Green

Mountain’ plants were surface sterilized and plated onto antibiotic-amended PDA. In total, 48 isolates resembling C. buxicola were obtained from these two plants. Requests for isolates were sent out, and five isolates of C. buxicola from Belgium, Italy, Germany, and BC were obtained

(Table 2.1). The first set of healthy boxwood plants were collected from Sheridan Nurseries

Norval Farm in Georgetown, Ontario in May 2012. Single flats containing 18 plants were for each of the following cultivars: ‘Green Mountain,’ ‘Green Mound,’ ‘Green Gem,’ and ‘Green

Velvet’ were obtained. A flat containing Pachysandra terminalis plants was collected at this time 36

as well. A second set of the same four cultivars of boxwood plants were obtained in April 2013.

For the fungicide trials, 10 flats of ‘Green Velvet’ were obtained in September 2013. All plants were kept in a growth room until use.

The diseased boxwood plants received had symptoms including light and dark brown spots on the leaves with dark borders as well as black streaks along the stems. These have been described as a characteristic symptoms of box blight (Henricot 2006). Clusters of leaves also showed fungal sporulation and the presence of sporodochia on the abaxial surface of the leaves.

Fungal isolations from diseased leaf tissue produced colonies and conidia which resembled C. buxicola. These results were consistent with previous descriptions where colonies have been described as amber brown with pale luteous outer margins, and the reverse colony as fuscous black in the middle which fades to sienna (Crous et al. 2002).

Species of the genus Cylindrocladium are usually characterized by hyaline, cylindrical, 0-

1 multi-septate conidia with the formation of a stipe at the apex of a conidiogenous apparatus and

C. buxicola is characterized by having one-septate conidia and ellipsoidal vesicles with papillate apices (Henricot 2006; Crous et al. 1992). The morphological characteristics observed strongly suggested that the disease on the plants received from the nursery in Ontario was caused by the fungus C. buxicola, and this implied that the fungus could potentially be introduced to other nurseries and become established. Box blight has also been identified in British Columbia and shows potential to spread throughout the nurseries and natural landscape settings if management methods are not initiated (Elmhirst et al. 2013).

Cylindrocladium buxicola can co-occur with the pathogen Pseudonectria buxi which causes a blight on Buxus and produces pink to orange spore masses on infected tissue (Ivors

2011). There was an outbreak on boxwood caused by P. buxi in 2008 in Ontario nurseries causing substantial damage to boxwood crops (Shi and Hsiang 2013). The two pathogens produce similar symptoms on boxwood plants such as yellowed foliage and black streaks along the stems, which can make identification difficult. The symptoms of P. buxi and C. buxicola are easiest to distinguish during the earlier stages of infection. P. buxi does not cause circular leaf spots and usually only blights one branch at a time, in contrast to C. buxicola which causes blight on the lower foliage first and moves upwards to give the plant a top heavy appearance (Ivors

2011). There were a few colonies of P. buxi isolated from the infected plant tissue received from local nurseries, although the majority of the colonies resembled C. buxicola. This suggests that these diseases can co-occur together on the same host.

2.3.2 Koch’s postulates

To demonstrate Koch’s postulates, boxwood leaves were inoculated with Ontario isolates of C. buxicola. When signs of infection were observed, the leaves were surface sterilized and isolated onto PDA and once growth began to develop which resembled C. buxicola, the colonies were re-isolated and then used to inoculate healthy boxwood plants once again. To confirm the identity of C. buxicola, DNA was extracted from the fungal mycelium following Edwards et al.

(1991) and the ITS region of fungal DNA was amplified using ITS1 and ITS4 primers. The PCR product was sent for sequencing and the results were compared to databases in NCBI using

BLAST which showed a 98% top match for sequences previously identified as C. buxicola

(Appendix 2.7). With this information it can be stated that box blight caused by C. buxicola has been positively identified on boxwood plants in Ontario. There have been no other positive identifications thus far from other nurseries in Ontario but nursery growers should continue to employ safe cultural practices to avoid the establishment of this fungus.

2.3.3 Temperature growth analysis

Ten isolates were used to assess growth optima for C. buxicola at various temperatures

(Table 2.1). The isolates were incubated at 4, 10, 15, 20, 25, and 30°C (Table 2.1). The overall mean isolate growth rates did not differ significantly for these 10 isolates (p-value= 0.49) however there were differences between temperatures (p-value<0.0001, Table 2.1). At 4 and

30°C, growth after 23 d was at minimum with the slowest growth at 4°C and no growth at 30°C.

At 20°C growth after 23 d was the fastest and at 15 and 25°C growth after 23 d growth was suboptimal. The mean mycelial growth rates (mm/d) for each isolate at each temperature were compared using the Fisher’s Protected LSD test (Table 2.1). Anomalous data was found for isolates grown at 20°C where some isolates produced inconsistent results because they stopped growing in a particular replication. To adjust for this, the experiment was repeated but without 4 and 30°C since none of the isolates grew at these temperatures.

This experiment was repeated using five C. buxicola isolates, Belgium (12001), Germany

(12013), Italy (12015), B.C. (12018), and Ontario (12176) (Table 2.2), which were incubated at

10, 15, 20, and 25°C for 29 d. For this experiment each temperature by isolate combination was repeated four times. Significant treatment effects were found when the mean mycelial growth data was subjected to an analysis of variance (p< 0.0001, Table 2.2). The mean mycelial growth rates (mm/d) for each isolate at each temperature were then separated using Fischer’s LSD test

(p=0.05, Table 2.3). This test demonstrated that there are significant differences between the average mycelial growth rates of each isolate at 10, 15, 20 and 25°C. The experiment also confirms that 20°C is the optimal temperature for the growth of C. buxicola with the fastest mean mycelial growth rate, while 15°C and 25°C are suboptimal temperatures for growth. Isolates

12013 (Germany) and 12015 (Italy) were the slowest growing isolates and had mycelial growth

rates significantly lower when compared to isolates 12001, 12018 and 12176 from Beglium,

B.C., and Ontario.

The growth temperature experiment for C. buxicola revealed that the optimal temperature for growth is 20°C with suboptimal temperatures at 15 and 25°C, and little to no growth was seen at 4 and 30°C. These results are generally in agreement with previous temperature growth studies for this fungus (Douglas 2011; Henricot 2006) which reported that the fungus stops growing above 30°C; however the optimum temperature for growth from those studies was 25°C, which differs from the optimum in this study at 20º C. This difference in temperature optima could result from natural variation between isolates.

There have been some reports of differences in optimal growth temperature depending on location. It was found that 20-22°C were optimal conditions for Colletotrichum acutatum in

Israel but 24-26°C was the optimal range for the same species in California (Freeman et al.

1998). Perhaps since this was the first temperature growth experiment done for C. buxicola isolates in Ontario, the differences seen here are due to location. There was some variation between the isolates from different geographic regions where the isolates from Germany and

Italy grew significantly slower compared to the other isolates. Genetic variation between isolates is further explored in Chapter 3.

2.3.4 Survival and viability of Cylindrocladium buxicola

In-vitro survival experiments were done to assess how long C. buxicola can remain viable at different temperatures. Infected boxwood leaves were placed on autoclaved sand with no moisture or nutrition and they were incubated at 4 and 23°C. After one month, both sets of leaves incubated at 4 and 23°C showed 100% viability for all the replicates tested (Table 2.4). However

in the following months, the viability of the leaves stored at 23°C began to decrease rapidly and eventually demonstrated 0% viability after four months (Table 2.4). The leaves incubated at 4°C showed consistent viability from May 2012 up until 2014 when sampling ended.

The first outdoor burial trial began in November 2012 where boxwood leaves infected with either isolate 12018 (BC) or 12176 (Ontario) were buried to three different depths (0, 10, and 20 cm) in the soil at the GTI in Guelph. The soil at this particular GTI location consists of

Fox sandy loam with a pH of 7. Weather data; including air temperature, soil temperature, and precipitation can be found in Appendices 2.2 – 2.4. The first sample was retrieved one month after the leaves were buried and every other collection occurred after the snow had melted in

April 2013. After one month, C. buxicola was recovered from the leaf samples, however the first collection made after snowmelt showed low viability rates (Table 2.5). Each subsequent sample collection had 0% viability, and the experiment was ended after 5 samplings.

The second outdoor burial trial began in August 2013 to assess if the survival of C. buxicola differs in the winter versus the fall. Boxwood leaves infected with isolate 12031

(Ontario) were again buried to three different depths and the collections began in September every month until December 2013. Since there were no differences between the survival of isolates from Ontario and B.C. observed in the winter trial, only Ontario isolates were used in the fall trial. For both fall and winter trials, there was a high incidence of fungal and bacterial colonizers present in the soil which made isolating colonies of C. buxicola difficult. Therefore, for the second trial, the leaves were incubated at 4ºC for two weeks after collection to allow the common contaminants on the surface of the leaves to die before attempting surface sterilization.

Colonies of C. buxicola were obtained for all sampling dates for the fall burial trial (Table 2.6)

Viable colonies of C. buxicola for the in vitro experiments were obtained for over 14 months from the infected leaf pieces stored at 4°C with no moisture or nutrition. The infected leaf pieces stored at 23°C demonstrated gradually decreasing viability with no viability after four months. The difference in survival at 4°C versus 23°C can be attributed to C. buxicola being a low temperature fungus since it can grow below 10°C and is killed above 30°C (Henricot 2006).

This is also consistent with the temperature growth experiment which demonstrated that the fungus grows faster at temperatures between 15-20°C and slower at 25°C. Another factor which could have aided the survival of C. buxicola at 4°C over time was the lack of moisture and humidity. High humidity and temperatures could have supported the growth of other fungi during the incubation time period. Norman and Stranberg (1997) found that survival of conidia and sclerotia of Colletotrichum acutatum declined rapidly under moist conditions but under dry conditions, viable conidia could be detected for up to 12 months.

During the winter and fall field trials in which leaf pieces infected with C. buxicola were buried to different depths, survival was much higher during the fall months compared to the survival after the winter months. The average temperature during the winter of 2013 between the months of December and March was -4.8°C (Anonymous 2013a). This is well below the lowest temperature recorded for successful growth of C. buxicola in this study as well as in other studies, suggesting that the severity of the winters in Ontario may not be conducive for the survival of C. buxicola. However, if tissue is buried under snow it will experience temperatures of around 0°C, which is still outside the acceptable range for growth of C. buxicola (Snider et al.

2000). But if the tissue on the surface is not covered by snow or even lightly covered, it will experience the air temperature. Roth et al. (1979) observed that the number of germinable

Cylindrocladium crotalariae microsclerotia decreased progressively over 4 weeks when 42

naturally infested soils were incubated at 6°C, and even lower numbers of germinable microsclerotia were found in soils incubated at -10°C. It is important to consider that the leaf pieces were not incubated for two weeks after recovery and prior to isolation for the winter trial but was done for the subsequent fall trial. If this step had been carried out for the winter trial, there could have been a slightly higher incidence of survival throughout the seven months after snowmelt.

In contrast to the winter burial trial, the fall trial showed survival and viability of C. buxicola throughout the four months from September to December. There was an increase in survival from 11% in October to 33% in November; this might be attributable to natural variation in competing organisms and the isolation process. Conditions during these four months can be found in Appendix 2.3. In a similar study done in Florida, USA, on Colletotrichum acutatum, infected fern fronds were buried to 3 cm depth, and samples collected every three weeks (Norman and Strandberg 1997). They found that conidia were viable for up to 3 months during the summer months from the leaf debris, where experiments were conducted in sandy soils (pH 6.9) at temperatures between 2-37ºC. Another two year study done in Iowa, USA, looked at the survival of Fusarium moniliforme, F. proliferatum, and F. subglutinans in maize stalk residues buried to 15 or 30 cm (Cotten and Munkvold 1998). The range of survival after

630 days was between 0-50% from inoculated stalk pieces.

The higher survival rate of C. buxicola during the fall months compared to the winter months contrasts with a study from the U.K., where C. buxicola survived for over five years on decomposing boxwood leaves and on microsclerotia of C. buxicola (Henricot 2006). However this experiment was completed in the UK where the average winter temperature is much milder and the winter is more comparable to fall months in Ontario. Survival also varies depending on 43

the fungal species. Urena-Padilla et al. (2001) looked at the over-summer survival of

Colletotrichum gleosporioidies in strawberry crown tissue where they buried the crowns at 5 or

13 cm and recovered the samples over 6 months. Following an initial increase in detection of the fungus, there was a rapid decline in survival and no Colletotrichum was detected after 56 days.

The results of this experiment on C. buxicola have important implications for nursery growers. This fungus is unlikely to survive on infested plant material in the field over the winter months, but there is potential for survival during the fall months or during a mild winter. Milder winters in Ontario are expected to result in increased survival of host or debris borne fungi

(Boland et al. 2004). Milder winters could alternatively lead to less snow fall or a shorter period of time where the ground is covered in snow, meaning the overwintering debris could be exposed to colder temperatures. However regardless of the duration of snow cover; C. buxicola viability at 0°C is low.

2.3.5 Disease development of Cylindrocladium buxicola on detached ‘Green Mountain’

leaves

The infection process of C. buxicola on detached ‘Green Mountain’ leaves was monitored over a 72 h period to record each stage of the infection cycle. Leaves were inoculated with spore suspension of C. buxicola and the abaxial surface of the leaves was peeled back, soaked in acetyl alcohol and trypan blue before being analyzed underneath the microscope at 400 x magnification. On inoculated leaves, germination began 1 hpi with 100% germination occurring 3 hpi. Germ tubes from germinating conidia grew towards stomata and made contact with the stomatal opening and this was considered penetration. Penetration began between 4-5 hpi with 100% penetration occurring 24 hpi (Table 2.7, Figure 2.3). Sporodochia and dark brown lesions 3-5 mm in diameter began to form between 72- 120 hpi, along with sporulation on the 44

leaf surface. The lesions which appeared 72 hpi, occupied 25-30% of the leaf and by 120 hpi the abaxial surface was entirely covered with sporodochia. Lesions on the adaxial surface occupied approximately 50-100% of the leaf surface. Leaf fragments were examined for sporulation under the microscope between 72-120 hpi after the formation of lesions. There were approximately 12 spores in one field of view when leaf pieces were observed underneath the microscope at 400 x where the circular field of view was 390.4 µm in diameter.

The incidence and timing for the production of sporodochia was much more variable (72-

120 hpi) compared to germination (1-3 hpi) and penetration (5-24 hpi) the latter two of which both occurred strictly within the stated time interval. Penetration appeared to occur near the natural openings of the leaf surface such as stomata 100% of the time when a spore suspension was used as the source of inoculum, although it is possible for the fungus to penetrate directly through the cuticle. Direct penetration through the cuticle was observed when mycelial plugs were used as the source of inoculum almost 100% of the time, but only if the mycelial plugs were left on the leaves for more than 5 days. No wounding was required for detached leaves to become infected with C. buxicola however direct penetration through the leaf surface was not observed when spore suspension was used. Finally, after a period of 1-2 months chlamydospores or microsclerotia formed on the surface of infected leaves and appeared as masses of mycelia underneath the microscope (Figure 2.4).

The infection cycle of C. buxicola from germination to sporulation can be completed in

72 h. Penetration almost always occurred through stomata on the leaf however it is possible for the hyphae of this fungus to directly penetrate the leaf surface. Direct penetration was seen when mycelial plugs were used as the source of inoculum and was not seen during the infection process experiment when spore suspension was used. Perhaps since the mycelial plugs remain on 45

the leaves for a longer period of time, the amount of inoculum overwhelms the plant and allows direct penetration through the surface both abaxial and adaxial. There were a much higher number of stomata present on the abaxial surface compared to the adaxial surface which most likely why the abaxial side of the leaf is the preferred surface for penetration.

Similarly, when P. buxi colonizes boxwood plants, sporodochia would only form on the abaxial surface but not on adjacent surfaces, likely due to the presence of stomata on the abaxial surfaces versus the thicker cuticle on the adaxial surface (Shi and Hsiang 2013). Other

Cylindrocladium pathogens such as C. crotalariae produce infection cushions on the plant epidermis followed by complete hyphal colonization of the cortex and collapse of the epidermal cells (Beute 1980). Other ascomycete, necrotrophic pathogens such as B. cinerea and Scerotinia sclerotiorum produce appressoria structures which differentiate on the plant surface and form a penetration peg which breaches the cuticle to entire the plant cell (van Kan 2006). There have been no reports of the formation of appressoria or penetration structures for C. buxicola.

A period of incubation was observed between 24 and 48 h as the fungus spread throughout the plant tissue where there were no signs of further penetration. Sporulation was observed under the microscope between 72 and 120 hpi. During this time period, visible symptoms appeared on the leaves such as brown lesions and sporodochia developing on the abaxial surface. After a period of two to three weeks, the leaves eventually died. This senescence has been associated with general stress resulting from colonization of the intercellular spaces along with the deregulation of stomata (Henricot 2006). The rapid speed of the infection process, in terms of the time period between germination and sporulation, highlights the severity of this disease and why it has become a concern for nursery growers. The result of this rapid disease cycle could be a faster transition of surrounding healthy boxwood plants becoming infected. 46

2.3.6 Pathogenicity experiments on Buxus and Pachysandra terminalis

For pathogenicity tests, the C. buxicola isolate 12031 from Ontario was chosen randomly since all of the 48 Ontario isolates came from the same location, and appear to have a clonal population structure ( as seen in Chapter 3). The preliminary test conducted to assess which leaf surface the inoculum should be applied, to demonstrated that infection and colonization is achieved significantly more often on the abaxial surface of the boxwood leaves (Table 2.8, Table

2.9). To assess how long hyphal plugs are required to remain on the leaf surface for infection to occur, plugs were removed 1, 2, 3 and 4 dpi. The results show that the plugs are only required to remain on the leaves for one day to observe signs of infection, however if the plugs remain on the surface for longer the leaves have significantly higher levels of infection (Table 2.10). The comparison looking at the susceptibility of young versus old leaf tissue demonstrated that young leaves are more susceptible and became severely infected, while the old leaves did not show any signs of infection after two weeks (Table 2.11). When detached pachysandra leaves were inoculated with spore suspension, re-isolations produced colonies which resembled C. buxicola.

Experiments were done to assess if cultivars commonly grown in Ontario differ in their susceptibility to infection by C. buxicola. The results of the experiment using hyphal plugs show that ‘Green Gem’ and ‘Green Velvet’ are significantly more susceptible to infection while

‘Green Mountain’ and ‘Green Mound’ are more tolerant, since the latter were 25-75% infected by day 17 while the former were 75-100% infected by day 17 (p=0.0247) (Table 2.12). The experiment using spore suspension as inoculum was repeated twice and the results demonstrate that ‘Green Mountain’ is the least susceptible to infection by C. buxicola (Table 2.13). The final pathogenicity test done was to assess if pathogenicity varies at different temperatures. The results from this experiment demonstrate that infection is most likely to occur at 20 or 15°C where the

leaves were 87.5% and 100% infected by day 16 respectively as opposed to at 25°C where the leaves were 59.1% infected by day 16 (p=< 0.0001) (Table 2.14).

Colonization and infection with C. buxicola was achieved significantly more often on the abaxial surface of boxwood leaves as opposed to the adaxial surface, which was already apparent from the infection process experiment. The fungus can move through the natural openings to colonize the leaf tissue rather than exerting energy to directly penetrate the plant cuticle. When mycelial plugs were used as the source of inoculum, the minimum amount of time required for the plugs to remain on the leaf surface before signs of infection appeared was one day however, after five days the total number of leaves which became infected was higher when compared to leaves where the plugs were removed 1 dpi. It was important to remove the mycelial plugs after a period of five days because if left on the leaf surface the leaves could become overwhelmed and die faster than they would if the plugs were removed.

Young one-month-old leaf tissue was found to be more susceptible to infection compared to one year old leaf tissue. There have been several studies which have seen a correlation between age of leaf tissue and susceptibility to plant pathogenic fungi. Allen et al. (1983) observed that Alternaria helianthi developed most rapidly on leaves of plants at the seeding stage, where older leaves at the budding stages of growth almost completely lacked lesions or symptoms of infection. Another study also found that age of plants played a significant role in disease infection where younger plants at 11 and 18 DAS (days after sowing) were more susceptible to infection compared to plants at 25 DAS (Mamza et al. 2008). This agrees with

Agrios (2005) who reported that plant age is important in disease infection and that young plants are often more susceptible. Therefore nursery growers should take this into account when

performing weekly inspections for the presence of disease or during the propagation process to prevent injury of young leaf tissue.

Differential susceptibility was seen between the four Green Series boxwood cultivars. All cultivars were susceptible to C. buxicola to some degree; no cultivar was completely resistant to disease. During initial experiments where mycelial plugs were used as the source of inoculum, both ‘Green Mountain’ and ‘Green Mound’ were found to be less susceptible to infection compared to ‘Green Velvet’ and ‘Green Gem’. However when spore suspension was used as inoculum only ‘Green Mountain’ showed significantly less disease severity. This experiment using spore suspension as inoculum was done twice to confirm the results and is more comparable to the natural infection process that would be seen in a nursery setting.

Ganci et al. (2013) also reported different levels of tolerance to this fungus among commercial boxwood taxa. They concluded that Buxus sempervirens types were more susceptible in general and ranked the following three Green Series cultivars from most to least susceptible ‘Green Mound,’ ‘Green Mountain,’ and then ‘Green Gem’(Ganci et al. 2013).

Differences between the study done by Ganci et al. (2013) and the results found here could be due to cultural conditions during inoculation, the isolates used and the duration of the study, all of which were not stated in this short abstract. Further studies using different isolates of C. buxicola under various conditions could provide more insight. Similarly, whole plant pathogenicity experiments could also provide more detailed information regarding the conditions for successful infection of boxwood cultivars in a greenhouse or nursery setting.

2.3.7 Pathogenicity experiments on whole Buxus and Pachysandra terminalis plants

The non-wounded ‘Green Mountain’ and ‘Green Velvet’ seedlings which were inoculated with a spore suspension with a concentration of 5.0 x 105 spores/ml and incubated at

15, 20 and 22°C, showed very minimal to no signs of infection two weeks post inoculation.

Leaves with minimal signs of infection were surface sterilized and plated onto antibiotic PDA.

One of the boxwood plants incubated at 15°C produced C. buxicola colonies after re-isolation, but the infection on the plant itself did not progress and no further symptoms were observed.

None of the other re-isolations produced colonies of C. buxicola and the plants remained symptomless throughout a period of three weeks. The pachysandra plant inoculated with the same spore suspension and incubated at 20°C developed dark brown lesions after one week, and when surface sterilization and re-isolation was conducted, colonies of C, buxicola were produced

(Figure 2.5). The inoculations on pachysandra plants were repeated a total of three times. The

‘Green Mountain’ and ‘Green Velvet’ seedlings which were injured prior to inoculation developed lesions on the leaves one week after inoculation and after re-isolation, colonies of C. buxicola were produced (Figure 2.6). The inoculations after wounding using ‘Green Mountain’ plants was repeated a total of three times.

The pathogenicity tests on both detached pachysandra leaves and on whole pachysandra plants demonstrated that colonies of C. buxicola could be obtained from symptomatic lesions.

Therefore Pachysandra terminalis could become a potential host for box blight in a nursery and in a natural landscape setting. This has also been confirmed in the literature in the US

(Anonymous 2012b). Pathogenicity tests on whole boxwood plants provided new insight on the conditions for successful infection. Initially spore suspension was applied to uninjured ‘Green

Mountain’ and ‘Green Velvet’ plants and no signs of infection were observed after three weeks. 50

However when the leaves were injured prior to inoculation, infection was apparent within one week. Differential susceptibility on wounded tissue has been reported by Hudler and Banik

(1986) who found that when wounds of various ages on the stems of pachysandra are inoculated with conidia of Volutella pachysandraicola, older wounds are less likely than younger ones to serve as sights of infection for the pathogen. Plants respond to injury by producing lignin in the cell walls surrounding the wound preventing subsequent infection (Hudler and Banik 1986).

Wounds appear to be the major target for penetration of C. buxicola on whole boxwood plants.

Detached leaves did not require wounding for infection to occur on the leaf surface but whole plants did require wounding before any signs of infection were apparent. Perhaps whole plants are more capable of recognizing C. buxicola relatively early after the pathogen comes into contact with the plant enabling a successful defense response. These defense specific processes could include recognition of the pathogen through PAMPs or effectors present in the fungus, such as chitin or glucan fragments or proteins secreted by the pathogen (Jones and Dangl 2006).

This could lead to events such as phosphorylation of defense specific proteins or the activation of enzymes involved in strengthening cell walls (Jones and Dangl 2006). It is evident that when a leaf is detached from a plant senescence will eventually occur (Gan and Amasino 1995). It is possible that when the boxwood leaves are detached from the plant that these defenses are not strong enough to neutralize the pathogen and thus infection ensues.

Other pathogenicity experiments done for boxwood have either stated that wounding is not required for infection to occur, or the methods have not been clearly specified (Henricot et al.

2008; Ganci et al. 2013). The consensus in the literature is that wounding is not required for infection to occur, however there have been very few studies done on whole plants. Henricot et al. (2008) dipped detached stems and leaves into conidial suspensions and Ganci et al. (2013) did 51

not specify how the whole plants were inoculated. Boxwood plants in a nursery setting are trimmed periodically to maintain shape and uniformity; this results in wounds for pathogens to colonize. The boxwood plants used in this study were not trimmed or pruned for the duration of storage for slightly over a year. Therefore when the plants were inoculated with spore suspension with no wounding prior to inoculation, fresh wounds were not available for pathogen entry.

Another factor which could affect the successful infection of whole plants is the concentration of spore suspension. Henricot et al. (2008) adjusted suspensions to a concentration of 106 conidia/ml and in all of the studies done here, it was only possible to achieve spore suspensions of 105 spores/ml. It is possible that if a higher concentration of spore suspension was achieved, infection could occur on uninjured whole plants.

2.4 Conclusions

Cylindrocladium buxicola was positively identified in a nursery in Southern Ontario and the pathogen was thoroughly analyzed by morphological and molecular techniques. This disease has the potential to become established, through introduction of both symptomatic and asymptomatic boxwood plants into nursery production. This could negatively impact the production and growth of boxwood crops. Studies on the infection process demonstrated that the disease cycle can be completed in 72 hpi until spore production, which is relatively rapid and narrows the window for the effective implementation of control measures. Differences in susceptibility were found between four different boxwood cultivars, and this information can be implemented if the disease does become an issue across Ontario. The lack of overwinter survival and the success of fall survival in Ontario is previously unreported and could potentially be beneficial for nursery growers in terms of lack of carry-over of this disease from season to season in this province. Finally, pathogenicity tests on whole plants revealed vital information 52

regarding the conditions for successful infection, since wounding on whole plants was a prerequisite for C. buxicola to colonize boxwood. Future work should focus on pathogenicity and infection process studies to determine if whole plants require wounding under all circumstances for infection to occur. Also, another burial trial could be conducted which looked at the survival and viability of C. buxicola in several different locations.

Growth Rate (mm/day)1 Temp °C Isolate Origin 4 10 15 20 25 30 12001 Belgium3 0.11 0.52 1.48 0.87 1.00 0.09 12013 Germany 0.11 0.81 0.85 2.09 1.31 0.04 12015 Italy 0.07 0.39 1.39 1.41 0.91 - 12018 B.C. 0.09 0.43 1.46 1.39 1.09 - 12019 B.C. - 0.35 1.20 2.19 0.36 - 12168 Ontario 0.03 0.17 0.19 1.87 - 0.22 12169 Ontario 0.06 0.46 1.20 1.02 1.19 - 12170 Ontario 0.06 0.30 1.40 1.80 1.13 - 12171 Ontario 0.06 0.56 1.70 1.78 1.79 0.19 12172 Ontario 0.07 0.37 1.70 2.39 0.61 - LSD 0.09 0.34 0.76 2.16 0.79 0.16 Average (LSD= 0.30) 0.07 0.44 1.26 1.68 1.07 0.03

1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) 2Missing values in the table are represented by a dash (-) and indicate contaminated tubes. 3Isolates were provided by: Kurt Huengens (Institute For Agriculture and Fisheries, Merelbeke, Belgium), Sabine Werres (Institute for Plant Protection In Horticulture and Forests, Saxony- Anhalt, Germany), Paolo Cortesi (The Department of Agri-Food and Urban Systems Protection, Milan, Italy), Vippen Joshi (Ministry of Agriculture, Fraser Valley, Bristish Columbia), and Jennifer Llewellyn (OMAF, Guelph, Ontario).

Table 2.2. Mean mycelial growth (mm/d) of five isolates of C. buxicola (12001, 12013, 12015,

Temperature (°C) Growth rate (mm/day)1 10 0.86 15 1.63 20 2.27 25 1.87 LSD (p=0.05) 0.10 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05)

Growth (mm/day)1 at different temperatures Isolate Origin 10 °C 15 °C 20 °C 25 °C 12001 Belgium 1.1 1.7 2.4 2.1 12013 Germany 0.7 1.4 1.8 1.5 12015 Italy 0.6 1.3 1.8 1.6 12018 B.C. 1.0 1.9 2.5 2.0 12176 Ontario 0.9 1.9 2.5 2.2 LSD (p=0.05) 0.1 0.1 0.2 0.1 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05)

Table 2.4. Percent viability of boxwood leaves over time infected with C. buxicola from isolate

12031, where the leaves were stored at either 4°C or 23°C on autoclaved sand in Petri plates.

