. , 1 − P. edulis mol Trolox Wong A number of µ 0.12 g kg b 11 ± The predominant Brix, total sugar, ◦ 17 Phenolic compounds 9 and 139.69 1 2012 Society of Chemical Industry − c and 409.13–586.70 1 − 0.17 g kg cultivars Purple, Frederick, Yellow, Pink, 16 ± – 12 Muta Harah Zakaria, P. edulis a Department of Aquaculture, Faculty of43400, Agriculture, UPM Universiti Serdang, Selangor Putra Darul Malaysia, Ehsan, Malaysia Correspondence to:Science and Fisheries, ShiamalaPutra Faculty Devi Malaysia of Bintulu Agriculture Ramaiya,[email protected] Sarawak and Campus, Food Department 97008 Sciences, of Bintulu, Universiti Sarawak. Animal E-mail: Department of Animal Science andSciences, Fisheries, Universiti Faculty Putra of Malaysia, Agriculture 97008, and Bintulu, Food Sarawak The sugar content in fruit can influence the physiochemical ∗ a a b nutrients content including micronutrients such as minerals,phenolic fiber, compounds and ascorbic acid content. properties(e.g.pH,totalacidity,microbialstability)andcanprovide valuable information on food wholesomeness. are secondary metabolites naturally constituent in many fruitswell and known for their antioxidantrole potential, food in quality prevention and of their human diseases, and reducing the risk of sugars in passion fruitwhich juices are are of economic sucrose,acid importance. glucose In and content passion fructose, fruit isaffects the lower the ascorbic characteristics compared of to fruit quality. the sugar content and it studies on other plantstrawberries, species oranges) (e.g. indicate cashew the apple, importancefor of sweet human micronutrients cherry, health. spp.) cultivars: (we also tested this cultivar’s mesocarp). . Sucrose content was significantly higher in juice of non-vine-ripened Passiflora In Peninsular 3 , 342.80–382.00 mg gallic acid equivalent L . Ascorbic acid, TPC and TAA were significantly higher in vine-ripened Purple and Harvesting time 1 − 5 Japar Sidik Bujang, P. maliformis ∗ a and P. quadrangularis had significantly higher total sugar, 142.85 Other important passion depends on the cultivar and ripeness. It enters the international flavicarpa Quantitative information 2 However, this fruit is still 1 f. and 4 5,6 P. edulis ) cultivars Passiflora P. edulis P. maliformis P. quadrangularis : 1198–1205 www.soci.org , , Demands for passion fruit juice are increasing and Muhd Arif Shaffiq Sahrir 93 10 (Pink) and a – ; ranges were 0.22–0.33 g kg 7 2013;

P. edulis ascorbic acid; HPLC; passion fruit cultivars; sugars; total antioxidant activity; total phenolic content flavicarpa f. P. edulis

P. edulis

, respectively. Based on principal component analysis (PCA) and cluster analysis, the main variables – 2012 Society of Chemical Industry 1

The physical and chemical composition of passion fruit can Passiflora − c not only because of the juice’s exotic flavor but also its essential J Sci Food Agric INTRODUCTION The passion fruit is anbeauty exotic of fruit its that flower is and popular fruity for aroma. the startling BACKGROUND: The levelsdetermined of in sugars, fruit juices ascorbic from seven acid, passion total fruit ( phenolic content (TPC) and total antioxidant activity (TAA) were Abstract ( Shiamala Devi Ramaiya, and total antioxidant activity in passion fruit Sugars, ascorbic acid, total phenolic content (wileyonlinelibrary.com) DOI 10.1002/jsfa.5876 Research Article Received: 16 May 2012 Revised: 3 August 2012 Accepted article published: 20 August 2012 Published online in Wiley Online Library: 2 October 2012 vary according to cultivar, environmental factors including climate and soil condition, and agricultural practices. cultivated in Peninsularsuitable growing Malaysia conditions and owing increase in to demand. the prevalence of Malaysia, passion fruit has been grownHighlands in since pre-war Johor days and and the fruit production Cameron inhas these regions been affected byexpansion a in viral commercial disease which planting. discouraged further trade mainly in the form offruit juice. The increased world production from of passion 1.27 approximately million 1.05 Mt million inconsumer Mt of 2010, passion in with fruit in 2005 Brazil the as to world. the larger producer and concerning the fruit’s contentacids of and sugars, phenolics ascorbicthe is acid, the authenticity organic most andmanufacturing. important quality factor in index verifying for fruits used in food fruit producing countries are Ecuador,New Zealand, Colombia, South Peru, Africa Australia, and the state of Hawaii. Yellow and postharvest aresensory also and factors nutritional that quality. may affect the fruit’s L P. edulis RESULTS: Purple and Yellow Sing King respectively, than other cultivars. Glucose and fructose contentand were Yellow higher in juice from vine-ripened fruits of Purple, Frederick CONCLUSIONS: Glucose, fructose, sucrose, ascorbicabove acid, variables TAA in juices and of TPC were quantified in passion fruit juices. Variation of the Keywords: glucose, fructose, ascorbic acid, TPC and TAA – formed the characteristics for the group comprising Purple and Yellow fruits of

1198 1199 ; 1 − 21,31 were 1 0.0283 − = 0.0316 mg = ,LOQ C, respectively. 1 ◦ The absorbance 0.0727 mg kg − for 15 min at room = 21 ,LOQ . g 1 . The temperature of − 300 mm Sugar Pak I 1 × − et al with some modification × 99.5% (Sigma, Steinheim, 30 . wileyonlinelibrary.com/jsfa ≥ 0.0085 mg kg 0.9998, limit of detection (LOD) 0.996). Analysis was performed et al = = = 2 2 0.0095 mg kg R R ( and Macoris = 1 − 31 . and Silva pulp. 29 0.9999, LOD . 1 et al , limit of quantitation (LOQ) − = 1 2 − et al R 0.9999, LOD L were used per injection. µ = 2 R ) to determining the concentrations. 1 − ;fructose: 1 − 0.0218 mg kg m pore size membrane filter (Waters-Millipore Corp., Milford, MA, Calibration standards For quantitative examinationstandard of solutions sugar of content HPLC-grade in the juices, temperature and filtered through Whatman no.filtered 2 extracts filter were paper. used The for measurement of TPC and TAA. mg kg HPLC components and operating conditions The complete HPLCwas system equipped (Waters within-line Corp., a Milford, Waters Waters MA,refractive degasser Delta index USA) detector. A AF 600 Waters 2707introduce pump autosampler connected a was sample used controller, automatically to with into an thechromatography inlets. a Sugar-Pak An ion I exclusion Waters column (Watersseparated Corp.) 2414 the was used soluble to column sugars. was The packed with 6.5 ain microparticulate calcium cation-exchange form. gel Thethe juices column were at isocratically separated a through flow rate of 0.4 mL min Germany) sucrose, glucose and fructose werephase. prepared Calibration in standards mobile ranging from 0.05 to 1.0 g L analysis. Prior to injectionµ all juices were filteredUSA) through and 10 a 0.45 Determination of TPC TPC was determined by using the Folin–Ciocalteu (Merck)as method, used by Asami using a direct titration method. AscorbicStation, acid NJ, (Merck, Whitehouse USA) was usedwas as titrated standard. against The iodine filtered solution juice untilcolor the (25 developed. endpoint The mL) blue-black volume of iodinethe solution endpoint was required recorded. to Titrations reach were performedfor in triplicate standards and filtered juice of passion fruit. Extraction for TPC and TAA Passion fruit pulpcontaining 70% (4 methanol–water (v/v). mL) The samples were vortexed wasand placed in extracted an ultrasonic with bathThe extracts at 40 were room then temperature mL centrifuged for at 1640 60 solution min. readingsweretakenat740nmona1100Seriesspectrophotometer (UNICO, Fairfield, NJ, USA). Quantificationusing a of calibration curve prepared TPC with gallic was acid (Merck) performed in standard the range 50–500 mg L the detector and column was set at to 40 and 70 = Sugar compounds in juicesretention times were with identified standard sugars by andmeasurement quantified comparing using by Waters peak their Empower area Pro software. Determination of ascorbic acid content Juices were extracted from fresh passion fruit pulp, filtered through Whatman no. 2 filter paper (Camlab,ascorbic Cambridge, UK) acid and used analysis. for Ascorbicto acid Suntornsuk was determined according glucose: in triplicate andequivalent the (GAE) L results were expressed as mg gallic acid kg made for each sugar (sucrose: C P. ◦ 20 cultivars www.soci.org 17,24,25 C until − ◦ calcium 28 (Purple), 1 Passiflora However, − 2012 Society of Chemical Industry (Pink) and c for 5 min and Several studies Passiflora 21,26,27 g P. edulis sodium hydroxide Eventhoughawide × 1 fresh weight. P. edulis − 1 19 22,23 1,19,21,26 − The antioxidant activity in Sims. and about 25 kg (16 fruits) 18 P.edulis 30–60 fruits) of vine-ripened fruits Brix using a hand-held refractometer ∼ ◦ and : 1198–1205 P. maliformis 93 Brix), pH and total titratable acidity (TTA) were harvested randomly from 10 plants for ◦ were picked from a farm at Sarikei, Sarawak. The 1,11,20,21 for another 10 min to separate the juice from 2013; g × (Frederick), (Yellow) were collected from an orchard at Ba’kelalan, flavicarpa The juices were then diluted at the proportion of 1:50 with flavicarpa f. f. 11 Thesugarsinpassionfruithavebeeninvestigatedbyresearchers The aim of this study was to determine the sugars, ascorbic edulis fruits were brought to theand laboratory cleaned. and Fruits immediately inspected were cutout with in a half spoon. The and pulps were the separated2.0 pulps from mm the were pore seeds using size scooped a sieve. The pulps, either fresh or stored at Sarawak, while non-vine-ripened fruits of P. edulis P. quadrangularis each cultivar at theBintulu passion Sarawak fruit Campus farm, (UPMKB) Universitifruit-bearing season Bintulu, Putra in Sarawak, Malaysia April–June duringP. of the 2011. edulis Vine-ripened fruits of edulis from various geographical locations using different approaches on the most important commercial passion fruit cultivars: J Sci Food Agric HPLC sugar analysis Sample preparation Pulp (5 mL) was centrifuged twice at 2500 at 20000 pulp. (based on the fruit’s skin color and firmness) of Fruit harvest and storage Two to four kilograms ( EXPERIMENTAL More attention has alsoand been antioxidant drawn activity to in ascorbic passion acid, fruit. phenolic Chemical composition and antioxidant activity of cancer and cardiovascular disease. range of studies haveacid been contents, published few on have made the usechromatography sugar of and the (HPLC) high-performance organic technique liquid for fruit juice analysis. (ATAGO Corp., Tokyo, Japan). Thea pH pH meter value (Mettler-Toledo, was Greifensee, measuredamount Switzerland). using TTA of is total acida in standard the alkaline juice solution as of determined 0.1 by mol titration L using mobile phase (filtered ultrapure water with 0.0001 mol L passion fruit is notablefunction since in the free radical fruit scavenging is activity. rich in compounds that acid, total phenolic content andjuices total from antioxidant passion fruit activity cultivars of toTherefore, fruit evaluating account their for chemical taste constituents differences. andactivity antioxidant can help inprocessing them understanding as juice the and other worth processed products. of these fruits in very little information on sugars,and ascorbic antioxidant acid, activity phenolic content iscultivars of available passion in fruit. the literature for various General juice content Total soluble solid ( were subsequently used for the various analyses described below. ethylenediaminetetraacetic acid) and kept refrigerated at 4 have highlighted a strongactivity correlation between (TAA) total and antioxidant total phenolic content (TPC). The extracted juices fromsolids content fruit by the pulps index of were refraction,solids pH analyzed and TTA. were for Total soluble soluble assessed as (NaOH)andexpressedasagcitricacidkg

< 0.05). P test, (Tukey’s significant statistically are (a–e) letter different the with row same the in Means

et al.

rxai . 181. 771. . . 3.5 5.3 8.1 16.3 17.7 11.7 11.8 9.6 Brix/acid

◦ 16–.9 11–.6 13–.1 07–.3 00–.5 17–.4 1.125)(2.75–3.39) (12.01–2.52) (1.72–2.04) (0.04–0.05) (0.78–0.93) (1.31–1.41) (1.19–1.36) (1.66–1.99)

: 1198–1205

oa irtbeaiiy()1.80 (%) acidity titratable Total 0.19a 3.03 0.12b 2.19 0.09b 1.88 0.01e 0.04 0.05d 0.88 0.03cd 1.37 0.05d 1.29 0.10bc ± ± ± ± ± ± ± ±

93

1.–80 1.–56 1.–75 1.–58 6070 1.–60 1.–22 (10.0–12.0) (11.0–12.2) (14.4–16.0) (6.0–7.0) (15.4–15.8) (15.0–17.5) (15.0–15.6) (16.2–18.0)

0.64b 10.7 0.37b 11.7 0.46a 15.2 0.29c 6.5 0.12a 15.6 0.76a 16.0 0.20a 15.2 0.53a 17.2 Brix) oa oul oi ( solid soluble Total

± ± ± ± ± ± ± ±

◦ 2013;

34–.6 33–.9 33–.6 37–.9 47–.9 33–.3 32–.6 (3.14–3.18) (3.23–3.26) (3.38–3.43) (4.72–4.79) (3.74–3.79) (3.39–3.46) (3.38–3.49) (3.47–3.56)

H3.51 pH 0.01e 3.16 0.01e 3.24 0.02d 3.40 0.02a 4.76 0.02b 3.76 0.02cd 3.43 0.03cd 3.43 0.03c ± ± ± ± ± ± ± ±

ri opnnsPl upPl upMscr upPl Pulp Pulp Pulp Mesocarp Pulp Pulp Pulp Pulp components Fruit

2.73.8 1.82.2 1.52.4 166–8.3 7.17.4 2.63.9 (32.23–41.92) (24.56–30.69) (70.11–76.24) (156.65–187.43) (18.65–21.34) (17.98–26.82) (24.87–35.98) J Sci Food Agric

uc egt()31.15 (g) weight Juice 2.80c 37.01 1.81c 27.99 1.80b 73.44 8.90a 171.53 0.81c 19.81 2.61c 22.96 3.29c ± ± ± ± ± ± ±

