Post-Transcriptional Regulation of Gene Expression by Rod1
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
CEP41 As an ASD Gene Ashok Patowary 1,Soyeonwon2,Shinjioh2,Ryanrnesbitt1, Marilyn Archer1, Debbie Nickerson3, Wendy H
Patowary et al. Translational Psychiatry (2019) 9:4 https://doi.org/10.1038/s41398-018-0343-z Translational Psychiatry ARTICLE Open Access Family-based exome sequencing and case- control analysis implicate CEP41 as an ASD gene Ashok Patowary 1,SoYeonWon2,ShinJiOh2,RyanRNesbitt1, Marilyn Archer1, Debbie Nickerson3, Wendy H. Raskind1,4, Raphael Bernier1,JiEunLee2,5 and Zoran Brkanac1 Abstract Autism Spectrum Disorder (ASD) is a complex neurodevelopmental disorder with a strong genetic component. Although next-generation sequencing (NGS) technologies have been successfully applied to gene identification in de novo ASD, the genetic architecture of familial ASD remains largely unexplored. Our approach, which leverages the high specificity and sensitivity of NGS technology, has focused on rare variants in familial autism. We used NGS exome sequencing in 26 families with distantly related affected individuals to identify genes with private gene disrupting and missense variants of interest (VOI). We found that the genes carrying VOIs were enriched for biological processes related to cell projection organization and neuron development, which is consistent with the neurodevelopmental hypothesis of ASD. For a subset of genes carrying VOIs, we then used targeted NGS sequencing and gene-based variant burden case-control analysis to test for association with ASD. Missense variants in one gene, CEP41, associated significantly with ASD (p = 6.185e−05). Homozygous gene-disrupting variants in CEP41 were initially found to be responsible for recessive Joubert syndrome. Using a zebrafish model, we evaluated the mechanism by which the 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; CEP41 variants might contribute to ASD. We found that CEP41 missense variants affect development of the axonal tract, cranial neural crest migration and social behavior phenotype. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Supplemental Material Table of Contents
Supplemental material Table of Contents Detailed Materials and Methods ......................................................................................................... 2 Perioperative period ........................................................................................................................... 2 Ethical aspects ................................................................................................................................... 4 Evaluation of heart failure ................................................................................................................. 4 Sample preparation for ANP mRNA expression .................................................................................. 5 Sample preparation for validative qRT-PCR (Postn, Myh7, Gpx3, Tgm2) ............................................ 6 Tissue fibrosis .................................................................................................................................... 7 Ventricular remodeling and histological tissue preservation ................................................................ 8 Evaluation of the histological preservation of cardiac tissue ................................................................ 9 Sample preparation and quantitative label-free proteomics analyses .................................................. 10 Statistical methods ........................................................................................................................... 12 References ........................................................................................................................................ -
Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer
diagnostics Review Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer Shunsuke Kato Department of Clinical Oncology, Juntendo University Graduate School of Medicine, 2-1-1, Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; [email protected]; Tel.: +81-3-5802-1543 Abstract: The prognosis of patients with solid tumours has remarkably improved with the develop- ment of molecular-targeted drugs and immune checkpoint inhibitors. However, the improvements in the prognosis of pancreatic cancer and biliary tract cancer is delayed compared to other carcinomas, and the 5-year survival rates of distal-stage disease are approximately 10 and 20%, respectively. How- ever, a comprehensive analysis of tumour cells using The Cancer Genome Atlas (TCGA) project has led to the identification of various driver mutations. Evidently, few mutations exist across organs, and basket trials targeting driver mutations regardless of the primary organ are being actively conducted. Such basket trials not only focus on the gate keeper-type oncogene mutations, such as HER2 and BRAF, but also focus on the caretaker-type tumour suppressor genes, such as BRCA1/2, mismatch repair-related genes, which cause hereditary cancer syndrome. As oncogene panel testing is a vital approach in routine practice, clinicians should devise a strategy for improved understanding of the cancer genome. Here, the gene mutation profiles of pancreatic cancer and biliary tract cancer have been outlined and the current status of tumour-agnostic therapy in these cancers has been reported. Keywords: pancreatic cancer; biliary tract cancer; targeted therapy; solid tumours; driver mutations; agonist therapy Citation: Kato, S. Tumour-Agnostic Therapy for Pancreatic Cancer and 1. -
UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12 -
Datasheet: VPA00331KT Product Details