Viability of C. buxicola (%)1 Time 4°C 22°C 1 month 100 100 2 months 80 35 3 months 95 20 4 months 85 5 5 months 80 0 6 months 90 0 7 months 90 0 8 months 85 0 12 months 65 0 16 months 70 0 LSD (p=0.05) 33 17 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on five replicate observations.

Table 2.5. Percent viability by depth of two C. buxicola isolates on infected leaf tissue buried to three different depths at the GTI. Samples were collected 1 month after burial in November of

2012 and after snowmelt in April 2013. Leaves were inoculated with either isolate 12018 (BC) or

Percent Viability1 Depth Dec 2012 (after 1 month) April 2013 (at snowmelt) 0 cm 541 4 10 cm 46 0 20 cm 54 29 LSD p=(0.05) 63 28 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on three replicate observations

Table 2.6. Percent viability of C. buxicola on infected leaf tissue buried to three different depths,

1, 2, 3, and 4 months after burial in August 2013 at the GTI. Leaves were inoculated with isolate

Percent Viability1 Isolate 0 cm 10 cm 20 cm 1 month 25 50 33 2 months 33 0 0 3 months 0 67 42 4 months 0 17 42 LSD p=(0.05) 27 38 62 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on three replicate observations. Percent viability is out of 100%

Table 2.7. Mean percentage of germination and penetration of C. buxicola spores from isolate

Process Time (h) Mean (%)1 Germination2 1 33 Germination 2 49 Germination 3 99 LSD 11 Penetration3 4 3 Penetration 5 32 Penetration 6 56 Penetration 24 100 LSD p=(0.05) 16 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) 2Germination was assessed as the appearance of a germ tube from the tip of the conidia. 3Penetration was assessed as the germ tube coming into contact with the stomatal opening

Table 2.8. Mean infection rate of ‘Green Velvet’ boxwood leaves inoculated with mycelial plugs

The hyphal plugs were removed 4 days post inoculation (dpi), disease severity was measured 5,

7, 10, 13, and 17 dpi, and the plates were stored at 25°C with a 24 h photoperiod at 270

µmol/m2/s.

Disease severity2 Surface 5 dpi 7 dpi 10 dpi 13 dpi 17 dpi Abaxial 3.6 1 4.0 4.0 4.0 4.0 Adaxial 0.8 1.6 2.2 2.6 3.9 LSD p=(0.05) 1.4 2.2 2.7 3.3 0.2 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations. 2 Disease severity was rated on the following scale: 0= 0%, 1= 0-25%, 2= 25-50%, 3= 50-75%, and 4= 75-100% infection based upon the percentage of the leaf area showing necrosis

Disease severity2 Surface 5 dpi 7 dpi 10 dpi 13 dpi 17 dpi Abaxial 0.71 2.2 3.1 3.2 3.6 Adaxial 0.3 0.8 1.4 2.0 2.0 LSD p=(0.05) 0.2 2.0 2.6 2.8 2.8 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations. 2 Disease severity was rated on the following scale: 0= 0%, 1= 0-25%, 2= 25-50%, 3= 50-75%, and 4= 75-100% infection based upon the percentage of the leaf area showing necrosis

Table 2.10. Mean infection rate of ‘Green Gem’ boxwood leaves inoculated with plugs of an

Days of exposure to mycelial Disease severity2 plug inoculum 1 2.21 2 1.9 3 3.3 4 3.5 LSD p=(0.05) 0.8 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations 2 Disease severity was rated on the following scale: 0= 0%, 1= 0-25%, 2= 25-50%, 3= 50-75%, and 4= 75-100% infection based upon the percentage of the leaf area showing necrosis

6 dpi. Leaves were incubated at 25°C with a 24 h photoperiod at 270 µmol/m2/s.

Disease severity2 Age of Boxwood Tissue 2 dpi 4 dpi 6 dpi Young3 1.51 1.8 2.1 Old4 0.0 0.0 0.1 LSD p=(0.05) 0.4007 0.3272 0.2314 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations 2 Disease severity was rated on the following scale: 0= 0%, 1= 0-25%, 2= 25-50%, 3= 50-75%, and 4= 75-100% infection based upon the percentage of the leaf area showing necrosis 3 Young leaf tissue was obtained from newly sprouted buds which were distinctly light green in colour near the top of boxwood plants 4Old leaf tissue was obtained from the base of boxwood plants where leaves were dark green in colour

Disease severity2 Cultivar 5 dpi 7 dpi 10 dpi 13 dpi 17 dpi Green Gem 2.81 3.3 3.6 3.6 3.7 Green Velvet 1.9 3.2 3.7 3.9 4.0 Green Mountain 2.2 2.5 3.3 3.2 3.2 Green Mound 1.8 2.4 2.8 2.7 2.7 LSD p=(0.05) 1.3 1.4 0.8 0.8 0.8 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations. 2 Disease severity was rated on the following scale: 0= 0%, 1= 0-25%, 2= 25-50%, 3= 50-75%, and 4= 75-100% infection based upon the percentage of the leaf area showing necrosis

Disease severity2 Cultivar 5 dpi 7 dpi 10 dpi 13 dpi 17 dpi Green Gem 27.51 35 57.5 57.5 57.5 Green Velvet 20 35 65 70 70 Green Mountain 12.5 15 47.5 47.5 47.5 Green Mound 20 30 55 55 57.5 LSD p=(0.05) 0.8 0.8a 0.7 0.7 0.7 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations 2 Disease severity was rated on a rating scale from 0-100% based upon the percentage of the leaf area showing necrosis

µmol/m2/s.

Disease severity2 Temperature °C 3 dpi 6 dpi 8 dpi 10 dpi 16 dpi 25 1.31 17.6 37.5 62.8 59.1 22 3.4 69.3 81.2 82.8 87.5 15 0.0 4.1 42.8 84.4 100 10 0.0 0.0 0.0 3.3 31.0 4 0.0 0.0 0.0 0.2 10.0 LSD p=(0.05) 0.7 19.3 26.7 24.4 20.5 1Means were compared with a two-way ANOVA and then separated with Fisher’s least significant different (LSD) test (p= 0.05) and are based on four replicate observations. 2 Disease severity was rated on a rating scale from 0-100% based upon the percentage of the leaf area showing necrosis

Figure 2.1. Signs and symptoms of C. buxicola on ‘Green Mountain’ boxwood. Brown spots on the leaves, sporulation under high humidity, and black streaks along the stems of boxwood plants are all characteristic symptoms of this disease.

Figure 2.2. Screw cap tubes were used to assess growth optima for C. buxicola. Each tube was filled with 5.5 ml of PDA and a hyphal plug was placed at the mouth of each tube. The extent of fungal growth was marked every 3 d.

20 µm 20 µm A B 20 µm

20 µm

C 20 µm D 20 µm

Figure 2.3 A. Germination of conidida 3 hpi. B. Penetration of germ tube into the stomata of the leaf 21 hpi. C. An incubation period between penetration and the production of sporodochia. D.

Sporulation on the leaf 72 hpi.

A B

Figure 2.4. A. Chlamydospores forming on a detached ‘Green Mountain’ leaf after being

incubated with a spore suspension of C. buxicola (2.0 x 105 spores/ml) for 4 weeks at 25ºC. B.

Chlamydospores on ‘Green Mountain’ leaf tissue under 40 x magnification.

Figure 2.5. Pachysandra terminalis 7 dpi, where C. buxicola was applied as a spore suspension with a concentration of 2.0 x 105 spores/ml. Plants were stored at 20ºC, under a 24 h photoperiod, with a light intensity of 115 µmol/m/s2, and were sealed in a Ziploc bag.

µmol/m2/ s and were sealed in a Ziploc bag.

Chapter 3 Genome Assembly, Genetic Variation, and Specific Detection of C. buxicola

3.1 Introduction

3.1.1 Genome assembly and gene prediction

Advances in genome sequencing technology have allowed scientists to sequence and assembly small eukaryotic genomes with fewer resources and at lower costs, as well as offering a broad range of applications such as de novo genome sequencing, re-sequencing, and comparative genomic analyses (Haridas et al. 2011; Minoche et al. 2011; Schadt et al. 2010). These advances in sequencing and comparative genomic techniques have made it possible to gain a better understanding of fungal-plant interactions and pathogenicity factors, which are crucial for the development of novel disease control strategies (Xu et al. 2006).

First generation sequencing or the chain termination method was originally developed by

Sanger in 1975. The key limitations of the Sanger method include the small amounts of DNA processed per unit time, also known as throughput, and the high costs associated with longer processing times (Schadt et al. 2010). However in the years following the Sanger method, there have been incredible advances in high-throughput sequencing technologies at lower costs and in less time but with shorter sequence reads called Next Generation Sequencing (NGS) (Haridas et al. 2011; Minoche et al. 2011). This ability to generate extremely large numbers of sequence reads in short periods of time at markedly reduced costs, has vastly broadened the scope of economically feasible sequencing projects (Lin et al. 2011).

Each of these NGS platforms involves a combination of enzymology, chemistry, high- resolution optics, hardware and software engineering which allows for advanced DNA preparation prior to sequencing which significantly reduces the time to completion (Mardis 74

2008). The NGS platforms sequence each base several times to obtain deeper coverage and often utilize paired end sequencing where both ends of the fragments are sequenced to provide better positional or linking information and to identify structural variation (Haridas et al. 2011; Mardis

2008).

Recently NGS technology has been dominated by Illumina who utilize a sequencing-by- synthesis approach. Technology, such as the Illumina Genome Analyzer and HiSeq2000, can yield 80 to 100 million 100 bp reads from a single lane which is equivalent to 300 fold coverage

(Haridas et al. 2011; Quail et al. 2012 ). There are enough duplications to allow for loss or discarding of 50% of the data for issues of potential poor quality or unassembled reads, while still providing enough data for a de novo assembly (Haridas et al. 2011).

For assembling genome sequence data, bioinformatics software is used to align overlapping reads to assembly the original genome into contiguous sequences where longer read lengths correspond to an easier reassembly of the genome (Schadt et al. 2010). An assembly is a hierarchical data structure which maps the sequence data into a conjectured reconstruction of the main target, where it gathers reads into contigs and contigs into scaffolds (Miller et al. 2010). A de novo assembly occurs when no reference reads or previous sequencing information are available or are utilized in the assembly process (Paszkiewicz and Studholme 2010). However,

NGS technologies produce much shorter read lengths which is a fundamental limitation for traditional de novo assembly tools since they have difficulty processing these short reads. (Lin et al. 2011; Miller et al. 2010; DiGuistini et al. 2009). Shorter sequences result in a greater potential impact of base calling errors as well as the reduced likelihood of unique overlaps between pairs of reads (Miller et al. 2010; Paszkiewicz and Studholme 2010).

Lin et al. (2011) compared several de novo assemblers where stronger performance was indicated by higher sequence coverage, higher N50 values, lower assembly error rates and lower computational resource consumption, where the N50 value is a median weighted statistic used to assess assembly quality (Haridas et al. 2011). Lin et al. (2011) found that the assembler

SOAPdenovo required less depth of coverage to generate higher N50 lengths and was also the fastest of all tools when compared to SSAKE, VCAKE, Euler-sr, Velvet, and ABySS. The program SOAPdenovo relies on algorithms that use de Bruijn graphs and the results are highly dependent on the range of K-mers chosen (Miller et al. 2010; Paszkiewicz and Studholme 2010).

K-mer values are the number of perfectly matching adjacent nucleotides among the reads and are required to make contigs or contiguous DNA segments (Haridas et al. 2011; Paszkiewicz and

Studholme 2010). The choice of K-mer depends on whether the requirement is specificity or sensitivity, where a smaller K-mer is more sensitive and a longer k-mer will provide more specificity (Haridas et al. 2011). The output from SOAPdenovo is usually further processed using GapCloser which closes gaps and provides a better overall assembly (Simpson and Durbin

2011).

In 2011, a group of researchers initiated a competition called Assemblathon 1 in which teams were asked to assemble a simulated Illumina HiSeq data set of an unknown simulated diploid genome (Earl et al. 2011). This competition allowed the researchers to evaluate haplotype specific contributions to the assemblies and aimed to comprehensively assess de novo assembly methods when applied to current sequencing technologies (Earl et al. 2011). The results showed that it was possible to assemble a genome to a high level of coverage and accuracy within a benchmark and that large differences exist between the assemblies, which suggests that there is room for further improvements in current methods (Earl et al. 2011).

Assemblathon 2 was launched in 2013 where teams were provided with a variety of sequence data for three vertebrate species (Bradnam et al. 2013 ). It was discovered that many of the current genome assemblers produced useful assemblies which contained a significant representation of their genes and overall genome structure. Despite this, there was a high degree of variability between the entries which suggests that there is still room for vast improvements and that strategies which are successful in assembling the genome of one species may not necessarily work well for another species (Bradnam et al. 2013 ).

Several different assembly programs were examined in this project including

SOAPdenovo. For SOAPdenvo Assemblathon 2, this particular assembly program had the most input sequences (1.5 Gbp) of any assembly, across all three species. However, this assembly ranked third last with only 13.6% of the sequences being aligned at any coverage level (Bradnam et al. 2013 ). Similarly, the SOAPdenovo bird assembly had the second highest N50 length but ranked sixth among competitive assemblies based on the overall score. Conversely, the Ray snake assembly ranked ninth for N50 scaffold length but ranked first in the two metrics of coverage and validity.

Based on these findings, Bradnam et al. (2013 ) provided broad suggestions for performing de novo assembly of eukaryotic organisms. One is to not rely on a single assembly, but instead generate several assemblies using different assemblers and different assembler parameters. Another is to not place too much emphasis in a single metric and attempt to choose an assembler which excels in your area of interest (e.g. coverage, continuity, or number of error free bases) (Bradnam et al. 2013 ). Therefore, it is not feasible to rank a single assembler as the best overall program; however it is more important to choose an assembler that is well suited for the particular genome project. 77

After the initial assembly of the genome is complete, genes can be predicted. There are two general types of gene prediction programs: similarity based and de novo. The former uses external information or a corresponding protein that has already been sequenced and de novo gene prediction utilizes statistical models to predict gene structure with the genome in question as the only input (Wei and Brent 2006).

Gene prediction programs have generally achieved a high level of accuracy on short genomic sequences but often have difficulty performing well on longer sequences containing an unknown number of genes and this leads to the prediction of false exons (Stanke and Waack

2003). Stanke and Waack (2003) developed a program called AUGUSTUS which utilizes the ab initio method based on the Hidden Markov Model to predict coding genes in eukaryotic genomes. The AUGUSTUS program has been shown to predict long sequences far more accurately when compared to other programs (Stanke and Waack 2003).

Strict similarity-based programs such as GENEWISE and GENOMESCAN have limitations when there is no homology for the sequence in question. Homology refers to similarity by descent and is considered qualitative where two sequences are either homologous or they are not (Hsiang and Baillie 2004). The level of identity for proteins required to establish homology is often between 25- 30% across a large segment. The expect value (E) is a statistic used as the main criterion for homology which refers to the number of hits one can expect to see just by chance when searching a database of a particular size. De novo based gene prediction programs such as HMMGENE and GENEID have been shown to be less accurate when compared to similarity-based methods (Wei and Brent 2006; Stanke and Waack 2003).

AUGUSTUS overcomes some of these common challenges since it is not a purely similarity based program. AUGUSTUS is an ab initio gene finding tool which means it can be applied to 78

sequences without known homologies and can accurately model shorter sequence lengths

(Stanke and Waack 2003). Once assembly and gene prediction are complete one can analyze the exclusive and unique set of genes each organism contains using comparative genomic techniques

(Hsiang and Baillie 2004).

3.1.2 Specific detection of fungal pathogens

There are often two general approaches used to select target DNA sequences for use in plant pathogen detection. One is to develop primers from well known or ubiquitous genes common in fungi but which have useful sequence variation, and the other is to locate parts of the fungal genome to find regions that show specificity and uniqueness (McCartney et al. 2003;

Lievens and Thomma 2005). The other is to select target sequences from the fungal genome and this is often done by screening random parts of the genome using random amplified polymorphic

DNA (Lievens and Thomma 2005). For the first approach, the primary target is often the nuclear ribosomal DNA (rDNA) which occurs in all organisms in high numbers and are well characterized, making them ideal for targets in detection experiments (McCartney et al. 2003;

Lievens and Thomma 2005). Fungal rDNA occurs as a subunit containing three ribosomal RNA genes, is separated by internal transcribed spacers (ITS), and contain alternating regions of high conservation and variability (Lievens and Thomma 2005). For the second approach, it is possible to design specific PCR primers by targeting DNA sequences which are unique to the pathogen of interest following sequence analysis (McCartney et al. 2003). The amount of the target sequence present in samples can also be quantified with limiting dilutions, which is the limit of dilution of a specific sequence using negative and positive controls (Henson and French 1993).

A common issue that can arise with conventional PCR is poor reproducibility especially since the final product comes from exponential amplification of the starting template and any 79

minor differences in amplification conditions can result in large differences in product yield

(Diviacco et al. 1992). A well known method to overcome this variation in product yield is the inclusion of an internal control sequence which is usually amplified with the same primers and is identical to the target sequence except for the size difference to help distinguish it from the target

DNA (Henson and French 1993). However, a control gene or housekeeping gene of interest can also be used with specific primers for the target pathogen (Dyer et al. 2001). The principle behind the addition of an internal control is that any factor influencing amplification should affect both the reference and the template in a similar manner if the reaction is maintained until completion (Diviacco et al. 1992). This approach can solve issues such as tube-to-tube variation, and it largely eliminates contamination by PCR inhibitors because when a positive signal from secondary target is obtained by successful amplification, it validates the results for the primary target (Bjerrum et al. 2002; Rosenstraus et al. 1998). Thus far, there is no study in the literature which has at attempted to create a detection assay for C. buxicola using specific and unique primers designed from the fungal genome.

3.1.3 Specific detection of Cylindrocladium buxicola

Henricot et al. (2002) sequenced the ITS region for C. buxicola using the primers ITS1 and ITS4. More variable regions were also sequenced including parts of the -tubulin using the primers T1 and Bt2b as well as the HMG box of the MAT2 gene using primers ColHMG1 and

ColHMG2 (Henricot and Culham 2002). It was discovered that these three gene sequences were unique compared to other Cylindrocladium species published at the time. Several genes were sequenced to give a better resolution on the phylogeny of this fungus. The ITS region has few informative sites and can differentiate only a few members of the genus Cylidrocladium whereas the -tubulin and MAT2 HMG box had enough informative sites to differentiate the species of

Cylindrocladium. For the specific detection of C. buxicola, Gehesquiere et al. (2013) developed a q-PCR assay using ITS and -tubulin genes. Shan et al. (2013) also developed a conventional

PCR assay to detect C. buxicola in boxwood plants. Specific primers were created from the ITS and -tubulin genes and an artificially constructed internal control DNA fragment was spiked into each reaction along with these unique primers. The limit of detection was also assessed in this study for both spiked leaf and spiked leaf stem DNA and was found to be 10 pg (Shan et al.

2013).

3.1.4 Genetic diversity of fungal plant pathogens

There are several different molecular techniques commonly used to study systematics and genetic variation within fungi (Bruns et al. 1991). A common technique called restriction fragment length polymorphism analysis (RFLP) generates restriction patterns by cleaving DNA with restriction enzymes followed by size separation of the resulting fragments using gel electrophoresis (Bruns et al. 1991). Another technique used called random amplification of polymorphic DNA markers (RAPD) or PCR fingerprinting utilizes single primers of arbitrary sequence to analyze polymorphisms on genomic DNA with no external information or nucleotide sequences (Buscot et al. 1996). This method is acceptable for investigations at the intraspecific level but requires careful optimization and often demonstrates poor reproducibility

(Tyler et al. 1997). Another approach similar to RAPD analysis is amplified fragment length polymorphism analysis (AFLP) which also uses randomly generated primers to initiate amplification of discrete portions of the genome; however the main difference is that amplification occurs under highly stringent conditions (Caetano-Anolles et al. 1992, Mueller et al. 1996).

A more reproducible fingerprinting technique uses single primers which are designed based on microsatellite regions of the genomic DNA (Buscot et al. 1996). If a single, short primer is designed from known repeating sequences, amplification of numerous random loci can occur since short sequences are known to repeat several times throughout any given genome

(Zietkiewicz et al. 1994). These patterns or fingerprints are also known as inter-simple sequence repeats (ISSR) or polymorphisms and they can be detected among individuals of the same population using ISSR molecular analysis (Zietkiewicz et al. 1994). ISSR analysis is a PCR based technique that produces dominant markers of putative microsatellite regions and can provide useful information regarding the genetic diversity and variation of a fungal population

(Mishra et al. 2003). ISSR analysis has yielded vital and reliable molecular markers for studies focusing on population genetics as well as evolutionary biology of many eukaryotes including plant pathogenic fungi (Mishra et al. 2004).

3.1.5 Genetic diversity of Cylindrocladium buxicola

There have been several phylogenetic studies conducted for the genus Cylindrocladium in which molecular techniques were used to analyze the relationship between different species to identify unknown strains (Crous et al. 1997, 2004, Crous and Seifert 1998, Henricot et al. 2002).

Species of the genus Cylindrocladium can be differentiated based on morphological features such as size, shape and septation of conidia and vesicles; however some of these features can be influenced by changing environmental conditions which makes it difficult to distinguish between different species (Henricot et al. 2002). This is common for most fungal pathogens which encourages the use of molecular techniques to solve taxonomic disputes and to identify genetic variation between isolates of the same species (Henricot et al. 2002). Henricot et al. (2002) utilized AFLP analysis to distinguish genetic differences between isolates of C. buxicola from

the UK and New Zealand, and they found little variation between these isolates. ISSR analysis of

C. buxicola isolates from Ontario and several areas of Europe were carried out using primers initially designed to identify genetic variation between P. buxi isolates (Shi 2011).

3.1.6 Fungal mating type genes and sexual reproduction

The process of mate selection and the commitment to mating are vital steps in the life cycle of sexually reproducing fungi (Kronstad and Staben 1997). Once the conditions are favorable for sexual reproduction, a developmental program is initiated which includes the formation of sexual structures (Turgeon et al. 1993). The key factor controlling the sexual reproductive mode in fungi is the presence or absence of mating type (MAT) genes which are located within the genome at mating type loci and they determine mating compatibility or incompatibility (Rydholm et al. 2007). Mating type is a genetically determined sexual compatibility phenotype and the term type refers to the genetic regulation of mating specificity and sexual development (Kronstad and Staben 1997). In heterothallic species these genes control the initial fusion of thalli and the formation of dikaryotic hyphae which is necessary for the formation of zygotes (Kronstad and Staben 1997). The main advantage of sexual reproduction is the generation of genetic variation which may generate individuals with increased virulence, increased fitness or this genetic variation can result in altered responses to fungicide treatments

(Li et al. 2010, McCartney et al. 2003).

Heterothallic fungi are self sterile and require gamete nuclei to come from parents with complementary mating type genes. In contrast, with homothallic fungi each strain is self fertile meaning sexual reproduction can occur between two identical nuclei and therefore mating type cannot be defined (Kronstand and Staben 1997). All known heterothallic ascomycetes have two non-allelic versions of the MAT locus termed idiomorphs and are found in isolates with 83

complementary mating types (Rydholm et al. 2007). The two versions are termed MAT1-1 and

MAT1-2 where they are distinguished by the presence of an open reading frame (ORF) encoding a MAT protein with an alpha domain and a single ORF encoding a MAT protein with a high mobility group (HMG) domain, respectively (Rydholm et al. 2007). Homothallic species usually contain a single MAT locus with the alpha and HMG genes fused together or in very close proximity (Rydholm et al. 2007). The binding of HMG domain proteins induces DNA bending and are capable of recognizing altered DNA structures (Coppin et al. 1997). The alpha domain protein is a transcription activator that works with other proteins to recognize the promoter of several alpha-specific genes (Coppin et al. 1997).

Identifying the presence of both mating type genes within a fungal pathogen population provides an essential application for disease management strategies to predict the prospects of sexual reproduction and the risk of production of airborne inoculum (McCartney et al. 2003). In the past the determination of mating type has been conducted with the time intensive method of crossing isolates of unknown mating type with control isolates of known mating type

(McCartney et al. 2003). This process can take weeks to obtain any results, whereas a PCR based method can accurately detect mating type for a cultivar in approximately 24 hours without the need to isolate the fungus from infected plant tissue (McCartney et al. 2003).

Within ascomycete fungal species, the mating type loci consist of idiomorphic regions where the sequences are dissimilar between the opposite mating types but are flanked by regions of high similarity (McCartney et al. 2003:, Turgeon 1998) The MAT locus is flanked by the genes SLA2 and APN2 which are almost identical between mating types (98% identity), however there is a blunt transition between the common flanking DNA and the idiomorphs where the identity decreases to random levels (Turgeon 1998). The availability of mating type 84

sequences and the knowledge of the mating type region has allowed the use of PCR diagnostic tests to determine the mating type of several fungal plant pathogens (McCartney et al. 2003).

Mating type genes are uniquely suited to address questions about evolution of reproductive strategies as well as sexuality itself, however their usefulness has been limited in the past due to the difficulty involved in cloning them from a wide array of fungi (Arie et al.

1997). Whole genome sequencing and comparative fungal genomics provides a powerful tool to overcome these limitations by providing detailed information on the unique gene pool each species contains. Previously, cloning of MAT genes has been conducted using PCR techniques but the occurrence of MAT genes and the synteny within a fungal species is not always straight forward and PCR assays cannot always provide a detailed outline of the organization of mating systems. Kellis et al. (2003) present a comparative genomic analysis of four related species of

Saccharomyces yeasts where they discovered an unusually slow rate of evolution for the mating type gene MAT1-2. The genes showed perfect conservation at the amino acid level over its entire length across all four species. This observation was only possible because the authors had access to all of the genome sequences for all four species.

3.1.7 Sexual reproduction in Cylindrocladium buxicola

There has been very limited research done which as focused on the sexual reproduction and the diversity of C. buxicola. Currently, the geographic origin of C. buxicola is unknown, however its geographic range has expanded over the past 10 years and has extended beyond

Europe and Australasia (Henricot 2006). DNA evidence from AFLP analysis indicates that C. buxicola has a clonal population structure and all the isolates from the UK and New Zealand seemed to belong to one mating type, as suggested by mating experiments which failed to produced any fertile perithecia (Henricot 2006). Henricot and Culham (2002) suggest that these 85

data support the hypothesis of an exotic origin and that C. buxicola was introduced to Europe from a geographically isolated region on asymptomatic plants. However, Henricot and Culham

(2002) speculate that it may be possible for fertile perithecia to be produced under different environmental conditions, therefore, sexual reproduction cannot be ruled out. More research is needed to observe if MAT1-1 is present within the species and whether sexual reproduction does occur.

3.1.8 Objectives

The objectives of this research were as follows:

1) To assemble the genome of two isolates of C. buxicola from Germany and Ontario;

2) To search for unique and core fungal genes to develop markers for specific detection of this fungus

3) To test the limits of the specific detection markers for their ability to reveal low levels of infection from infected boxwood tissue.

4) To identify genetic variation between isolates of C. buxicola from different geographic regions

5) To survey isolates for mating type genes.

3.2 Materials and methods

3.2.1 Genome assembly and gene prediction of Cylindrocladium buxicola

Two isolates (12034 from Ontario and 12013 from Germany) of the fungus C. buxicola were chosen for genome sequencing and assembly. DNA was extracted using a Qiagen

DNeasy® Plant Mini Kit 50 (Qiagen Sciences, Gaithersburg, Maryland, USA) from isolate

12034 by Amy Shi in October 2012. The isolate 12013 from Germany was also sent for sequencing in March 2013 where the DNA was extracted following Edwards et al.(1991). A minimum of 1 µg of DNA from each isolate was sent to the Génome Québec Innovation Centre

(McGill University, Montreal, Quebec, Canada) for 100 bp paired-end reads using the Illumina

Hiseq2000 platform. Each sample was multiplexed with seven other samples for running on a single lane which theoretically could yield around 5 Gb of data per sample. After two to four months, the data became available and were copied to local Linux servers. Assembly of the data was done using the Linux-based de novo assembler SOAPdenovo v. 1.1.2 (Li et al. 2008) using k-mer values of 19 to 63 for isolate 12034 and k-mer values of 29 to 83 for isolate 12013.

The output from SOAPdenovo was further processed using GapCloser v. 1.1.2 (Li et al.

2008) which closes gaps or joins contigs into scaffolds and provides an improved assembly.