5.5186)(03–37)(48–77)(095–045)(2.6185)(46–86)(84.73–94.73) (64.63–68.69) (120.46–128.57) (1029.57–2014.58) (24.87–37.78) (30.34–53.70) (56.45–138.64)

ri egt()98.47 (g) weight Fruit 3.18b 88.41 1.22b 66.33 2.34b 124.39 94.43a 1528.74 3.79b 32.01 6.75b 42.34 10.68b ± ± ± ± ± ± ±

52–.2 43–.7 34–.2 1.91.8 63–.3 51–.1 (5.13–5.91) (5.14–5.71) (6.36–6.53) (11.79–12.88) (3.45–3.72) (4.32–4.87) (5.26–6.72)

0.25bc 5.63 0.18bc 5.36 0.05b 6.43 0.32a 12.36 0.08d 3.57 0.16cd 4.60 0.44b 6.11 Width ± ± ± ± ± ± ±

c)(.487)(.559)(.847)(07–51)(.890)(.961)(5.94–6.65) (5.69–6.12) (8.48–9.09) (20.72–25.11) (3.68–4.74) (4.65–5.93) (6.04–8.76) (cm)

ri ieLnt 7.84 Length size Fruit 0.21bcd 6.24 0.13bcd 5.92 0.18b 8.76 0.92a 22.54 0.33d 4.33 0.39cd 5.15 0.90bc ± ± ± ± ± ± ±

.mlfri .qaaglrsP edulis P. quadangularis P. maliformis P. (Frederick) edulis P. (Purple) edulis P. Variable flavicarpa f. edulis P. (Pink) edulis P. (Yellow)

ecito ftepsinfutcliasadterjuices their and cultivars fruit passion the of Description 1. Table ) 50 The and had .For 0.05) 33 values P. edulis < P. edulis www.soci.org SD Ramaiya 50 . The TTA P agreed with (Merck). The 2012 Society of Chemical Industry and Kelebek 1 flavicarpa 12.36 cm) and c − 32 . f. had significantly × P. maliformis , (Purple) was within et al P. quadrangularis flavicarpa and a lower amount of f. P. edulis mol Trolox L P. quadrangularis µ P. edulis Brix value reported by Kishore and Telesphore and He. was highest, at 156.65–187.43 ◦ , in which 11–15% of the fruit 23 P. edulis . 20 flavicarpa P. quadrangularis (Pink) and .The P. quadrangularis f. et al value, the higher was the antioxidant 0.02) was less acidic compared to its Brix) in juice from vine-ripened ◦ 50 ± (Purple) and P. edulis flavicarpa was slightly lower (13–16%) than the results 94.43 g were recorded in f. (Frederick), P. quadrangularis P. quadrangularis ± Passiflora edulis 0.02). P. edulis ± P. edulis P. edulis P. edulis (Yellow) were significantly higher compared with Brix), TTA, as well as sugars, ascorbic acid, TPC and in The experiment was performed in triplicate. DPPH radical Brix percentage than other cultivars. Of the juice extracted, ◦ ◦ (%). The lower the EC 22 24 . . 50 The total soluble solids ( lower TTA was greater in of our study. The mesocarp of TAA, were statistically analyzed using(SAS, SAS 9.0 Marlow, Windows UK). software analysis Means of were variance (ANOVA). compared Post using hoc single-factor Tukey’s test ( was performed if the ANOVA result was significant. EC wileyonlinelibrary.com/jsfa Sugar composition and content Sucrose, glucose andcomponents in fructose passion fruit werefor (Table the sucrose, 2). The glucose predominantmin, retention respectively; times and sugar (RT) the fructoseexperimental overlay section were of were shown sugar 10.3, in standards 12.7 Fig. described 1. and in The total 15.1 sugar was RESULTS AND DISCUSSION Description of passion fruit cultivars and theirTable juices 1 describes the various passion fruit cultivarsThe and their juice juices. yield of g. Simultaneously, larger fruit dimensionweight (22.54 1528.74 Determination of total antioxidant activity 2,2-Diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging activity Total antioxidant activity was determined using themethod based DPPH on (Merck) quantification of free radicalof scavenging activity the extracts described by Brand-Williams all cultivars, the pulpfruit, represented except 50–58% for of the weight of the was edible mesocarp. Withwith respect cultivars. to the juice, pH value varied et al scavenging activity was expressed as Statistical analysis Mean, standard errordetermination. and The range data weresolid for computed ( fruit for dimension, triplicate pH, total soluble activity. et al concentration of samples required to scavenge 50% DPPH (EC acidity was detected inand mesocarp TSS for of those found by Sema and Maiti. was determined by linearEC regression for the concentration and for TAA werecorrelation calculated by analysis linear wasbetween regression performed the analysis. above to variables Multiple and determinecomponent passion fruit relationships analysis cultivars. (PCA) Principal andagglomeration cluster method analysis by based dissimilarity–Euclidean oncarried distance) Ward’s out was using XLSTAT softwareobtain (Addinsoft, the New relationship York, between variables USA) and to cultivars. (Purple), P. edulis mesocarp pH value (4.76 juice (3.76 a significantly lower pH. The pH of (Pink) and the range obtained by Frank

1200 1201 ) and -1 )and 1 − (Purple) P. edulis 0.12a 0.17a 0.10b 0.31b 0.23c 0.07e 0.03d 0.08d , ± ± ± ± ± ± ± ± 35 P. edulis (45.13–47.27) (74.67–82.19) (56.96–57.86) (60.97–63.84) P. maliformis P. edulis (137.75–141.98) (139.33–144.86) (104.94–108.33) (106.27–116.96) ) or slightly greater In the passion fruits , with approximately 10 1.12 139.69 1.02 46.37 1.03 142.85 1.00 77.73 0.96 106.91 0.97 57.47 1.12 111.05 1.06 62.63 (Yellow), wileyonlinelibrary.com/jsfa fresh weight) flavicarpa 1 (Purple) juice: 1, sucrose; 2, glucose; − f. 0.12c 0.03c 0.67a 0.06a 0.02e 0.01e 0.03d 0.15b P. edulis P. quadrangularis Brix and pH values between 2.7 and ± ± ± ± ± ± ± ± ◦ ) content of glucose (36.37 g kg 1 P. edulis − ;11 33.72 31.32 58.61 64.65 16.17 14.65 (57.46–59.49) (15.61–16.48) (63.75–65.38) (32.11–36.04) (30.75–31.82) (14.47–14.91) (36.67–41.78) (21.51–22.54) 22.14 39.07 1 ). Among the examined cultivars, lower total − 1 (Purple). In addition, all the variables (Table 1) − 0.05). Passiflora edulis ) in concentration. A value above 1.03 indicates < P 0.02f 0.01f 0.11c 0.67a 0.09a 0.03e 0.03d 0.11b ± ± ± ± ± ± ± ± and mesocarp of P. edulis 1 180.0 g kg < 1.0 in juices of Purple, Frederick, Pink 1.06–1.12 in juices of Glucose/fructose ratio is also important in determining 17.14 14.15 33.73 65.68 66.33 23.42 (64.63–66.96) (16.72–17.46) (64.52–67.35) (32.28–35.84) (29.54–30.55) (13.91–14.67) (22.78–23.92) (42.26–45.85) 30.17 43.73 ∼ ∼ 34 Generally, glucose/fructose ratio is the key indicator for Sugar content in juice of fruit (g kg flavicarpa days after anthesis. Thisdetermination observation for was juice confirmed obtained from from sugar fruits of harvestedafter52daysofanthesis,wherethejuicepossessedtwice the sucrose (74.54 g kg determining the authenticity of citrus juice. the natural fructose content inexcess fruits. fructose Consumption may of cause foods fructose malabsorption. with examined in this studyglucose were within the range of standards e.g. sugar was recorded in fructose (34.42 g kg 3.8 to meet the qualitystandards). of passion fruit pulp (Brazilian legislation studied, the measured glucose/fructose ratios(ratio were almost equal half that of f. (ratio P. quadrangularis a higher glucose/fructose ratio as reported byRSK. the Dutch–German – 0.12f 0.02c 0.04a 0.02e 0.03d 0.02d 0.01b 0.06b for ± ± ± ± ± ± ± ± 20 cultivars www.soci.org (Purple) pointed P. edulis (9.87–10.41) (14.75–15.77) (12.72–13.43) (14.74–15.39) (44.73–46.06) (28.45–28.87) (16.71–18.43) (27.41–29.45) flavicarpa 23 (Yellow) at . Non-reducing sugar Reducing sugar f. 2012 Society of Chemical Industry c et al Passiflora . Higher glucose P. edulis 1 (Purple), − P.edulis P. quadrangularis , with glucose and P. edulis 1 − P. edulis ,respectively.Togetherthey 1 (Pink) and − (Yellow) and reported that in (Purple) and 23 . Sarikei Non-vine-ripened 28.64 UPMKB Vine-ripened 28.19 UPMKB Vine-ripened 17.08 UPMKB Vine-ripened 13.12 P.edulis 0.12gkg et al P. edulis ± a , P. edulis : 1198–1205 93 Frank flavicarpa 1 . (Purple) UPMKB Vine-ripened 15.11 (Yellow) Ba’kelalan Vine-ripened 15.33 (Pink) Sarikei Non-vine-ripened 45.51 (Frederick) UPMKB Vine-ripened 10.22 f. 2013; et al P. maliformis Sugar content of the different passion fruit cultivars 0.17and139.69 (Purple) grown in another country. Glucose comprised (a) HPLC overlay chromatogram of sugar standards. (b) HPLC chromatogram of sugar in ± , followed by fructose at 22.14–64.65 g kg 1 Sugars from mesocarp. − a CultivarPassiflora edulis Harvest site Ripeness stage Sucrose Glucose Fructose G/F ratio Total sugar (g kg Table 2. Means in the same column with different letters (a–f) are statistically significant (Tukey’s test, Passiflora edulis Passiflora edulis Passiflora edulis Passiflora maliformis Passiflora edulis Passiflora quadrangularis Passiflora quadrangularis (a) (b) 142.85 from Sarikei) where thehigher, sucrose ranging concentration from was 28.54 significantly to 46.06 g kg J Sci Food Agric Figure 1. 3, fructose. significantly higher in Chemical composition and antioxidant activity of out a marked higherand fructose content from of juices of sucrose non-vine-ripened compared fruits to harvested 55 glucose the glucose and fructoseharvested after content 60–80 in days juices ofwas anthesis, were whereas significantly the lower. higher sucrose A level in reversenon-vine-ripened trend fruit fruits (e.g., was observed in juices of the larger portion ofkg total sugar, with a range of 23.42–66.33 g P. edulis (Frederick), constituted approximately 80% ofBasically, the in TSS in the passion vine-ripened fruit fruits juice. – fructose tending to be substantially lower. Frank values are accompanied by higherlevel fructose obtained content. in The this glucose presentby study Janzantti was in the range as reported the reducing sugars content waslevel, larger compared confirming to the the sucrose data reported by Sema and Maiti 1 P 0 . P. = ± 43 ± r et al. 281.8 0.734) Brix ( et al ◦ > P. edulis FW) = juice and 1 r − : 1198–1205 for respectively) ,whichwere 93 1 1 0.67 and 277 1 havemoderate − − − ± P. quadrangularis and TAA of 300 2013; The mesocarp of 1 2.67a (1307.6–1376.0) 9.82a (1302.4–1964.9) 1.96d (409.13–500.62) 1.00d (489.50–586.70) 5.68b (888.40–986.86) 2.54b (876.58–964.88) mol Trolox L − 2.81bc (713.29–805.58) 1.91bc (755.24–816.37) µ ± ± ± ± ± ± ± ± flavicarpa f. mol Trolox L µ 21,26,27,40 mol Trolox kg mol Trolox L cultivars for reported TPC values of 0.817). Numerous studies cited µ µ J Sci Food Agric 21 = Passifloraquadrangularis . 9.82 P.edulis r 107 mg GAE L ± et al ± 15,42 1006.9 Passiflora > FW) TAA ( 1 ) was reported in fresh passion fruit pulp. (Pink)and 1 − were not available. Results of this present 0.05). − .Macoris < 0.598), while strong and negative correlation was respectively) as well as a weak antioxidant activity 1 0.05) for some of the variables related to chemical P 1 has slightly higher TPC and TAA than its juice. Non- − = − and TAA r < P.edulis possessed a lower TPC value (272.96 3.99a (354.50–368.40) 524.00 4.68a (342.80–382.00) 547.70 0.67d (271.90–275.50) 1352.30 3.56b (304.10–316.00) 749.70 1.54b (308.10–322.90) 927.00 . Using the same methodology, Janzantti P 1 1.00cd (276.00–279.50) 1685.00 1.20cd (280.40–284.60) 918.73 1.81bc (295.20–301.40) 778.34 2.67 and 1685.00 − ± ± ± ± ± ± ± ± ± 44 studied 14 exotic fruits in Mauritius, with fresh passion fruit P. maliformis 26 . 0.05). Sucrose content was not correlated with reducing and flavicarpa A positive and weak correlation obtained between TPC and mol Trolox kg content in passionbetween the fruit. sugars High and ascorbiccomplex positive acids interactions due correlation between to was the the common found organic and acids and sugars. stronger antioxidant activity.this Several relationship authors in have various studies. mentioned ascorbic acid ( found between TPC and TAA ( in the literature showed a similar pattern of strong correlation showing TPC values of 574 recorded TAA values of 1122.1 Correlation between chemical constituents of passion fruits A correlation matrix (Tablecorrelation ( 4) showed a significant and strong Glucose and fructose showedthem high and positive were correlation strongly between correlated to the total sugar and quadrangularis vine-ripened phenol amount and strong TAA. Comparative values for and study suggest that thein variation cultivars may and be ripenesslevel due of of antioxidant fruit. to present It theby in has genetics, difference fruits climate, been may development stages, be reportedalso cultivation strongly that the system influenced analytical and the method. (1352.30 and this could beglucose. related to the synthesis of ascorbic acid from < total sugar, butacid was content showed weakly strong correlated positive correlationvariables with and with moderately most TTA. correlated of with the The TTA,However, except ascorbic ascorbic for sucrose. acid was0.527). Ascorbic negatively acid correlated showed correlation with with pH glucose ( ( µ consistent with previous(5289.3 studies. mg In GAE contrast, L higher TPC level f. among the passionet al fruit cultivars. Using ABTS assay, Ramma P.maliformis 1.00 mg GAE L mg GAE L FW) TPC (mg GAE L 1 ± ± − and and mol µ 1 )than 1 200 20,36,37 21,31,40 1 − − .These ,which (Purple) www.soci.org SD Ramaiya P. edulis − cultivars 1 27 4 0.3 − − 0.99c (0.16–0.20) 310.93 0.72c (0.14–0.16) 277.00 0.72a (0.31–0.33) 362.00 0.35e (0.06–0.08) 281.67 0.73d (0.10–0.13) 317.30 0.82b (0.22–0.25) 298.00 0.71b (0.22–0.25) 361.73 0.94b (0.19–0.25) 272.96 ± 2012 Society of Chemical Industry 10 to obtain an ± ± ± ± ± ± ± ± c × P. edulis in fresh passion 40 P. quadrangularis P. quadrangularis . (Yellow) at 524 Passiflora 41 ) , respectively. 1 1 − − et al 4.68 mg GAE L mol Trolox L µ ± ). The mean ascorbic acid 1 P. edulis 32 mg GAE per kg, any food that has 15–30 mg − 38 ± and reported in the literature as 0.70 1 was lower (0.10–0.15 g kg − Vine-ripenedVine-ripened 0.15 0.22 Vine-ripened 0.07 at 362.00 mol Trolox kg respectively. Similarly, the strongest 20 Non-vine-ripened 0.18 . µ 0.73 g kg ) compared to other 1 1 − ± − a (Frederick) content of ascorbic acid was et al 0.4 . In general, a higher TPC value gave a and antioxidant activity (500 1 ± − P. edulis 41 ) P. mollissima . The ascorbic acid content of flavicarpa 1 mol Trolox L (Purple) showed the highest mean ascorbic acid 1 − f. (Pink) Non-vine-ripened 0.23 (Yellow) Vine-ripened 0.24 (Frederick) Vine-ripened 0.11 (Purple) Vine-ripened 0.32 0.72 g kg µ 1020 − P. edulis ± 27 , and between 0.16 and 0.20 g kg Ascorbic acid, total phenolic content (TPC) and total antioxidant activity (TAA) of the different passion fruit cultivars 1 which is an excellent source of ascorbic acid. 3.08 1 3.99 mg GAE L − − 39 P. edulis was two times higher than that obtained from ± ± 30 mg per serving is an excellent source of ascorbic acid. mol Trolox L 1 > µ − Sugar from mesocarp . Passiflora edulis Passiflora edulis Passiflora edulis Passiflora maliformis Passiflora edulis a CultivarPassiflora edulis Ripeness stage Ascorbic acid (g kg Table 3. Means in the same column with different letters (a–e) are statistically significant (Tukey’s test, Passiflora quadrangularis FW, fresh weight. Passiflora quadrangularis (Table 3). The significantly lower (0.11 antioxidant activity was observed in vine-ripened at 547 (Purple), juice reported by Sema TPC and TAA TPC was determinedFolin–Ciocalteu reagent. A by number of studies oxidation–reductionon have been reported the reactioncomponents response using in of samples such this as sugar reagent and ascorbic towards acid. other interfering wileyonlinelibrary.com/jsfa Thus correction value wasvalues determined following and deducted the from method TPC of Stella According to the Natural Food Hub, Ascorbic acid content Ascorbic acid content incultivars fresh was determined passion using fruit thejuice juice of iodine from titration different method. The content (0.32 was about three0.62–0.72 times g less kg than its juice content, which was The ascorbic acid content in the mesocarp of ascorbic acid can beacid; considered a very good source of ascorbic accurate result. The resultsratio provided of a 0.781 gallic and acid:ascorbic gallic acid acid:sugar ratio of 4.9 Trolox kg 1.96 361.73 TAA within the range 409.13–1964.90 was deducted from previousTAA TPC values values (Table varied 3).fruit between The cultivars TPC cultivars. ranged and The from TPC 271.90 to for 382.00 all mg passion GAE L 2.6 mg GAE kg content was similar to other data statedand in Yellow the literature passion for Purple fruit, which0.32 g mostly kg falling between 0.20 and gkg the results obtained in this study.concentration As a in reference, the ascorbic acid results were inconcerning accordance phenolic with content (610 the findings of other authors fruit. The highest phenolic contentPurple was observed and in Yellow vine-ripened