Datasheet: VPA00331KT Description: PRPF19 ANTIBODY WITH CONTROL LYSATE Specificity: PRPF19 Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 2 Westerns Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse, Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation 20μl Rabbit polyclonal antibody purified by affinity chromatography Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN ) Stabilisers 3 Immunogen KLH-conjugated synthetic peptide corresponding to aa 4-33 of human PRPF19 External Database Links UniProt: Q9UMS4 Related reagents Entrez Gene: 27339 PRPF19 Related reagents Synonyms NMP200, PRP19, SNEV Page 1 of 3 Specificity Rabbit anti Human PRPF19 antibody recognizes PRPF19, also known as PRP19/PSO4 homolog, PRP19/PSO4 pre-mRNA processing factor 19 homolog, nuclear matrix protein 200, nuclear matrix protein NMP200 related to splicing factor PRP19, psoralen 4 and senescence evasion factor. The PRPF19 gene is the human homolog of yeast Pso4, a gene essential for cell survival and DNA repair (Beck et al. -
Miasdb: a Database of Molecular Interactions Associated with Alternative Splicing of Human Pre-Mrnas
RESEARCH ARTICLE MiasDB: A Database of Molecular Interactions Associated with Alternative Splicing of Human Pre-mRNAs Yongqiang Xing1, Xiujuan Zhao1, Tao Yu2, Dong Liang1, Jun Li1, Guanyun Wei1, Guoqing Liu1, Xiangjun Cui1, Hongyu Zhao1, Lu Cai1* 1 School of Life Science and Technology, Inner Mongolia University of Science and Technology, Baotou, 014010, China, 2 School of Science, Inner Mongolia University of Science and Technology, Baotou, 014010, China a11111 * [email protected] Abstract Alternative splicing (AS) is pervasive in human multi-exon genes and is a major contributor to expansion of the transcriptome and proteome diversity. The accurate recognition of alter- OPEN ACCESS native splice sites is regulated by information contained in networks of protein-protein and Citation: Xing Y, Zhao X, Yu T, Liang D, Li J, Wei G, protein-RNA interactions. However, the mechanisms leading to splice site selection are not et al. (2016) MiasDB: A Database of Molecular fully understood. Although numerous databases have been built to describe AS, molecular Interactions Associated with Alternative Splicing of Human Pre-mRNAs. PLoS ONE 11(5): e0155443. interaction databases associated with AS have only recently emerged. In this study, we doi:10.1371/journal.pone.0155443 present a new database, MiasDB, that provides a description of molecular interactions Editor: Ruben Artero, University of Valencia, SPAIN associated with human AS events. This database covers 938 interactions between human splicing factors, RNA elements, transcription factors, kinases and modified histones for 173 Received: November 19, 2015 human AS events. Every entry includes the interaction partners, interaction type, experi- Accepted: April 28, 2016 mental methods, AS type, tissue specificity or disease-relevant information, a simple Published: May 11, 2016 description of the functionally tested interaction in the AS event and references. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
32-3099: PRKAB1 Recombinant Protein Description
9853 Pacific Heights Blvd. Suite D. San Diego, CA 92121, USA Tel: 858-263-4982 Email: [email protected] 32-3099: PRKAB1 Recombinant Protein Alternative Name : AMPK,HAMPKb,5'-AMP-activated protein kinase subunit beta-1,AMPK subunit beta-1,AMPKb,PRKAB1. Description Source : E.coli. PRKAB1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 293 amino acids (1-270 a.a.) and having a molecular mass of 32.8 kDa. The PRKAB1 is fused to a 23 amino acid His Tag at N- Terminus and purified by proprietary chromatographic techniques. 5'-AMP-activated protein kinase subunit beta-1 (PRKAB1) hinders protein, carbohydrate and lipid biosynthesis, in addition to cell growth and proliferation. AMPK is a heterotrimer comprised of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK acts via direct phosphorylation of metabolic enzymes, and longer-term effects by phosphorylation of transcription regulators. PRKAB1 is a regulator of cellular polarity by remodeling the actin cytoskeleton; most likely by indirectly activating myosin. Beta non-catalytic subunit acts as a scaffold on which the AMPK complex compiles, through its C-terminus that joins alpha (PRKAA1 or PRKAA2) and gamma subunits (PRKAG1, PRKAG2 or PRKAG3). Product Info Amount : 5 µg Purification : Greater than 85% as determined by SDS-PAGE. The PRKAB1 protein solution (0.5mg/ml) contains 20mM Tris-HCl buffer (pH 8.0), 0.15M NaCl, Content : 10% glycerol and 1mM DTT. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. -
Human Kinome Profiling Identifies a Requirement for AMP-Activated
Human kinome profiling identifies a requirement for AMP-activated protein kinase during human cytomegalovirus infection Laura J. Terrya, Livia Vastagb,1, Joshua D. Rabinowitzb, and Thomas Shenka,2 aDepartment of Molecular Biology and bDepartment of Chemistry and the Lewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544 Contributed by Thomas Shenk, January 11, 2012 (sent for review December 29, 2011) Human cytomegalovirus (HCMV) modulates numerous cellular (7). Thus, the connections between AMPK activity and metabolic signaling pathways. Alterations in signaling are evident from the changes during HCMV infection have remained unclear. broad changes in cellular phosphorylation that occur during HCMV We confirmed the requirement for AMPK during infection, infection and from the altered activity of multiple kinases. Here we and we show that an AMPK antagonist, compound C, blocks report a comprehensive RNAi screen, which predicts that 106 cellular HCMV-induced changes to glycolysis and inhibits viral gene kinases influence growth of the virus, most of which were not expression. These studies argue that AMPK or a related, com- previously linked to HCMV replication. Multiple elements of the pound C-sensitive kinase is an essential contributor to metabolic AMP-activated protein kinase (AMPK) pathway scored in the screen. changes initiated by HCMV and provide unique insight into As a regulator of carbon and nucleotide metabolism, AMPK is poised potential antiviral strategies. to activate many of the metabolic pathways induced by HCMV infection. An AMPK inhibitor, compound C, blocked a substantial Results portion of HCMV-induced metabolic changes, inhibited the accumu- HumanKinomeScreenIdentifies Putative Effectors of HCMV Replication. lation of all HCMV proteins tested, and markedly reduced the We conducted an siRNA screen of the human kinome to perform an production of infectious progeny. -
Profiling Data
Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8