Assembly statistics were calculated using the PERL script N50.pl (Appendix 3.1) which gives file size, assembly size, and number of contigs, N50 and N90 length. The N50 values are median weighted statistics used to assess assembly quality for each k-mer; where a high N50 value (>

100, 000) indicates a high quality assembly and a low N50 value (<10 000) indicates a low quality assembly (Haridas et al. 2011). An assembly was chosen based on the highest N50 value, this assembly was then used for gene prediction. Gene prediction for both isolates was conducted using the program AUGUSTUS v. 2.6.1 (Stanke et al. 2004) which is an ab initio gene calling program based on the Hidden Markov Model. The gene prediction from the model organism

Fusarium graminearum (Sordariomycetes) within the AUGUSTUS package was used as the reference model to assist in prediction of genes for C. buxicola. AUGUSTUS was run on a Linux server running UBUNTU 10.04 64-bit with 16 Gb of RAM. The modified PERL script

get_gene.pl (Appendix 3.2) was used to create FASTA sequence files from the AUGUSTUS output.

3.2.2 Specific detection of Cylindrocladium buxicola

ITS PCR product of isolates from Belgium (12001), Germany (12013), and Ontario

(12169 and 12170) were sent to Lab Services (University of Guelph) and sequenced with the

ITS1 (TCCGTAGGTGAACCTGCG) primer. Once the sequence results were received the sequences were re-analzyed using Chromas Lite sequence and chromatogram editor v. 2.1

(Technelysium Software, South Brisbane, Queensland, Australia) to replace unknown N’s with the most likely nucleotide. An ITS1 sequence of C. buxicola was obtained from GenBank (NCBI http://www.ncbi.nlm.nih.gov/) and all five sequences were aligned using MUSCLE (Edgar 2004) and visualized CLUSTAL X (Thompson et al. 1997). The consensus sequence was compared against GenBank using BLASTn v. 2.2.24 (1e-5) (Altschul et al. 1990) to find sequences from 10 closely related fungal species. The sequences from these 10 closely related species along with

ITS1 sequences of isolates 12001 and 12013 were aligned using MUSCLE and visualized using

CLUSTALX (Appendix 3.3).

Primers were then designed from the specific regions of C. buxicola which were not conserved in the closely related species, and visualized in CLUSTALX to ensure the specific detection of C. buxicola following the rules of primer design. The primers were designed using the following critera in the program Gene Runner v. 3.01 (Hastings Software Inc, Vancouver,

BC, Canada): primer length between 18-22 bp; GC content between 40-60%; predicted melting temperature between 55-60°C, and absence of dimer problems or hairpins. The two primer sequences selected were ITS311F (5'-TGTTGGGGATCGGCAGA) and ITS419R (5'-

CCAGAGCGAGGTGTATTAA) (Appendix 3.3). The annealing temperatures of these primers 88

were tested following the procedure in section 2.2.9 at 55°C, but they did not successfully amplify C. buxicola; however when ITS311F was paired with ITS4 (5'-

TCCTCCGCTTATTGATATGC), these primers did successfully amplify C. buxicola.(see

Chapter 2 for ITS1/ITS4 sequences) To confirm specificity, these primers were tested against 10 closely related fungal species: Trichoderma reesi, Cryphonectria parasitica, Sclerotinia homoeocarpa, Chaetomium globsum, Fusarium laterititum, Bionectria ochroleuca,

Pseudonectria buxi, Fusarium equiseti, Acremonium sp., and Leptographium terebrantis . The

DNA for these isolates was extracted following Edwards et al. (1991) in the laboratory of Dr.

Tom Hsiang. The primers were used in a PCR reaction with annealing temperatures of 55-60°C.

Amplifications were performed in a Bio-Rad MycyclerTM Thermal Cycler with an initial denaturing step of 94°C for 2 min follow by 25 cycles of 94°C for 30 s, annealing tempearture for 1 min, 72°C for 1 min, and a final extension of 72°C for 10 min

ITS-specific primers were used to assess the lowest concentration at which the primers could still amplify the DNA of C. buxicola. ITS specific primers ITS311F and ITS4 were used with isolate Ontario (12227) where the DNA was diluted to make concentrations of 1, 0.1, 0.01,

0.001, 0.0001, and 0.0001 ng/µl. A PCR was run following the procedure in section 2.2.9 with an annealing temperature of 55°C. This experiment was repeated using pure plant DNA combined with pure fungal DNA where the plant DNA was extracted from ‘Green Mountain’ boxwood leaves following Edwards et al. (1991). The quality of the plant DNA was confirmed by conducting a PCR using chloroplast primers (cp_atpB-1

ACATCKARTACKGGACCAATAA and cp_rbc-1 AACACCAGCTTTRAA TCCAA)(Chiang and Schaal 2000). The same 6 concentrations of fungal DNA from the isolate 12227 were used

where 1 µl of 1 ng/µl plant DNA was added to each PCR tube containing 13 µl of master mix in addition to the 1 µl of fungal DNA.

3.2.3 Selection of unique gene primers

To search for novel genes within the C. buxicola genome, the predicted gene set for isolate 12034 was compared to a wide range of fungal genomes obtained from the Hsiang lab genome database. In total, 34 genomes were used including two Leotiomycetes, two

Eurotiomycetes, two Dothidiomycetes, and 28 Sordariomycetes (Appendix 3.4). The predicted amino acids were compared to the 34 fungal genomes using StandAlone Blast v. 2.2.24 with tBLASTn at a cut-off e-value of 1e-5. The BLAST output was parsed using the PERL script split_parse_bn.pl (Appendix 3.5) which splits multi-record BLAST output files into individual records and then parses these files or extracts the relevant information including: query, query length, number of hits, subject id number, subject length, bit score, and e-value. The parsed output file was converted to an Excel file from which the genes which had zero hits with any of the 34 genomes were selected.

The PERL script bp_retrievelistfromfasta.pl (Appendix 3.6) was used to take the list of fasta headers from the genes selected with zero hits and then using these headers, the script retrieved those entries from the original predicted gene set. Once the list of genes with no matches was retrieved, Blastcl3.exe v. 2.2.26 with tBLASTn (1e-5) was used to remotely search the NCBI database for possible matches with other genes. The output file from the remote

BLAST analysis was parsed using the PERL script bp_blastparse-nomeanid.pl (Appendix 3.7) which takes the specified text formatted BLAST files and returns e-values and bit scores for the top two hits. A new list of genes with no matches with fasta headers was then created and the

bp_retrievelistfromfasta.pl script was used to retrieve these genes from the original predicted gene set.

Before sequences were chosen to design primers, the PERL script fasta_filterminlength.pl

(Appendix 3.8) was used to eliminate sequences which were less than 100 aa or 300 bp. Genes were then selected at random from the set of proposed unique genes and primers were designed from these genes to test their specificity with C. buxicola. Four primer sets- UG319F/UG875R,

UG19F/UG 429R, UG120F/UG575R, and UG120F/UG765R- were created from three different genes (Appendix 3.9-3.12). To test whether these unique genes were present as single copy genes in the C. buxicola genome, they were compared to the whole genome as well as the predicted genes using StandAlone Blast v. 2.2.24 with BLASTn at a cut-off e-value of 1e-5. The results showed how many matches each gene had within the genome, and allowed inference of whether these genes were single copy ones, or duplicated, or members of gene families.

The annealing temperature of these primers was tested at various temperatures following the protocol in section 2.2.9, where each primer set was tested with the same 10 closely related fungal species used in section 3.2.2 to ensure specificity. The PCR limit of detection was determined where the unique fungal gene primers were used to assess the lowest concentration at which the primers could still amplify C. buxicola with both pure fungal DNA and pure fungal

DNA combined with pure plant DNA following the protocol in section 3.2.2.

3.2.4 Co-amplification with unique gene primers

The primers were then assessed as to whether these unique gene primers could detect the presence of C. buxicola from infected plant material. ‘Green Mountain’ boxwood leaves were inoculated with a spore suspension of C. buxicola from Ontario isolate 12031. The spore

suspension had a concentration of 2.0 x 105 spores/ml and the inoculated leaves were incubated at room temperature under a light intensity of 270 µmol/m2/s. DNA was extracted following

Edwards et al. (1991) from ‘Green Mountain’ boxwood tissue one week after inoculation. A second set of infected plant DNA was extracted using a GeneJet Plant Genomic DNA purification mini kit (Fermentas Life Sciences, Ottawa, Canada). The DNA was tested with the unique gene primers (UG120F/UG575R) following the protocol in section 2.2.9 with an annealing temperature of 58°C. Single, clear bands were amplified in the 450 bp region which meant that co-amplification could be attempted where both the unique fungal gene primers and the chloroplast primers (cp_atpB-1 and cp_rbc-1) are used in the same master mix.

In the multiplex PCR, two bands should have been produced, one in the 450 bp range for the fungal DNA, and one band in the 1000 bp range for the chloroplast DNA. Co-amplification would demonstrate the presence of C. buxicola within the infected boxwood tissue while the presence of the chloroplast DNA should act as an internal control. Co-amplification was attempted with two of the unique fungal primers (UG120F/UG575R and UG120F/UG765R) and with two different sets of chloroplast primers (cp_atpB_1/cp_rbc_1 and

103_atpBF/1056_rbcLR) following the protocol in section 2.2.9 at 58°C and 57°C. For initial reactions, pure fungal DNA and pure plant DNA were used as positive controls. Once co- amplification was successful, the PCR products were separated in 1% agarose gels, stained with

1% ethidium bromide and visualized on a transilluminator. The image was saved as an electronic file and quantification of fungal tissue was done using Image J v. 1.47 (Research Services

Branch, Bethesda , Maryland, USA). For each gel lane, the intensities of the bands were calculated for both the fungal gene and the internal control gene. The ratio of the intensity of the fungal band over the intensity of the internal control was calculated which indicates the amount

of fungal DNA present within the infected plant DNA. A limit of detection test was done following the protocol in section 3.2.2 to assess the lowest concentrations of fungal and plant

DNA required to still achieve co-amplification.

Another co-amplification experiment was done with infected boxwood DNA at different time points during the infection process. ‘Green Mountain’ boxwood leaves were inoculated with a spore suspension of the C. buxicola isolate 12031 from Ontario. The spore suspension had a concentration of 2.0 x 105 spores/ml. The leaves were incubated for the appropriate amount of time at 22°C under a light intensity of 270 µmol/m2/s. In total, infected plant DNA was collected at three different time points: low level infection after 7 days, mid-level infection after 14 days, and high level infection after 21 days. DNA was extracted using a GeneJet Plant Genomic DNA purification mini kit (Fermentas Life Sciences, Ottawa, Canada). Co-amplification was attempted using unique fungal gene primers and chloroplast primers following the protocol in section 2.2.9 at an annealing temperature of 60°C. Band intensities were measured using Image J v. 1.47 and the quantity of fungal DNA was analyzed by calculating the ratio between the fungal band and the chloroplast band.

3.2.5 ISSR primer screening and analysis

To assess if there was variation between the C. buxicola isolates from Ontario and between the isolates from different geographic regions, the isolates were compared using ISSR

PCR techniques where ISSR markers were used to identify any major differences between the isolates. Eight ISSR primers which had been used for ISSR experiments with Pseudonectria buxi (Shi 2011) were used here for screening for genetic variation: (CAG)6CC, DD(CCA)5,

(CAC)5, CCA(TGA)5TG, (CAA)5, (AG)8, (ACC)6CCA, and (CAC)5. The isolates tested were from Belgium (12001), Germany (12013), Italy (12015), British Columbia (12018), and Ontario 93

(12174, 12025, 12030, 12194, 12168, and 12176). The annealing temperatures of the primers were tested with a gradient thermal cycler (Bio-Rad MycyclerTM Thermal Cycler 580BR10964), with temperatures ranging from 45 to 52°C to find the optimal annealing temperature to achieve clear banding patterns. DNA was extracted from these isolates following Edwards et al. (1991) and was diluted to 100-fold prior to the ISSR reactions. The reactions were done in a total volume of 20 µl containing 1xPCR buffer (50 mm Tris-HCl, pH 8.5), 200 µM of each dNTP, 2.5 mM MgCl2, 0.4 µM of each primer, 0.6 U Tsg DNA polymerase and 1 µl DNA. DNA amplification took place in the MyCycler thermal cycler with an initial denaturation step of 94°C for 1.5 min, followed by 35 cycles of 94°C for 40 s, annealing temperature for 45 s, 72°C for 1.5 min, 94°C for 45 s and a final extension at 72°C for 5 min. Primer (ACC)6CCA was chosen because this particular primer produced the clearest bands on subsequent agarose gels. The annealing temperature of this primer was 48°C.

The PCR product was run through 1% agarose gels (Agarose A, BioBasic, Canada) where 3 µl aliquots of the PCR product were mixed with 1 µl of 6x loading dye and a 6 µl aliquot of DNA marker (DNA Logic-Ladder 100bp -10kb, BioBasic, Canada) was used to measure band sizes. Electrophoresis was done at 100 V in a mupid-2plus submarine electrophoresis system (Helixx Technologies, Toronto, Ontario, Canada). Gels were stained with ethidium bromide (EtBr) for 5 min and observed on a UV transilluminator from Syngene

(Synoptics, Cambridge, Cambridgeshire, U.K.) for DNA band visualization. To examine the gels, a GBC video camera CCTV (South Hackensack, New Jersey, USA) was used, and image files were saved on a computer for later examination.

3.2.6 Search for mating type genes within Cylindrocladium buxicola

To screen for MAT genes within isolates of C. buxicola the first step was sequencing and assembling the genome of isolate 12034 from Ontario (refer to section 3.2.1). The whole genome was then compared to MAT1-2 and MAT1-1 sequences from closely related fungal species, obtained from NCBI, using StandAlone Blast v. 2.2.24 with tBLASTn at an e-value cutoff of 1e-

5. The results demonstrated the occurrence of MAT1-2 for isolate 12034. The scaffold which contained the strongest match was compared to NCBI using blastcl3.exe v. 2.2.26 with tBLASTn

(1e-5) to identify the region with the most coverage of the MAT1-2 gene. This region was then used to design primers to screen the C. buxicola isolates to assess if the MAT1-2 gene was present. Elongation factor 1-α PCR was used to ensure the quality of DNA before attempting to amplify with the MAT1-2 primers. Once DNA quality was confirmed, the primers MAT2-812F and MAT2-1353R (Appendix 3.13) were used to screen C. buxicola isolates for the MAT1-2 gene.

The screening tests for MAT1-2 prompted further analysis for isolate 12013 from Germany since amplification was not seen for this particular isolate. Isolate 12013 from Germany was sent for whole genome sequencing in March 2013 (see section 3.2.1). Once the whole genome was assembled the assembly was compared to the same set of MAT1-1 and MAT1-2 sequences from closely related fungal species used above using StandAlone Blast v. 2.2.24 with tBLASTn (1e-5).

These results demonstrated the presence of MAT1-1 for isolate 12013. The scaffold which contained the strongest match was compared to NCBI using blastcl3.exe v. 2.2.26 with tBLASTn at an e-value cutoff of 1e-5 to identify the scaffold with the most coverage of the MAT1-1 gene.

This region was used to design primers MAT1-431F and MAT1-866R (Appendix 3.14) to screen

isolate 12013 along with the C. buxicola isolates to assess whether any of the other isolates contained MAT1-1.

To identify the synteny of genes surrounding the MAT genes the genomes for each isolate

(12034 and 12001) were compared to a list of APN2 and SLA2 genes obtained from GenBank using StandAlone Blast v. 2.2.24 with tBLASTn at an e-value cutoff of 1e-5. The scaffold with the highest similarity to APN2 and SLA2, respectively was located and compared against the list of APN2 and SLA2 genes from other species using StandAlone Blast v. 2.2.24 with tBLASTn at an e-value cutoff of 1e-5. The regions with the highest similarity to APN2 and SLA2 were chosen for further comparisons. The region between the APN2 and SLA2 was compared to

GenBank to ensure that it represented the correct MAT gene.

3.2.7 Mating type crosses

Mating type crosses were conducted to attempt to produce perithecia in a laboratory setting.

The isolate Germany (12013) which contains MAT1-1 was crossed with other isolates of C. buxicola which are known to contain MAT1-2 including Belgium (12001), Italy (12015), BC

(12018), and Ontario (12034) (Table 3.3). Initially 5-mm-diameter mycelial plugs of isolates with the opposite mating type were placed at opposite ends of both PDA and water agar. Water agar was prepared by combining 10 g of Bacto agar (Becton, Dickinson and Company, Franklin

Lakes, New Jersey USA) with 500 mL of water and autoclaving for 20 minutes at 121°C. Mating type crosses were also conducted using sterilized boxwood tissue where two isolates of the opposite mating type were placed on either end of a sterilized piece of ‘Green Mountain’ boxwood leaf, inside Petri plates with either water agar or on moist filter papers. ‘Green

Mountain’ boxwood leaves were dried and autoclaved at 121°C for 20 minutes prior to placement inside the Petri plates. Finally mating type crosses were also conducted on fresh 96

boxwood tissue which had not been autoclaved where two isolates of the opposite mating type were placed on either end of a boxwood leaf inside Petri plates with water agar or moist filter papers. All plates were incubated in plastic storage containers at 20°C and were checked every month for signs of perithecia formation.

3.2.8 Comparison of two different isolates of Cylindrocladium buxicola

Once the genomes for isolates 12034 and 12013 had been sequenced and assembled, they were compared to analyze how many genes and what type of genes the two genomes had in common and which genes were unique to each isolate. This analysis was done using BLAST+ v.

2.2.28 because BLAST v. 2.2.26 and v. 2.2.24 for blastcl3.exe and blastall.exe had become deprecated and were no longer available for use at the time this experiment was conducted. All analyses were done comparing isolate 12013 to isolate 12034 and then vice versa; isolate 12034 compared to isolate 12013. Initially the predicted gene sets for both isolates were compared to each other using BLAST+ v. 2.2.28 with BLASTp at an e-value cutoff of 1e-5. The BLAST output was parsed using the PERL script split_parse_bp.pl (Appendix 3.5) which splits multi- record BLAST output files into individual records and then parses these files. The parsed out file was converted to an Excel file from which the genes which had zero hits with the corresponding genome were selected. The PERL script bp_retrievelistfromfasta.pl (Appendix 3.6) was used to take the list of fasta headers from the genes selected with zero hits and then using these headers, the script retrieved those entries from the original predicted gene set.

The results from this initial BLAST job at an e-value of 1e-5, comparing the predicted gene sets for each of the isolates, was separated into three categories based on the resulting e-values using the script find_not_found.pl (Appendix 3.15). The three categories were e-values of 1e-5,

1e-50, and 1e-100 where the script grabs all the genes that are not found from a predicted gene 97

versus predicted gene comparison and separates them based on the three specified e-values. This provides three different lists of genes which do not have matches in the opposite genome at three different e-value cut-offs. The list of genes with no matches to the opposite genome at an e-value of 1e-100 was taken and compared again using BLAST+ with BLASTp to the whole genome instead of the predicted gene set to investigate whether the gene prediction algorithm failed to predict some of the genes within this list. The BLAST results were then parsed and a final list of genes with no matches was retrieved. This final list was then compared to the non-redundant

(NR) BLAST database downloaded from NCBI using BLASTp with 1e-5. The results were then organized into the three different e-value categories using the script compare_list_to_blast.pl

(Appendix 3.16) which provided the genes unique to each genome at e-values of 1e-5, 1e-50, and

1e-100.

3.3 Results and discussion

3.3.1 Genome assembly and gene prediction

The genomes of isolates 12034 and 12013 of C. buxicola were assembled using the Linux based assembler called SOAPdenovo. For isolate 12034, K-mer values ranging from 19 to 63 were used and GapCloser was utilized to join contigs into scaffolds. The highest scaffold N50 value was 248,551 bp at K-mer 63. The genome size was 52.7 Mb, and there were 861 contigs with 129 fold coverage (Table 3.1). For isolate 12013, K-mer values ranging from 29 to 83 were used and GapCloser was utilized to join contigs into scaffolds. The highest scaffold N50 value was 479, 128 bp at K-mers above 61. The genome size was 54.9 Mb, there were 10175 contigs with 87 fold coverage (Table 3.1). K-mer63 for isolate 12034 and K-mer65 for 12013 were used for gene prediction following the assembly. AUGUSTUS was used to predict genes for both

isolates where there were 13, 082 genes predicted for isolate 12034 and 13, 181 genes predicted for isolate 12013.

For isolate 12034 from Ontario, the raw reads were initially assembled into scaffolds by

Dr. Tom Hsiang and were then used to predict protein sequences. Isolate 12034 was then re- assembled to confirm the N50 values obtained from the initial assembly, and this assembly was then used for further analysis. The second isolate 12013 from Germany was sent for whole genome sequencing after discovering genetic differences in comparison to other the C. buxicola isolates (more in section 3.3.4) and because this isolate lacked the MAT1-2 gene (more in section 3.3.5). The raw sequencing reads were successfully assembled into scaffolds which were then used to predict protein sequences. The two assembled genomes and predicted proteins were then used to conduct comparisons between the isolates and to search for unique genes within each isolate.

For C. buxicola isolate 12034, an N50 value of 24, 8551 bp was obtained, compared to isolate 12013 where an N50 value of 47, 9128 bp was obtained. This second N50 value for isolate 12013 was higher compared to isolate 12034 and this allowed for a slightly higher number of predicted proteins for isolate 12013. However, even though there were a lower number of predicted genes for isolate 12034 there was 129 fold coverage compared to isolate

12013 which had 87 fold coverage. The difference in coverage could be due to repetitive regions in the latter genome that were not properly assembled, reads which were not all full length, or reads that could not be assembled at all (Haridas et al. 2011). However, the assembly statistics obtained align with previously assembled ascomycetes in the literature. The genome of Sordaria macrospora was sequenced using a combination of Illumina/Solex and 454 sequencing, where

38.7 Mb of sequence data, in 3344 contigs with an N50 size of 51 kb was obtained using the

Velvet assembler (Nowrousian et al. 2010 ). The assembly of Fusarium graminearum was 36.1

Mb in size, with 511 contigs where an N50 of 147 kb was obtained using the Arachne assembler

(Cuomo et al. 2007).

Gene prediction for both C. buxicola genomes produced very similar numbers of predicted genes despite the differences in sequencing coverage. The range of estimated number of predicted genes for fungal genomes was between 4700 and 17, 000 and poor gene prediction can result if there are coding sequences which are not detected by AUGUTUS due to poor sequencing coverage or due to chance (Nowrousian et al. 2010 ). The number of predicted gene sets for both isolates, 13, 082 for isolate 12034 and 13, 181 for isolate 12013, fell within the range for other fungi, and although there may have been some coding sequences which were not detected by AUGUSTUS, the predictions can likely be considered mostly complete.

3.3.2 ITS and unique gene primers for Cylindrocladium buxicola

Since the forward primer (ITS311F) and reverse primer (ITS419R) did not successfully amplify C. buxicola together, ITS311F and ITS4 were used instead since these primers did successfully amplify C. buxicola in the expected 250 bp region. When these primers were tested against 10 closely related species they were found to be specific, meaning there was no amplification seen for the 10 closely related species with the exception of Bionectria ochroleuca where a faint band was visible but in the 750 bp region. The PCR limit of detection experiment demonstrated that 0.01 ng/µl was the lowest concentration of pure fungal DNA required to see amplification with ITS311F and ITS4 primers and 0.01 ng/µl was also the lowest concentration required when pure fungal DNA and pure plant DNA were combined in this PCR reaction.

100

To evaluate whether the primers designed from the proposed unique genes were specific to C. buxicola, each primer set was tested with 10 closely related fungal species. In total four primer sets were tested (Appendix 3.9-3.12). The first two sets of primers were not specific to C. buxicola and amplified DNA from the some of the 10 closely related species. The third set of primers, UG120F and UG575R, amplified single strong bands in the 450 bp region for C. buxicola DNA, with an annealing temperature of 60°C. There was no amplification seen for any of the 10 closely related fungal species indicating that the third set of primers was highly specific to C. buxicola. However the third set of primers was unable to co-amplify plant and fungal DNA from infected boxwood tissue or with a combination of plant and fungal DNA. The fourth set of primers, UG120F and UG765R amplified single strong bands in the 600 bp region for C. buxicola DNA, with an annealing temperature of 60°C. There were no amplification products seen for any of the 10 closely related fungal species indicating that the fourth set of primers was also highly specific to C. buxicola. The PCR limit of detection experiment demonstrated that the lowest concentration of pure fungal DNA required to see amplification is 0.1 ng/µl and the lowest concentration of infected plant DNA required was also 0.1 ng/µl.

Specific primers were designed from the ITS region of C. buxicola for rapid detection of this fungus specifically from low fungal cell concentrations. When the forward ITS specific primer was paired with the universal reverse ITS primer, ITS4, C. buxicola was amplified with an expected 250 bp band size. When this primer pair was tested for specificity with the 10 closely related fungal species there was no amplification seen; however there was a 750 bp band produced for Bionectria ochroleuca. Since the size of the band amplified for B. ochroleuca was not the same as the expected band size for C. buxicola, and because the band was extremely faint, these primers were still utilized for specific detection. However because amplification was

101

seen for one of the closely related fungal species it is possible that this primer pair could amplify other species of fungi. Therefore, downstream use of these primers should not be utilized to detect C. buxicola from dirty plant samples where other fungal colonizers may be present and could skew detection assays. The limit of detection test demonstrated that the lowest level of fungal DNA required for detection was 0.01 ng/µl which could be useful for detecting C. buxicola in low quantities.

The development of specific primers from the ITS region for detection of various fungi is one most common methods used in fungal pathogen diagnostics due to the high copy number of ribosomal DNA in all organisms, which allows for very sensitive detection (McCartney et al.

2003). Gardes and Bruns (1993) designed two taxon selective primers for the ITS region, intended to be specific to basidiomycetes and discriminate against ascomycetes. Although the primer pair successfully amplified DNA specifically for basidiomycetes there was a small amount of PCR product present for certain plant species. Under conditions where both plant and fungal DNA were present, the fungal DNA was amplified to the apparent exclusion of plant

DNA. (Gardes and Bruns 1993). Other studies have been more successful when attempting to place emphasis on the discrimination between plant and fungal species when designing ITS specific primers (Martin and Rygiewicz 2005).

However many researchers have argued that even though the high variability of the ITS region allows classification over a wide range of taxonomic levels, ribosomal sequences do not always possess sufficient sequence variation to discriminate between particular species (Lievens and Thomma 2005). Nilsson et al.(2008) also argued that assuming fungal intraspecific variability is generally low and can be applied across all species of fungi is misguided and that this notion is only true for some fungi but not all. To make such a statement across a kingdom, 102

one would need to obtain detailed knowledge on intraspecific ITS variability in all fungi. Other housekeeping genes are becoming more intensively studied including -tubulin. Camele et al.

(2009) successfully designed primers from the -tubulin gene for easy and accurate detection of

Cylindrocladium pauciramosum from fungal cultures and in DNA extracted from infected plants.

Alternative strategies to select target sequences for detection of plant pathogens besides using housekeeping genes, involve screening of the whole fungal genome to find diagnostic sequences. Using the genome of C. buxicola isolate 12034, several sets of primers were designed for the rapid detection of C. buxicola from both pure fungal DNA and from infected boxwood plants. The goal was to obtain highly specific primers for C. buxicola, to ensure that amplification would only be seen with DNA from C. buxicola and not from other fungi or plant tissues. Optimization with these primer pairs proved to be difficult when testing for specificity.

The first two sets of primers (UG319F/UG875R and UG19F/UG 429R) were not specific to C. buxicola since amplification was seen when the primers were tested with the 10 closely related fungal species. The third set of primers was specific to C .buxicola however; this primer pair amplified boxwood plant DNA. The fourth pair of primers was unique to C. buxicola and did not amplify plant DNA from boxwood or from other fungal and plant DNA samples from the Hsiang lab DNA stock

The limit of detection for these unique gene primers was 0.1 ng/µl for both pure fungal

DNA and from combined pure fungal DNA and pure plant DNA. This is slightly lower than for the ITS specific primers and was to be expected since the ITS is likely present in higher copy numbers than the target regions for these unique primers which were based on single-copy genes.

The advantage of these unique gene primers versus the ITS specific primers, was that the unique gene primers were designed after searching the whole genome for genes within C. buxicola 103

which did not have any matches in the GenBank protein database. These genes were putatively unique to C. buxicola only, which should have allowed for very specific targeted detection of box blight. Additionally, these unique gene primers were able to distinguish fungal DNA from plant DNA meaning these primers could potentially be used to detect C. buxicola from dirty plant samples from nurseries. In conclusion, these unique gene primers can be used in future specific detection assays if C. buxicola is suspected to be present in a nursery or landscape setting.