1202 1203 * * * * –had P. edulis (Purple) 0.380 0.095 0.382 0.456 0.410 0.651 0.817 1.000 Brix/acid − − − flavicarpa − − − − ◦ f. * * * * * flavicarpa P. quadrangularis f. P. edulis 0.391 0.188 1.000 0.598 0.456 0.760 0.775 0.685 (Purple) and 0.306 − − Passiflora edulis was the only group in the P. edulis wileyonlinelibrary.com/jsfa * * 0.396 0.168 * * (Frederick), P. edulis (Pink) and Brix, total and individual reducing 0.358 1.000 0.849 0.614 0.943 0.952 ◦ − (Pink) and P. edulis P. edulis * * * P. qudrangularis P. edulis . This group includes those with moderate 0.749 0.660 0.996 0.256 0.214 0.084 1.000 − − (Yellow) cultivars located at the positive site of this * * 0.213 0.247 0.734 0.652 − − P. maliformis P. edulis Based on PCA and cluster analysis there were no single specific * 0.051 0.087 0.209 was 21.38%. Ascorbic acid, TPC, CONCLUSION The main sugars (glucose,and fructose and quantified sucrose) in were passion identified fruit cultivars. Glucose and fructose sugars were positively connected to PC1. and PC1 were highly correlatedsuch as with sucrose and the TTA in abovewere correlated variables. with Variables the positivecorrelated with end PC1 of and PC2. PC2 (Fig. pH 2a). was negatively variablesthatcorrelatedwiththegroupingofpassionfruitcultivars (Fig. 2b). The seven cultivars were clusteredThe into first four main group groups. consisted of and amounts of total sugar,The and second group lower – antioxidant activity and TPC. ratio. The mesocarp of third cluster with the lowest values ofthe pH all value the was variables, less acidic except and that antioxidant activityFinally, was the moderate. forth group consisted of (Yellow); they had higher valuesTPC, of TAA and total ascorbic sugar, acid, glucose, and fructose, lower sucrose concentration. higher values of sucrose and TTA and a lower value of 0.351 0.216 0.436 15 14 − − cultivars www.soci.org 0.380). berries = * * * r 2012 Society of Chemical Industry 16,40 c 0.527 0.565 0.499 Passiflora also reported a − in passion fruit. 46 . 0.5571) was obtained in fruits from Ecuador, * et al 15,40,42 = 27 . r 0.853 0.936) in pulps obtained from − et al = 0.05. r < * P observed a strong negative correlation Brix TTA Ascorbic acid Sucrose Glucose Fructose Total sugar TPC TAA 0.568 ◦ 0.800) in studies of berries. − 21 . = : 1198–1205 r 93 et al (a) (b) . Other than passion fruit, a similar observation In the present study, the ascorbic acid content did 0.860) in pulp from an organic cultivation system. studied the influence of cultivation system on TAA 2013; = 21 13,45 . r Correlation matrix for all variables in fruit juice of passion fruit Macoris P. edulis (a) Plot of chemical sugars, ascorbic acid, TPC and TAA and other chemical content of passion fruit juice. Percentage in parenthesis represents et al 26 Brix 1.000 0.201 Ascorbic acidSucrose 1.000 0.302 1.000 TAA Glucose 1.000 TPC Fructose Total sugar TTA 1.000 Values in bold are significant at o pH 1.000 Table 4. Sample pH between TAA and TPC by Vasco J Sci Food Agric and cherries. the variation of each component. (b) Positions of PC score of seven passion fruit cultivars accordingbetween to PC1 and TAA PC2. *Mesocarp. andcontributor to TPC. the ThisMacoris antioxidant suggests activity that TPC is the main Figure 2. Chemical composition and antioxidant activity of has been reported for other fruits such as oranges, including andTPCinyellowpassionfruit.Theauthorsfoundastrongnegativecorrelation ( Moreover, a moderate correlation ( not contribute significantly to thefruit antioxidant juices as activity shown of by passion theThis weak is agreeable negative with previously correlation reported ( research, where ascorbic acid provided minor or no contributionin to fruits. the antioxidant activity an organic cultivation system and Kalt between TAA and ascorbic acid ( Principal component analysis PCA is a statistical technique in multivariateresults analysis. The of analyzed sugars, ascorbicpassion acid, fruit TPC, juice TAA by andaccounted PCA other for are variables 73.94% shown of of inpercentage Fig. total of 2. variance. total The PC1 first variance explained two the (52.56%) PCs high compared to PC2, which negative correlation ( + JSci JLiq Food et al. and + Am J Clin J Sci Food :121–130 :484–488 25&offset Food Chem 18 48 = : 1198–1205 ) extracts on Fruits 93 = &max J Agric Food Chem . [Online]. Available: = 2013; :703–725 (2001). Studies on Postharvest 36 :1421–1422 (1999). &count Passiflora alata 76 = J Food Sci Technol Passion Fruit Proc Florida State Hortic Soc J Food Compos Anal and :142–151 (2011). :849–855 (2002). 91 28 Sims). &format J Sci Food Agric = :25–30 (1995). JChemEduc . [11 September 2011]. 28 . Mississippi State University, Starkville, MS, = : 1806–1813 (2009). Status and Prospects of Passion Fruit Industry Int J Food Sci Technol &lfacet 8 = . [Online]. Available: http://ebookbrowse.com/ :1886–1891 (2012). Passiflora edulis J Sci Food Agric :187–192 (2009). 92 :2123–2141 (2000). (in press http://onlinelibrary.wiley.com/doi/10.1002/ Passiflora edulis :496–502 (2003). &qlookup 91 23 = 83 :259–265 (2011). Pak J Nutr (17th edn). Association of Official Analytical Chemists, J Pharm Biomed Anal :831–838 (2012). :748–753 (1993). Juices&man 128 .,JuicecomponentsandantioxidantcapacityoffourTunusuan 92 58 Official Method of Analysis of the Association of the Analytical + :816–823 (2008). :198–200 (1985). :1237–1241 (2003). 175&sort etal JH, Angenot Lof and passion fruit Franck ( T, Evaluation of antioxidant activity (2005). millennium’s health. Food Agric Nutr stimulated neutrophils and myeloperoxidaseChem activity assays. (2011). Quality of Passion Fruit pp. 1–9 (2006). of organic acids,capacity sugars, of phenolic orange juice compositions andMicrochem and J wine made antioxidant from a Turkish cv. Kozan. inositol in citrus juicesChromatogr by HPLC and a literature compilation. and vitamin C contents of common Mauritian exotics fruits. antioxidant capacities of111 major fruits from Ecuador. http://ndb.nal.usda.gov/ndb/foods/show/2409?fg determination of organic acidsexclusion liquid and chromatography. sugars in fruit juices by ion- Fruit in Northeast India status-prospects-of-passion-fruit-industry [13 November 2011]. of ripening stage andactivity cultivation and total system phenolic on compounds of theJ yellow Sci total passion Food fruit Agric antioxidant pulp. Chemists Gaithersburg, MD (2000). Quantitation of vitamintitration. C content in herbal juice using direct grapefruit juice98 from Florida. temperature on physico-chemical and sensorypassion attributes fruit of ( purple for iodometric titrations. total phenolic and ascorbicdried marionberry, acid strawberry and content corn of grownorganic using freeze-dried conventional, and and sustainable air- agricultural51 practices. phenolic composition of commercial extracts of sageLWT and rosemary. – Food Sci Technol cloudy passion fruit juice processing using pectolytic andenzymes. amylolytic G citrus varieties. = JSciFoodAgric jsfa.5740/pdf). MD, Variations inin Brazilian antioxidant savannah and properties harvested in of different seasons. strawberries grown Agric 19 Zeraik ML, Serteyn D, Dupont GD, Wauters JN, Tits M, Yariwake 18 Kaur C and Kapoor HC, Antioxidants in fruits and vegetables: the 23 Frank BM, Harvey EA, James OG and Silva JL, 24 Kelebek H, Selli S, Canbas A and Cabaroglu T, HPLC determination 25 Lee HS and Coates GA, Quantitative study of free26 sugars Ramma and AL, Bahorun myo- T and Crozier A, Antioxidant actions and phenolics 27 Vasco C, Ruales J and Eldin AK, Total phenolic compounds and 36 USDA, Agricultural Research Service. 17 Chinnici F, Spinabelli U, Riponi C and Amati A, Optimization of the 20 Sema A and Maiti CS, 21 Macoris MS, De Marchi R, Janzantti NS and Monteiro M, The influence 28 AOAC, 29 Suntornsuk L, Gritsanapun W, Nilkamhank S and Paochom A, 34 Rouseff RL and Martin SF, Sugar levels35 in Riby canned JE, single Fujisawa T strength and Kretchmer N, Fructose absorption. 22 Kishore K, Pathak KA, Shukla R and Bharali B, Effect of storage 30 Silva CR, Simoni JA, Collins CH and Volpe PLO, Ascorbic31 acid a standard Asami DK, Hong YJ, Barrett DM and Mitchell AE, Comparison of the 32 Brand-Williams W, Cuvelier ME and Berset C, Antioxidative activity of 33 Telesphore M and He Q, Optimization of processing parameters for 16 Tounsi MS, Wannes WA, Querghemmi I, Jegham S, Njima YB, Hamdaoui 15 Pineli LLO, Moretti CL, Rodrigues JSQ, Ferreira DB and Chiarello . L. var also www.soci.org SD Ramaiya J Sci Food L.) shoots. P. edulis L.) cultivars. 2012 Society of Chemical Industry ,ed.byValdez (Yellow) had c Citrus sinensis :233–254 (2004). J Food Comp Anal 47 LWT–FoodSciTechnol P. quadrangularis :996–1002 (2010). P. edulis :1855–1862 (2011). Prunus avium :179–186 (2004). 91 121 228 Origanum majarana . [Online]. Available: http://www. :11–16 (2011). BrazArchBiolTechnol Food Chem 24 (Purple) and :2530–2537 (2011). JMembrSci J Sci Food Agric 46 Passion fruit P. edulis ) during storage. :1526–1536 (2006). Passion Fruit Culture in Malaysia. Fruit Research Branch J Food Comp Anal 86 :127–130 (2011). :511–518 (2012). Food Industrial Processes: Methods and Equipment process of reconstituted apple juice using membranefilter-aid filtration pretreatment. with Malaysian Agricultural(MARDI), Malaysia, pp. Research 1–12 (1986). and Developmentand chemical characteristics of tropical and Institute non-conventional fruits, in B. InTech, Rijeka, Croatia. AC and Chiarello MD, Antioxidantcharacteristics and other chemical of and physical twostages. strawberry cultivars at different ripeness passionfruit.com [2 April 2011]. metric method with on-lineof photodegradation ascorbic for acid determination and24 total sugars in fruit juices. grape cultivars analyzed by principal component analysis. Agric al., Salt effect onand phenolics Canadian and antioxidant sweet activities marjoram of ( Tunisian and sugar components in a Turkish cv. Dortyol ( Int J Food Sci Technol Osbeck) orange juice. Constant PBL, Hunter colour dimension, sugarcompounds content in and volatile pasteurized yellow passion fruit juice ( antioxidant activity of sweet cherry ( flavicarpa FM, Bioactive compounds andtraditional fruits antioxidant of capacities Brazil. on 18 non- the cultivation system in the aromatotal of antioxidant the volatile activity compounds of and 46 passion fruit. Statistic Division.February [Online]. 2012]. Available: http://faostat.fao.org [11 7 Youn KS, Hong JH, Bae DH, Kim SJ and Kim SD, Effective clarifying 5 Cavalcante IHL, Cavalcante LF, Miranda JMS and Martins ABG, Physical 6 Pineli LLO, Moretti CL, Santos MS, Campos AB, Brasileoro AV, Cordova 4ChaiTB, 9 Liu H, Wu B, Fan P, Li S and Li S, Sugar and acid concentrations in 98 8 Llamas EN, Nezio MSD and Band BSF, Flow-injection spectrophoto- 2 Food and Agricultural Organization (FAO) of the United Nations, 1 Janzantti NS, Macoris MS, Garruti DS and Monteiro M, Influence of 3 ITI TROPOCALS. 14 Baatour O, Mahmoudi H, Tarchoun I, Nasri N, Najla T, Kaddour R et 10 Kelebek H and Selli S, Determination of volatile, phenolic, organic acid 11 Sandi D, Chaves JBP, Sousa ACG, Parreiras JFM, Silva MTC and 13 Kelebek H and Selli S, Evaluation of chemical constituents and 12 Rufino MS, Alves ER, Brito ES, Jimenez JP, Calixto FS and Filho contained free sugarsconsumption. and The variation ascorbic in acidand sugar, ascorbic favorable TPC acid for in content,the TAA human fresh species juice or ofstrong cultivars relationship themselves, passion between and TAA fruits andthat ripeness. depended TPC phenolic A was compounds mainly significant contributed found, on to indicating passion antioxidant fruit juice. capacity in wileyonlinelibrary.com/jsfa REFERENCES ACKNOWLEDGEMENTS This study was funded by the Ministry of Higher Educationand Malaysia UPM understudies RUGS-01-01-12-1592RU, on entitled passion fruit ’Comparative speciesgrateful and to their ScinceDocs, Inc. potential for uses’.in revising We this and paper. are checking the English were present in large amountscompared with from the sucrose vine-ripened portion. fruits A reverse cultivars in trend non-vine-ripened was observed fruits. Ascorbic acid,determined TAA and and TPC were also higher levels of the aboveBesides contents the compared juice, to the other cultivars. edible mesocarp of

1204 1205 J J :1715–1724 Prunus avium 85 :E65–E71 (1998). 274 J Sci Food Agric wileyonlinelibrary.com/jsfa C nuclear magnetic resonance spectroscopy 13 :4638–4644 (1999). :185–192 (2008). 47 :2301–2309 (2010). 107 90 in vivo Am J Physiol Endocrinol Metab Food Chem of rat liver. consumption of phenolics and total antioxidantand capacity vegetables in from the fruit American diet. (2005). cultivar on the organicSci acid Food and Agric sugar composition of potatoes. observed by composition and antioxidant activity of sweetL.) cherry ( Agric Food Chem C, phenolics and anthocyanins after fresh storage of small fruits. 42 Hun OK, Kim DO, Smith N, Schroeder D, Han JT and43 Lee Golden CY, BR, Daily Mesa DR, Rodriguez EMR and Romero CD, Influence of the 44 Kustermann E, Seelig J and Kunnecke B, Ascorbic acid, a vitamin, is 45 Usenik V, Fabcic J and Stampar F, Sugars, organic acids, phenolic 46 Kalt W, Forney CF, Martin A and Prior RI, Antioxidant capacity, vitamin , cultivars www.soci.org J Food Sci 2012 Society of Chemical Industry c Passiflora Handbook of Fruit Science :1283–1287 (2006). 36 Cienc Rural . [Online]. Available: http://www.kau.edu/ : 1198–1205 93 2013; Passion fruit (Passiflora edulis Sims): Passifloraceae. :392–397 (2011). 76 silvestres e polpas de fructaspolifenois congeladas: e antocianinas. antividade antioxidante, PineappleResearchStation prsvkm/Html/PassionFruitPedulis.htm [26 August 2011]. Available: http://www.naturalhub.com/natural_food_guide_fruit_ vitamin_c.htm [13 March 2012]. and Technology, Production, Composition,ed. Storage by and Salunkhe Processing pp. 445–454 DK (1995). and Kadam SS. Marcelof commercial Dekker, ready-to-drink New orange York, juice and nectar. 41 Kuskoshi EM, Asuero AG, Morales MT and Fett R, Frutos tropicais 37 Joy PP, 38 The Natural Food Hub. Natural Food-Fruit Vitamin C Content. [Online]. 39 Chavan UD and Kadam SS, Passion fruit, in 40 Stella SP, Ferrarezi AC, Santos KO and Monteiro M, Antioxidant activity J Sci Food Agric Chemical composition and antioxidant activity of Hindawi Publishing Corporation e Scientific World Journal Volume 2014, Article ID 167309, 10 pages http://dx.doi.org/10.1155/2014/167309

Research Article Assessment of Total Phenolic, Antioxidant, and Antibacterial Activities of Passiflora Species

Shiamala Devi Ramaiya,1 Japar Sidik Bujang,1 and Muta Harah Zakaria2

1 Department of Animal Science and Fisheries, Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia 2 Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia (UPM), 43400 Serdang, Selangor Darul Ehsan, Malaysia

Correspondence should be addressed to Shiamala Devi Ramaiya; shiamala [email protected]

Received 26 October 2013; Accepted 16 December 2013; Published 21 January 2014

Academic Editors: A. Geng and A. A. Guevara-Garcia

Copyright © 2014 Shiamala Devi Ramaiya et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study focused on total phenolic content (TPC) and antioxidant and antibacterial activities of the leaves and stems of Passiflora quadrangularis, P. malifor mi s ,andP. edu li s extracted using three solvents: petroleum ether, acetone, and methanol. The maximum extraction yields of antioxidant components from the leaves and stems were isolated using methanol extracts of P. edu li s (24.28%) and P. qu adrang u l ar i s (9.76%), respectively. Among the leaf extracts, the methanol extract of P. malifor mi s had the significantly highest TPC and the strongest antioxidant activity, whereas among the stem extracts, the methanol extract of P. qu adrang u l ar i s showed the highest phenolic amount and possessed the strongest antioxidant activity. The antibacterial properties of the Passiflora species were tested using the disc diffusion method against 10 human pathogenic bacteria. The largest inhibition zone was observed for the methanol extract of P. malifor mi s against B. subtilis. Generally, extracts from the Passiflora species exhibit distinct inhibition against Gram-positive but not Gram-negative bacteria. Based on the generated biplot, three clusters of bacteria were designated according to their performance towards the tested extracts. The present study revealed that methanol extracts of the Passiflora contain constituents with significant phenolic, antioxidant, andntibacterial a properties for pharmaceutical and nutraceutical uses.

1. Introduction Passion fruit is an agronomically important crop and is used commercially in the fruit industry. This plant belongs Natural products have received significant interest as source to the genus Passiflora and is extensively grown in the for new drug development in biomedical research. The tropical and subtropical regions of the world. Passion fruit is modern pharmaceutical industry is highly dependent on widely distributed over Central America and South America, plant-based medicines, with more than 50% of drug sub- with more production in the latter region [6]. Brazil is the stances derived from natural resources [1]. Plants are known major producer and consumer of passion fruit worldwide. to produce phytochemicals, which are potential sources of In Malaysia, this fruit is cultivated on a small scale due to anticarcinogenic, anticancer, antimicrobial, and antioxidant the prevalence of suitable growing conditions and increase in activity; these compounds include flavonoids, phenolic acids, demand [7]. and tannins [2, 3]. Research has focused on the discovery In recent years, researchers have shown increasing inter- of clinically useful antimicrobial drugs and functional food est in the passion fruit plant due to its phytotherapeutic prop- from natural resources for pharmaceutical and nutraceutical erties, ethnobotanical uses, chemotaxonomic information, uses [4, 5]. Additionally, the increasing interest in traditional and the interaction of the plant with its environment; these ethnomedicine may lead to the discovery of novel therapeutic factors have been suggested as selection criteria for potential agents. sources of natural molecules of pharmaceutical relevance [8]. 2 The Scientific World Journal

Theleaves,stems,roots,andfruitsofPassiflora species have 2.3. Determination of Total Phenolic Content (TPC). TPC long been used in folk medicine and are finding an increas- was determined using the Folin-Ciocalteu (Merck) method ingly important place in modern medicine. Traditionally, as described by Asami et al. [33]. The extract solution in the flower of Passiflora has been valued medicinally for its appropriate solvent (1 mL) was added with 0.3 mL of Folin- sedative, antispasmodic, anxiolytic, and hypotensive activity, Ciocalteu reagent. Six minutes later, 10mL of 7% sodium car- as well as its sleep-inducing effects [6, 9–11]. Although a bonate solution was added, mixed well, and left it for 2 hours. number of species, including P. e du li s and P. qu adrang u l ar i s , The absorbance readings were taken at 740 nm on an 1100 have been valued for the above purposes, P. incarnata has Series spectrophotometer. The experiment was performed in demonstrated the strongest effects, and its efficacy is compa- triplicate. The quantification of TPC was conducted using a 2 rable with that of other species [12–16]. The ethnobotanical calibration curve prepared with a gallic acid standard (𝑅 = literature has also indicated that the Passiflora plant contains 0.997). The results were expressed as g garlic acid equivalent a variety of compounds, including alkaloids, phenols, (GAE) per 100 g DW of extract. glycoside flavonoids, and cyanogenic constituents10 [ ]. The leaf extract of Passiflora species has been shown to possess 2.4. 2,2-Diphenyl-1-picrylhydrazyl (DPPH) Radical Scavenging anxiolytic and sedative activity [17–19], as well as treatment Assay. Total antioxidant activity (TAA) of the Passiflora for diabetes and hypertension [20], and anti-inflammatory extracts against DPPH radicals was determined according to [21], cytotoxic [22], antioxidant [23, 24], antibacterial [25– the modified methods of Brand-Williams et al.34 [ ]. Three 27], and antifungal properties [28]. In support of these milliliter DPPH (100 𝜇M) in methanol was added to 1.0 mL claims, a study by Birner and Nicolls [29]hasreportedthe of Passiflora extract. After 30 min incubation period at room isolation of an antibacterial and antifungal compound called temperature the absorbance was taken against blank prepared Passicol from P. e du li s . This plant has a continuing history of without extract at 517 nm on an 1100 Series spectrophotome- use in Ayurveda and homeopathic medicine as a treatment ter. The concentration of sample required to scavenge 50% for a number of ailments [30]. The seeds possess an antifungal DPPH (EC50) was determined by linear regression for the protein (Passiflin)31 [ ] and an antifungal peptide (Pe-AFP1), concentration and EC50 (%). The experiment was performed −1 which protect the plant from invasion by pathogenic fungi in triplicate, and the results were expressed as 𝜇g/mL .A [32]. lower EC50 value indicates a higher antioxidant activity. From the above review, it may be concluded that although many studies have examined the ethnobotanical attributes 2.5. Bacterial Strains. The plant extracts were individually and medicinal uses of purple passion fruits, little infor- tested against 10 human pathogenic bacteria: the 5 Gram- mation exists on phenolic content, antioxidant capacities, positive bacteria Bacillus subtilis (ATCC 6633), Bacillus and antibacterial properties of other Passiflora species. To cereus (ATCC 11778), Listeria monocytogenes (ATCC 7644), fill this gap, the present study screens various parts of Streptococcus gallolyticus (ATCC 49147), and Staphylococ- several Passiflora species for the total phenolic content and cus aureus (MTCC 554231) and the five Gram-negative antioxidant and antibacterial activity extracted using three bacteria Pseudomonas aeruginosa (ATCC 27853), Klebsiella different solvents: petroleum ether, acetone, and methanol. oxytoca (ATCC 49131), Proteus vulgaris (ATCC 49132), Salmonella enteritidis (MTCC 125239), and Escherichia coli 2. Materials and Methods (MTCC 423155). The bacterial strains were obtained from Thermo Fisher Scientific. The bacterial strains were cultured ∘ 2.1. Plant Materials. Leaves and stems of P. qu adrang u l ar i s , overnight at 37 Cinnutrientbroth.Thecultureswerethen ∘ P. malifor mi s ,andP. e du li s were collected randomly from 10 maintained at 4 C and were subcultured prior to analysis. plants of each species at the passion fruit farm at Universiti Putra Malaysia Bintulu Sarawak Campus (UPMKB), Bintulu, 2.6. Antibacterial Activity. The antibacterial activity of the Sarawak. Specimen identification and botanical nomencla- Passiflora species extracts was studied by the disc diffusion ture were based on the scheme of Ulmer and MacDougal [6]. method as reported by Lalitha [35]. The turbidity of each The plant parts were brought to the laboratory and imme- bacterial suspension was adjusted to a 0.5 McFarland stan- 8 diately inspected, cleaned with distilled water, and dried in dard, with each suspension containing 1.5 × 10 CFU/mL. the shade at room temperature for 2 weeks. The dried parts The bacterial strains were spread individually in sterile Petri werehomogenizedtoafinepowderandstoredinairtight dishes on prepared nutrient agar medium. Sterilized filter containersuntilusedfortheanalysesdescribedbelow. paper discs (5.5 mm in diameter) were impregnated with 5 𝜇L of 50 𝜇g/𝜇L extract (250 𝜇g/disc) and placed on the surface 2.2. Preparations of Extracts. Foreachofthedriedparts,5gof of the agar plates that had previously been inoculated with poweredsamplewasseparatelyextractedwith50mLofthree the tested bacteria. A disc impregnated with chloramphenicol different solvents (petroleum ether, acetone, and methanol) (10 𝜇g/disc) was used as a standard, while the respective using a shaking water bath at 80 rpm for 48 hours at room solvents were used as the negative controls. The agar plates ∘ temperature. The extracts were then centrifuged at 500 ×gfor were incubated at 37 C for 24 hours. The antibacterial activity 10minandfilteredthroughWhatmanNo.2filterpaper.Each wasexaminedbymeasuringthediametersofthegrowth extractwasthenevaporatedtodryness.Theconcentrated inhibition zones (mm) for the tested pathogenic bacteria extracts were suspended in dimethyl sulfoxide (DMSO) and compared to the standards. The measurement of the inhibi- ∘ stored in a refrigerator at 4 Cpriortotheanalyses. tion zones was conducted using three sample replications. The Scientific World Journal 3