3.3.3 Co-amplification with unique gene primers

The C. buxicola-unique gene primers UG120F and UG575R alone successfully amplified a single band in the 450 bp region for C. buxicola DNA from infected boxwood tissue and a single band in the 1000 bp region was present for the pure plant DNA when chloroplast primers were used alone. Co-amplification was initially attempted using infected boxwood DNA extracted following Edwards et al.(1991) with the chloroplast primers cp_atpB-1 and cp_rbc-1 as well as the unique gene primers UG120F and UG575R. It was found that when the DNA was extracted using the GeneJet kit, the resulting DNA was of much better quality compared to extractions done following Edwards et al.(1991), since co-amplification was only successful using DNA extracted with the kit. All other extractions for co-amplification experiments were then done using the GeneJet kit. There was single a band in the 450 bp region for the infected plant DNA but no band was present for the chloroplast primers in the 1000 bp region. It was then found that the forward chloroplast primer cp_atpB-1 had a much lower melting temperature (Ta:

49.1°C vs. Ta: 57°C) compared to the rest of the primers in the co-amplification reaction, which could result in lack of amplification for the plant DNA. The forward chloroplast primer cp_atpB-

1 was re-designed to increase the melting temperature by obtaining sequences of both the ATP

104

synthase beta subunit (atpB) and the ribulose-1,5 bisphosphate carboxylase/oxygenase (rbcL) genes from species closely related to Buxus from GenBank.

The sequence for the species Buxus sempervirens containing partial atpB and rbcL genes was taken from GenBank and a BLAST search was done to find other partial atpB/rbcL genes from plants closely related to Buxus. These species included Phoenix dactylifera, Pachysandra terminalis, Aextoxicon punctatum, Cercidiphyllum japonicum, Myrothamnus flabellifolia,

Myrothamnus moschata, and Didymeles integrifolia. These atpB and rbcL sequences for these species, including Buxus sempervirens, were aligned using MUSCLE and visualized in

CLUSTAL X. From these species, Phoenix dactylifera had the longest sequence and contained complete atpB and rbcL genes along with the spacer region between the two genes (Appendix

3.17). Using this Phoenix sequence, the location of each of the genes along with the spacer region was identified where the atpB gene was 1500 bp long, the spacer region was 800 bp long, and the rbcL gene was 1333 bp long. With this information the atpB region was located and the forward primer was modified to increase the melting temperature (Appendix 3.18). The starting point of the rbcL gene was located but the sequences were too short and did not encompass the entire the reverse primer, so a BLAST search against Genbank was done for the Buxus sempervirens rbcL gene to find other closely related species with the full rbcL gene including:

Pachysandra, Sarcococca, Nelumbo, and Exbucklandia. The reverse primer (103_atpBF) was then located and redesigned to amplify a 1 kb region when used with the forward primer

(1056_rbcLR).

The new chloroplast primers 103_atpBF and 1056_rbcLR were used with the unique gene primers UG120F and UG575R in an attempt to achieve co-amplification. However co- amplification was not successful using these two sets of primers. The band for the fungal DNA 105

would amplify clearly in the 450 bp region however the band for the chloroplast DNA would be faint or absent in the 1000 bp region. The chloroplast and fungal primers were aligned and compared to determine if there were any annealing events occurring between the two sets of primers. This indicated that indeed the forward chloroplast primer was annealing onto the reverse fungal primer preventing the amplification of chloroplast DNA. A new reverse primer was designed from the same gene used to design the primer UG575R since this particular gene was already found to be unique to C. buxicola. The reverse primer was re-designed to avoid any unwanted annealing to the chloroplast primers and used with the forward primer UG120F. When unique gene primers UG120F and UG765R were used with chloroplast primers103_atpBF and

1056_rbcLR, co-amplification was seen with infected boxwood DNA and with the addition of both plant and fungal DNA. A limit of detection test was also done for the co-amplification experiment where infected plant DNA could be co-amplified up to 1 ng/µl and plant and fungal

DNA could also be co-amplified up to 1 ng/µl.

Finally, co-amplification was attempted with infected plant DNA at various levels of infection with unique fungal gene primers and chloroplast primers. DNA was extracted from infected boxwood leaves 7, 14 and 21 dpi and then used in co-amplification reactions to compare the amount of fungal tissue present in relation to the amount of plant tissue present. As expected, the leaves 7 dpi had the lowest detected amount of fungal tissue present, and the leaves 21 dpi had the highest amount (Table 3.2). There was very little variation between the three different biological replicates and the ratios were consistent for high, mid and low levels of infection.

Once amplification was successful using the unique gene primers with pure fungal DNA, the primers were used to amplify C. buxicola from infected boxwood DNA. Chloroplast primers were also used to determine if the plant DNA could also be detected from these infected 106

boxwood samples. The next step was attempting co-amplification of fungal DNA and plant DNA from boxwood leaves infected with C. buxicola. To achieve this, both the unique fungal gene primers and chloroplast primers were used in multiplex-relative PCR where the presence of plant

DNA acted as a housekeeping gene or internal control. The advantage of multiplex PCR over conventional PCR is that this method allows for standardization as well as semi-quantification.

The presence of the chloroplast DNA relative to the fungal DNA can be used as an indication of how much fungal DNA is present within the boxwood tissue.

Co-amplification proved to be very difficult using the unique fungal gene primers and the chloroplast primers. Initial attempts resulted in the strong amplification of C. buxicola with very low amplification seen for the plant DNA. After redesigning the chloroplast primers to increase the annealing temperature to match the fungal primers, there was still very little amplification for the plant DNA. Further investigations revealed that one of the fungal primers was annealing onto one of the chloroplast primers and decreasing the efficiency of amplification. Since the annealing temperature for the fungal primers was lower, and the amplicion was smaller and more quickly produced, the fungal amplicon was preferentially selected over the competing plant amplicon.

After redesigning a fourth set of unique fungal gene primers where possible annealing between primers was excluded, co-amplification was successful, yielding a band in the 600 bp region for fungal DNA and in the 1000 bp region for chloroplast DNA. The limit of detection experiment showed that C. buxicola DNA and plant DNA could be co-amplified at concentrations as low as 1 ng/µl. This could be beneficial for the identification of C. buxicola from plant samples with minimal signs of infection.

107

Successful co-amplification from infected boxwood tissue suggested that these unique fungal gene primers are able to detect C. buxicola from dirty plant samples which means that this assay could be used to positively identify box blight from symptomatic boxwood originating from nurseries or a natural landscape setting. Mauchline et al. (2002) used competitive PCR to identify the soil fungus Verticillium chlamydosporium in the rhizosphere of two soils infested with one of two different types of nematodes, where V. chlamydosporium was identified in association with only one of these nematodes. Simon et al. (1992) also used competitive PCR with fungal specific primers along with an internal standard to detect endomycorrhizal fungi directly from colonized root extracts to gain quantitative information. By determining the ratio between the fungal band and the chloroplast band which were co-amplified, the quantity of C. buxicola within the plant tissue can also be estimated to infer how much of the fungus is present within the leaf at a specific time period.

The quantity of fungal DNA present at the different stages of infection was determined and the results reflected the expected pattern for plant samples with high, mid, and low levels of infection. The quantity of fungal DNA was the highest 21 dpi and the lowest after 7 dpi. Another technique which could be used for the detection of C. buxicola in future studies is the use of quantitative PCR (qPCR). This method avoids the need for post reaction processing since the amplified products are detected by a built in fluorimeter as they accumulate with faster processing times and higher throughput (Ward et al. 2004). Gehesquiere et al. (2013) developed a qPCR assay for C. buxicola using ITS and -tubulin genes, however the ITS primers were deemed not specific to C. buxicola. The primers designed based on the -tubulin gene did provide full specificity and could detect C. buxicola at low levels in water, air, and plant material. 108

Shan et al. (2013) also developed a rapid detection assay for C. buxicola using PCR. The

ITS region as well as the -tubulin region from 33 Cylindrocladium species were obtained from

GenBank or locally sequenced, and primers were designed from the regions specific to C. buxicola. The ITS sequences did not demonstrate any polymorphisms and were not used to designed primers, however the -tubulin sequences showed regions which were unique to C. buxicola and the primer pair designed from these regions amplified only C. buxicola DNA. The limit of detection for this primer pair was 10 pg, with and without an internal control. The incorporation of qPCR with the unique fungal gene primers designed for this study could potentially provide an even more accurate and specific detection assay for C. buxicola.

3.3.4 Genetic variation in Cylindrocladium buxicola

To test for genetic variation between the isolates from different geographic regions, 8

ISSR markers were screened with each of the isolates from Belgium (12001), Germany (12013),

Italy (12015), 12019 (BC), and several isolates from Ontario (12174, 12032, 12025, 12030,

12194, 12168, and 12176) (Figure 3.1). No genetic variation or polymorphisms were seen for any of the isolates from Ontario; however a polymorphism was found with the isolate from

Germany (12013). ISSR markers (CCA)5, (CAG)6CC, and (ACC)6CCA all revealed polymorphisms for the German isolate, where (ACC)6CCA showed the polymorphism very clearly (Figure 3.1). The primer (ACC) 6CCA amplified an average of 5 fragments in the 300 and

2500 bp where the highest number of fragments with this primer was 8.

The presence of polymorphic banding patterns for the German isolate 12013 of C. buxicola was the first indication that this particular isolate was genetically different compared to the rest of the C. buxicola isolates obtained from Ontario and from the other European locations.

All other isolates tested including several of the isolates obtained from Strathroy, Ontario, the 109

isolates from B.C., Italy, and Belgium showed identical banding patterns with several different

ISSR markers. A previous study done by Henricot and Culham (2002) used AFLP techniques to assess if there were any genetic differences between C. buxicola isolates from the UK and from

New Zealand. Based on their results they concluded that C. buxicola has a clonal population structure since only one of the 18 isolates used showed any variation in banding pattern. This supported the hypothesis of an exotic origin. Back in 2002, the geographic range of C. buxicola was limited in relation to the distribution of its hosts and because of this, Henricot and Culham

(2002) suggested that C. buxicola could be an exotic species which was recently introduced.

In 2014, C. buxicola was identified in several areas of Europe, New Zealand, and North

America, and analysis of isolates from these different geographic regions can possibly provide more insight into the genetic variation between isolates and the possibility of clonal introductions worldwide. Simply by analyzing a wider subset of isolates from Europe and Canada resulted in finding more genetic diversity. The larger and more diverse the sample population is the more likely it is to discover outliers, which in this case is represented by the German isolate. There could be serious implications of the German isolate displaying genetic differences and belonging to a different mating type than other isolates of C .buxicola. If sexual reproduction were to occur, new virulence types might be generated which could be more aggressive and difficult to control.

3.3.5 Identification of mating type genes for Cylindrocladium buxicola

When the C. buxicola isolates were screened with MAT1-2 primers MAT2-812F and

MAT-1353R, the DNA from most of the isolates was amplified in the 500 bp region (Table 3.3).

However one C. buxicola isolate (12013, Germany) did not show any amplification in the expected 500 bp region, suggesting that this isolate may contain the opposite MAT gene which would imply the possibility of sexual reproduction. Indeed, when the genome of isolate 12013 110

was compared to the list of MAT1-1 and MAT1-2 genes from closely related species there was a strong match for MAT1-1. The MAT1-1 region was then used to design primers MAT1-431F and MAT1-866R and these primers were used to amplify the MAT1-1 gene from isolate 12013.

A single clear band was amplified in the 450 bp region for isolate 12013 which suggests that this

German isolate does contain the opposite mating type gene. The synteny of genes surrounding both the MAT1-1 and MAT1-2 genes was observed where APN2 was 1688 bp with the MAT1-1 gene in between followed by SLA2 which was 2414 bp (Appendix 3.19). Similarly MAT1-2 was found in between APN2 which was 1688 bp and SLA2 which was found to be 2414 bp

(Appendix 3.19).

Genetic differences and the subsequent lack of the MAT1-2 gene observed for the isolate

12013 from Germany prompted further investigation into the genetic makeup of this particular isolate. When the whole genome of the German isolate 12013 was searched for the presence of the MAT1-1 gene, strong matches for the MAT1-1 gene indicated that this isolate does contain the MAT1-1 gene. When primers were designed from this MAT1-1 region, isolate 12013 was amplified in the expected region. This is the first report of the presence of an isolate with the opposite mating type for the fungus C. buxicola. Previously it was stated that C. buxicola has a heterothallic mating system based on the presence of the MAT-2 gene and the lack of perithecia from mating type crosses on carnation leaf agar (Henricot and Culham 2002). It was also stated that the production of fertile perithecia cannot not be ruled and could be produced under different environmental conditions. However the conclusion from Henricot and Culham’s (2002) study was that C. buxicola displays sexual sterility.

One advantage of sexual reproduction is the resulting genetic variation which can produce individuals with altered virulence or increased fitness in new ecological niches (Hsueh 111

and Heitman 2008). The ability to identify the presence of both mating types within a pathogen population provides vital information that can be used in disease management strategies to predict the likelihood of sexual reproduction and the risk of airborne inoculum. The consequence of the presence of the MAT1-1 gene within the German isolate of C. buxicola is the potential for these isolates to reproduce sexually with other isolates of C. buxicola which contain the opposite

MAT1-2 gene. This genetic exchange can occur between progeny derived from a cross or between progeny of a cross with isolates from a broader general population (Hsueh and Heitman

2008). The latter is more likely for C. buxicola since the German isolate thus far has been the only isolate across several geographic regions to demonstrate the presence of MAT1-1. More isolates from Germany would need to be obtained and analyzed to determine whether all isolates from this region contain MAT1-1. Other isolates from C. buxicola from an even broader geographic range should also be obtained to gain a better understanding of the incidence of MAT genes within this species.

Only asexual reproduction has been observed to occur in nature and in laboratory settings for C. buxicola on boxwood. Many fungi have the ability to reproduce both asexually and sexually and it has been hypothesized that fungi may preferentially reproduce asexually in a stable environment but then reproduce sexually in response to stressful conditions when faced with new environmental conditions (Li et al. 2010). Other species of Cylindrocladium have been shown to reproduce sexually. Schoch et al. (1999) found that Cylindrocladium candelabrum-like isolates mated to produce Calonectria teleomorphs with viable progeny where four dinstinct mating populations were identified. This study encompassed 100 Cylindrocladium isolates collected from a wide variety of geographic locations which is vastly larger than the population of C. buxicola isolates examined in this study. Perhaps if a larger collection of isolates was

112

obtained and analyzed for the incidence of mating type genes, the knowledge of the reproductive system would be better understood.

3.3.6 Mating type crosses

The mating type crosses conducted with isolate 12013 which contains MAT1-1 and several other isolates which contained MAT1-2, including Belgium (12001), Italy (12015), B.C.

(12018), and Ontario (12034) did not produce any perithecia over the course of 6 months.

Mating type crosses were conducted on water agar and on boxwood agar. Detached boxwood leaves on water agar and on moist filter paper were also used for the mating type experiments where mycelial plugs of the opposite mating type were placed on either end of a boxwood leaf.

After a period of 1 month, chlamydospores would form on the leaf surface or on the surface of the boxwood agar, but no perithecia were observed for the duration of this experiment.

Although no perithecia were obtained under laboratory conditions for C. buxicola, it does not rule out the possibility of sexual reproduction for this pathogen. In rust fungi, such as

Ustilago maydis and Ustilago horedi, sexual reproduction is necessary for virulence, however the ability of these pathogens to complete their sexual cycle under laboratory settings is limited and cues from the host are necessary to support efficient mating (Hsueh and Heitman 2008). An intriguing case presents itself in Cryptococcus neoformans where the pathogen’s sexual cycle readily occurs in the laboratory, but mating has never been directly observed in nature during infection (Hsueh and Heitman 2008). Several fungal pathogens such as Aspergillus fumigatus and Candida glabrata have never demonstrated sexual reproduction despite the fact that they all posses MAT loci and the machinery for mating and meiosis (Hsueh and Heitman 2008).

113

One of the possible causes for the lack of sexual reproduction is the unequal mating type distribution in a species. If the majority of isolates are of a single mating type, the chances for sexual reproduction between opposite mating type are limited (Hsueh and Heitman 2008).

Perhaps since only one C. buxicola isolate has been identified with the MAT1-1 genotype and the majority of the other isolates contain MAT1-2, the opportunities for sexual reproduction are extremely limited. Most fungal pathogens possess the tools to engage in sexual reproduction; however their ability to efficiently undergo sexual reproduction is restricted. This is possibly to ensure the fungal virulence traits remain linked but also retain the potential to diversify the population when faced with strong selection pressure, especially in new environments (Hsueh and Heitman 2008). For example, fungal isolates may be forced to reproruce sexually under extreme temperatures, pH, humidity, or due to lack of nutrition. Further mating type experiments, under a variety of environmental conditions, with a larger population of C. buxicola isolates may provide insights into whether C. buxicola will actually reproduce sexually under laboratory or natural conditions.

3.3.7 Genomic comparisons of the Ontario and German isolates

The two C. buxicola isolates which were sent for genome sequencing were compared to determine how many genes are unique to each isolate. In total there were 13,181 predicted genes for isolate 12013 and 13,082 predicted genes for isolate 12034. The number of genes found to be unique to each isolate varied depending on the e-value cut-off. At an e-value of 1e-5 there were

220 genes found only in 12013 and 63 genes found only in 12034, at 1e-50, 727 genes were found only in isolate 12013 and 75 genes were found only in isolate 12034, and finally at 1e-100, 1496 genes were found only in isolate 12013 and 149 genes were found only in isolate 12034 (Table

3.4)

114

This comparison also showed the presence of MAT1-1 only in isolate 12013 and MAT1-2 only in isolate 12034. Initially the comparison was done with an e-value cut-off of 1e-50 which demonstrated the presence of MAT1-1 exclusively in isolate 12013 with a hit at 1e-27, but

MAT1-2 was not found exclusively in 12034. It was discovered that the MAT1-2 gene in isolate

12034 was matching an HMG protein in isolate 12013 at an evalue of 5e-15 and to MAT1-1-3 at an evalue of 6e-13 which is why the MAT1-2 gene was not found to be exclusive to isolate

12034 with a cut-off of 1e-50 and below. When the comparison was re-done with a cut off of 1e-

100 the MAT1-2 gene was found in isolate 12034 with a hit at e-value of 2e-76 and the MAT1-1 gene had a match for isolate 12013 at 2e-115. A list of the number of genes found in each isolate at three different e-value cut offs- 1e-5, 1e-50, and 1e-100 is summarized in Table 3.4.

At an e-value cut-off of 1e-50 and lower, the MAT1-2 gene was matched up with an HMG protein and MAT1-1-3 in the German isolate. When an e-value cut-off of 1e-100 was used, the

MAT1-2 gene was found exclusively in isolate 12034. The HMG box or the high mobility group is a highly conserved DNA binding motif which can be encoded in both MAT1-2 and MAT1-1 genes. There is an abrupt transition between the common flanking DNA surrounding the MAT genes where the identity between mating types is more than 97%, and the idiomorphs where nucleotide similarity falls to the level of chance (Arie et al. 1997). The translation product of the

MAT-2 ORF has a region similar to the HMG box in the Neurospora crassa, Podospora anserina, and Schizosaccharomyces pombe MAT1-1 proteins (Arie et al. 1997). Therefore, the

MAT1-2 gene in the Ontario isolate was matching the HMG domain of the MAT1-1-3 gene in the German isolate. When the e-value cut-off was adjusted to be more stringent, the MAT1-2 gene alone was found to be unique to the Ontario isolate.

115

When comparing two different isolates of C. buxicola, the number of genes found to be unique to each isolate varied depending on the e-value cut off chosen for the analysis. The more strigent the e-value cut off the more unique genes were found in one isolate compared to the corresponding isolate. This pattern was expected since stricter parameters would override possible matches between these two isolate. The e-value statistic refers to the number of hits one can expect to see by chance when searching a database of a particular size

(www.ncbi.nlm.nih.gov/BLAST/blast_FAQs.shtml). Looking at a range of e-value cut offs provides a more detailed account of the level of identity between two isolates of the same species.

One of the main goals of comparative genomics is to compare sequences to identify the presence or absence of homologs. Homology refers to similarity by descent and is qualitative not quantitative (Hsiang and Baillie 2004). Identity with regards to nucleotide sequences refers to the occurrence of the same nucleotide at the same position. For protein sequences identity has the same meaning however, similarity includes matches with amino acids which have similar triplet coding (Hsiang and Baillie 2004). It is important to distinguish the level of identity or similarity required to establish homology. For database searches within BLAST, a match with an e-value of

10-20 is considered a strong match while matching below a threshold of 10-5 can be considered as the baseline for sequences to be homologous (Hsiang and Baillie 2004). The number of identical genes between two isolates of the same species is expected to be high and it is expected that sequences between these two isolates will have strong matches rather than just borderline homologous matches.

Several studies have scrutinized the discrepancies between fungal genomes of the same species and between different species. Yoder and Turgeon (2001) looked at the occurrence of 116

selected protein families in genomes of pathogenic fungi and found that Cochliobolus sativus,

Fusarium graminearum, and Botrytis cinerea contain more genes dedicated to secondary metabolism when compared to N. crassa and Saccharomyces cerevisiae. Tzung et al. (2001) compared Candida albicans with S. cerevisiae and discovered that genes important for sexual reproduction were not present in C. albicans suggesting that this species uses alternative tools for reproduction. The analysis here for C. buxicola demonstrates that although there are a high number of genes which are identical between these two isolates, there is a small subset of genes which are unique to each isolate, as an example, the mating type genes.

3.3.8 Conclusions

The genomes of two C. buxicola isolates were successfully sequenced and assembled which then allowed a specific detection assay to be created for this fungus. Unique fungal gene primers designed from unique gene regions of the C. buxicola genome provided an accurate and rapid detection method from infected boxwood tissue. Application of this detection assay could be incorporated into nursery practices to detect the presence of C. buxicola within boxwood crops. Deeper analysis of the German fungal genome exposed new information regarding genetic makeup including the presence of the opposite mating type MAT1-1 for this isolate. This is the first report of the presence of MAT1-1 within isolates of C. buxicola, and it was previously believed that the possibility of sexual reproduction was very unlikely for this species. Crosses between C. buxicola isolates of the opposite mating type did not result in the production of perithecia, however sexual reproduction cannot be ruled out. Perhaps under different environmental conditions, sexual reproduction could be favored, allowing chromosomal assortment and leading to offspring with enhanced virulence and elevated fitness.

117

Table 3.1. Top ranking assemblies obtained using SOAPdenovo for C. buxicola genomes 12013 and 12034 based on single lanes of 100 bp paired-end reads.

Genome 12034 12013 Program SOAPdenovo SOAPdenovo K-mer 63 63 to 83 Assembly 54147042 54900566 Contigs (bp) 861 10175 N50 (bp) 248551 479128 N90 (bp) 51470 57360 PE (bp) 100 100 Reads 36,222,607 23,894,268 NT (gb) 7.245 4.779 Coverage 129 87

118

1000 bp region. Image J was used to determine the ratio of fungal DNA present relative to the amount of chloroplast DNA present.

Ratio Fungal:Plant DNA Biological Rep 7 dpi 14 dpi 21 dpi 1 0.09 0.6 0.9 2 0.2 0.3 2.7 3 0.08 0.2 2.8

119

Table 3.3. Isolates of Cylindrocladium tested with both MAT1-1 and MAT1-2 primers

Isolate Species Location MAT Genes 12001 C.buxicola Belgium MAT1-2 13395 C.buxicola Belgium MAT1-2 12013 C.buxicola Germany MAT1-1 12015 C.buxicola Italy MAT1-2 12018 C.buxicola British Columbia MAT1-2 12019 C.buxicola British Columbia MAT1-2 12176 C.buxicola Ontario MAT1-2 12031 C.buxicola Ontario MAT1-2 12234 C.buxicola Ontario MAT1-2 12194 C.buxicola Ontario MAT1-2 12168 C.buxicola Ontario MAT1-2 12169 C.buxicola Ontario MAT1-2 12170 C.buxicola Ontario MAT1-2 12026 C.buxicola Ontario MAT1-2 12033 C.buxicola Ontario MAT1-2 12172 C.buxicola Ontario MAT1-2 12173 C.buxicola Ontario MAT1-2 G7 P30920-3 C.buxicola UK MAT1-2 G8 P21350-3 C.buxicola UK MAT1-2 G9 PT25-2 C.buxicola UK MAT1-2 G10 P28954-2 C.buxicola UK MAT1-2 G11 P30735-1 C.buxicola UK MAT1-2 13394 C. leucothoes Florida Primers did not work 13392 C.canadense Ontario Primers did not work

120

Genes found only in isolate Genes found only in isolate E-value 12013 12034 1e-5 220 63 1e-50 727 75 1e-100 1496 149 Total # genes 13,181 13,082

121

Figure 3.1. Example of the ISSR PCR analysis, using primer (ACC)6CCA, for C. buxicola isolates from Belgium (12001), Germany (12013), Italy (12015), B.C. (12018), and Ontario

(12171, 12172), where a polymorphic banding pattern is present for the German isolate indicating that this isolate is genetically different from the rest of the isolates.

122

Chapter 4 Sensitivity of Cylindrocladium buxicola to fungicides, and chemical management of box blight 4.1 Introduction

Box blight caused by the ascomycetous fungus, Cylindrocladium buxicola, was first reported in North America in 2011 (Ivors et al. 2012). Prior to that, outbreaks were seen in

Europe starting in 1994 (Henricot and Culham 2002). The origin of this fungus is not known, although it is suspected to be from Asia. Reports from Europe state that fungicidal control of this disease is complex, so the overall objective of this Chapter was to examine the sensitivity of the fungus to several fungicides and to investigate the control of the disease by several fungicides in lab and growth room tests.

4.1.1 History of fungicide use

Plant pathogens are estimated to cause yield reductions of almost 20% in principal food and cash crops worldwide (Knight et al. 1997). Fungi are a major contributor of plant diseases, and chemical countermeasures, such as fungicides, are necessary for successful crop protection.

Some of the first uses of fungicides, e.g. sulfur compounds and botanicals, were recorded by the

Sumerians and Chinese in 2500-1500 BC (Oerke 2006). In 1807, Prevost demonstrated that bunt of wheat caused by Tilletia caries was caused by a fungus, and could be controlled to some extent with copper sulfate (Russell 2005). However, it wasn’t until 1885 when Pierre-Marie-

Alexis Millardet discovered that a combination of copper sulfate and hydrated lime could effectively control downy mildew of grape, that the cause and effect relationship of fungicidal compounds was accepted (Agrios 2005). The discovery of Bordeaux mixture is considered the first landmark in the history of chemical disease control (Waard et al. 1993; Ruberson 1999).

123

For more than 100 years, Bordeaux mixture has been used to control plant diseases, and its efficacy was the initial stimulus for the study of plant pathogens and their control (Agrios

2005). The second generation of pesticides began in 1934 with the introduction of the first fully synthetic, organic fungicides called dithiocarbamates, including thiram, ferbam, zineb, maneb, and mancozeb (Ruberson 1999). The fungicides in the carbamate group all share an important feature: they are all surface protectants, which means they need to cover the plant surface to prevent fungal infection (Waard et al. 1993). Any new growth after application is not covered, and once infection is already established, these protectant fungicides are generally non-effective.

The third generation of fungicides were also organic but they were able to penetrate plant tissue and had activity against established infections in a curative manner (Oerke 2006). These fungicides were called systemic because they can be translocated within plant tissues to reach growing pathogen hyphae and newly grown parts of the plant (Ruberson 1999). The first specific and systemic fungicide, carboxin, was introduced in 1965, and this was followed by the introduction of several other systemic fungicides, such as benomyl (Agrios 2005).

Systemic fungicides became the major focus of fungicide development efforts, and by the

1970s the use of systemic fungicides had become widespread. The most recent major class of fungicides, the strobilurins, was introduced to the market the 1990s. However, reliance on fungicides with very specific modes of action, contributed to the development of resistance among fungal populations, therefore fungicides with novel modes of action must be developed to combat pathogens with resistance or reduced sensitivity to existing compounds (Knight et al.

1997; Oerke 2006). There are several fungicides which have been developed and posses novel modes of action, such as the anilinopyrimidines and the phenylpyrroles (Gullino et al. 2000).The 124

anilinopyrimidines include chemicals like cyprodinil, which provides effective control of grey mould and apple scab. Phenylpyrroles are developed from Pseudomonas pyrrocinia, and include chemicals like fludioxinil which shows efficacy against Botrytis cinerea (Gullino et al. 2000).

Fungicides are expected to remain an essential tool for plant disease management, and fungicide research has continued to strive for the development of safe and effective chemicals.

4.1.2 Fungicides and the ornamental industry

The production of ornamental plants is a continually expanding industry, which is economically important in Canada, the US, South America, Australia, and Europe, as well as in many developing countries (Garibaldi and Gullino 2007). As the largest sector of horticulture in

Canada, the ornamental industry yields a major economic impact and has significant room for further development. The industry is responsible for an estimated $6.3 billion per year in sales, an additional $1.8 billion in landscape services, and the total economic contribution of this sector in Canada is approximately $14.5 million per year (Anonymous 2009a). Plant health management is a primary concern for nursery growers since the entire plant is marketed, which in turn means that profits are directly related to the aesthetics and attractiveness of the plants

(Daughtrey and Benson 2005; Baker and Linderman 1979). The ornamental industry continues to experience disease outbreaks which is why integrated pest management (IPM) is a vital part of nursery crop production, with a key component being fungicide application (Jacobsen 1997).

Management of plant health for ornamentals must ensure the health of the plant in production, provide conditions to act against disease development, and provide solutions to identify and treat problems which do arise (Daughtrey and Benson 2005).