2.7. Statistical Analysis. The statistical software SAS 9.0 was The stem extracts of P. qu adrang u l ar i s had the highest used for data analysis. Means were compared using single TPC value among all of the extracts. Phenolic compounds factor analysis of variance (ANOVA). A post hoc Tukey’s are widely distributed in plants and have garnered attention test (𝑃 < 0.05) was performed if the ANOVA result was due to their antimutagenic, antitumor, and antioxidant prop- significant. Principal component analysis (PCA) based on the erties, which contribute to human health [40]. The variation Pearson method was conducted using XLSTAT software to in TPC values may be attributed to the plant origins of determine the relationship between the activity of the plant the extractable compounds and the efficacy of the solvents parts extracts and the pathogenic bacteria. used to recover the polyphenols from the plant materials. Similar variations have been described for Passiflora [23, 41] 3. Results and Discussion andforotherplants,forexample,Pongamia pinnata [5] and Hippophae salicifolia [42]. The variation could also be 3.1. Extract Yields. The extract yields of the leaves and stems influenced by geographical origin, cultivar, harvesting, and of P. quadrangularis, P. maliformis, and P. e du li s obtained drying method [43]. using the three extraction solvents are presented in Table 1. The extraction yields showed significant differences among 3.3. Total Antioxidant Activity (TAA). Significant variation the Passiflora species and the different solvents tested. The of TAA was observed among the different extracts of the extract yields of the leaves and stems ranged from 3.70 to Passiflora species and is presented in Table 1.Thepresent 24.28% and 1.53 to 9.76% (per 5 g dry weight), respectively. results indicate that the extracts exhibited potential free Methanol was the most effective extractant of antioxidant radical scavenging activity. A lower EC50 value indicates a compounds, followed by acetone and petroleum ether. This greater antioxidant activity for a given extract. The TAA trend was similar to the findings of Gahlaut and Chhillar ranged from 456.9 to 3423.8 𝜇g/mL and 313.7 to 2137.2 𝜇g/mL [36]. Both methanol and ethanol have been established as for the leaves and stems, respectively. Among the extracts, the effective solvents for extracting antioxidant compounds from strongest TAA was observed in the methanol, followed by the plant materials [37]. Methanol yielded the greatest percentage acetone, with the lowest antioxidant activity observed in the of crude extract from the leaves of P. e du li s (24.28 ± 0.67%), petroleum ether extracts. In accordance with the TPC results, whereas lower yields were obtained from the petroleum ether the antioxidant activity of the leaf was observed to be highest extracts of P. e du li s and P. malifor mi s , 4.39 ± 0.46%and in the methanol extract of P. malifor mi s (456.9±13.1 𝜇g/mL), 3.70±0.97%, respectively. For the stem, the highest percentage followed by those of P. e du li s (653.5 ± 6.1 𝜇g/mL) and P. of crude extract was obtained from the methanol extracts quadrangularis (785.2±1.8 𝜇g/mL). The TAA values obtained of P. qu adrang u l ar i s (9.76 ± 0.20%), and the lowest extract in this study agreed with the findings of Vasic et al.38 [ ]for yield was recorded from the petroleum ether extracts of P. the methanol and acetone extracts of P. al ata , 808.69 𝜇g/mL maliformis (1.53 ± 0.11%). The present study revealed that and 1107.79 𝜇g/mL, respectively. Similarly, the TAA value of the extraction yield varied with the solvents used and the the P. e du li s leaf extract was comparable to that recorded by chemical properties of the extractable components in each Sunitha and Devaki [24](875𝜇g/mL) using ethanol extracts. plant part [5]. The present TAA value for P. e du li s was higher than that reported previously by Silva et al. [39](1100𝜇g/mL) for 3.2. Total Phenol Content (TPC). The total phenolic con- methanol leaf extract but lower than those reported by Ripa tent varied between the different plant parts of the Pas- et al. [22](58.88𝜇g/mL, using petroleum ether). siflora species with respect to the extraction solvent used The strongest antioxidant activity in the stem was (petroleum ether, acetone, or methanol). The phenolic con- recorded from the methanol extracts for P. qu adrang u l ar i s tent for the extracted leaves and stems ranged from 3.32 to (313.7 ± 1.2 𝜇g/mL), followed by those of P. e du li s (429.6 ± 1.23 g GAE/100 g and 3.74 to 1.03 g GAE/100 g, respectively 3.6 𝜇g/mL) and P. malifor mi s (973.0 ± 3.7 𝜇g/mL). The (Table 1). Among the three solvents, methanol recovered petroleum ether extract of the P. malifor mi s stem was found to the maximum TPC from the leaves and stems. Petroleum possess the weakest activity (2137.2 ± 2.7 𝜇g/mL). The TAA ether was least effective at extracting phenolic compounds. values of the stem extracts in the present study were lower Among the leaf extracts, the methanol extract from P. than that of the petroleum ether extracts (54.01 𝜇g/mL) of P. maliformis showed the highest phenolic content (3.32 ± edulis as reported by Ripa et al. [22]. In general, a higher TPC 0.06 g GAE/100 g), followed by the methanol extract of P. value led to stronger antioxidant activity. Several authors have edulis at 2.37 ± 0.11 g GAE/100 g, whereas petroleum ether mentioned this relationship in previous studies, for example, and acetone extracts from P. qu adrang u l ar i s produced had those of Passiflora species [44]andVeronica species [45]. TPC lower phenolic contents. In a comparison of the results could be considered as an important indicator of the antioxi- obtainedfortheTPCoftheP. e du li s leaves with those dant properties of plant extracts. Although TPC has a strong reported in the literature, similar values have been reported correlation with antioxidant activity, other constituents, such for P. al ata : 3.42 ± 0.39 g GAE/100 g for ethanol and 1.40 ± as flavonoids, alkaloids, glycosides, carotenoids, vitamins, 0.49 g GAE/100 g for acetone extracts [38]. However, the and other secondary metabolites, may also be contributing present TPC values for the leaves of P. e du li s were higher than factors [46]. thoseobtainedbySilvaetal.[39](0.83 ± 0.07 gGAE/100g) and four times lower than those reported by Rudnicki et al. 3.4. Antibacterial Activities. The antibacterial activities of the [23] (9.25 g GAE/100 g). leaves and stems extract of the Passiflora species were tested 4 The Scientific World Journal e b c a cd de 973.0 ± 3.7 3.32 ± 0.06 3.07 ± 0.06 1.28 ± 0.07 456.9 ± 13.1 15.56 ± 0.56 cd b de de de bcd 9.21 ± 0.59 2.40 ± 0.35 1.07 ± 0.14 1807.2 ± 3.1 1.71 ± 0.20 1264.6 ± 11.2 a ab f f e cd 3.70 ± 0.97 1.53 ± 0.11 1.03 ± 0.15 1.52 ± 0.36 2137.2 ± 2.7 2113.1 ± 3.9 b a a b d de species. 9.76 ± 0.20 3.74 ± 0.24 2.17 ± 0.43 313.7 ± 1.2 785.2 ± 1.8 16.73 ± 0.78 species Passiflora c c bc b b d Passiflora Stems Leaves 3.98 ± 0.18 2.68 ± 0.28 1.39 ± 0.06 12.14 ± 0.72 1080.5 ± 9.8 1715.2 ± 9.1 b a e d d ef ). PE: petroleum ether; ACT: acetone; MET: methanol. Solvent extracts of 7.73 ± 0.53 1.23 ± 0.05 1.52 ± 0.04 2.17 ± 0.19 3423.8 ± 5.5 1730.4 ± 10.5 𝑃 < 0.05 a b b b d de 2.37 ± 0.11 4.33 ± 0.38 2.58 ± 0.06 429.6 ± 3.6 653.5 ± 6.1 24.28 ± 0.67 bc c cd c c bc Table 1: Yields, TPC, and TAA of different solvent extracts of 3.17 ± 0.23 2.21 ± 0.16 2.03 ± 0.08 1085.7 ± 8.5 10.15 ± 0.03 1499.6 ± 11.3 Passiflora edulis Passiflora quadrangularis Passiflora maliformis a b f c bc cde PE ACT MET PE ACT MET PE ACT MET 4.39 ± 0.46 2.01 ± 0.08 1.98 ± 0.07 1765.1 ± 8.2 2.58 ± 0.18 2338.0 ± 12.6 g/mL) g/mL) 𝜇 𝜇 Variable TPC (g GAE/100 g) TAA ( TPC (g GAE/100 g) TAA ( Yield (%) Yield (%) Means in the same row with a different letter (a–f) are significantly different (Tukey’s test, The Scientific World Journal 5

1 6

P. qu adrang u l ar i s methanol 4 P. malifor mi s 3 1 0.5 methanol P. edu li s 2 methanol P. v u lg ar i s B. cereus S. gallolyticus %) P. qu adrang u l ar i s %) S. aureus 0 acetone 0 B. subtilis L. monocytogenes 16.40 16.40 ( P. qu adrang u l ar i s ( 2 petroleum ether 2 S. enteritidis P. ae r ug inos a PC P. malifor mi s PC petroleum ether K. oxytoca −2 E. coli P. edu li s 2 acetone −0.5 P. malifor mi s acetone P. edu li s petroleum ether −4

−1 −6 −1 −0.5 0 0.5 1 −6 −4 −2 0246 PC1 (70.13%) PC1 (70.13 %)

(a) Variables (axes PC1 and PC2: 86.54%) (b) Observations (axes PC1 and PC2: 86.54%)

Figure 1: (a) Plot of the variables tested against pathogenic microbes for leaves extracts. Percentages in parentheses represent the variation of each component. (b) Positions of the PC scores of the 10 microorganisms according to PC1 and PC2. against 10 human pathogenic bacteria; the results of the tests (Figure 1(b)), the first group consisted of L. monocytogenes, on the 5 Gram-positive and 5 Gram-negative bacteria are S. gallolyticus, S. aureus, B. subtilis,andB. cereus.This presented in Tables 2 and 3. The observed antibacterial activi- group represents the Gram-positive bacteria, and all the ties were categorized as follows: (a) sensitive-inhibition zone, extracts from the three tested solvents showed significant >18 mm; (b) intermediate-inhibition zone, 13–17 mm; and antibacterial activities against this group. The methanol (c) resistance-inhibition zone, <13 mm [47]. The methanol leaf extracts of the Passiflora species exhibited intermediate extracts exhibited considerable antibacterial activity against activity against S. aureus (14.5 ± 0.6 mm), B. subtilis (14.0 ± the bacteria tested. The activity of the methanol extracts 0.6 mm), and L. monocytogenes (14.5 ± 0.5 mm), whereas the mightbepartlyduetotheirhigherphenolicandantioxidant petroleum ether and acetone extracts showed smaller zones contents. The largest inhibition zone was produced by the of inhibition against the other tested pathogenic bacteria. methanol leaf extract of P. malifor mi s against B. subtilis (22.5± Moderate inhibition was also observed from the methanol 0.8 mm, sensitive zone). Bacillus cereus and S. gallolyticus and acetone extracts of P. qu adrang u l ar i s against S. aureus were also sensitive to the methanol leaf extract of P. mali - and B. cereus. Staphylococcus aureus was also moderately formis (inhibition zones of 18.7 ± 0.2 mm and 20.5 ± 0.5 mm, susceptible (14.2 ± 0.6 mm) to the methanol extract of P. resp.). These results showed that the methanol extracts have maliformis. The acetone and petroleum ether extracts of P. considerable antibacterial potency despite their crude form. maliformis showed intermediate-inhibition zones against S. The potential antibacterial activities of the extracts gallolyticus (16.3 ± 0.3 and 13.5 ± 0.1 mm, resp.). againstthe10humanpathogensareanalyzedusingPCAand The second group was composed of P. ae r ug ino s a , E. illustrated as biplots in Figures 1 (leaf) and 2 (stem). The coli,andK. oxytoca which are categorized as Gram-negative PCA indicates that the first two PCs for the leaf extracts bacteria and exhibited some degree of sensitivity towards accounted for 86.54% of the total variance. PC1 explained all the extracts.The leaf and stem extracts, as well as the a higher percentage of total variance (70.13%) than did standard, showed weak antibacterial activities towards both P. PC2 (16.40%). For the stem extracts, the first two principal aeruginosa and E. coli. Klebsiella oxytoca was highly sensitive components explained 92.94% of the total variance, with (21.4 ± 0.8 mm) to the acetone extracts and moderately PC1 and PC2 representing 81.54% and 11.40% of the total susceptible (∼14.0 mm) to the methanol and petroleum variance, respectively. The methanol extracts tested were ether extracts of P. malifor mi s .Thethirdgroupconsisted loaded heavily on the positive sites of PC1 and PC2, while of P. v u lg ar i s and S. enteritidis, and these bacteria were the acetone and petroleum ether extracts were connected sensitive to the methanol extracts of the Passiflora leaves. tothepositivesitesofPC1andnegativesitesofPC2in Different species exhibited varying degrees of sensitivity to both the leaf and stem biplots (Figures 1(a) and 2(a)). The the antibacterial activity of the extracts. These differences 10 pathogens examined clustered into three main groups in can be attributed to the presence of natural antimicrobial both leaf and stem biplots. For the biplot of the leaf extracts compounds in the different parts and species of the Passiflora 6 The Scientific World Journal

Variables (axes pc1 and pc2: 92.94%) 1 8

P. malifor mi s 6 methanol

P. qu adrang u l ar i s 1 0.5 methanol 4 3 P. edu li s methanol 2 S. aureus B. subtilis L. monocytogenes P. malifor mi s S. enteritidis 2 B. cereus 0 acetone 0 P. qu adrang u l ar i s acetone E. coli S. gallolyticus P. malifor mi s P. v u lg ar i s PC2 (11.40 %) petroleum ether PC2 (11.40 %) −2 K. oxytoca P. edu li s acetone P. ae r ug inos a P. qu adrang u l ar i s P. edu li s petroleum ether petroleum ether −0.5 −4

−6

−1 −8 −1 −0.5 0 0.5 1 −8 −6 −4 −2 0246 8 PC1 (81.54 %) PC1 (81.54 %)

(a) Variables (axes PC1 and PC2: 92.94%) (b) Observations (axes PC1 and PC2: 92.94%)

Figure 2: (a) Plot of the variables tested against pathogenic microbes for stems extracts. Percentages in parentheses represent the variation of each component. (b) Positions of the PC scores of the 10 microorganisms according to PC1 and PC2.

plants. The antibacterial activity of the P. e du li s leaf extract that makes these bacteria more accessible to the penetration against S. aureus in the present study was similar to the levels of active plant compounds [51]. This work provides insight reported by Akanbi et al. [27] (12.0 mm) and Kannan et al. into the therapeutic properties of Passiflora in traditional [48](10±1.03 mm) for methanol extracts. Johnson et al. [49] medicine. Further research is required to study the isolates reported that chloroform and methanol extracts of the callus of this plant’s bioactive compounds and to evaluate the tissue and leaves of P. e du li s possessed potential antimicrobial mechanisms of action for their antioxidant and antibacterial activity against S. aureus. The antibacterial inhibition against activities. B. subtilis in the present results was slightly lower than that obtained (18.0 ± 0.88 mm) by Kannan et al. [48]. 4. Conclusions Similarly, for the stem extracts (Figure 2(b)), the first group consisted of the Gram-positive bacteria: L. monocy- The results confirmed the ethnobotanical views of the Pas- togenes, S. gallolyticus, S. aureus, B. subtilis,andB. cereus. siflora species, which are used in traditional medicine to The methanol and acetone extracts of P. malifor mi s and the treat the various infectious diseases caused by the microbes. methanol extracts of P. qu adrang u l ar i s exhibited intermediate Methanol was established to be the most effective among the inhibition against S.aureus,S.gallolyticus,andB. subtilis. tested solvents at recovering the phenolic and antioxidant The second group comprised the Gram-negative bacteria: contents from the different parts of the Passiflora species. P. aeruginosa, K. oxytoca,andE. coli.TheS. enteritidis, The methanol extract also contained certain constituents with which was resistant to only the methanol extracts, and the P. significant antibacterial properties. Gram-negative bacteria vulgaris that was not inhibited by the extracts were clustered were generally less susceptible to the Passiflora extracts than inthelastgroup.Theobtainedvaluesfortheantibacterial were Gram-positive bacteria. This contrast was illustrated in activities of the stem extracts against S. aureus, B. subtilis, the biplots generated from the PCA. Although the materials P. ae r ug ino s a ,andE. coli were within the range of previous employed in this study are generally considered as plant studies of P. e du li s stem extracts [22, 27]. The PCA showed wastes, they can be used as sources of bioactive constituents. significant variation between the Gram-positive and Gram- The present study establishes that the leaves and stems of negative bacteria. This result was in agreement with the the Passiflora species could be utilized for treating ailments, fact that Gram-negative bacteria possess a unique outer giving the plants value beyond that of their fruits, which are membrane of lipopolysaccharide, which protects them from processed as juice and other products. thepermeationofactivecompounds[50]. The tested extracts showedpotentialactivityagainsttheGram-positivebacteria; Conflict of Interests L. monocytogenes, S. gallolyticus, S. aureus, B. subtilis,andB. cereus were all susceptible to the Passiflora extracts, which The authors declare that there is no conflict of interests may be attributed to the presence of a single membrane regarding the publication of this paper. The Scientific World Journal 7 a a a a a a a a a a STD 24.7 ± 0.6 28.6 ± 0.7 30.8 ± 0.8 21.7 ± 0.5 28.3 ± 0.2 12.3 ± 0.6 26.2 ± 0.5 23.3 ± 0.6 21.5 ± 0.2 11.3 ± 0.1 c b b b b b b b ab cd 9.0 ± 0.2 8.3 ± 0.4 14.5 ± 0.3 14.2 ± 0.6 18.7 ± 0.2 22.5 ± 0.8 14.2 ± 0.7 20.5 ± 0.5 c b b d b def de de 7.0 ± 0.6 9.1 ± 0.3 7.7 ± 0.4 16.3 ± 0.1 10.8 ± 0.3 21.4 ± 0.8 11.3 ± 0.2 10.8 ± 0.2 .PE:petroleumether;ACT:acetone;MET:methanol; c b cd de de e ab de species. Passiflora 0.0 ± 0.00.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 14.7 ± 0.4 7.6 ± 0.3 8.3 ± 0.4 9.1 ± 0.1 7.4 ± 0.5 14.2 ± 0.9 12.6 ± 1.1 13.5 ± 0.3 11.9 ± 0.1 10.4 ± 0.2 Passiflora c b b bc e b b d cde cd 9.3 ± 0.2 7.2 ± 0.5 9.3 ± 0.1 8.5 ± 0.3 15.7 ± 0.4 12.5 ± 0.4 13.3 ± 0.3 12.1 ± 0.1 b bc cd de e e b d 8.6 ± 0.2 6.2 ± 0.2 7.1 ± 0.5 9.5 ± 0.1 10.4 ± 0.6 13.7 ± 0.6 13.6 ± 0.3 10.5 ± 0.2 )ofthemeansforeachsolventextractofthe bc de f e b b d de 𝑃 < 0.05 0.0 ± 0.00.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 15.0 ± 0.6 6.8 ± 0.2 8.0 ± 0.2 9.1 ± 0.3 9.6 ± 0.5 7.0 ± 0.1 9.2 ± 0.6 7.2 ± 0.4 12.3 ± 0.8 11.2 ± 0.2 Plant extracts inhibition zone diameter in mm c a b b b d ab de c b 14.0 ± 0.6 10.6 ± 0.3 14.5 ± 0.6 17.5 ± 0.4 14.5 ± 0.5 11.2 ± 0.4 10.6 ± 0.5 11.6 ± 0.2 c b cd de de b ef bc Table 2: Antibacterial activity of different solvent extracts from the leaves of 7.2 ± 0.3 9.8 ± 0.3 9.8 ± 0.2 13.3 ± 0.6 13.2 ± 1.0 11.4 ± 0.4 10.6 ± 0.6 10.3 ± 0.2 Passiflora edulis Passiflora quadrangularis Passiflora maliformis b d ef e e e ab bc PE ACT MET PE ACT MET PE ACT MET 0.0 ± 0.00.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 7.6 ± 0.3 6.8 ± 0.5 8.7 ± 0.1 8.7 ± 0.4 8.4 ± 0.5 9.1 ± 0.6 9.7 ± 0.4 10.1 ± 0.3 10.4 ± 0.8 10.2 ± 0.2 B. cereus B. subtilis L. monocytogenes S. gallolyticus K. oxytoca P. v u lg ar iS. s enteritidis E. coli S. aureus P. ae r ug inos a Bacteria Gram-positive bacteria Gram-negative bacteria STD: standard (chloramphenicol). Differentsuperscript letters within same the row indicate significant differences (Tukey’s test, 8 The Scientific World Journal a a a a a a a a a STD 24.7 ± 0.6 28.6 ± 0.7 30.8 ± 0.8 21.7 ± 0.5 28.3 ± 0.2 12.3 ± 0.6 26.2 ± 0.5 21.5 ± 0.2 11.3 ± 0.1 b b b bc bc b b b cd 6.5 ± 0.6 7.5 ± 0.3 7.9 ± 0.3 15.4 ± 0.1 11.2 ± 0.9 10.7 ± 0.1 14.7 ± 0.5 11.3 ± 0.3 c b b b b b cd cd 6.8 ± 0.7 7.6 ± 0.4 9.6 ± 0.2 7.8 ± 0.1 13.4 ± 0.1 15.1 ± 0.2 11.0 ± 0.4 10.3 ± 0.3 .PE:petroleumether;ACT:acetone;MET:methanol; b de e b b d d ab species. Passiflora 0.0 ± 0.0 0.0 ± 0.0 6.6 ± 0.5 9.0 ± 0.1 9.7 ± 0.4 6.6 ± 0.4 8.5 ± 0.2 7.5 ± 0.5 9.5 ± 0.1 10.7 ± 0.8 10.1 ± 0.6 Passiflora c b b b b b b bcd cd 7.2 ± 0.5 8.0 ± 0.2 8.2 ± 0.5 13.3 ± 0.3 16.2 ± 0.2 12.1 ± 1.0 11.5 ± 0.6 10.1 ± 0.6 a b b b d cd a d 7.5 ± 0.5 8.2 ± 0.1 10.5 ± 0.3 10.9 ± 0.5 10.3 ± 0.4 11.4 ± 0.3 10.4 ± 0.2 11.7 ± 0.5 )ofthemeansforeachsolventextractofthe a b b b f b de cd 𝑃 < 0.05 0.0 ± 0.0 0.0 ± 0.0 7.4 ± 0.3 8.5 ± 0.4 7.6 ± 0.6 9.5 ± 0.4 9.6 ± 0.6 10.9 ± 0.2 13.0 ± 0.5 10.7 ± 0.5 11.9 ± 0.9 Plant extracts inhibition zone diameter in mm a b b b cd b b de cd 7.8 ± 0.2 8.1 ± 0.2 9.3 ± 0.3 11.8 ± 0.3 12.5 ± 0.7 11.2 ± 0.8 10.4 ± 0.1 11.7 ± 0.5 a b b d e b b d Table 3: Antibacterial activity of different solvent extracts from thestems of 8.3 ± 0.2 9.7 ± 0.1 8.4 ± 0.2 8.7 ± 0.2 11.3 ± 0.3 11.0 ± 0.4 12.1 ± 0.5 10.3 ± 0.3 Passiflora edulis Passiflora quadrangularis Passiflora maliformis b b ab f c e b bcd PE ACT MET PE ACT MET PE ACT MET 0.0 ± 0.00.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 7.3 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 23.3 ± 0.6 7.0 ± 0.1 9.4 ± 0.2 7.3 ± 0.2 8.1 ± 0.3 11.3 ± 0.3 10.0 ± 0.5 10.3 ± 0.4 10.4 ± 0.2 B. cereus B. subtilis L. monocytogenes S. gallolyticus K. oxytoca P. v u lg ar iS. s enteritidis E. coli S. aureus P. ae r ug inos a Bacteria Gram-positive bacteria Gram-negative bacteria STD: standard (chloramphenicol). Differentsuperscript letters within same the row indicate significant differences (Tukey’s test, The Scientific World Journal 9