125

The ornamental industry has constantly faced the challenge of controlling and managing fungal plant pathogens. In the 1930s, foliar diseases on the chrysanthemum fall-flowering plant were controlled by fungicide applications, and verticillium wilt on chrysanthemum was controlled using soil fumigation (Baker and Linderman 1979). In the 1960s a major disease epidemic, caused by Cylindrocladium scoparium, rapidly destroyed azalea crops throughout the

US as a result of the rapid expansion of the flowering pot-azalea as a florist item (Baker and

Linderman 1979). Growers today are continually faced with old diseases which complicate IPM, but they also have to deal with the occurrence of new diseases. New pests and diseases can suddenly arise in plant material or as a consequence of a newly introduced cultivar with a different range of susceptibility to pathogens, or the introduction of a pathogen itself. New plant species and varieties are important to the ornamental industry, and the constant turnover in consumer demand multiplies the number of potential pests and diseases (Gullino et al. 2000). A high capital investment and high crop value often justifies expensive methods of disease eradication, including the application of fungicides compared to some agricultural crops

(Jacobsen 1997).

4.1.3 Fungicide use on woody ornamentals in Ontario

There is a relatively small worldwide market for nursery and ornamental fungicides, because ornamentals are considered minor crops, and this leads to higher costs associated with product introduction (Garibaldi and Gullino 2007). Newer chemical control products are typically developed for agricultural use and sometimes acquire ornamental uses. This means that the fungicides available for ornamental use are similar to and generally a subset of those developed for agricultural production (Daughtrey and Benson 2005). Some of the active 126

ingredients which have been used against ornamental plants include those from several chemical families such as the demethylation inhibitors (DMIs), strobilurins, triazoles, anilinopyrimidines, phenylpyrroles, and chloronitriles. The following seven fungicides are commonly used on ornamental plants in Ontario: Daconil 2787 (40% chlorothalonil), Banner MAXX (14.3%

Propiconazole), Heritage 50W (50% azoxystrobin), Fore 80WP (80% mancozeb), Nova 40W

(40% myclobutanil), Switch 62.5W (37.5% cyprodinil, 25% fludioxinil), and Phyton 27 (5.5%

Elemental copper). In the sections below, each of these fungicides is described individually to include their origin, mode of action, and common uses in the ornamental industry.

The copper fungicide Phyton 27 is commonly used to combat several ornamental plant pathogens. Copper fungicides represent one of the oldest active ingredients used against plant diseases dating back to the 1800s when copper sulfate pentahydrate was formulated with lime into Bordeaux mixture (Richardson 1997; Chase 2010). Copper fungicides are classified as having a multisite mode of action and act by disrupting cellular proteins (Chase 2010). Copper products now commonly used on ornamental plants are sold under the trade names Camelot,

Junction, Kocide, and Phyton 27. Phyton 27 has extensive labelled uses in ornamental production for dip propagation, drenching, and tree injection (Chase 2010). Phyton 27 has been shown to be effective against Fusarium moniliforme on dracaenas, powdery mildew on flowering dogwood, and leaf spot diseases caused by species of Alternaria, Cercospora, Colletotrichum, and

Sphaceloma (Chase 2010; Chase and Harris 1999; Hagan et al. 2005).

The fungicide azoxystrobin is a broad spectrum fungicide which controls major economic pathogens and has been used on more than 30 major crops worldwide (Knight et al. 1997).

127

Azoxystrobin fungicides are part of the strobilurin chemical family which are based on naturally occurring antifungal compounds in certain wood-decaying mushrooms, such as Strobilurus tenacellus (Knight et al. 1997). The mode of action of this chemical is by the inhibition of mitochondrial respiration in fungi which can inhibit spore germination, mycelial growth and spore production (Knight et al. 1997). The azoxystrobin fungicide Heritage was first registered for use in Canada in 2006 and was one of the first of this new class of low risk, environmentally compatible fungicides to be registered for use on ornamentals (Anonymous 2009b) . Heritage shows activity against several different foliar and soilborne fungal pathogens including Pythium and Phytophthora diseases ,as well as Mycosphaerella macrospora which causes leaf spot on bulbous iris (Hagan et al. 2001; Chastagner and Kaufmann 2004).

The demethylation inhibiting (DMI) fungicides are one of the leading groups of fungicides used for the control of fungal pathogens (Gullino et al. 2000). DMI fungicides inhibit ergosterol biosynthesis in fungi which is important for fungal membranes (Bonde et al. 1995).

Myclobutanil is known to have systemic, protective, and curative activity against a wide range of fungal plant pathogens and is classified as a sterol demethylation inhibitor. The myclobutanil fungicide commonly known as Nova was first registered for use in Canada in 1992 and is the only highly effective fungicide for chrysanthemum white rust caused by Pucinnia horiana

(Bonde et al. 1995). The development of fungicide resistance is a concern with DMI fungicides because they share a common, site specific mode of action. Since these fungicides have a single inhibition site there is a higher risk of selecting fungicide resistant pathogen populations when compared to multiple site inhibitors (Bonde et al. 1995). Propiconazole is also considered a DMI fungicide and is a mixture of four stereoisomers: 1-[2-(2,4-dichlorophenyl)-4-propyl-1,3- 128

dioxolan-2-yl-methyl]-1H-1,2,4-triazole. The propiconazaole fungicide Banner MAXX was first registered for use in Canada in 2002 and has shown efficacy against powdery mildew on flowering dogwood as well as several anthracnose diseases (Hagan et al. 2005; Anonymous

2013b).

In 1964, chlorothalonil was introduced as a broad-spectrum protectant fungicide initially intended for the control of a range of diseases of fruits and vegetables (Russell 2005). However, chlorothalonil is the second most widely used agricultural fungicide with applications totaling 5 million kilograms annually (Cox 1997). It is also used for fruit, field, and ornamental as well as on turf and is registered under names like Daconil and Bravo. The mode of action of chlorothalonil involves its bonding with a molecule called glutathione inside fungal cells. As glutathione-chlorothalonil derivatives form, they use up all of the available glutathione in the cells, leaving gluthatione-dependent enzymes unable to function (Cox 1997). The fungicide

Daconil has been registered for use in Canada since 1980 and has been shown to be effective against a wide variety of pathogens on several different hosts (Anonymous 2013b).

The anilinopyrimidines represent a relatively new class of fungicides with novel modes of action (Knight et al. 1997). The fungicide Switch contains two active ingredients cyprodinil and fludioxonil. Cyprodinil is classified as an anilinopyrimidine which do not affect spore germination but inhibit germ tube elongation and mycelial growth. Cyprodinil acts to inhibit the biosynthesis of methionine and inhibits secretion of hydrolic enzymes (Rosslenbroich and

Stuebler 2000). Fludioxonil belongs to a another chemical class called the phenylpyrroles which inhibits spore germination and induces morphological alterations of germ tubes (Rosslenbroich

129

and Stuebler 2000). The phenylpyrroles also represent a newer class of fungicides with novel modes of action. Fludioxonil is a non-systemic and protective fungicide and is marketed as a tankmix partner for cyprodinil in the fungicide Switch. Switch was first registered for use in

Canada in 2006 and was marketed for Botrytis control in ornamentals (Anonymous 2013e).

Switch has also shown efficacy against various powdery mildew diseases and Volutella blight on boxwood (Anonymous 2013b).

In the 1960s, the chemical mancozeb was introduced. It is a dithiocarbamate based on manganese and zinc and is possibly one of the most widely used chemicals of this class (Russell

2005). Mancozeb is registered in Canada to control a broad range of destructive plant diseases such as downy mildew, apple scab, and Cercospora leaf spot (Anonymous 2013c). Mancozeb is a protectant contact fungicide with multisite mode of action. Contact fungicides remain on the outside of the plant and protect the plant from new infection which means that these fungicides do not have curative efficacy and new growth will not be protected. The duration of activity can be short due to environmental factors such as rainfall events or exposure to UV light

(Anonymous 2013c). The mancozeb fungicide Fore has been registered for use in Canada since

2006 and has demonstrated excellent control of Fusarium leaf spot of dracaenas, anthracnose caused by Gleosporium aridum and several needlecast diseases (Chase and Harris 1999;

Anonymous 2013b).

4.1.4 Emergence of box blight caused by Cylindrocladium buxicola

The appearance of Cylindrocladium buxicola on boxwood in North America was of concern for nursery growers since this pathogen was known to be difficult to control with

130

fungicides. This fungus poses a severe threat, especially because the disease may have been transported to North America on apparently asymptomatic plants (Henricot 2006). After the introduction in 2011 of C. buxicola to the US and Canada, two fungicides were registered for emergency use in Ontario, British Columbia and Quebec by the PMRA until December of 2013

(Anonymous 2012d). This temporary registration included Switch 62.5 WG (37.5% cyprodinil,

25% fludioxinil) and Daconil 2787 (40% chlorothalonil) along with a recommendation to rotate these two products to prevent the development of resistance (Anonymous 2012d).

The most extensive fungicide trial reported for box blight was by Henricot et al. (2008) with several different fungicides registered for use in the UK, but many of these active ingredients were also used in the current study. Their study looked at the in vitro effect of 13 fungicides on the mycelial growth and conidial germination of C. buxicola. Based on the EC50 values or the effective concentration at which mycelial growth was inhibited by 50%, kresoxim- methyl, the combined fungicides epoxiconazole + kresoxim-methyl + pyraclostrobin, epoxiconazole + pyraclostrobin, and boscalid + pyraclostrobin were most the effective at inhibiting fungal growth in vitro. The main focus of the study by Henricot et al. (2008) was on the in vitro effects of several fungicide on C. buxicola, and did not include any tests done against the disease on detached leaves or whole boxwood plants. The toxicity of these fungicides against

C. buxicola is likely to be different on whole plants versus on amended media, and it is important to identify and characterize any differences.

131

4.1.5 Objectives

The objective of this study were as follows

1) To assess the inhibitory effects of six different fungicides on the growth of Canadian isolates of C. buxicola in amended agar tests. A range of concentrations was tested on a few isolates to calculate the EC50 value (concentration to inhibit growth by 50%), and from these values, a discriminatory concentration for each fungicide was selected for screening a larger number of isolates

2) To examine preventative and curative efficacy of fungicides commonly used in the nursery industry in Canada in detached leaf trials.

3) To examine preventative and curative efficacy of fungicides commonly used in the nursery industry in Canada in inoculated whole plant trials.

4.2 Materials and methods 4.2.1 In-vitro fungicide sensitivity tests on amended PDA

Six different fungicides were used in this experiment, and each fungicide was made to different concentrations (Table 4.1). Switch 62.5W (37.5% cyprodinil, 25% fludioxonil), Banner

MAXX (14.3% propiconazole), Daconil 2787 (40.3% chlorothalonil), and Heritage 50W (50% azoxystrobin) were provided by Syngenta, Guelph, Ontario. Fore 80WP (80% Mancozeb) and

Nova 40W (40% myclobutanil) were provided by Dow Agro Sciences, St. Marys, Ontario, and

Phyton27 (5.5% elemental copper) was provided by Plant Products Co., Brampton, Ontario.

132

To grow the fungal isolates, 2% Potato Dextrose Agar (PDA) was prepared by adding

19.5 g of PDA powder to 500 ml deionized water and autoclaving at 121°C for 20 min. A 1000

µg/ml stock solution of the active ingredients was made for each of the fungicides and for the mixture of copper and myclobutanil, the concentration was adjusted to ensure that the stock solution was a combined total of 1000 µg a.i./ml. and all stock solutions were stored at 5°C, for up to 3 weeks.

Fungicide solutions prepared from the stock solutions were added to 2% PDA that had been cooled to 60°C with final concentrations of 0.01, 0.1, 1.0 and 10 µg/ml. The PDA was kept at 60°C using a water bath to prevent constant re-heating of the media and an electronic pipette

(IBS Integra Biosciences, Mandel Scientific, Guelph, Ontario) was used to dispense 15 ml aliquots of amended PDA into 9 cm diameter Petri plates. Once the agar had solidified, the plates were cut with six blades mounted on a 9 cm diameter Plexiglas holder and the agar was removed with a sterilized spatula to leave three 1-cm-wide strips (Hsiang et al. 1997). The amended PDA plates were incubated for 4 days at 5°C, to ensure there was no contamination present on the media. After 4 days the amended plates were inoculated with C. buxicola, and a separate set of plates with non-amended PDA were inoculated with C. buxicola as a control.

Five different C. buxicola isolates were tested for sensitivity to these fungicides: Belgium

(12001), Germany (12013), Italy (12015), B.C. (12018), and Ontario (12176) (Table 4.2). Each fungicide by isolate combination was repeated three times. For each concentration, five plates were prepared where each plate contained three different isolates, with a total of 120 plates

(Table 4.4). A 5-mm-diameter plug was taken from the edge of actively growing mycelium from

133

C. buxicola colonies grown for 2 weeks at 25°C and was placed onto the middle of a PDA strip.

The plates were wrapped in parafilm, incubated at 20°C, and were marked at both edges of the mycelial growth every other day for 21 d or until the growth reached the edge of the Petri plate

(Figure 4.5).

Growth measurements were analyzed using SAS PROBIT in SAS 9.1 (SAS 2003)

(Appendix 4.1). Growth Inhibition was calculated as 1- (mean diameter of treated/mean diameter of untreated control). EC50 values were calculated for each isolate by fungicide combination.

The initial probit analysis gave abnormal EC50 values, and EC50 could not be determined using probit analysis for some fungicides at the concentration tested. Scatter plots were generated to show inhibition vs. log concentration and 50% inhibition were visually estimated from the graphs for each isolate by fungicide combination, with each of the three replicates represented separately. These 50% inhibition values were then subjected to analysis of variance using

Fisher’s LSD test (p= 0.05).

4.2.2 Detached leaf fungicide trials

Fungicides were prepared according to the recommended application rates on the label

(Table 4.1). They were prepared in 500 ml spray bottles which were tested prior to use to ensure that the amount of liquid dispensed per spray was consistent for each bottle and between bottles.

Preventative tests were initiated using detached ‘Green Velvet’ leaves, where there were three replicate Petri plates for each fungicide, plus three water control plates only sprayed with water, and three C. buxicola control plates which were only inoculated with C. buxicola. Each Petri plate contained a piece of filter paper which was soaked with 2 mL of autoclaved water and four

134

‘Green Velvet’ leaves with the abaxial surface facing up. The leaves were not further wounded prior to treatment or inoculation.

Leaves were sprayed with the appropriate fungicide until runoff was seen on the leaves.

Negative control plates were sprayed with water and positive control plates were not sprayed at all. The leaves were then inoculated with a spore suspension C. buxicola 1, 3, 5 or 7 days after fungicide application, where the spore suspension was made to a concentration of 6.0 x 105 spores/ml using the Ontario isolate 12031. This isolate was randomly chosen based on the clonal population structure seen in Chapter 3 between the Ontario isolates. Controls were used that were treated with water rather than fungicide but still received inoculation.

Plants were incubated in a growth room at 22°C with a 16 hr photoperiod at 270

µmol/m2/s. The leaves were then monitored for signs of infection every day, for 7 days using a scale of 0-100%. Curative trials were also conducted following the same protocol, but leaves were inoculated with C. buxicola first and then 1, 3, 5 or 7 days after inoculation, the appropriate fungicides were applied. Disease suppression was calculated by subtracting the disease incidence for each fungicide from the disease incidence value for the positive control (inoculated and no fungicide) and then dividing by the disease incidence value of the positive control. The data were collected and analyzed using PROC GLM in SAS 9.3 (SAS 2003) using Fisher’s protected LSD test (p=0.05) to separate means if the treatment effect were significant.

4.2.3 Whole plant fungicide trials

Fungicides were mixed in 1 L of water according to the recommended application rates on the corresponding fungicide label (Table 4.1). Whole plants of three year old ‘Green Velvet’

135

were used for this experiment and were incubated in a growth room at 22°C with a 16 hr photoperiod at 270 µmol/m2/s. The boxwood plants were not pruned or treated with chemicals for six months prior to the fungicide trials to avoid effects from fungicide residues or wounding.

The plants were watered with regular tap water three times a week.

For each fungicide, there were three replicate plants, along with three negative control plants sprayed with just water, and three positive control plants which were only inoculated with the Ontario C. buxicola isolate 12031. Each individual boxwood plant was placed in a plastic

Petri plate bag and sealed with tape to maintain humidity and to prevent cross contamination between plants included in the study and the healthy boxwood plants growing nearby.

Preventative trials were conducted where the plants were sprayed with the appropriate fungicide and then seven days after fungicide application, the plants were inoculated with a spore suspension of C. buxicola. Prior to inoculation with C. buxicola, 10 leaves per plant were cut at the tip. The spore suspension was prepared to 5.0 x 105 spores/ml and the plants were sprayed until runoff.

Curative trials were also conducted where the plants were inoculated with C. buxicola, and then one day after inoculation the fungicides were applied. The plants for both the curative and preventative trials were monitored for signs on infection every day for seven days. Each leaf out of the 10 injured leaves, which demonstrated symptoms of infection was rated on a scale of 0-4 where 0= 0%, 1=0-25%, 2=25-50%, 3=50-75%, 4=75-100%. The total amount of infection for each plant was calculated by totaling the amount of infection calculated for each leaf, dividing by

4, dividing by 10, and then multiplying by 100 to transform values to percentages out of 100%.

136

The data were collected and analyzed using PROC GLM in SAS 9.3 (SAS 2003) using Fisher’s protected LSD test (p=0.05) to separate means if the treatment effect were significant.

4.3 Results 4.3.1 In-vitro sensitivity on amended PDA

A total of six fungicides (propiconazole, chlorothalonil, fludioxonil + cyprodonil, azoxystrobin, mancozeb, copper + myclobutanil), prepared at 4 different concentrations (0.01,

0.1, 1 and 10 µg/ml) were used in this experiment with five C. buxicola isolates. The EC50 values were calculated for each fungicide by isolate combination using a probit analysis and by producing scatter plots from which 50% inhibition values were visually estimated (Appendix

4.3). Both the probit analysis and the scatterplot-estimated values showed that chlorothalonil, azoxystrobin, and mancozeb did not perceptibly inhibit mycelial growth at the concentrations tested, therefore it was not possible to obtain inhibition values for these three fungicides. The inhibition values which could be calculated from the probit analyses were compared to the scatterplot-estimated values for propiconazole, copper + myclobutanil, and fludioxonil + cyprodinil in Table 4.2.

When the scatterplot-estimated 50% inhibition values were compared using Fisher’s LSD test (p= 0.05), the results showed that isolate 12013 from Germany was significantly different from all the other isolates for all three fungicides (Table 4.2). The EC50 values for the German isolate were higher for all three fungicides compared to the other isolates used in this study.

Isolate 12001 had an EC50 value which is also significantly higher compared to the other isolates for the fungicide Phyton + Nova.

137

4.3.2 Detached leaf fungicide trials

Both preventative and curative detached leaf trials using seven different fungicides were conducted using ‘Green Velvet’ boxwood leaves. For the preventative trials, the leaves were sprayed with fungicides and then 1, 3, 5, or 7 days after fungicide application the leaves were inoculated with C. buxicola. The preventative trial where the inoculum was applied 7 days after the plants were sprayed with fungicide was the first trial completed, and no disease was seen on the leaves after one week. This prompted another application of inoculum on day 14 and day 21 to assess whether the effect of the fungicides had diminished. The leaves were monitored for one week every time inoculum was re-applied and no disease developed on the leaves, with the exception of the positive C. buxicola control plates. This lead to subsequent trials where inoculum was applied 1, 3 or 5 days after fungicide application to observe whether disease would develop on the leaves. For all the preventative trials on detached leaves, no signs of disease developed even after 21 days. There was some phytotoxicity observed on the leaves which were sprayed with copper + myclobutanil. This lead to closer observations of the effects of this fungicide combination on whole boxwood plants to ensure that the aesthetics of the plant were also rated.

For the curative trials, the leaves were inoculated with C. buxicola and then sprayed with fungicide 1, 3, 5 or 7 days after inoculation. Disease developed on all of the leaves including the positive control when fungicides were sprayed after inoculation with C. buxicola, for all time periods tested (Table 4.4). There were some significant differences in disease severity between the different fungicides; however the disease suppression 1, 3, 5 or 7 days after inoculation did

138

not demonstrate consistent results. Therefore the discrepancies regarding the curative effects of these six fungicides were not clear and further necessitating whole plant trials.

4.3.3 Whole plant fungicide trials

The efficacy of these seven fungicides was also tested using whole 'Green Velvet' boxwood plants in preventative and curative trials. Disease only developed on the leaves which were wounded while the remaining leaves did not show symptoms. For the preventative trials, the plants were sprayed with fungicides and were then inoculated with C. buxicola, 7 days after fungicide application. The fungicides propiconazole and chlorothalonil suppressed disease on whole plants most effectively with disease suppression of 72.9 and 91.4%, respectively (Table

4.5). For the curative trials, the plants were inoculated with C. buxicola and were then sprayed with fungicides 1 day after inoculation. The fungicides fludioxonil + cyprodonil and copper + myclobutanil showed 81.0 and 85.6% disease suppression respectively at one week after inoculation (Table 4.5).

For the preventative trials, fungicides were applied 7 days before inoculation, and if lesions formed, they began to form at the tip of cut leaves approximately 3 days post inoculation

(dpi). The lesions spread from the top of the leaf downwards, eventually showing signs of sporulation. Only the leaves which were cut prior to inoculation developed symptoms of disease; however in some cases disease did develop at the tip of buds or branches which showed visible signs of wounding due to accidental detachment/breakage. None of the other intact leaves or stems showed indications of infection. Besides propiconazole and chlorothalonil, the fungicides azoxystrobin, copper + myclobutanil, and mancozeb demonstrated moderate disease control with

139

disease suppression of around 50% (Table 4.5). However fludioxonil +cyprodinil showed relatively low disease suppression of 19%.

For the curative trials, fungicides were applied 1 day after inoculation with C. buxicola, and lesions also began to form on the tips of the leaves approximately 3 dpi. In addition to fludioxonil + cyprodonil and copper + myclobutanil, the fungicides propiconazole and chlorothalonil demonstrated some curative efficacy with ~77% disease suppression.

Azoxystrobin and mancozeb demonstrated lower disease suppression at 35.8 and 26.5%, respectively. None of the fungicides demonstrated 100% disease suppression since signs and symptoms of disease were present on all plants inoculated with C. buxicola.

4.4 Discussion

Fungicide trials were conducted with seven different fungicides commonly used on ornamentals to assess if any of these chemicals demonstrated efficacy against C. buxicola on boxwood. First, in vitro fungicide experiments were conducted on amended PDA to assess the concentration required to inhibit fungal growth by 50% (EC50). Three of the seven fungicides did not inhibit fungal growth at the highest concentrations tested, including chlorothalonil, azoxystrobin, and mancozeb. One of the factors which could have contributed to the inability to calculate an EC50 values for these three fungicides, was the low concentrations of fungicides tested. Henricot et al. (2008) tested higher fungicide concentrations up to 50 µg a.i/ml, whereas in this study, the highest concentration used was 10 µg a.i/ml. It is possible that if higher concentrations were used for these three chemicals, EC50 values may have been obtained.

However, chlorothalonil was included in subsequent experiments, because this particular

140

chemical has been recommended for use against box blight by the PMRA. Azoxystrobin and mancozeb were also included in subsequent experiments to assess if these fungicides show efficacy against disease caused by C. buxicola on whole plants.

Propiconazole (in Banner MAXX), copper (Phyton) + myclobutanil (Nova), and cyprodinil + fludioxonil (Switch) did inhibit fungal growth (Table 4.2). The EC50 values calculated using PROC PROBIT in SAS produced abnormal EC50 values and prompted further analysis. Scatter plots were created displaying inhibition vs. log concentration and 50% inhibition values were visually estimated from the graphs for each isolate by fungicide combination. A regression analysis was also conducted to analyze the comparison of probit vs. scatterplot-estimated values for each fungicide (Figures 4.1 –Figure 4.3). This comparison demonstrated that there were some differences between the scatterplot-estimated 50% inhibition values and the EC50 values obtained from the probit analysis. The regression analysis for propiconazole indicated that there was a close relationship between the probit values and the visually estimated values for this fungicide (R2= 0.99, p-value= 0.000223). However, for copper

+ myclobutanil and fludioxonil + cyprodinil, there were a few outliers present which skewed the regression and lowered the significance (Figures 4.1- 4.3).

The scatter-plot estimated 50% inhibition values and the probit EC50 values for the fungicide propiconazole had the most significant relationship, which means that the estimated values were very similar to the probit calculated values. However, this was not the case for copper + myclobutanil and fludioxonil + cyprodinil. There were several outliers present for both fungicides which lowered the significance and indicated that the scatterplot-estimated 50%

141

inhibition values were not as similar to the EC50 values obtained from the probit analysis.

Therefore, because some of the probit EC50 values were abnormal, it was necessary to obtain the scatterplot-estimated 50% inhibition values to achieve a more reliable estimate of the concentration required to inhibit fungal growth. It is possible that there could have been an unknown error in the probit analysis, causing these skewed EC50 values. Propiconazole almost completely prevented fungal growth at concentrations of 1 µg/ml and higher. However, there was still fungal growth observed at concentrations of 1 µg/ml and higher for fludioxonil + cyprodinil and copper + myclobutanil. This could perhaps be the reason why the EC50 values and the scatter-plot estimated 50% inhibition values were more similar for propiconazole.

There were also some significant differences between the different isolates tested. Overall,

EC50 values for isolate 12013 from Germany were consistently higher for all three fungicides, which mean that this German isolate was less sensitive to the fungicides than isolates from other regions, including Ontario. The German isolate differed genetically from the other isolates as demonstrated by ISSR analysis (see section 3.3.4), and contained the opposite mating type gene

MAT1-1 rather than MAT1-2 found in all the other isolates (see section 3.3.5). It is possible that if German isolates were to engage in sexual reproduction with other C. buxicola isolates of the opposite mating type, more versatile isolates could be produced. The presence of more versatile isolates could hinder effective chemical management methods. More study is needed on this

German isolate provided courtesy of Dr. Sabine Werres.

Henricot et al. (2008) used several of the same active ingredients to test in vitro toxicity against C. buxicola and included chlorothalonil, mancozeb, azoxystrobin, myclobutanil, and a

142

copper fungicide. Henricot et al. (2008) stated that mancozeb, chlorothalonil, and azoxystrobin were highly effective at inhibiting at least 50% of conidial germination. Similarly, when higher concentrations were used, these fungicides also inhibited conidial germination by at least 90% and chlorothalonil caused 100% inhibition. Henricot et al. (2008) also stated that mancozeb and chlorothalonil had relatively high EC50 values (2.70, 2.50 µg a.i./ml, respectively), which means that a higher concentration of fungicide was needed to inhibit fungal growth by 50%. The only fungicide which did not inhibit fungal growth in the study done by Henricot et al. (2008) was copper.

LaMondia (2014) also conducted in vitro fungicide tests for activity against C. buxicola and found that thiophanate-methyl, fludioxonil, pyraclostrobin, trifloxystrobin, kresoxim-methyl, mancozeb, and chlorothalonil all had activity against mycelial growth. It is evident, that the fungicides utilized in the studies done by Henricot et al. (2008) and LaMondia (2014) demonstrated in vitro toxicity against C. buxicola. There were several active ingredients used in these studies which were also used for this thesis project and some of the results are similar.

Differences in in vitro toxicity between studies could be a result of the concentrations used or due to differences in the C. buxicola isolates used.

Preventative and curative whole plant fungicide trials were conducted where the leaves were cut prior to inoculation. The reason the leaves were purposely wounded was because it was previously observed that whole boxwood plants require wounding for infection to develop (see section 2.3.2). There have been no other reports which have stated that wounding is necessary for successful infection with C. buxicola. Henricot et al. (2008) conducted pathogenicity tests with

143

C. buxicola on boxwood cuttings, however, the cuttings were detached from the whole boxwood plants, which could reduce the ability of the cutting to display a defense response. It is also possible that a higher concentration of spore suspension could result in successful infection on whole plants without the need for wounding. Further studies could be conducted to determine if boxwood plants truly require injury for successful infection by C. buxicola, under all circumstances.

Chlorothalonil and propiconazole were the two fungicides which demonstrated the highest disease suppression for the preventative fungicide trials, and copper + myclobutanil and fludioxonil + cyprodonil were the two fungicides with the highest disease suppression for the curative trials. Mueller et al. (2004) also found that propiconazole and chlorothalonil significantly reduced lesion development by six different Puccinia rust pathogens on daylily, geranium, and sunflower when the compounds were applied preventatively up to 15 days before inoculation. Chlorothalonil was one of the fungicides registered for emergency use by the PMRA for use against C. buxicola, which is why it is not surprising that this fungicide was one of the most effective in these fungicide trials. Propiconazole has been shown to be effective against a number of other leaf blights such as anthracnose on dogwood and against apple scab

(Anonymous 2013b).