Acknowledgments depression,” Journal of Ethnopharmacology,vol.139,no.1,pp. 273–279, 2012. This study was funded by the Ministry of Higher Education [15] R.Soulimani,C.Younos,S.Jarmouni,D.Bousta,R.Misslin,and Malaysia and UPM under the RUGS-01-01-12-1592RU titled F. Mortier, “Behavioural effects of Passiflora incarnata L. and its “Comparative studies on passion fruit species and their indolealkaloidandflavonoidderivativesandmaltolthemouse,” potential uses.” The authors are grateful to the American Journal of Ethnopharmacology,vol.57,no.1,pp.11–20,1997. Journal Expert (AJE) for revising and checking the English [16] A. Menghini, M. Capuccella, V. Mercati, L. Mancini, and M. language of this paper. Buratta, “Flavonoid contents in Passiflora spp,” Pharmacological Research,vol.27,no.1,pp.13–14,1993. [17]C.E.Seaforth,C.D.Adams,andY.Sylvester,AGuideforthe References Medicinal Plants of Trinidad & Tobago, Commonwealth Secre- teriate, Marlborough House, London, UK, 1983. [1] S. Krief, M.-T. Martin, P. Grellier, J. Kasenene, and T. Sevenet,´ “Novel antimalarial compounds isolated in a survey of self- [18]J.Deng,Y.Zhou,M.Bai,H.Li,andL.Li,“Anxiolyticandsed- medicative behavior of wild chimpanzees in Uganda,” Antimi- ative activities of Passiflora edulis f. flavicarpa,” Journal of Ethno- crobial Agents and Chemotherapy,vol.48,no.8,pp.3196–3199, pharmacology,vol.128,no.1,pp.148–153,2010. 2004. [19] H. Li, P. Zhou, Q. Yang et al., “Comparative studies on anxio- lytic activities and flavonoid compositions of Passiflora edulis [2] S. Tavassoli and Z. E. Djomeh, “Total phenols, antioxidant pot- “edulis” and Passiflora edulis “flavicarpa”,” Journal of Ethnophar- ential and antimicrobial activity of methanol extract of rose- macology,vol.133,no.3,pp.1085–1090,2011. mary (Rosmarinus officinalis L.),” Global Veterinaria,vol.7,no. 4, pp. 337–341, 2011. [20] M. K. K. Nippon, “Angiotensin converting enzyme and aldo- sereductase inhibitory agent-comprises Passiflora quadrangu- [3] J. Bruneton, Pharmacognosy, Phytochemistry, Medicinal Plants, laris extract with organic solvent or water, or vitexin,”patent no. Lavoisiler, Paris, France, 1995. 1995-009562, 1993. [4] J. Davies, “Inactivation of antibiotics and the dissemination of [21] A. B. Montanher, S. M. Zucolotto, E. P.Schenkel, and T.S. Frode,¨ resistance genes,” Science,vol.264,no.5157,pp.375–382,1994. “Evidence of anti-inflammatory effects of Passiflora edulis in an [5] Z.I.Sajid,F.Anwar,G.Shabir,G.Rasul,K.M.Alkharfy,andA.- inflammation model,” Journal of Ethnopharmacology,vol.109, H. Gilani, “Antioxidant, antimicrobial properties and phenolics no. 2, pp. 281–288, 2007. of different solvent extracts from bark, leaves and seeds of [22]F.A.Ripa,M.Haque,L.Nahar,andM.M.Islam,“Antibacterial, Pongamia pinnata (L.) pierre,” Molecules,vol.17,no.4,pp.3917– cytotoxic and antioxidant activity of Passiflora edulis sims,” 3932, 2012. European Journal of Scientific Research,vol.31,no.4,pp.592– [6] T. Ulmer and J. M. MacDougal, Passiflora-Passionflowers of the 598, 2009. World, Timber Press, Portland, Ore, USA, 1st edition, 2004. [23] M. Rudnicki, M. R. de Oliveira, T. D. Veiga Pereira, F. H. [7]D.R.Shiamala,S.B.Japar,H.Z.Muta,S.K.Wong,andA.S.S. Reginatto, F.Dal-Pizzol, and J. C. Fonseca Moreira, “Antioxidant Muhd, “Sugars, ascorbic acid, total phenolic content and total and antiglycation properties of Passiflora alata and Passiflora antioxidant activity in passion fruit (Passiflora)cultivars,”Jour- edulis extracts,” Food Chemistry,vol.100,no.2,pp.719–724, nal of the Science of Food & Agriculture, vol. 93, pp. 1198–1205, 2007. 2013. [24] M. Sunitha and K. Devaki, “Antioxidant activity of Passiflora [8] S. M. K. Rates, “Plants as source of drugs,” Toxicon,vol.39,no. edulis sims leaves,” Indian Journal of Pharmaceutical Sciences, 5, pp. 603–613, 2001. vol.71,no.3,pp.310–311,2009. [25] L. N. Yuldasheva, E. B. Carvalho, M.-T. J. A. Catanho, and O. V. [9] M. Bourin, T. Bougerol, B. Guitton, and E. Broutin, “Acombina- Krasilnikov, “Cholesterol-dependent hemolytic activity of Pass- tion of plant extracts in the treatment of outpatients with adjust- iflora quadrangularis leaves,” Brazilian Journal of Medical and ment disorder with anxious mood: controlled study versus Biological Research, vol. 38, no. 7, pp. 1061–1070, 2005. placebo,” Fundamental and Clinical Pharmacology, vol. 11, no. 2, pp. 127–132, 1997. [26] S. Singh and D. Das, “Passion fruit: a fetched passion fruit for dentists,” International Journal of Pharmaceutical Sciences and [10]K.Dhawan,S.Dhawan,andA.Sharma,“Passiflora:areview Research, vol. 4, no. 2, pp. 754–757, 2013. update,” Journal of Ethnopharmacology,vol.94,no.1,pp.1–23, [27] B. O. Akanbi, O. D. Bodunrin, and S. Olayanju, “Phytochem- 2004. ical screening and antibacterial activity of Passiflora edulis,” [11] S. Akhondzadeh, H. R. Naghavi, M. Vazirian, A. Shayeganpour, Researcher,vol.3,no.5,pp.9–12,2011. H. Rashidi, and M. Khani, “Passionflower in the treatment [28] S. Kannan, B. P. Devi, and B. Jayakar, “Antifungal activity of of generalized anxiety: a pilot double-blind randomized con- isolated compound from the leaves of Passiflora edulis Sims,” trolled trial with oxazepam,” Journal of Clinical Pharmacy & Current Pharma Research,vol.1,no.1,pp.35–37,2010. Therapeutics,vol.26,no.5,pp.363–367,2001. [29]J.BirnerandJ.M.Nicolls,“Passicol,anantibacterialandanti- [12] K. Dhawan, S. Kumar, and A. Sharma, “Anti-anxiety studies on fungal agent produced by Passiflora plant species: preparation extracts of Passiflora incarnata Linneaus,” Journal of Ethnophar- and physicochemical characteristics,” Antimicrobial Agents and macology,vol.78,no.2-3,pp.165–170,2001. Chemotherapy,vol.3,no.1,pp.105–109,1973. [13]R.K.Gupta,D.Kumar,A.K.Chaudhary,M.Maithani,and [30] A. G. Ingale and A. U. Hivrale, “Pharmacological studies of R. Singh, “Antidiabetic activity of Passiflora incarnata Linn. in Passiflora sp. and their bioactive compounds,” African Journal streptozotocin- induced diabetes in mice,” Journal of Ethnophar- of Plant Science,vol.4,no.10,pp.417–426,2010. macology,vol.139,no.3,pp.801–806,2012. [31] S. K. Lam and T. B. Ng, “Passiflin, a novel dimeric antifungal [14] B. Singh, D. Singh, and R. K. Goel, “Dual protective effect proteinfromseedsofthepassionfruit,”Phytomedicine,vol.16, of Passiflora incarnata in epilepsy and associated post-ictal no. 2-3, pp. 172–180, 2009. 10 The Scientific World Journal

[32] P. B. Pelegrini, E. F. Noronha, M. A. R. Muniz et al., “An anti- [48] S. Kannan, B. P. Devi, and B. Jayakar, “Antibacterial evaluation fungal peptide from passion fruit (Passiflora edulis) seeds with ofthemethanolicextractofPassiflora edulis,” Hygeia-Journal for similarities to 2S albumin proteins,” Biochimica et Biophysica Drugs and Medicines, vol. 3, no. 1, pp. 46–49, 2011. Acta, vol. 1764, no. 6, pp. 1141–1146, 2006. [49] M. Johnson, M. Maridass, and V. Irudayaraj, “Preliminary [33] D. K. Asami, Y.-J. Hong, D. M. Barrett, and A. E. Mitchell, phytochemical and anti-bacterial studies on Passiflora edulis,” “Comparison of the total phenolic and ascorbic acid content of Ethnobotanical Leaflets,vol.12,pp.425–432,2008. freeze-dried and air-dried marionberry, strawberry, and corn [50] H. Nikaido, “Microdermatology: cell surface in the interaction grown using conventional, organic, and sustainable agricultural of microbes with the external world?” JournalofBacteriology, practices,” JournalofAgriculturalandFoodChemistry,vol.51, vol. 181, no. 1, pp. 4–8, 1999. no. 5, pp. 1237–1241, 2003. [51] H. V. Girish and S. Satish, “Antibacterial activity of important [34] W. Brand-Williams, M. E. Cuvelier, and C. Berset, “Use of a medicinal plants on human pathogenic bacteria: a comparative free radical method to evaluate antioxidant activity,” LWT-Food analysis,” World Applied Sciences Journal,vol.5,no.3,pp.267– Science and Technology,vol.28,no.1,pp.25–30,1995. 271, 2008. [35] M. K. Lalitha, Manual on Antimicrobial Susceptibility Testing, 2012, http://www.ijmm.org/documents/Antimicrobial.doc. [36] A. Gahlaut and A. K. Chhillar, “Evaluation of antibacterial potential of plant extracts using resazurin based microtiter dilu- tion assay,” International Journal of Pharmacy and Pharmaceu- tical Sciences,vol.5,no.2,pp.372–376,2013. [37] B. Sultana, F. Anwar, and M. Ashraf, “Effect of extraction sol- vent/technique on the antioxidant activity of selected medicinal plant extracts,” Molecules, vol. 14, no. 6, pp. 2167–2180, 2009. [38] S. M. Vasic, O. D. Stefanovic, B. Z. Licina, I. D. Radojevic, and L. R. Comic, “Biological activities of extracts from cultivated gran- adilla Passiflora alata,” EXCLI Journal,vol.11,pp.208–218,2012. [39] J. K. Silva, C. B. B. Cazarin, T. C. Colomeu et al., “Antioxidant activity of aqueous extract of passion fruit (Passiflora edulis) leaves: in vitro and in vivo study,” Food Research International, vol. 53, no. 2, pp. 882–890, 2013. [40]Y.Li,C.Guo,J.Yang,J.Wei,J.Xu,andS.Cheng,“Evaluationof antioxidant properties of pomegranate peel extract in compar- ison with pomegranate pulp extract,” Food Chemistry,vol.96, no. 2, pp. 254–260, 2006. [41] V.Sasikala, S. Saravanan, and T. Parimelazhagan, “Evaluation of antioxidant potential of different parts of wild plant Passiflora foetida L,” Journal of Applied Pharmaceutical Science,vol.1,no. 4, pp. 89–96, 2011. [42] M. Saikia and P. J. Handique, “Antioxidant and antibacterial activity of leaf and bark extracts of seabuckthorn (Hippophae salicifolia D. Don) of North East India,” International Journal of Life Sciences Biotechnology and Pharma Research,vol.2,no.1, pp.80–90,2013. [43] N.Babbar,H.S.Oberoi,D.S.Uppal,andR.T.Patil,“Totalphen- olic content and antioxidant capacity of extracts obtained from six important fruit residues,” Food Research International,vol. 44,no.1,pp.391–396,2011. [44] S. S. Patel, “Morphology and pharmacology of Passiflora edulis: a review,” JournalofHerbalMedicineandToxicology,vol.3,no. 1, pp. 1–6, 2009. [45] U. S¸. Harput, Y. Genc¸, N. Khan, and I. Saracoglu, “Radical scavenging effects of different Veronica species,” Records of Natural Products,vol.5,no.2,pp.100–107,2011. [46]J.Javanmardi,C.Stushnoff,E.Locke,andJ.M.Vivanco,“Anti- oxidant activity and total phenolic content of Iranian Ocimum accessions,” Food Chemistry,vol.83,no.4,pp.547–550,2003. [47] I. O. Okonko, O. B. Donbraye-Emmanuel, A. Ijandipe, A. A. Ogun, A. O. Adedeji, and A. O. Udeze, “Antibiotics sensitivity and resistance patterns of pathogens to nitrofurantoin and nali- dixic acid in pregnant women with urinary tract infections in Ibadan, Nigeria,” Middle-East Journal of Scientific Research,vol. 4, no. 2, pp. 105–109, 2009. BioMed Research Journal of International Journal of International Journal of International Nucleic Acids Peptides Genomics

Biochemistry Research International

Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013

Enzyme Research ArchaeaHindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013

Submit your manuscripts at http://www.hindawi.com

Journal of International Journal of Marine Biology Evolutionary Biology Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013

Advances in Advances in The Scientific Stem Cells Journal of Bioinformatics World Journal International Signal Transduction Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 Virolog y http://www.hindawi.com Volume 2013

ISRN ISRN ISRN ISRN ISRN Cell Biology Molecular Biology Zoology Biotechnology Microbiology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 http://www.hindawi.com Volume 2013 Hindawi Publishing Corporation e Scientific World Journal Volume 2014, Article ID 598313, 11 pages http://dx.doi.org/10.1155/2014/598313

Research Article Genetic Diversity in Passiflora Species Assessed by Morphological and ITS Sequence Analysis

Shiamala Devi Ramaiya,1 Japar Sidik Bujang,1 and Muta Harah Zakaria2

1 Department of Animal Science and Fisheries, Faculty of Agriculture and Food Sciences, Universiti Putra Malaysia Bintulu Sarawak Campus, 97008 Bintulu, Sarawak, Malaysia 2 Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia

Correspondence should be addressed to Shiamala Devi Ramaiya; shiamala [email protected]

Received 16 January 2014; Revised 13 May 2014; Accepted 15 May 2014; Published 22 June 2014

Academic Editor: Andrea Zuccolo

Copyright © 2014 Shiamala Devi Ramaiya et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study used morphological characterization and phylogenetic analysis of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA to investigate the phylogeny of Passiflora species. The samples were collected from various regions of East Malaysia, and discriminant function analysis based on linear combinations of morphological variables was used to classify the Passiflora species. The biplots generated five distinct groups discriminated by morphological variables. The group consisted of cultivars of P. edu li s with high levels of genetic similarity; in contrast, P. fo eti d a was highly divergent from other species in the morphological biplots. The final dataset of aligned sequences from nine studied Passiflora accessions and 30 other individuals obtained from GenBank database (NCBI) yielded one most parsimonious tree with two strongly supported clades. Maximum parsimony (MP) tree showed the phylogenetic relationships within this subgenus Passiflora support the classification at the series level. The constructed phylogenic tree also confirmed the divergence of P. fo eti d a from all other species and the closeness of wild and cultivated species. The phylogenetic relationships were consistent with results of rphologicalmo assessments. The results of this study indicate that ITS region analysis represents a useful tool for evaluating genetic diversity in Passiflora at the species level.