Mueller et al. (2004) also found that myclobutanil demonstrated curative activity on geranium when the fungicide was applied seven days post inoculation. Myclobutanil is a triazole fungicide and is known to have strong curative properties. Bonde et al. (1995) found that application of myclobutanil five days after inoculation with Puccinia horiana was strongly

144

curative and almost totally prevented disease development in both inoculated plants and cuttings from infected plants. Fungicides that inhibit sterol biosynthesis (like myclobutanil) are not usually used to inhibit spore germination and therefore can proceed in the absence of biosynthesis (Henricot et al. 2008). Henricot et al. (2008) found that myclobutanil had no effect on spore germination of C. buxicola which suggests that this particular fungicide should be used as a curative chemical rather than a preventative one. Rosslenbroich and Stuebler (2000) stated that cyprodinil, which is one of the active ingredients in Switch, possesses protective activity and some curative activity, although this fungicide is most often recommended for preventative use.

Although copper + myclobutanil and fludioxonil + cyprodonil demonstrated curative efficacy against C. buxicola, these fungicides were applied one day after inoculation with the fungus and there were still some symptoms of disease present on the leaves. It is unlikely that these two fungicides could successfully be incorporated as curative chemicals for the control of box blight. The timing between inoculation and the application of fungicides would have to be less than 24 hours to ensure disease suppression. This is unrealistic since it takes approximately

48 hours before any signs of disease are visible on the plant, meaning that it would be too late by the time the curative fungicides are applied. Therefore, best management practices for the control of box blight should be primarily preventative. This is the first report of fungicide assays conducted on whole boxwood plants against box blight caused by C. buxicola. Propiconazole and chlorothalonil demonstrated efficacy against C. buxicola and should be considered in nursery sanitation programs to prevent the establishment and spread of box blight.

145

Table 4.1. Fungicides used for the in vitro sensitivity tests, detached leaf trials, and whole plant

trials. Fungicides were prepared as 1000 ppm stock solutions for the in-vitro sensitivity tests and

the fungicides were mixed in 1 L of water according to the recommended application rates for

the detached leaf trials and whole plant trials.

Trade Name Chemical Name 1000 µg active Concentration

ingredient/ml H2O (per L H2O) stock solution Banner Maxx 14.3% propiconazole 0.025 ml ai/10 ml H2O 0.35 ml

1 Daconil 2787F 40% chlorothalonil 0.124 ml ai/ 50 ml H2O 2.4 ml

1 Switch 62.5WG 37.5% Cyprodinil 0.04 mg ai/ 25 ml H2O 1 g 25% Fludioxonil Phyton 27 5.5% Elemental 0.45 ml ai/ 25 ml H2O 1.25 ml copper Fore 80WP 80% mancozeb 0.03 mg ai/ 25 ml H2O 1.8 g

Heritage 50WG 50% azoxystrobin 0.02 mg ai/ 10 ml H2O 0.22 g

Nova 40W 40% myclobutanil 0.45 mg ai/ 25 ml H2O

Negative Control Water Not available Not available

Positive Control C. buxicola Not available Not available 1 The following fungicides received emergency use registrations for box blight in Ontario by Landscape Trades (Landscape Trades 2012)

146

1 EC50(µg/ml) Isolate Banner Phyt-Nova Switch Scatterplot Probit Scatterplot Probit Scatterplot Probit 12001 0.12 0.07 2.02a 0.03 0.45b 1.29 12013 0.68 0.60 2.50a 1.47 1.88a 1.53 12015 0.04 0.04 0.67b 0.54 0.11b 0.10 12018 0.11 0.07 0.78b 1.01 0.36b 2.03 12176 0.06 0.06 1.00b 1.01 0.31b 1.65 LSD 0.23 0.59 2.7 1 Scatterplot means within a column were compared using Fisher’s LSD test (p= 0.05) based on three replicate observations. Probit values were calculated using PROBIT analysis in SAS 9.1.

147

µmol/m2/s at 25°C.

Disease Severity (0=low, 100= high) after fungicide application Fungicide Day 1 Day 3 Day 5 Day 7 Banner 01 0 0 0 Daconil 0 0 0 0 Heritage 0 0 0 0 Fore 0 0 0 0 Phyton+ Nova 0 0 0 0 Switch 0 0 0 0 Positive Control 8.3 8.3 12.5 12.8 Negative Control 0 0 0 0 LSD 1.9 1.9 3.1 3.9 1Means within a column were compared using Fisher’s LSD test (p=0.05) and are based on 4 replicate observations.

148

Table 4.4. Average amount of infection on detached ‘Green Mound’ boxwood leaves inoculated with a spore suspension of C. buxicola and then sprayed with six different fungicides 1, 3, 5 and

7 days after inoculation. Leaves were monitored for 7 days where there were three replicate plates for each fungicide with four leaves per plate. The spore suspension had a concentration of

6.0 x10 5 spores/ml. The plants were incubated with a 24 hr photoperiod at 270 µmol/m2/s at

25°C.

Disease Severity (0=low, 100=high) after inoculation Fungicide Day 1 Day 3 Day 5 Day 7 Banner 16.01 12.9 17.7 40.4 Daconil 19.2 27.1 24.8 29.4 Heritage 15.6 28.9 35.4 42.7 Fore 8.8 12.8 24.0 39.6 Phyton+ Nova 4.4 16.9 27.1 38.5 Switch 13.1 10.0 33.8 26.0 Positive Control 20.6 32.7 27.5 26.3 Negative Control 0 0 0 0 LSD 7.7 8.6 7.8 9.3 1Means within a column were compared using Fisher’s LSD test (p=0.05) and are based on 4 replicate observations.

149

Preventative Curative Fungicide Disease Disease Disease Disease Severity1 Suppression % Severity Suppression % Banner 5.81 79.2 5.9 77.0 Daconil 2.4 91.4 5.8 77.4 Heritage 13.9 50.2 16.5 35.8 Fore 13.4 52.0 18.9 26.5 Phyton + Nova 14.6 47.7 4.9 81.0 Switch 22.6 19.0 3.7 85.6 Positive Control 27.9 0 25.7 0 Negative Control 0 100 0 100

LSD 6.0 6.6 1Means within a column were compared using Fisher’s LSD test (p=0.05) and are based on 4 replicate observations. 2 Disease severity was rated on a rating scale from 0-100%

150

Figure 4.1. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Banner. A regression analysis was conducted for each fungicide. R2 = 0.99, p- value=0.000223.

151

Figure 4.2. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Phyton-Nova. A regression analysis was conducted for each fungicide. R2 = 0.017, p- value= 0.832

152

Figure 4.3. Comparison of the visually estimated 50% inhibition values and the Probit EC50 values for Switch. A regression analysis was conducted for each fungicide. R2 = 0.083, p-value =

0.637.

153

Figure 4.4. Example of the placement of the repeated randomized placement of five different C. buxicola isolates on amended PDA where each fungicide by replicate combination is repeated 3 times (0.01, 0.1, 1 and 10 µg/ml at 20°C for 21d)

154

155

Chapter 5 General Discussion and Conclusions

5.1 Major conclusions

The major conclusions derived from the research presented in this thesis are as follows:

1. Cylindrocladium buxicola was positively identified by morphological analysis and DNA

sequence comparisons as the cause of boxwood blight, from samples from a nursery in

Southern Ontario. The fungus had a relatively rapid disease cycle which can be

completed within 72 hours from germination to sporulation in vitro. Contrary to prior

findings, whole boxwood plants required wounding for successful infection to occur at

the spore concentration used (105 spores/ml); however detached leaves did not require

wounding. The ‘Green Series’ cultivar ‘Green Mountain’ was found to be the least

susceptible to C. buxicola compared to ‘Green Gem,’ ‘Green Velvet,’ and ‘Green

Mound’ that are commonly grown in Ontario. The overall survival of C. buxicola

inoculum buried in the fall at soil depths up to 20 cm in Southern Ontario was very low at

snowmelt declining to not detectable within a month; however the fungus did remain

viable (over 10%) throughout the fall months, suggesting that C. buxicola can survive at

temperatures of 4°C but may not be adapted for survival under the snow in the conditions

tested.

2. All isolates included in this study, from a variety of geographic locations, had identical

genetic patterns based upon ISSR analysis, and they all contained the MAT1-2 gene

based on PCR with primers derived from whole genome sequencing, with the exception

of the German isolate. Whole genome sequencing of a C. buxicola isolate from Ontario 156

and the one from Germany revealed the presence of the MAT1-1 gene in the German

isolate and confirmed the presence of MAT1-2 in the Ontario isolate. This implies that

there is a possibility for sexual reproduction between isolates of C. buxicola in nature

since both MAT genes are available. However, the production of perithecia was not

observed between C. buxicola isolates with the opposite mating types under laboratory

settings.

3. While both preventative (7 days before) and curative (1 day after) applications showed

significant suppression of disease, the preventative use of fungicides for the control of

box blight in a nursery setting, rather than curative use, is likely to provide better

management of this disease because of timing issues; curative applications at 3 and 7

days did not have efficacy. In vitro fungicide assays demonstrated that the German isolate

required a higher concentration of fungicide (50% more) to reduce mycelial growth by

50%. This suggests that the German isolate was more versatile, and these characteristics

could be transferred in the event of successful sexual reproduction.

5.2 General discussion, future research, and conclusions

The major goal of this thesis was to investigate the biology and nature of C. buxicola, a new fungal plant pathogen which has recently been introduced on boxwood plants in Ontario.

Specifically, this research aimed to explore and discover more about the biological characteristics of this fungus to aid in the development of effective management strategies. In

2012, a nursery in Strathroy, Ontario identified symptoms on boxwood plants which resembled box blight including brown spots on the leaves, black streaks on the stems, defoliation, and 157

overall bronzing of the foliage. Samples were obtained for further analysis to assess whether these symptoms were a result of C. buxicola. Fungal isolates were obtained resembling descriptions of C. buxicola. One isolate was subjected to pathogenicity testing, and it successfully passed Koch’s postulates to be confirmed as the causal agent of box blight. The morphological identification was further confirmed by sequencing the ITS region which showed a 98% top nt match for sequences previously identified as C. buxicola (Chapter 2). This positive identification of C. buxicola from other samples was further validated in Chapter 3 with a specific detection assay designed from unique regions within the C. buxicola genome. Thus far, there have been no other reports of box blight within nurseries in Ontario; but in Canada, there have been positive identifications in landscape settings in British Columbia (Elmhirst et al.

2013).

Subsequent experiments conducted in Chapter 2 focused on characterizing the basic pathogenicity, survival, and infection patterns of C. buxicola. Temperature growth experiments revealed that C. buxicola isolates from Ontario, B.C., Germany, Belgium, and Italy had an optimal growth temperature of 20°C. This is not consistent with reports in the literature which state that the optimal temperature for C. buxicola is 25°C. Discrepancies between the reported optimal growth temperatures could be a result of isolate variation, since the isolates analyzed here were mainly from Ontario (5 out 10 isolates), whereas most of the isolates analyzed by

Henricot and Culham (2002) originated from the UK. Interestingly, it was also observed that the

German isolate was among the slowest growing isolates indicating that this isolate has unique characteristics compared to the rest of the isolates used in this study. This characteristic can be

158

linked to the genetic differences present in the German isolate which were explored further in

Chapter 3.

A growth room survival test of C. buxicola on dried boxwood leaves showed survival at

4ºC past 14 months, indicating that this fungus can remain viable without moisture or nutrition for long periods of time. This is in agreement with Henricot and Culham’s (2002) statement that

C. buxicola can survive for over 5 years on decomposing plant tissue. However, when field trials were conducted in the current study, where infected boxwood leaves were buried to different depths, the results did not show long term survival of C. buxicola, but showed limited survival after the winter and some survival throughout the fall. There were notable differences between the survival trial done here and the survival trial done by Henricot and Culham (2002).

Especially since the relative temperature in Ontario throughout the winter is much lower compared to the average temperature experienced in the UK during the same months. Also,

Henricot and Culham (2002) placed the infected leaf samples on a tray outdoors but in the current study, the infected leaf samples were buried.

The survival of C. buxicola after the winter months, where infected leaf pieces were buried in one location in Ontario, revealed extremely low survival and viability rates compared to higher levels of survival over four months in the fall. This is the first study which has examined the survival of C. buxicola in a less controlled and more natural environment. The lowest temperature at which C. buxicola was still able to grow in the temperature growth experiments was just above 4°C. During the burial trials, the temperature beneath the snow was approximately 0°C and the average temperature the leaves may have been exposed to when there

159

was no snow cover was -4.8°C. Therefore, the survival of C. buxicola in Ontario at these low temperatures is highly unlikely, which suggests very low survival of C. buxicola between subsequent growing seasons under Ontario conditions.

When the infected leaf samples from the winter trial were recovered from the burial site, they were immediately surface sterilized and isolated onto antibiotic PDA. There were high numbers of other fungal colonizers present, making it difficult to identify colonies of C. buxicola. To address this issue, when the infected leaf samples from the fall trial were collected, they were incubated at 4°C for two weeks prior to processing to allow other fungal colonizers present on the surface of leaf samples to die off. It is possible that the survival rate of C. buxicola during the winter could have been higher if the leaf samples were also incubated prior to processing, and therefore it would be worthwhile to repeat the winter burial trial to assess any differences in the survival level. Future studies could also incorporate more than one burial site, perhaps in several locations across Ontario with a variety of isolates, to gain a clearer picture of the overall survival capability of C. buxicola in Ontario.

Analysis of the infection process of C. buxicola on boxwood revealed that the entire infection cycle can be complete within 72-120 hours. The observations here are very similar to previous findings in the literature (Ivors 2011; Henricot and Culham 2002). Spore germination was observed 1 hpi , with 100% germination occurring by 3 hpi. Penetration via the germ tubes into the stomata of boxwood leaves began between 4-5 hpi, with 100% penetration occurring by

24 hpi. Sporodochia and dark brown lesions began to form between 72-120 hpi. The infection

160

process was investigated on detached boxwood leaves where wounding of the leaf surface was not found to be a prerequisite for successful infection.

Penetration by hyphae occurred through open stomata when a spore suspension was used.

Penetration occurred directly through the cuticle when inoculum was applied as mycelial plugs.

It would be valuable to conduct infection process studies on whole plants to identify any differences in the timing of key events and/or the strategies utilized by C. buxicola when whole plant defense mechanisms are intact. This is especially important because in the whole plant inoculation studies, wounding was found to be a pre-requisite for infection (Chapter 2).

Several different pathogenicity experiments were conducted in this work to investigate the susceptibility of the different boxwood cultivars, the susceptibility of P. terminalis, and the susceptibility of boxwood, incubated at different temperatures. Pathogenicity experiments on detached boxwood leaves revealed that the four cultivars which make up the ‘Green Series’ were all susceptible to infection by C. buxicola; however the ‘Green Mountain’ cultivar was less susceptible compared to ‘Green Velvet,’ ‘Green Gem,’ and ‘Green Mound.’ This is an important finding for nursery growers when considering which cultivars to propagate and produce in the event of pathogen invasion. Another important result which could have implications for nursery growers was the confirmation that P. terminalis is susceptible to infection by C. buxicola. This was previously reported in the US (Anonymous 2012b), and it is suggested that nursery growers remain cautious, since other species closely related to Buxus also have the potential to become infected. Temperature was also found to have a significant effect on the success of infection for detached boxwood leaves. The incidence of infection was higher at 20 or 15°C rather than 25°C;

161

this information can be taken into consideration in nurseries when deciding on incubation temperatures for young boxwood plants.

The results from pathogenicity tests on whole boxwood plants revealed that injury was a prerequisite for successful infection. Only after whole boxwood plants were scratched with a sterilized probe or cut with scissors, did signs and symptoms develop which resembled C. buxicola. There have been very few studies done in the literature which have incorporated whole boxwood plants for pathogenicity experiments. Henricot and Culham (2002) looked at the susceptibility of different boxwood cultivars typically grown in the UK; however they used detached boxwood cuttings rather than whole plants. A report given at the American

Phytopathology Society annual meeting in 2013 also looked at the susceptibility of several different boxwood cultivars, including those commonly grown in Ontario (Ganci et al. 2013).

Their inoculation protocol was not specified in this short abstract, but it was implied that boxwood plants were inoculated with C. buxicola without wounding.

It is possible that if a higher concentration of spore suspension was achieved and utilized for whole boxwood inoculation, infection could occur without injury. It was not possible to consistently obtain a spore suspension with a concentration higher than 105 spores/ml using the protocol presented here. Future studies could also focus on achieving a more efficient method to obtain spores from colonies of C. buxicola, which would then allow a higher concentration of spore suspension to be utilized. It would also be valuable to analyze which genes are over or under expressed during infection using RNA sequencing data and comparative genomics.

162

Molecular and genetic patterns of C. buxicola were explored in Chapter 3 after using

Next Generation Sequencing technology to sequence the genomes of two C. buxicola isolates.

These whole genome sequences were compared within and between different species and the observations made were used for several different analyses. Initially, the genome for the Ontario isolate 12034 was analyzed for species-specific genes from which to design specific primers. A list of genes which were apparently unique to C. buxicola was obtained after conducting a thorough comparison with other fungal genomes. A set of primers was designed and demonstrated strict specificity to C. buxicola and moreover this primer set was able to co- amplify plant and fungal DNA from infected boxwood tissue when used in multiplex-relative

PCR with chloroplast primers.

After co-amplification was achieved, the relative amount of fungal DNA present within infected boxwood tissue was calculated using the ratio of band intensities between the internal control and the target sequence. These unique fungal gene primers and chloroplast primers can therefore be used in downstream applications for the detection of box blight from infected boxwood samples. The advantage of this detection assay is the level of specificity achieved by designing primers from these unique regions of the C. buxicola genome. Additionally, this detection assay can provide relatively rapid results without the requirement of post PCR DNA sequencing to confirm identity. However, the quantification technique used for this experiment is not as reliable as the qPCR technique which can more accurately quantify a target pathogen in plants (Mumford et al. 2006). Gehesquiere et al. (2013) developed a detection assay using qPCR techniques but they used the -tubulin region of fungal DNA. Future studies should focus on developing a qPCR detection assay, perhaps incorporating these unique fungal gene primers. 163

A common tool used to investigate genetic diversity is the examination of microsatellite regions with ISSR experiments. Several C. buxicola isolates from Germany, Belgium, Italy,

B.C., and Ontario were analyzed using ISSR primers previously tested with the P. buxi (Shi

2011). All of the isolates from Ontario, B.C., and most of the isolates from Europe had a clonal population with identical banding patterns. However the isolate from Germany contained polymorphisms and genetic differences compared to all of the other isolates tested. This was the first indication that the German isolate of C. buxicola contained different qualities relative to the other isolates and prompted a more thorough analysis of the genome. More isolates from

Germany should be obtained to reveal if isolates from this region have the same genetic patterns.

Analysis of the German isolate of C. buxicola using both comparative genomics and PCR analysis revealed that this particular isolate contains the opposite mating type (MAT1-1) compared to rest of the isolates (MAT1-2) analyzed in this thesis. It was suspected that the

German isolate was different based on findings in chapter 2 and earlier in chapter 3, such as the slower growth rate, the presence of polymorphisms, and the lack of the MAT1-2 gene. Whole genome sequencing of the German isolate allowed for easy identification of mating type genes, by comparing the genome to other fungal mating type genes in GenBank NR database and by comparing the two sequenced genomes of C. buxicola (Germany 12013 and Ontario 12034).

Both techniques confirmed that MAT1-2 is present in the isolate from Ontario and MAT1-1 is present in the isolate from Germany. The identification of the MAT1-1 gene in the German isolate was further validated by designing primers from this MAT1-1 region and then using these primers to amplify fungal DNA from this isolate.

164

Mating type crosses conducted with C. buxicola isolates containing the opposite mating type genes were conducted in the lab; however no viable perithecia were obtained from this experiment. The possibility of sexual reproduction cannot be ruled out and future work should place an emphasis on determining if sexual reproduction can occur under laboratory and field conditions. There have been several cases where fungal pathogens reproduce sexually in the lab but have never been observed to reproduce sexually in nature (Hsueh and Heitman 2008).

Several fungi have also never demonstrated sexual reproduction even though they possess the appropriate MAT loci and machinery for mating (Hsueh and Heitman 2008). Often for sexual reproduction to occur, favorable environmental conditions are needed along with very specific cues from the host. Future studies should initiate several different mating type experiments under a variety of environmental conditions. Also, a wider range of isolates should be incorporated to determine if the unequal distribution of mating type genes in this thesis is the contributing to the lack of sexual reproduction.

The comparison of the two C. buxicola genomes was conducted at several different e- value cut-offs to evaluate the number and types of genes which were present in one isolate but not the other. MAT1-1 matches were found exclusively in the German isolate, but MAT1-2 matches were not found exclusively in the Ontario isolate. This meant that there was a certain level of similarity between proteins in the German isolate and the MAT1-2 gene identified in the

Ontario isolate. This was dependent on the e-value cut-off; at an e-value cut-off of 1e-50 and lower, the MAT1-2 gene was matched up with an HMG protein and MAT1-1-3 in the German isolate. When an e-value cut-off of 1e-100 was used, the MAT1-2 gene was found exclusively in isolate 12034. Only when the e-value cut-off was adjusted to be more stringent, was the MAT1-2 165

gene found to be unique to the Ontario isolate, demonstrating that discovery of mating genes in non-sequenced species is complicated by false matches when using conserved sequences as a guide for primers.

The comparison of the two C. buxicola genomes also provided information on the number of predicted genes which are apparently unique to each isolate. The number unique genes in each isolate were expected to be quite low since the comparison was between to isolates of the same species. The more stringent the e-value was, the fewer genes apparently unique to one isolate were found and vice versa. This is to be expected; however how does one determine what the ‘ideal’ e-value cut-off should be? This depends on what the researcher’s objective is.

For example, using a strict e-value will increase the likelihood of finding truly unique genes; however this can cause additional homologues to be missed or conversely, highlight extremely rare circumstances within one isolate (Doyle and Gaut 2000).

It is important that future work focuses on collecting and analyzing more C. buxicola isolates from Germany as well as from a variety of other geographic regions to learn more about the distribution of mating type genes with the species. The goal here was to compare two C. buxicola isolates to confirm the presence of opposite mating type genes, as well as estimating the number of apparently unique genes in each isolate.

One of the goals of this thesis project was to assess fungicidal inhibition of C. buxicola in amended agar tests and of control of box blight on detached leaves and on whole boxwood plants. In vitro fungicides tests if pure cultures on amended media were conducted and gave some abnormal results. Three of the seven fungicides tested (chlorothalonil, azoxystrobin, and

166

mancozeb) did not inhibit fungal growth compared to the control plates. Two other studies in the literature tested in vitro toxicity of fungicides for C. buxicola. Henricot et al. (2008) found that several fungicides were able to inhibit fungal growth, but they did state that the EC50 values were higher for mancozeb and chlorothalinol in comparison to the other fungicides. The high

EC50 values for chlorothalonil and mancozeb were around 2.5 µg a.i./ml which is not excessively high, and values close to this number were obtained for other fungicides used in this thesis. LaMondia (2014) also reported that chlorothalonil and mancozeb had activity against fungal growth. It is possible that the highest concentration of fungicide used in for this thesis experiment was not high enough to inhibit fungal growth, or that the isolates used in this study have different sensitivities to these fungicides. Therefore, the in vitro fungicide experiment could be repeated to observe whether the same patterns persist with these fungicides and the same C. buxicola isolates.

Temperature growth experiments revealed that 20°C is the optimal temperature for the growth of C. buxicola, and subsequent pathogenicity experiments at different temperatures confirmed that infection is more likely to occur at 20°C rather than 25°C. This information was applied when setting the room temperature for the fungicide trials to ensure that the temperature did not go above 22°C. Additionally, pathogenicity experiments on whole boxwood plants demonstrated that wounding was required prior to inoculation for successful infection to occur.

For the whole plant fungicide trials, the leaves were cut prior to inoculation to ensure that the plants would be susceptible to C. buxicola.

167

Overall, the results from the whole plant fungicide trials demonstrated that preventative fungicide use and curative fungicide use resulted in disease suppression, however the timing for curative fungicide use was much more sensitive. The fungicides were not effective when they were applied to detached leaves 3, 5, and 7 dpi and only resulted in disease suppression when applied 1 dpi. The fungicides propiconazole and chlorothalonil were the best preventative fungicides and application of these fungicides prior to inoculation resulted in high disease suppression. Chlorothalonil was one of the fungicides recommended for emergency use on boxwood when C. buxicola was first identified in North America (Anonymous 2012d), and therefore it was not a surprise that this fungicide displayed efficacy. The other fungicide recommended for emergency use was Switch (fludioxonil + cyprodonil). This fungicide did show curative efficacy. The fungicide was applied one day after inoculation with C. buxicola, and the disease suppression was still not 100%. Therefore, recommendations to nursery growers would be to incorporate a preventative fungicide program for boxwood rather than trying to use curative fungicides. However, this further validates the concern surrounding the introduction of this disease, because once the fungus becomes established it is much more difficult to control.

These fungicide trials should be repeated to give these results more strength and to test different cultivars of boxwood and different isolates of C. buxicola.

In this research, biological characteristics of the fungal pathogen C. buxicola were analyzed and explored to develop a clear understanding of the pathogen and aid in the development of effective management methods. The techniques used to achieve this objective were pathogenicity tests, molecular and genetic analyses, genomic analyses, as well as fungicide tests. In the event that box blight does become established within nurseries in Canada, growers 168

should be aware of these characteristics and incorporate strict measures to contain the spread and eradicate the disease. Together the results of this thesis provide helpful guidelines for concerned nursery growers, and open a window for future research.

169

References

Åafrankova, I., Kmoch, M., and Holkova, L. 2012. First report of Cylindrocladium buxicola on box in the Czech Republic. New Disease Reports 25: 5.

Agrios, G.N. 2005. Plant Pathology. 5th eds. Academic Press, San Diego.

Akilli, S., Katircioglu, Y.Z., Zor, K., and Maden, S. 2012. First report of box blight caused by Cylindrocladium pseudonaviculatum in the Eastern Black Sea region of Turkey. New Dis. Rep 25: 23.

Allen, S.J., Brown, J.F., and Kochman, J.K. 1983. Effects of leaf age, host growth stage, leaf injury, and pollen on the infection of sunflower by AIternaria helianthi. Phytopathology 73: 896-898.

Altschul, S., Gish, W., Miller, W., Myers, E., and Lipman, D. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.

Anonymous. 2009a. The impact of ornamental horticulture on Canada's economy Edited by D.T. LLP. COHA.

Anonymous. 2009b. Azoxytrobin Pesticide Info. Available from http://www.agf.gov.bc.ca/pesticides/infosheets/azoxystrobin.pdf [accessed February 2014]. Anonymous. 2011. The 'box blight' pathogen: Cylindrocladium pseudonaviculatum = Cylindrocladium buxicola (Teleo. Calonectria pseudonaviculata) Available from http://illinoisgreen.org/pdfs/boxwood2.pdf [accessed May 2012].

Anonymous. 2012a. Invasive Species Compendium: Calonectria pseudonaviculata (Buxus Blight) Available from http://www.cabi.org/isc/?compid=5&dsid=17414&loadmodule=datasheet&page=481&site =144 [accessed May 2012].

Anonymous. 2012b. Boxwood Blight New Host: Pachysandra Available from http://www.ct.gov/caes/cwp/view.asp?a=3756&q=500388&pp=. [accessed May 2012].

Anonymous. 2012c. State Department of Agriculture Compliance Agreement Template Available from http://nationalplantboard.org/docs/sanc/FINAL_npb_model_bwb_Agree_4-5-2012_1.pdf [accessed June 2012].

Anonymous. 2012d. Emergency use label Switch 62.5 WG fungicide Available from http://www.al.gov.bc.ca/pesticides/switch-emerg-label.pdf [accessed February 2014].

170

Anonymous. 2013a. Daily data report for Guelph Turfgrass Ontario Available from http://climate.weather.gc.ca/climateData/dailydata_e.html?StationID=45407&timeframe=2 &cmdB1=Go&cmdB2=Go&Year=2013&Month=3&cmdB2=Go# [accessed February 2014].

Anonymous. 2013b. Crop protection guide for nursery and landscape plants. In Publication 840 OMAF.

Anonymous. 2013c. Proposed re-evaluation decision PRVD2013-01, Mancozeb Available from http://www.hc-sc.gc.ca/cps-spc/pest/part/consultations/_prvd2013-01/prvd2013-01- eng.php [accessed February 2014].

Anonymous. 2013e. Fungicides-Switch. Available from http://www.syngenta.com/global/corporate/en/products-and-innovation/product- brands/crop-protection/fungicides/pages/switch.aspx [accessed February 2014].

Arie, T., Christiansen, S.K., Yoder, O.C., and Turgeon, B.G. 1997. Efficient Cloning of Ascomycete Mating Type Genes by PCR Amplification of the Conserved MAT HMG Box. Fungal Genetics and Biology 21: 118-130.

Baker, K.F., and Linderman, R.G. 1979. Unique features of the pathology of ornamental plants. Annual review of phytopathology 17: 253-277.

Baniecki, J.F. 2012. Boxwood Decline. Available from http://www.wvu.edu/~agexten/hortcult/treeshru/boxwood.htm [accessed May 2012].

Benson, D.M.J., R.K. 2000. Phytophothora root rot and its control on established woody ornamentals. Available from http://www.ces.ncsu.edu/depts/pp/notes/oldnotes/odin13/od13.htm [accesssed May 2012].

Beute, M.K. 1980. Cylindrocladium black rot (CBR) disease of peanut (Arachis hypogaea). In International Workshop on Groundnuts. p. 171.

Bjerrum, L., KjÃ¦r, T., and Ramsing, N.B. 2002. Enumerating ammonia-oxidizing bacteria in environmental samples using competitive PCR. Journal of microbiological methods 51: 227-239.

Boland, G.J., Melzer, M.S., Hopkin, A., Higgins, V., and Nassuth, A. 2004. Climate change and plant diseases in Ontario. Canadian Journal of Plant Pathology 26: 335-350.

Bonde, M.R., Peterson, G.L., Rizvi, S.A., and Smilanick, J.L. 1995. Myclobutanil as a curative agent for chrysanthemum white rust. Plant Disease 79: 500-505.

171

Brand, T. 2005. Auftreten von Cylindrocladium buxicola B. HENRICOT an Buchsbaum in Nordwest-Deutschland. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 57: 237- 240.

Bradnam, K.R., Fass, J.N., Alexandrov, A., Baranay, P., Bechner, M., Birol, I., Boisvert, S., Chapman, J.A., Chapuis, G., and Chikhi, R. 2013 Assemblathon 2: evaluating de novo methods of genome assembly in three vertebrate species. arXiv preprint arXiv:1301.5406.

Camele, I., Altieri, L., Vitale, A., and Polizzi, G. 2009. Development of PCR primers for detection of Cylindrocladium pauciramosum. Journal of Plant Pathology 91: 225-230.

Cech, T., Diminic, D., and Heungens, K. 2010. Cylindrocladium buxicola causes common box blight in Croatia. Plant Pathology 59: 1169-1169.

Chase, A.R. 2010. Mode of action group M1: Copper. Available from http://www.greenhousemag.com/gmpro-0210-copper-fungicides.aspx [accessed February 2014].

Chase, A.R., and Harris, S. 1999. Control of Fusarium diseases on ornamentals West connection; Turf Ornam 1: 1-4.

Chastagner, G.A., and Kaufmann, P. 2004. Efficacy of fungicides in controlling leaf spot on bulbous iris. In IX International Symposium on Flower Bulbs 673. pp. 509-512.

Chiang, T.Y., and Schaal, B.A. 2000. Molecular evolution and phylogeny of the atpB-rbcL spacer of chloroplast DNA in the true mosses. Genome 43: 417-426.

Cotten, T.K., and Munkvold, G.P. 1998. Survival of Fusarium moniliforme, F. proliferatum, and F. subglutinans in maize stalk residue. Phytopathology 88: 550-555.

Cox, C. 1997. Fungicide Factsheet: Chlorothalonil Journal of Pesticide reform 17: 14-20.

Crepel, C., and Inghelbrecht, S. 2003. First report of blight on Buxus spp. caused by Cylindrocladium buxicola in Belgium. Plant Disease. 87:1539-1539.

Crous, P.W., Phillips, A.J.L., and Wingfield, M.J. 1991. The genera Cylindrocladium and Cylindrocladiella in South Africa, with special reference to forest nurseries. South African Forestry Journal 157: 69-85.

Crous, P.W., Phillips, A.J.L., and Wingfield, M.J. 1992. Effects of Cultural Conditions on Vesicle and Conidium Morphology in Species of Cylindrocladium and Cylindrocladiella. Mycologia 84: 497-504.

172

Crous, P.W., Groenewald, J.Z., and Hill, C.F. 2002. Cylindrocladium pseudonaviculatum sp nov from New Zealand, and new Cylindrocladium records from Vietnam. Sydowia 54: 23-34.

Cuomo, C.A., Guldener, U., Xu, J.-R., Trail, F., Turgeon, B.G., Di Pietro, A., Walton, J.D., Ma, L.-J., Baker, S.E., and Rep, M. 2007. The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317: 1400-1402.

Dart, N. 2011. Boxwood Blight: A New Disease of Boxwood Found in the Eastern U.S. Available from http://pubs.ext.vt.edu/PPWS/PPWS-4/Boxwood_Blight_pdf.pdf [accessed June 2012].

Daughtrey, M.L., and Benson, D.M. 2005. Principles of plant health management for ornamental plants. Annu. Rev. Phytopathol. 43:141-169.

DiGuistini, S., Liao, N.Y., Platt, D., Robertson, G., Seidel, M., Chan, S.K., Docking, T.R., Birol, I., Holt, R.A., and Hirst, M. 2009. De novo genome sequence assembly of a filamentous fungus using Sanger, 454 and Illumina sequence data. Genome Biol 10: R94

Diviacco, S., Norio, P., Zentilin, L., Menzo, S., Clementi, M., Biamonti, G., Riva, S., Falaschi, A., and Giacca, M. 1992. A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene 122: 313-320.

Douglas, S.M. 2011. Boxwood Blight- A New Disease for Connecticut and the U.S. Available from http://www.ct.gov/caes/lib/caes/documents/publications/fact_sheets/plant_pathology_and _ecology/boxwood_blight-_a_new_disease_for_connecticut_and_the_u.s.__12-08-11.pdf [accessed May 2012].

Doyle, J.J., and Gaut, B.S. 2000. Evolution of genes and taxa: a primer. In Plant Molecular Evolution. Springer. pp. 1-23.

Dyer, P.S., Furneaux, P.A., Douhan, G., and Murray, T.D. 2001. A Multiplex PCR test for determination of nating type applied to the plant pathogens Tapesia yallundae and Tapesia acuformis. Fungal Genetics and Biology 33: 173-180.

Earl, D., Bradnam, K., John, J.S., Darling, A., Lin, D., Fass, J., Yu, H.O.K., Buffalo, V., Zerbino, D.R., and Diekhans, M. 2011. Assemblathon 1: A competitive assessment of de novo short read assembly methods. Genome Research 21: 2224-2241.

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792-1797.

Edwards, K., Johnstone, C., and Thompson, C. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19: 1349. 173

Elmhirst, J.F., Auxier, B.E., and Wegener, L.A. 2013. First report of box blight caused by Cylindrocladium pseudonaviculatum (C. buxicola) in British Columbia, Canada. Plant Disease 97: 559-560.

Freeman, S., Katan, T., and Shabi, E. 1998. Characterization of Colletotrichum species responsible for anthracnose diseases of various fruits. Plant Disease 82: 596-605.

Gan, S., and Amasino, R.M. 1995. Inhibition of leaf senescence by autoregulated production of cytokinin. Science 270: 1986-1988.

Ganci, M.L., Benson, D.M., and Ivors, K.L. 2013. Susceptibility of commercial boxwood cultivars to Cylindrocladium buxicola, the causal agent of box blight. Phytopathology 103: 47.

Gardes, M., and Bruns, T.D. 1993. ITS primers with enhanced specificity for basidiomycetes- application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.

Garibaldi, A., and Gullino, M.L. 2007. Critical aspects in management of fungal diseases of ornamental plants and directions in research. Phytopathologia Mediterranea 46: 135-149.

Gehesquiere, B., D'Haeyer, S., Pham, K.T.K., Van Kuik, A.J., Maes, M., Hofte, M., and Heungens, K. 2013. qPCR Assays for the detection of Cylindrocladium buxicola in plant, water, and air samples. Plant Disease 97: 1082-1090.

Gorgiladze, L., Meparishvili, G., Sikharulidze, Z., Natsarishvili, K., and Davitadze, R. 2011. First report of box blight caused by Cylindrocladium buxicola in Georgia. New Disease Reports 23: 2044-0588.2011.

Gullino, M.L., Leroux, P., and Smith, C.M. 2000. Uses and challenges of novel compounds for plant disease control. Crop protection 19: 1-11.

Hagan, A.K., Olive, J.W., Stephenson, J., and Rivas-Davila, M. 2005. Comparison of fungicides for the control of powdery mildew on dogwood. Journal of Environmental Horticulture 23: 179.

Hagan, A.K., Akridge, J.R., and Rivas-Davila, M.E. 2001. Impact of application rate, treatment interval, and placement on the control of Phytophthora shoot blight on annual vinca with azoxystrobin. Journal of Environmental Horticulture 19: 163-165.

Hansen, M.A. 2009. Major diseases of boxwood. Available from http://pubs.ext.vt.edu/450/450- 614/450-614.html [accessed May 2012].

174

Haridas, S., Breuill, C., Bohlmann, J., and Hsiang, T. 2011. A biologist's guide to de novo genome assembly using next-generation sequence data: A test with fungal genomes. Journal of Microbiological Methods 86: 368-375.

Henricot, B., and Culham, A. 2002. Cylindrocladium buxicola, a new species affecting Buxus spp., and its phylogenetic status. Mycologia 94: 980-997.

Henricot, B. 2006. Box blight rampages onwards: The latest news on the spread and control of a devastating disease. Plantsman London 5: 153.

Henricot, B., Gorton, C., Denton, G., and Denton, J. 2008. Studies on the control of Cylindrocladium buxicola using fungicides and host resistance. Plant Disease 92: 1273- 1279.

Henricot, B., David, J., Ivors, K., Heungens, K., Spooner, B., Sierra, A.P., and Daughtrey, M.L. 2012. Proposal to conserve the name Cylindrocladium buxicola against C. pseudonaviculatum (Ascomycota). Taxon 61: 1119-1120.

Henson, J.M., and French, R.C. 1993. The polymerase chain reaction and plant disease diagnosis. Papers in Plant Pathology 31: 81-109.

Hsiang, T., and Baillie, D.L. 2004. Recent progress, developments, and issues in comparative fungal genomics. Canadian Journal of Plant Pathology 26: 19-30.

Hsiang, T., Yang, L., and Barton, W. 1997. Baseline sensitivity and cross-resistance to demethylation-inhibiting fungicides in Ontario isolates of Sclerotinia homoeocarpa. European Journal of Plant Pathology 103: 409-416.

Hsueh, Y.-P., and Heitman, J. 2008. Orchestration of sexual reproduction and virulence by the fungal mating-type locus. Current opinion in microbiology 11: 517-524.

Hudler, G.W., and Banik, M.T. 1986. Wound repair and disease resistance in stems of Pachysandra terminalis. Canadian journal of botany 64: 2406-2410.

Ivors, K. 2011. A new pest to the U.S. ornamental industry: the "box blight" pathogen. Available from http://www.mnla.org/files/u2/NC%20pest%20alert%20box%20blight.pdf [accessed May 2012].

Ivors, K.L., Lacey, L.W., Milks, D.C., Douglas, S.M., Inman, M.K., Marra, R.E., and LaMondia, J.A. 2012. First report of boxwood blight caused by Cylindrocladium pseudonaviculatum in the United States. Plant Disease 96: 1070-1070.

Jacobi, J. 2003. Growing boxwoods in Alabama. Available from http://www.aces.edu/pubs/docs/A/ANR-0222/ANR-0222.pdf [accessed June 2012]. 175

Jacobsen, B.J. 1997. Role of plant pathology in integrated pest management. Annual review of phytopathology 35: 373-391.

Kellis, M., Patterson, N., Endrizzi, M., Birren, B., and Lander, E.S. 2003. Sequencing and comparison of yeast species to identify genes and regulatory elements. nature 423: 241- 254.

Knight, S.C., Anthony, V.M., Brady, A.M., Greenland, A.J., Heaney, S.P., Murray, D.C., Powell, K.A., Schulz, M.A., Spinks, C.A., and Worthington, P.A. 1997. Rationale and perspectives on the development of fungicides. Annual review of phytopathology 35: 349-372.

Knogge, W. 1996. Fungal infection of plants. The Plant Cell 8: 1711.

Kronstad, J.W., and Staben, C. 1997. Mating type in filamentous fungi. Annual review of genetics 31: 245-276.

LaMondia, J.A. 2014. Fungicide Efficacy Against Calonectria pseudonaviculata, Causal Agent of Boxwood Blight. Plant Disease 98: 99-102.

Lievens, B., and Thomma, B.P.H.J. 2005. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practice. Phytopathology 95: 1374- 1380.

Li, R., Li, Y., Kristiansen, K., and Wang, J. 2008. SOAP: short oligonucleotide alignment program. Bioinformatics 24: 713-714.

Li, W., Metin, B., White, T.C., and Heitman, J. 2010. Organization and evolutionary trajectory of the mating type (MAT) locus in dermatophyte and dimorphic fungal pathogens. Eukaryotic cell 9: 46-58.

Lin, Y., Li, J., Shen, H., Zhang, L., and Papasian, C.J. 2011. Comparative studies of de novo assembly tools for next-generation sequencing technologies. Bioinformatics 27: 2031- 2037.

Mamza, W.S., Zarafi, A.B., and Alabi, O. 2008. Incidence and severity of leaf blight caused by Fusarium pallidoroseum on varied age of Castor (Ricinus communis) inoculated using different methods. Afr. J. Gen. Agric 4: 119-122.

Mardis, E.R. 2008. Next-generation DNA sequencing methods. Annu. Rev. Genomics Hum. Genet. 9: 387-402.

Martin, K.J., and Rygiewicz, P.T. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC microbiology 5: 28. 176

Martin, R.R., James, D., and Levesque, C.A. 2000. Impacts of molecular diagnostic technologies on plant disease management. Annual Review of Phytopathology 38: 207-239.

Mauchline, T.H., Kerry, B.R., and Hirsch, P.R. 2002. Quantification in soil and the rhizosphere of the nematophagous fungus Verticillium chlamydosporium by competitive PCR and comparison with selective plating. Applied and Environmental Microbiology 68: 1846- 1853.

McCartney, H.A., Foster, S.J., Fraaije, B.A., and Ward, E. 2003. Molecular diagnostics for fungal plant pathogens. Pest Management Science 59: 129-142.

Malinoski, M.K.C., L. David, and Bosmans, V.R. 2012. IPM Series: Boxwood. Available from http://www.wicknursery.com/images/5Boxwood.pdf [accessed June 2012].

Mendgen, K., Hahn, M., and Deising, H. 1996. Morphogenesis and mechanisms of penetration by plant pathogenic fungi. Annual review of phytopathology 34: 367-386.

Miller, J.R., Koren, S., and Sutton, G. 2010. Assembly algorithms for next-generation sequencing data. Genomics 95: 315-327.

Minoche, A.E., Dohm, J.C., and Himmelbauer, H. 2011. Evaluation of genomic high-throughput sequencing data generated on Illumina HiSeq and Genome Analyzer systems. Genome Biol 12: R112.

Moorman, G. 2012. Boxwood Diseases. Available from http://extension.psu.edu/pests/plant- diseases/all-fact-sheets/boxwood-...1 [accessed May 2012].

Mueller, D.S., Jeffers, S.N., and Buck, J.W. 2004. Effect of timing of fungicide applications on development of rusts on daylily, geranium, and sunflower. Plant Disease 88: 657-661.

Mumford, R., Boonham, N., Tomlinson, J., and Barker, I. 2006. Advances in molecular phytodiagnostics- new solutions for old problems. European Journal of Plant Pathology 116: 1-19.

Niemiera, A.X. 2012. Boxwood (Buxus species). Available from http://pubs.ext.vt.edu/2901/2901-1037/2901-1037_pdf.pdf [accessed June 2012].

Nilsson, R.H., Kristiansson, E., Ryberg, M., Hallenberg, N., and Larsson, K.H. 2008. Intraspecific ITS variability in the kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evolutionary bioinformatics online 4: 193.

Nowrousian, M., Stajich, J.E., Chu, M., Engh, I., Espagne, E., Halliday, K., Kamerewerd, J., Kempken, F., Knab, B., and Kuo, H.-C. 2010 De novo assembly of a 40 Mb eukaryotic 177

genome from short sequence reads: Sordaria macrospora, a model organism for fungal morphogenesis. PLoS genetics 6: e1000891.

Norman, D.J., and Strandberg, J.O. 1997. Survival of Colletotrichum acutatum in soil and plant debris of leatherleaf fern. Plant Disease 81: 1177-1180.

Oerke, E.C. 2006. Crop losses to pests. The Journal of Agricultural Science 144: 31-43.

Pacholko, K. 2012. Boxwood (Buxus). Available from http://gardening- time.blogspot.ca/2012/11/boxwood-buxus.html [accessed May 2012].

Paszkiewicz, K., and Studholme, D.J. 2010. De novo assembly of short sequence reads. Briefings in bioinformatics 11: 457-472.

Quail, M.A., Smith, M., Coupland, P., Otto, T.D., Harris, S.R., Connor, T.R., Bertoni, A., Swerdlow, H.P., and Gu, Y. 2012 A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC genomics 13: 341.

Relf, D., Appleton, B.L., Weidhass, J., and Wills, W.H. 2001. Boxwood in the Landscape. Virginia Cooperative Extension.

Richardson, H.W. 1997. Handbook of copper compounds and applications. CRC Press. Ridley, G. 1998. New plant fungus found in Auckland box hedges (Buxus). Forest Health News (77).

Rosenstraus, M., Wang, Z., Chang, S.-Y., DeBonville, D., and Spadoro, J.P. 1998. An internal control for routine diagnostic PCR: design, properties, and effect on clinical performance. Journal of Clinical Microbiology 36: 191-197.

Rosslenbroich, H.-J., and Stuebler, D. 2000. Botrytis cinerea- history of chemical control and novel fungicides for its management. Crop Protection 19: 557-561.

Rossman, A.Y., Samuels, G.J., and Lowen, R. 1993. Leuconectria clusiae Gen-Nov and Its Anamorph Gliocephalotrichium bulbilium with Notes on Pseudonectria. Mycologia 85: 685-704.

Roth, D.A., Griffin, G.J., and Graham, P.J. 1979. Low temperature induces decreased germinability of Cylindrocladium microsclerotia. Canadian Journal of Microbiology 25: 157-162.

Ruberson, J.R. 1999. Handbook of pest management. CRC Press.

178

Russell, P.E. 2005. A century of fungicide evolution. The Journal of Agricultural Science 143: 11-25. Saracchi, M., Rocchi, F., Pizzatti, C., and Cortesi, P. 2008. Box Blight, a New Disease of Buxus in Italy Caused by Cylindrocladium Buxicola. Journal of Plant Pathology 90: 581-584.

SAS. 2003. SAS 9.13 Edited by S. Institute, Carey, NC.

Schadt, E.E., Turner, S., and Kasarskis, A. 2010. A window into third-generation sequencing. Human Molecular Genetics 19: R227-R240.

Schoch, C.L., Crous, P.W., Wingfield, B.D., and Wingfield, M.J. 1999. The Cylindrocladium candelabrum species complex includes four distinct mating populations. Mycologia: 286- 298.

Shan, X.C., Cao, H.H., and Stanescu, M.H., T. 2013. Rapid detection of Cylindrocladium buxicola in boxwood using PCR. In Canadian Phytopathological Society Edmonton, Alberta.

Shi, F., and Hsiang, T. 2013. Pseudonectria buxi causing leaf and stem blight on Buxus in Canada. European Journal of Plant Pathology: 1-11.

Shi, F. 2011. Causal agent, biology and management of the leaf and stem disease of boxwood (Buxus spp.) School of Environmental Science University of Guelph Guelph.

Simon, L., Levesque, R.C., and Lalonde, M. 1992. Rapid quantitation by PCR of endomycorrhizal fungi colonizing roots. Genome Research 2: 76-80.

Simpson, J.T., and Durbin, R. 2011. Efficient de novo assembly of large genomes using compressed data structures. Genome Research 22: 549-556.

Snider, C.S., Hsiang, T., Zhao, G., and Griffith, M. 2000. Role of ice nucleation and antifreeze activities in pathogenesis and growth of snow molds. Phytopathology 90: 354-361.

Stanke, M., and Waack, S. 2003. Gene prediction with a hidden Markov model and a new intron submodel. Bioinformatics 19: 215-225.

Stanke, M., Steinkamp, R., Waack, S., and Morgenstern, B. 2004. AUGUSTUS: a web server for gene finding in eukaryotes. Nucleic Acids Research 32: W309-W312.

Thompson, J.D., Gibson, T.J., Plewniak, F.d.r., Jeanmougin, F.o., and Higgins, D.G. 1997. The CLUSTAL_X Windows Interface: Flexible Strategies for Multiple Sequence Alignment Aided by Quality Analysis Tools. Nucleic Acids Research 25: 4876-4882.

179

Tzung, K.-W., Williams, R.M., Scherer, S., Federspiel, N., Jones, T., Hansen, N., Bivolarevic, V., Huizar, L., Komp, C., and Surzycki, R. 2001. Genomic evidence for a complete sexual cycle in Candida albicans. Proceedings of the National Academy of Sciences 98: 3249-3253.

Urena-Padilla, A.R., Mitchell, D.J., and Legard, D.E. 2001. Oversummer survival of inoculum for Colletotrichum crown rot in buried strawberry crown tissue. Plant Disease 85: 750- 754. van Kan, J.A.L. 2006. Licensed to kill: the lifestyle of a necrotrophic plant pathogen. Trends in Plant Science 11: 247-253.

Varela, C.P., Penalta, B.G., Vazquez, J.P.M., and Casal, O.A. 2009. First Report of Cylindrocladium buxicola on Buxus sempervirens in Spain. Plant Disease 93: 670-670.

Vincent, M. 2009. Die Krankheiten des Buchsbaums. Available from http://www.agroscope.admin.ch/publikationen/einzelpublikation/index.html?aid=223&la ng=de&pid=9893 [accesssed May 2012].

Waard, M.A., Georgopoulos, S.G., Hollomon, D.W., Ishii, H., Leroux, P., Ragsdale, N.N., and Schwinn, F.J. 1993. Chemical control of plant diseases: problems and prospects. Annual Review of Phytopathology 31: 403-421.

Ward, E., Foster, S.J., Fraaije, B.A., and McCartney, H.A. 2004. Plant pathogen diagnostics: immunological and nucleic acid-based approaches. Annals of Applied Biology 145: 1-16.

Wei, C., and Brent, M.R. 2006. Using ESTs to improve the accuracy of de novo gene prediction. BMC Bioinformatics 7: 327.

White, T.J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18: 315-322.

Xu, J.-R., Peng, Y.-L., Dickman, M.B., and Sharon, A. 2006. The dawn of fungal pathogen genomics. Annu. Rev. Phytopathol. 44: 337-366.

Yoder, O.C., and Turgeon, B.G. 2001. Fungal genomics and pathogenicity. Current Opinion in Plant Biology 4: 315-321.

180

Appendices for Chapter 2 Appendix 2.1 Example of PROC GLM statement data first; input cultivar$ rep infection; cards; GG 1 4 GG 2 1.25 GG 3 3 GV 1 4 GV 2 3.5 GV 3 2.25 GM 1 1 GM 2 1.5 GM 3 2.75 Gmd 1 2.5 Gmd 2 3 Gmd 3 3.5 ; proc sort; by cultivar; proc glm; class cultivar; model infection= cultivar; means cultivar/LSD lines; run;

181

Appendix 2.2. Air temperature, total rain, total snow, and total precipiation from November 2012 until April 2013 at the Guelph Turfgrass Institute. Obtained from Environment Canada.

182

Appendix 2.3. Air temperature, total rain, total snow, and total precipiation at the Guelph Turfgrass Insititute from August 2013 until December 2013. Obtained from Environment Canada.

183

Appendix 2.4. Example of the temperature gradient in the soil between 5 cm, 10 cm, and 20 cm. Obtained from the University of Waterloo weather station.

184

S3 S1 S4 S2 S5 S3 S2

S5 S1 S4 S6 S1 S6 S4

S7 S2 S7 S6 S3 S5 S1

185

Appendix 2.6 Arrangement of burial samples for the 2013 fall trial at the GTI where there were four sampling dates with 3 replicate stakes per sampling date. Each stake had 3 bags containing leaf pieces infected with the isolate 12032 of C. buxicola. The bags were buried to 0, 10, and 20 cm. Stakes were placed in between four maple trees where the experimental design was completely randomized.

S3 S4 S2 S3 S2

S1 S1 S4 S4

S2 S3 S1

186

Appendix 2.7 BLAST results for ITS PCR product from the DNA extracted from colonies which resembled C. buxicola, isolated from symptomatic boxwood leaves.

>gb|HM749646.1| Cylindrocladium buxicola strain CB-KR001 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence Length=514 Score = 545 bits (295), Expect = 7e-152 Identities = 304/311 98%, Gaps = 1/311 (0%) Query 5 GTGAACATACCTGTTTCGTNCCCTCGGCGGTGTCCGGAAACGGCCCGCCAGAGGANCCAA 64 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| Sbjct 38 GTGAACATACCTGTTTCGTTCCCTCGGCGGTGTCCGGAAACGGCCCGCCAGAGGACCCAA 97 Query 65 CAAACTCTTTTGAATTTATAGTATCTTCTGAGTGaaaaaaaCAATAAATCAAAACTTTCA 124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 98 CAAACTCTTTTGAATTTATAGTATCTTCTGAGTGAAAAAAACAATAAATCAAAACTTTCA 157 Query 125 ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 158 ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT 217 Query 185 GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTC 244 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 218 GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTC 277 Query 245 TGGCGGNN-TGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGNGT 303 |||||| |||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 278 TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGT 337

187

Appendices for Chapter 3

Appendix 3.1. Sample script used to calculate assembly statistics

#Filename:N50.pl #/usr/bin/perl -w # from: http://seqanswers.com/forums/archive/index.php/t-2766.html # edited by Sajeet Haridas to include #contigs and filesize # USAGE perl n50.pl input > output use strict; my ($len,$total)=(0,0); my @x; my $countcontigs = 0; while(<>){ if(/^[\>\@]/){ $countcontigs = $countcontigs + 1; if($len>0){ $total+=$len; push @x,$len; } $len=0; } else{ s/\s//g; $len+=length($_); } } if ($len>0){ $total+=$len; push @x,$len; } @x=sort{$b<=>$a} @x; my ($count,$half)=(0,0); for (my $j=0;$j<@x;$j++){ $count+=$x[$j]; if (($count>=$total/2)&&($half==0)){ my $Filesize = -s "$ARGV" ; print "$ARGV, Filesize = $Filesize, N50 = $x[$j], Contigs = $countcontigs, "; # prints out input_filename, filesize, N50 and contigs $half=$x[$j] }elsif ($count>=$total*0.9){ print "N90: $x[$j]\n"; exit; } }

188

Appendix 3.2. Sample script used to create FASTA sequences from AUGUSTUS output

#Filename: get_gene.pl #!/usr/bin/perl # Creates fasta sequence files from the AUGUSTUS output. # Mario Stanke, 10.05.2007 # Modified by Vincent Huang, 2012/10/15 to give whole gene sequences including start, stop & introns # USAGE: perl getAnnoFasta.pl INFILE.GFF seqfile=ASSEMBLY.FA # infile.gff was the output from AUGUSTUS use strict; use Getopt::Long; my $usage = "getAnnoFasta.pl augustus.gff\n"; $usage .= " Makes a fasta file with protein sequences (augustus.aa)\n"; $usage .= " and one with coding sequences (augustus.codingseq)\n"; $usage .= " from the sequences provided in the comments of the AUGUSTUS output.\n"; $usage .= " These sequence comments are turned on with --protein=on and -- codingseq=on, respectively\n"; $usage .= "Options:\n"; $usage .= " --seqfile=s Input a fasta file with the genomic sequences that AUGUSTUS was run on.\n"; $usage .= " When this option is given, an additional file with the individual\n"; $usage .= " coding exon sequences (augustus.cdsexons) is output.\n"; $usage .= " and a file with the complete mRNA including UTRs (augustus.mrna) is output.\n"; my ($seqname, $trid, $status, $haveCod, $haveAA, $haveCDS, $haveRNA, $seq, $seqfile); GetOptions('seqfile=s'=>\$seqfile); if ($#ARGV != 0) { print $usage; exit; } my $separator = ";";

189

Calonectriamultiphialidica GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAAGGCGTCCTCCGGGTCG 548 Calonectrianaviculata GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 548 Calonectriahongkongensis GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTTCGGGTCG 531 Calonectriapacifica GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 549 Calonectriakyotensis GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 547 Calonectriaindonesiae GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 548 Calonectriacolombiensis GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 546 Calonectriacurvispora GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 548 Calonectriailicicola GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 486 Calonectriacanadensis GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCG 366 12001a_its1_d09 GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGAGCGTCCTCCGGGTCG 342 12013_ITS1 GCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGAGCGTCCTCCGGGTCG 353 ********************************* ******* *******

ITS311F 5’TGTTGGGGATCGGCAGA 3’

17 bp, Tm:63.6 C, Dimers at -108.7 C, GC%:58.8%

Calonectriamultiphialidica CGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 598 Calonectrianaviculata CGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 598 Calonectriahongkongensis CGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 581 Calonectriapacifica CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 599 Calonectriakyotensis CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 597 Calonectriaindonesiae CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 598 Calonectriacolombiensis CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 596 Calonectriacurvispora CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 598 Calonectriailicicola CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 536 Calonectriacanadensis CGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 416 12001a_its1_d09 CGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAG 392 12013_ITS1 CGCCGTCCCCCAAATTTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAT 403 *************** ********************************* Calonectriamultiphialidica TAATACACCTCGCTCTGGAGTCTCGGTGCGACCACGCCGTAAAACCCCCA 648 Calonectrianaviculata TAATACACCTCGCTCTGGAGTCTCGGTGCGACCACGCCGTAAAACCCCCA 648 Calonectriahongkongensis TAATACACCTCGCTCTGGAGTCTCGGTGCGACCACGCCGTAAAACCCCCA 631 Calonectriapacifica TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCA 649 Calonectriakyotensis TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCA 647 Calonectriaindonesiae TAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGCCGTAAAACCCCCA 648 Calonectriacolombiensis TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCA 646 Calonectriacurvispora TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCA 648 Calonectriailicicola TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCA 586 Calonectriacanadensis TAATACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTAAAACCCCCA 466 12001a_its1_d09 TAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGGCCGTAAAACCCCA 442 12013_ITS1 TAATACACCTCGCTCTGGAGTCTCGGCGCGGCCACGCCATAAAA-CCCCA 452 ************************** *** ***** * *** ***** ITS419R 3’ CCAGAGCGAGGTGTATTAA 5’

Bp: 19, Tm: 57.4 C, GC%: 47.4%, Dimers at -93.1 C

190

Appendix 3.4. List of 34 fungal genomes used to compare to the predicted gene set of C. buxicola to locate unique genes within the C. buxicola genome.

Acremonium alcalophilum Alternaria brassicola Aspergillus niger Botrytis cinerea Colletotrichum gramicola Chaetomium globsum Coccidiodes immitis Cryphonectria parasitica Epichloe Festucae Fusarium graminearum Fusarium oxysporum Fusarium verticilloides Grosmannia clavigerum Gaeumannomyces aminis Giberella moniliformis Mycospharella fijiensis Magnaporthe oryzae Magnaporthe grisea Magnaporthe poae Nectria haematoccoca Neurospora crassa Neurospora discrete Neurospora tetrasperma Podospora anserina Sporotrichum thermophile Sclerotinia sclerotiorum Trichoderma atroviride Thielavia terristris Trichoderma reesei Trichoderma virens Verticillium alboatrum Verticillium dahlia Verticillium longisporum Volutella Buxi

191

Appendix 3.5. Sample script used to split a multi-record BLAST output file into individual records

# FILENAME: split_parse_bp.pl # DATE: 2010/9/26 # split a multi-record BLAST output file into individual records and parse it # use strict; # use warnings; # define variables and initialize my @line; my $line; my @record; # read multi-record file into array as individual records # by resetting read-until = record-separator characters; $/="BLASTN"; # This starts every BLAST record print "query,length,matches,hit1,hiteval1,identity,hit2,hiteval2,hit3,hiteval3,hit4,hiteval4 ,hit5,hiteval5\n"; @line = <> ; # read in each record and split it by newline into an array foreach $line (@line) { @record = split (/\n/,$line); # reset record separator character; $/="\n";

192

Appendix 3.6. Sample script used to retrieve FASTA files from a list of FASTA headers.

#Filename: BP_RetrieveListfromFasta.pl #Created on: 2011/02/24 #Usage: perl BP_RetrieveListfromFasta.pl fasta.file list.file #Takes the list of fasta headers, checks the fasta file for those headers and retrieves those entries #Generates a second file called fasta.file.out --> This is to preserve the original file use strict; use warnings; use Bio::SeqIO; my $file = $ARGV[0]; open LIST, $ARGV[1]; my @list = ; close LIST; chomp @list; my $switch; my $stream = Bio::SeqIO->new( -file => $file ); my $writer = Bio::SeqIO->new( -file => ">$file.out", -format => 'Fasta' );

#Calls the sequence up while ( my $seqobj = $stream->next_seq() ) { #grab gene id of the current fasta sequence in memory my $checkgene = $seqobj->display_id; #print "$checkgene\n"; $switch = 0; #checks against the array of headers to delete foreach my $listname (@list) { #if found if (

193

Appendix 3.7. Sample script used to take specified text formatted BLAST files to then return e- values and bit scores for the top two hits

#Filename: BP_BlastParse-nomeanid.pl #Created on: 2010/08/20 #Usage: perl BP_BlastParse-noid.pl blast.file >output.file #Takes the specified textformatted BLAST files and returns e-values and bit scores for top two hits #Should work for all flavours of BLAST use strict; use warnings; use Bio::SearchIO; print "Query\tQuery Length\t# of Hits\tSubject01\tSubject Length\t# of HSPS\tBits01\tE-value01\tSubject02\tBits02\tE-value02\n"; #Open blast file in text format my $SearchIO = Bio::SearchIO->new(-file=>$ARGV[0],-format=>"blast"); #Pull each blast result while( my $result = $SearchIO->next_result ){ #because the top hit is the best hit, the scalar 'i' acts as a counter and allows retrieval of top 2 hits my $i=0; #print out query name, length and number of hits #queries that do not return hits will also be printed printf("%s\t%d\t%d\t", $result->query_name, $result->query_length, $result->num_hits, ); #pull each blast hit

194

Appendix 3.8. Sample of script used to eliminate sequences which were less than 100 aa or 300 bp from a file.

#Filename: fasta_filterminlength.pl # 2010/7/21 written by Sajeet Haridas # Edited by Vincent Huang 2012/12/03 # perl script to filter fasta file to remove sequences greater than a specified cut off size # Usage : filter_filterminlength.pl minsize inputfile > outputfile if ($ARGV[0] =~ /^\d+$/ ) { $minlength = $ARGV[0] ; } else { die "I can only accept positive integers for maximun size.\n" ; } open (INFILE1, "<$ARGV[1]") or die "Cannot open input file $ARGV[1] .\n" ;

$ToPrint = ""; $SeqLen = 0; while() { $currentline = $_ ; chomp $currentline; if ( $currentline =~ /^>/ ) { if ($SeqLen >= $minlength) { print "$ToPrint\n" unless (length($ToPrint)==0); } $ToPrint = "$currentline\n"; $SeqLen = 0; }

195

Appendix 3.9. Primer design #1 from an apparently unique gene from the genome of C. buxicola isolate 12034.

AGCTCATTAACTCGCTAGAGCGGGAAAGCGGCAATGCCCTGAATGCAGAAATCGAGGCGC AGGCGCAACAGGAAAAGGCATTCTTGGCAGGGACAGAGGCAGAGGCGGCCCAGCAACAGG CTGTAGATGCCGCCGCGCTAACAGAACAAGTACACAACGCCTTCAGTACACTTGGAGAGA TCAGCGCTGCTATAGATGATGCACAAGCGGGCGCAGATGAAGCATCTAGCTACGAAGCAG CAGCCGCCAACAACGCCGACGAAGCGGACACAATTGCAGCTGCGGCCGTGGCAAAGGCGG GCGATGTAGCCATCAACGCTCGGGCAAGAGTAAACGCTGCGCAGAGACAAGTCAGATCAC AAGCCACAGCGGCCGCAGGAGCAGCCAAGGCAGCTCGAGACGCACTATCTGATGCCCAAG ACGCCCTTTTAACCGCCAATGATGCGGCTGAGCTTGCATCCTCCGCGTCGACTTTCGATG CGGCACAAGCAGCTGCCCAAACAGTCCTGACTGCCAAGGACACGGCTTTTGCCAGAGCAA GCCTCGGCGCAGGTCACCCGAGCAGAGCAGGCGGCGACGGCAGCAGAGGTAGCAA AATCGACACTGGAGGATGCATCCGCCCAAGTAACCGCCGTAATAACCGCCAGCGAAAGCA AGGACGACGCACAACGCTTGTTTGACAACACTGATCTGTTGGTCCAGCAAGCGGACCAAG ACAAAGCAGACGCGGCCCGGTTCGCAGACGAGGCAGAAAGTTACGCAGATGGGGCAGAAG TGTTAGCTGCTGGAAGTCAGGATGCCATCGTGGCAAGGCAAGCCGCAACGAATGCACGAG CGCAATATGGAGTAGCAGACCAAAGCACTGCTGCAGTCCACACCGCATATGACAGAGCGT CTTACGGGATTGTAGTTATTCAGACAAAGTTCAGCGAAGCGTTAGACGCGCAAACCTCGG CAGAGGCTCAAGCGGCCTTGGCAGGGATGAATCAAAATTATAATTCAGTCCTTAAGCCAA ACGCAGATTCGGCCCAAACGCAGCGAAATATGGTGGCCAACGCGCTGAATGCCGTGCTGG AGTCTAGAGATGTAGCATCCAACGCTTATGACCGGATCCCCAAATGA

Forward: UG-391F

CAGCTCGAGACGCACTATC

19 bp, Tm: 59.8°C, GC%: 57.9, dimers -39.8°C,

Reverse: UG-875R

ACACCGCATATGACAGAGC

Reverse complement

GCTCTGTCATATGCGGTGT 19 bp, Tm: 59.6°C, GC% 52.6, dimers at -55.6°C,

196

Appendix 3.10. Primer design #2 from an apparently unique gene from the genome of C. buxicola isolate 12034.

ATGACGACTGCTGTGGAAGAAGTTCTGCACGATCACGAGCCCATTGGAAAGCATATGCCA CTCACTCTACTACGCGGTAACCAAACCCTCGAGGACGAGCATGAGCATGGGCAAGGCCTA TTGGTTGTGGCAGCTCCTGAAGATGATGAAACTCTAGAGCCAAGCGATGAGCACTCAATG GCTTCCCAAAACACACAGTCTGATGTGCGTTCTCATCAAGTACCCGCTCAAAGCCACGCT TGTGTCGTTGAAGAAGAGCCCGGGGCTCGGGGGCTCATTTCGGAGCTGCCGTCTGAGGCT GAAGTTGAACATACTCCTGTTCTTCCTGTTCAAGCACCTGCAGTTGGGCAGCTTCAGAAA GATGGCGATATAGACTCAGAGGCGTATGCTGGAAATTTTGTCAGAGATACTCAAGCGGCT TTCGTGCCTCTAATGCTTGAACAATCGCCGAGGAGGTACACCTTGCCAAAGGTCGAGAAG CCACCTACTGTCTTGATGCCTCCTAGAAGGCAACCTCCTCCTAGGACCGTGATATACCGA CAACACGTTCCCATGGGCGTTTCGACAGCACCATCTGTTCGTGCTCCAGGTCCTGTGGAA GCTAAACAAGACCTTTCAACCGAGCGAGAGTTTCAAGCTGAGCGACAACTGCAAGTTGAT AGAGAGTTGCAATCCGAGGAAGTGCTGCGGGCTGAGCGAGCGATGAAGGCCAAGGAAGAA ATACATGGAGAATTTGCTCGAGCGGATCCTTTCTCTGTCGAGCGGCCTTCTCCGCTGAAT ATCCAAAGGCGCGCCGTCCCTCAGCCCTTGAATATACGTCCCGGGACAGAGGTGTACATG AAAGACCCAATCTATAAGCCTGTGACCAGCAAGCCTTCTGACACCAGCTCAGCCCATGGG CTCTCGGACGAGGCAAGCCAATCATCCAGAGCACCTTTTATGTCAGACTTTAA

Forward Primer UG-19F

GAAGTTCTGCACGATCACG

19 bp Tm: 60.1°C, GC%: 52.6%, dimers at -87°C, internal loops at

-83.8°C

Reverse Primer UG-429R

TCTAATGCTTGAACAATCGC

Reverse Complement

GCGATTGTTCAAGCATTAGA

20 bp, Tm: 60.6°C, GC%:40, dimers at -133.1°C, internal loops at

-79.7°C 197

Appendix 3.11. Primer design #3 from an apparently unique gene from the genome of C. buxicola isolate 12034

ATGATAAATAGCCTCGAATTGCTGATGCCGAATTTCGCCAGCGCCGACCTTGGCAGCATA GTTCTCAGGTGCCCCCGGGAAGCCGACCCAAAATTGATCGCCGCAGCCACGGCCCCACAC GATCCCATATACGCTGCTACTCTCTGCGGAAACTTTGGATACGTGAAATGGAAGCTTAGG AAATCGCGTGTGGATCCAGAGGTAATCAGTATGGACCTTTTACTACACTGTTTTCTATAT GCATGCAAAGGTGACCCGTCCGACATAAAAGATATGGTGGAGGTGATTATTACTCACGGA AACTTCGGGCCCAATGCAATATCGAGTGCCGGCATAATCGAACTAAATGAGCAGGAAACT GAAGCCAAAAGAGGAACCAAACTTGCGAGCCTAGCCGTATGGTGGCATCTCCTTGTGTCT TGTTACAGGTGGGGCAATCGCGAAAGAAGCAATTGGGAAATTATATTGGAGAAATATCTC GAGCATGGAGCCGACCCATACTTCGAGCTTCGGGCAAGCTTTGGCCCAACAGACTTGAGA CACAATGCCCTCTGGTCATATGCTCGCGGCGGAGGCATGTGCCAAATTACACTGATTCTT GGCAAAGAAAAAAAGGAGAAATTAGTCGAATTCCCAACTCTCAGCGCATTTACTTCAAGC GAGTCCTTTCCGTCACTTTCAAGTTATATTCAATCACTGAACCTTGAAAACGAATACCGG CTCTTGGAGCTTGTGCGGCGCAACATGGGGATTGTCGATGGAGCCGGAGAGGACGTTGAC ACTAAGACTCACGAGTTGGAACAGCATGAAGCAATCGGCCCTCTCGCATACGGCAGCGTC TCAAACGACAGGGATTTGATGGCTAGCAACGTGGAATGCACCAAGGATGAGACTACTTCG AGGCGGAAATCTGCCCCAATCTCACCCAAAATACCCAGACTTCCGCTTAATCTGTTGGGG ATTCTGTTTAGTAAGTTTTTTGACCGTCACGTATCCTGAATGGAATTTACAATGCATATT GATACATTCCAGGTGCTATTCTTGCTGTTTTTATAGCATGGGTGTTCGCAAATTAG

Forward Primer UG120-F

CGATCCCATATACGCTGCTA

20 bp, Tm: 63.3, GC%: 50, dimers @ -108.7°C

Reverse Primer UG575-R

GCATGTGCCAAATTACACTGA

21 bp, Tm: 63.5°C, GC%: 42.9, hairpin loops at 0°C, dimers @ -

103.6°C, bulge loops @ -58.8, internal loops at -61.2°C

198

Appendix 3.12. Primer design #4 from an apparently unique gene from the genome of C. buxicola isolate 12034

CGATCCCATATACGCTGCTA

20 bp, Tm: 63.3, GC%: 50, dimers @ -108.7°C

Reverse Primer UG765R

CGGAGAGGACGTTGACACT

Reverse complement

AGTGTCAACGTCCTCTCCG

19 bp, Tm: 61.2°C, GC%: 57.9 dimers @ -84.3°C

199

Appendix 3.13. Primer design from the MAT1-2 region of C. buxicola

CATTCTATCTCAGATCTGAACTTCGTTAATCCTCCTTGAAACCCAGAAACCAGCCATTCATAGA AGCTCCTGAATGTTGGTCAGCGGTGTTTAGTATGCAACTAACTCACATTTCGTGTCTTGTGGAC ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNACTAACTCACATTTCGTGTCTTGTGGACAGACGCTGGAGGCCCAACTTTTGTTTGTT GTCGAAACGGATTGGGGCGTCGTAGAGGTTTAAGAAACCTCGACACTAGCAGGAGCAGTCGCTT CGTCGTTGGAGTCATCATTGACTGCAGACGTAGCAGAAGTATTTCCAGCAGTTCCGTCTGCTGG GGCGTCCTGGGTAACACCTCGGCGTCTTCTCTCGGATGGTCGACGAGGTCGGTATTTGTAGTTG GGATGCTTCTTGATGAGCTCAGCCTTAATCTCATCTGCCATAAGTTTGTACTTCTTTCGCATTT CGGGCGTTTCCATATTCCAGGCACGGCCAAGAACCATCGCTGAGAGAAGTTAATAAAAGATGAA ATGCCAGAAGTGGATGAAGACTCACAAATCTCGCTGTTTGTAATTTGGGGGTTGGCCTGCTTCA GAATTCGGTGGCGGTCCTTGCGGTACAGGATGTATGCGTTGGGAGGGCGAGGAATCTTCAGGGG CTTCTCTGGCTCAGCAGGAGAAGGATTGGAAAGATAGGCAAAAGTGCTTGCGGGGCGCTTCACC CAAATCGCCTCGCCAGAGGTAACGTGATGGATGAGCATTCCGGAGCCAGCGAGAAAAAATCGAG GTGGGCCAAGATAGAAACGGTCGCTACCAGTACCATCACGGCAATACATGACATTCTCGGCGAT GTGCCCCCTGAAACAACTCAGCTTGGTAGGACAGATTTTGAAACTAAAAACTTACATGAACTTG AGAGCAATGAAGTTCTTGGCACCGTCATCAAGCTGACGGTAGAAATCGCCCTCGAGGCAAACGA CATAGCCA Forward: MAT2-812F

CGAGGTCGGTATTTGTAGTTGG

22 bp, Tm: 66.3°C, GC%: 50, dimers at -115.2°C, internal loops at -58.3°C

Reverse MAT2-1353R

GAAGTTCTTGGCACCGTCATC

Reverse Compliment

GATGACGGTGCCAAGAACTTC

21bp, Tm: 66.1°C, GC%: 52.4%, Dimers @ -125.3, Bulge Loops @ -

78.8, Internal Loops @ -74.2

200

Appendix 3.14. Primer design from the MAT1-1 region of C. buxicola atggcgacgagagctaaccttatgcaacatttgtccgccctcacaactgaggagctattagcat ttcttgacgatgaagctttctttgcgcttgctacgaagtactttgaaaaacatcccgataactt cgacgcaaatgagtccatgaacgatgttgatggaggcgcttctggcagcccccaagctcaagaa aatgccaccgaaaccatttcgcctcgccctaagcgtcctctcaatgcgtttatggcttttcgca cctctacctaaagattttccctgatgttcagcagaaaaccgcttcaggcttcttgaccacgctc tggagcagggagccttaccgcaacaagtgggctttgatcgccaaagtttactccttcgcaaggg atgaggttggtaaagggaacatctccctggcatgctttctcggcctctgctgtcccatcatgaa gattatggaccctagtgtctatcttactactcttggctgggccattcaggaagacgagaatggt tcccagaaactgatccaagattcacctgtcaacaatgaccacctccaaagtgaaccaactccaa ccacagaaatcgaactcctccaggctgtccttgatactggatacctttcccagcagggtattgc actcatggctcgcttgaacgcaaacaacaacgggatcatgacaacttctcgggtcccagctgag acaccccgtctgatcacccaacaaaagatcgactattgccatctacttgccaccgacccagtac aagcagcaagggacttacttgggcctcactacaacgaagatgtccttcgagctttgggtgtccg taccattcagatcgatgacctagaatccatcccctacaacatgcttcaggcacctcagccggat ccaattcagttctataactacactgaggccgagaacagtctcactcaagaccgagcgtttcagc tagagacggtccagctgccgatcccattgacatcgacagtccgtttgatatcgatgccataatc ggatacagacagtcagagggtgatcgaactgcagatctcccgcatggcgaggcttacaaccccg gtagagatttccacttcggaaatatt

Forward Primer:MAT-431F ctgctgtcccatcatgaagatta

Tm: 66.4°C, 23bp, GC%: 43.5, hairpin loops at 0°C, dimers at -58.3°C, bulge loops @ -69.5°C, and internal loops at -86.0°C

Reverse Primer: MAT-866R ctcagccggatccaattcag

Tm: 66.9°C, 20 bp, GC%:55.5, dimers @ -32.3°C

201

Appendix 3.15. Sample script used to retrieve genes found only in one C. buxicola isolate but not the other when the predicted genes from two C. buxicola isolates were compared

#!/usr/bin/perl use warnings; #14.01.06 #Script to grab all of the genes that are not found from a pred. gene vs pred. gene comparison

#Script use: ./find_not_found.pl blast_outfile evalue query_genes #Where: # blast_outfile is the blast outfile (NOTE: blast job should be run using -m 9 to produce a tabular output) # evalue is the e-value cutoff (e.g. for e-50 or smaller type 50) # query_genes is the genes (in fasta format) that were used to query the first genome

open ($BLAST, "$ARGV[0]"); open ($FASTA, "$ARGV[2]"); $e_cutoff = $ARGV[1]; open ($OUT_LIST, "+>$ARGV[2].not_found.$e_cutoff.list"); open ($OUT_FASTA, "+>$ARGV[2].not_found.$e_cutoff.fa"); %found = (); while (<$BLAST>) { chomp $_; unless ($_ =~ /\#/){ @line = split(/\t/, $_); $evalue = $line[10]; if ($evalue =~ /0.0/) { $evalue =~ /0.(\d+)/; $temp = $1; if ($temp == 0) { $evalue = 0; } } elsif ($evalue =~ /\d+e-\d+/) { $evalue = /\d+e-(\d+)/; $evalue = $1; }

$name = $line[0]; $name =~ /g.*_(nt\d+)/; $name = $1; if (($evalue >= $e_cutoff) || ($evalue == 0)) { $found{$name} = $name; } else { print "for $name evalue is $evalue which is less than $e_cutoff\n"; } } }

202

Appendix 3.16. Sample script used to organize BLAST results according to e-value

#!/usr/bin/perl #14.01.07 LJ

#Script to compare list of "not found" genes to blast results #Script use: ./compare_list_to_blast.pl blast_results evalue list_of_genes #Where: # "blast results" is the blast results for the 1-e-100 "not found" genes vs. the genome # evalue is the desired evalue cutoff (e.g. 50) # list_of_genes is the list of genes that were NOT found at a different evalue threshold (e.g. 50) open ($BLAST, "$ARGV[0]"); open ($LIST, "$ARGV[2]");

$e_cutoff = <$ARGV[1]>; open ($NOT, "+>$ARGV[2].not_found_blast.$e_cutoff"); open ($FOUND, "+>$ARGV[2].found_blast.$e_cutoff");

%found = (); while (<$BLAST>) { chomp $_; unless ($_ =~ /\#/) { @line = split(/\t/, $_); $line[0] =~ /.*_(nt\d+)/; $name = $1;

$evalue = $line[10];

if ($evalue =~ /0.0/) { $evalue =~ /0.(\d+)/; $temp = $1; if ($temp == 0) { $evalue = 0; } } elsif ($evalue =~ /\d+e-\d+/) { @eval = split(//, $evalue); $evalue = ""; for ($i=3; $i<=$#eval; $i++) { $evalue = "$evalue" . "$eval[$i]"; } $evalue = abs($evalue); } if (($evalue >= $e_cutoff) || ($evalue == 0)) { $found{$name} = $name; } else { }

} } while (<$LIST>) { chomp $_; 203

Appendix 3.17. Complete atpB and rbcL genes with the spacer region between for Phoenix dactylifera

Phoenix dactylifera ATP synthase epsilon subunit (atpE) gene, partial cds; ATPsynthase beta subunit (atpB) gene, complete cds; and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast genes for chloroplast products

5’ 3’ 368 1864 2660 3993 Spacer Region atpB rbcL 1865 2659

204

Appendix 3.18. Alignment of species closely related to Buxus for the redesign of chloroplast primers cp_atpB-1 and cp_rbcL-1

Forward Primer

Phoenix ACAGTATCTCGACTCTTAACTACCAAAGCGTTATAAATATTAGGCATCTT 1750 Didymeles AGAGTATCTCGACCTTTAACTACTAGAGCGTTGTAAATATTAGGCATCTT 83 Buxus ACAGTATCTCGACCCTTAACTACTAGAGCGTTGTAAATATTAGGCATCTT 83 Pachysandra ACAGTATCTCGACCCTTAACTACTAAAGCGTTGTAAATATTAGGCATCTT 83 Myrothamnusflabellifolia GCAGTATCTCTACCCTTAACTACCAGAGCGTTGTAAATATTAGGCATCTT 83 Myrothamnusmoschata GCAGTATCTATCCCCTTAACTACCAGAGCGTTGTAAATATTAGGCATCTT 1295 Aextoxicon ACAGTATCTCGACTCTTAACTACCAGAGCGTTGTAAATATTAGGCATCTT 83 Cercidiphyllum ACAGTATCTCGACCCTTAACTACCAGAGCGTTGTAAATATTAGGCATCTT 83 ******* * ******** * ****** ***************** Phoenix GCCCGGGGGAAAAACGACATCCAGTACTGGGCCAATAATTTGAGCGATAC 1800 Didymeles ACCGGGGGGAAAGGCTACATCCAGTACTGGACCAATGATTTGAGTGATAC 133 Buxus GCCTGGGGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 133 Pachysandra GCCCGGGGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 133 Myrothamnusflabellifolia GCCCGGGGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 133 Myrothamnusmoschata GCCCGGGGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 1345 Aextoxicon GCCTCGAGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 133 Cercidiphyllum GCCCGGGGGAAAAGCTACATCCAGTACCGGACCAATGATTTGAGCGATAC 133 ** * ***** * *********** ** ***** ******* *****

Old ACATCKARTACKGGACCAATAA New AGTACCGGACCAATGATTTG Primer Information

Old cp_atpB-1 ACATCKARTACKGGACCAATAA Tm: 49.1°C, 22 bp, GC%: 31.8

New 103_ATPF AGTACCGGACCAATGATTTG Tm: 61.5°C 20 bp, GC%:45, hairpins @ 0°C, dimers @ -47.9°C, internal loops @ -79.7°C

Reverse Primer

Phoenix GAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATT 2724 Buxus GAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATT 1031 Pachysandraprocumbens GAAACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATT 49 Sarcococca GAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATT 55 Nelumbo GAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAGATT 65 Exbucklandia GAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATT 65 * ******************** ********************** ***

Old AACACCAGCTTTRAATCCAA New AAAGCTGGTGTTAAAGATTACA

Primer Information

Old CP_rbcL-1: AACACCAGCTTTRAATCCAA New 1056_rbcLR AAAGCTGGTGTTAAAGATTA Tm: 59.6, 22bp, GC%: 31.8, hairpins @ 0, dimers @ -79.4, bulge loops @ -92.1, and internal loops @86.8

205

Appendix 3.19. Synteny of genes surrounding the MAT1-1 and MAT1-2 genes

APN2 MAT1-2 SLA2

1688 bp 2414 bp 6544 bp

APN2 MAT1-1 SLA2

1688 bp 2414 bp

7207 bp

206

Appendices for Chapter 4 Appendix 4.1. Example of SAS PROBIT statement used to analyzed EC50 values for seven different fungicides

* FILENAME: 121023_buxicola; * DATE: 2012/10/23; * Precede comments with an asterisk, and end with semicolon; data temp; options pagesize=80 linesize=70; infile cards; * infile cards expandtabs; * infile cards dlm='09'x missover; * dlm is delimiter and '09'x is the ascii symbol for tabs, however if the tab is not set to 9; * spaces in the native system, then this will misread the data; input fungic $ isolate $ rep conc Oct03 Oct11; diam = (Oct11 - Oct03); output; * these are measurements of the diameter (cm) including the plug; * Fungicide Isolate Rep # Concentration(µg/ml) 121003 121011; cards; Banner 12001 1 0.01 1.5 4 Banner 12001 2 0.01 1.9 4.7 Banner 12001 3 0.01 1.6 4.7…. ; run; data temp; set; * the command SET tells SAS to bring in the last data set which was * named by the DATA command. The default set (when no set is * specified) is the most recent data set. SET names can be specified.; number = 1; if conc = 0 then delete; * get rid of the 0 ppm values since they're in the denominator calculations for response = inhibition. I've also run the job including the 0 ppm values (with transform lconc=log10(conc+.0001) and found the results to be the same; lconc=log10(conc); * take the log of concentration, note that if the 0 values were still in the data set, one should add the next nonzero value e.g. 0.0001 so that one doesn't have problems with log(0); * the divisor of radmean was from the 0 ppm value for each isolate; * this following part of the SAS program is stored in a spreadsheet so 207

that it can be changed easily to replace the isolate names and the growth rate on unamended PDA which is the denominator for radmean; if isolate = "12001" then response = 1 - (diam/ 3.23); if isolate = "12013" then response = 1 - (diam/ 2.76); if isolate = "12015" then response = 1 - (diam/ 3.50); if isolate = "12018" then response = 1 - (diam/ 3.56); if isolate = "12176" then response = 1 - (diam/ 3.43); if response <= 0 then response = 0; * this resets all stimulated (non inhibitory) responses to 0; run; proc sort; by isolate fungic; run; proc probit log10; by isolate fungic; model response/number=conc /lackfit inversecl itprint; run;

208

Appendix 4.2. Example graph of concentration vs. response for the fungicide Banner Maxx

(which contains 14.3% propiconazole). The 50% inhibition values were visually estimated from this graph.

209