1. Introduction undergone significant revision based on morphological traits by Feuillet and MacDougal [7] and four subgenera were rec- Passiflora is extensively grown in tropical and subtropical ognized: Passiflora, Decaloba, Deidamioides, and Astrophea. regions of the world. More than 500 species in this genus have While progress has been made in understanding phylogenetic been identified, and most of them are distributed throughout relationships of subgenus Passiflora, little is known about Central and South America [1]. Colombia is one of the main the relationship among them. The subgenus Passiflora is the centers of Passiflora diversity which accommodates more largest in genus of Passiflora which comprised about 240 than 100 species and is rich in nearly all sections of the species generally regarded as typical passionflowers. Species genus [2]. Passiflora species have been cultivated for their of subgenus Passiflora are characterized by handsome flowers edible fruits, ornamental flowers, and pharmaceutical uses. that are dominated by corona [1]. Feuillet and MacDougal The Passiflora genus contains the highest number of species [7] subdivide the representatives of subgenus Passiflora into in Passifloraceae with edible fruit3 [ ]; in addition, the plants six supersections and further divided into sections or series of this genus have desirable organoleptic properties [4]. based on their morphological characteristics. At the early 20th century, two major technical mono- The species of the Passiflora genus have a wide range graphs laid the modern foundation for Passiflora systematics, of morphological characteristics, anatomical differences, and including works by Harms [5]andKillip[6]. The species were phylogenetic variability. According to Sanchez´ et al. [8], divided into 22 subgenera based on floral morphology by Passiflora species are difficult to classify because some species Killip [6]. Later, the infrageneric taxonomy of Passiflora has vary widely in terms of morphology and other species closely 2 The Scientific World Journal resemble each other. Taxonomic classifications of Passiflora subgenus Passiflora and DNA studies using sequence data aretypicallybasedonmorphological[9–11], ecological [12], from the genome may more accurately define this phylogeny. and agronomic variations [13]. For example, P. e du li s is Accessing molecular polymorphisms at the species level also generally characterized according to production, fruit weight, contributes to the acquisition of knowledge that can be fruit size, juiciness, and juice acidity; however, these variables useful for the conservation of the diversity of Passiflora. do not represent precise quantitative traits at the taxonomic Interest in this agronomically important crop (particularly level [9]. Moreover, existing inter- and intraspecies dissimi- in the Passiflora subgenus) has grown. Therefore, we studied larity among the Passiflora species makes understanding the morphological characteristics and phylogenetic relationships link between morphological plasticity, genotypic diversity, of species of this genus by evaluating the genetic diversity andspeciationchallenging.Increasingnumbersofvarious and comparing the ITS sequence data from plants of different interspecific hybrids have been produced in this genus14 [ ], origins. The knowledge generated by these genetic-based thus contributing to broad morphological variability. characterizations provides information on the parental selec- Germplasm characterization based on molecular phy- tion for breeding works and also may contribute to various logeny can also contribute to a better understanding of the aspects of future biological and ecological studies. evolutionary process and genetic divergence of accessions. Assessing genetic diversity in Passiflora is also important for the utilization and conservation of the germplasm. The 2. Materials and Methods genetic background of the plant is a crucial factor for plant 2.1. Sample Collection and Morphological Analysis. Plant breeders when selecting the parental material for breeding materials were obtained from various regions of East [15, 16]. Over the years, studies have been carried out to Malaysia as presented in Table 1.Plantpartsfromcultivated examine the phylogenetic relationships within the genera. Passiflora accessions P. e du li s producing purple fruits (PE1), Studies have reported attempts to clearly demarcate the P. e du li s producing dark purple fruits (PE2), P. incar nata , P. species of the Passiflora genus using restriction enzymes quadrangularis and P. malifor mi s were collected from the fruit (cpDNA sites; Yockteng and Nadot [17]; Paikrao et al. [18]), farm of Universiti Putra Malaysia Bintulu Sarawak Campus amplified fragments length polymorphism markers (AFLP; ∘ 󸀠 ∘ 󸀠 (UPMKB) Bintulu (N 03 12.45 and E 113 4.68 ), Sarawak. Ortiz et al. [4]; Segura et al. [15]), microsatellite markers The five plant species were grown from seeds acquired from (SSR; Ortiz et al. [4]; Oliveira et al. [19]), and inter-simple the commercial supplier Trade Winds Fruit, Windsor. In sequence repeats (ISSR; dos Santos et al. [11]).However,the addition, P. e du li s producing pink red fruits (PE3) and P. genetic diversity of Passiflora species is mostly estimated with edulis producing yellow fruits (PE4) were collected from random amplified polymorphic DNA (RAPD; Fajardo et al. ∘ 󸀠 small-scale passion fruit farms at Kota Kinabalu (N 05 58.28 [20]; Aukar et al. [21]; Crochemore et al. [22]; Cerqueira-Silva ∘ 󸀠 ∘ 󸀠 and E 116 5.72 ), Sabah and Ba’kelalan (N 03 58.44 and et al. [23]). ∘ 󸀠 E 115 37.08 ), Sarawak, respectively. Wild P. fo eti d a possessing The internal transcribed spacer (ITS) region of the flowers with green bracts (PF1) and P. fo eti d a possessing nuclear ribosomal 18S-5.8S-25S rDNA locus, which has been flowers with red bracts (PF2) were collected from bushes used in phylogenetic studies of many angiosperm families, ∘ 󸀠 ∘ 󸀠 at Bintulu (N 03 10.25 and E 113 2.39 ), Sarawak. Data has proven particularly useful for improving our under- on vegetative and reproductive morphology were recorded, standing of interspecies relationships [24]. The two internal and quantitative features were determined for the aril parts; transcribed spacer DNA sequences have evolved rapidly and leaves, stems, tendrils, bracts, flowers, fruits and seeds. are therefore useful for comparing closely related taxa. In Specimen identification and botanical nomenclature were some genera, variations in ITS sequences have proven useful based on the taxonomic keys of Ulmer and MacDougal [1]. for studies at the species level [25]. The ITS region is also flanked by well-conserved rRNA genes that can be used to differentiate plant species [26]suchaslentils[27], peanuts 2.2. Phylogenetic Analysis [28], maize [29], and seagrass [30]. The ITS regions have also been used to assess the phylogeny of the genus Passiflora. 2.2.1. Polymerase Chain Reaction (PCR) Amplification. DNA In particular, a recent study by Mader¨ et al. [31]used was isolated from 0.01 g of fresh leaves using a modified alka- ITS sequences to evaluate the intraspecific variability of 23 line lysis method without NaOH [35]. The nuclear ribosomal species of Passiflora. The first molecular phylogenetic analysis ITS regions were selected for PCR amplification and sequence of Passiflora using plastid regions and ITS sequences was analysis (forward (ITS1: TCCGTAGGTGAACCTGCGG) conducted by Muschner et al. [32]; these investigators studied and reverse (ITS4: TCCTCCGCTTATTGATATGA)). The the 61 species composing the entire subgenera and identified primers were chosen based on ITS sequences published three major clades (Passiflora, Decaloba, and Astrophea). by White et al. [36]andpurchasedinalyophilizedform Although insights into Passiflora phylogeny at the sub- from First BASE Laboratories, Malaysia. Each PCR reaction generic level have been gleaned, genetic information on and contained 13.0 𝜇L of sterile ultrapure water, 2.0 𝜇Lof10xNH4 evidence for monophyletic groups below this level are limited PCRbuffer,0.4𝜇Lof10𝜇M dNTPs, 2.0 𝜇Lof50𝜇M MgCl2, [15, 33, 34]. At lower levels, the use of an arbitrary selection of 1.0 𝜇Lof10𝜇M forward and reverse primers, 1 unit DNA Taq morphological characteristics to delimit genera has yielded polymerase, and 20–40 ng of template genomic DNA f8 or conflicting results. More information is needed to address a final volume of 20.0 𝜇L. The PCR amplification of the ITS evolutionary questions at the interspecies relationship in region was performed using an XP Thermal Cycler under The Scientific World Journal 3

Table 1: List of Passiflora accessions examined and individuals included in molecular analysis with their geographical locations, GenBank accession numbers, and references. Passiflora accessions Geographical locations GenBank accession number Citation Passiflora edulis (PE1) Bintulu, Sarawak, and Malaysia Present sequence Present study P. edu li s (PE2) Bintulu, Sarawak, and Malaysia Present sequence Present study P. edu li s (PE3) Kota Kinabalu, Sabah, and Malaysia Present sequence Present study P. edu li s (PE4) Ba’kelalan, Sarawak, and Malaysia Present sequence Present study P. qu adrang u l ar i s Bintulu, Sarawak, and Malaysia Present sequence Present study P. incar nata Bintulu, Sarawak, and Malaysia Present sequence Present study P. malifor mi s Bintulu, Sarawak, and Malaysia Present sequence Present study P. fo eti d a (PF1) Bintulu, Sarawak, and Malaysia Present sequence Present study P. fo eti d a (PF2) Bintulu, Sarawak, and Malaysia Present sequence Present study P. edu li s Brazilian state1,2,3 EU258382.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258381.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258378.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258383.1 Mader¨ et al. [31] P. edu li s Netherland AF454803.1 Ossowski [45] P. edu li s Brazilian state1,2,3 EU258379.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258384.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258380.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258375.1 Mader¨ et al. [31] P. edu li s Brazilian state1,2,3 EU258376.1 Mader¨ et al. [31] P. qu adrang u l ar i s French Guyana AF454799.1 Ossowski [45] P. qu adrang u l ar i s Ohio state AY636107.1 Krosnick and Freudenstein [46] P. al ata Viamao, RS AY032826.1 Muschner et al. [32] P. incar nata Brazilian state DQ344630.1 Muschner et al. [14] P. v itifoli a Unknown AF454796.1 Ossowski [45] P. cae r u l ea Netherland AF454802.1 Ossowski [45] P. cae r u l ea Brazilian state1 EU258315.1 Mader¨ et al. [31] P. ambig u a Unknown AF454801.1 Ossowski [45] P. pl at y l ob a Horticultural, USA AF454798.1 Ossowski [45] P. malifor mi s Dominica AY210956.1 Muschner et al. [32] P. fo eti d a Brazilian state1,2,4 EU258389.1 Mader¨ et al. [31] P. fo eti d a Brazilian state1,2,4 EU258393.1 Mader¨ et al. [31] P. p alme r i Brazilian state1,2,4 DQ238784.1 Muschner et al. [14] P. fo eti d a United States DQ521376.1 Hearn [47] P. fo eti d a Brazilian state DQ238783.1 Muschner et al. [14] P. fo eti d a Ecuador JQ723359.1 Thulin et al. [48] P. fo eti d a Brazilian state1,2,4 EU258394.1 Mader¨ et al. [31] P. fo eti d a Tropical regions DQ499117.1 Wright et al. [49] ∗ 𝑀𝑖𝑡𝑜𝑠𝑡𝑒𝑚𝑚𝑎 𝑏𝑟𝑒𝑣𝑖𝑓𝑖𝑙𝑖𝑠 Campo Grande5 AY102359.1 Muschner et al. [32] ∗ 𝑃𝑎𝑟𝑜𝑝𝑠𝑖𝑎 𝑚𝑎𝑑𝑎𝑔𝑎𝑠𝑐𝑎𝑟𝑖𝑒𝑛𝑠𝑖𝑠 M Zyhra 949, WIS AY102365.1 Muschner et al. [32] Samples collected from various locations of Brazilian states: RS1: Rio Grande do Sul, SC2: Santa Catarina, MG3:MinasGerais,PB4:Pernambuco,andMS5: ∗ Mato Grosso do Sul; tropical samples collected from New Guinea, northeast Australia, Borneo, India, Tahiti, and South America. Outgroups species. the following conditions: one cycle of initial denaturation with6xloadingbufferandusedtomeasurethesizeofthe ∘ ∘ for3minat95C and 35 cycles of denaturation at 94 Cfor obtained DNA fragments. Gel electrophoresis was run for ∘ 30 s, annealing at 55 C for 30 s, and elongation for 1 min at 90minat90Vusingagelelectrophoresissystem.Thegelwas ∘ ∘ 72 C. The final elongation step was conducted at 72 Cfor photographed using the AlphaView UV light imaging system. 5min.ThePCRproductswerequantifiedusing1%agarosegel The excess dNTPs were removed from the amplified PCR electrophoresis; 6 𝜇LofPCRproductwerepremixedwith6x products using the polyethylene glycol precipitation method loading buffer and loaded with 1 𝜇L of EZ-Vision Fluorescent [37],andthepurifiedPCRproductsweresenttoFirstBase Dye for the visualization of DNA bands in the agarose Laboratory, Malaysia, for DNA sequencing. Both strands gel. The GeneRuler 1 kb plus DNA ladder was premixed of the PCR product (reverse and forward) were sequenced 4 The Scientific World Journal using the Applied Biosystems BigDye Terminator v3.1 cycle models option used in other models, MEGA uses MP search sequencing kit. model option to implement parsimony. The basic premise of parsimony is that taxa share a common characteristic because they inherited that characteristic from common ancestors 2.3. Statistical Analysis. Data on morphological variables [41]. We used the heuristic search method with simple taxon (leaf length, leaf width, stem width, tendril length, tendril addition and tree bisection reconnection (TBR). The choice width, bract length, bracts width, flower size, petal length, of nodes for branch swapping in the resulting parsimonious petal width, sepal length, sepal width, number of outer rows model was informed by bootstrap analyses consisting of 1000 of corona, corona length, fruit weight, fruit length, fruit replications of the heuristic search. The MEGA 5.1 program width, seed length, and seed width) were statistically analyzed was also used to construct the phylogenetic tree and estimate using the SAS 9.0 for Windows. Single-factor analysis of sequence divergence [40]. variance (ANOVA) with post hoc Tukey’s test (𝑃 ≤ 0.05)was used to compare the mean values. Discriminant analysis (DA) basedonlinearcombinationsofthepredictorvariableswas 3. Results and Discussion used to find the maximum separation between the studied Passiflora species using XLSTAT 2013 for Windows. 3.1. Morphological Variation and Discriminant Analysis (DA). The electropherograms of the sequence fragments were Variations in the nineteen studied morphological character- inspected and assembled using Phred, Phrap, and Consed istics of the Passiflora species are presented in Table 2.The softwareinMacPro[38]. The chromatograms were ana- vegetative and reproductive data were analyzed for discrimi- lyzed with Phred, assembled with Phrap, and scanned with nant analysis. Discriminant function analysis based on linear PolyPhred; the results were then viewed with the Consed pro- combinations of the variables produced better discrimination gram. Only good-quality fragments (sequence quality above of the Passiflora species than the principal component anal- 20)werechosenforeachsample.TheninestudiedPassiflora ysis (data not shown). Biplots of the morphological dataset accessions sequences were compiled and aligned using multi- for discriminant functions (DF) one and two are shown plesequencecomparisonbylog-expectation(MUSCLE)[39]. in Figure 1. The discriminant function analysis that was Other 30 additional in-group sequences were obtained from based on linear combinations of the morphological variables the GenBank database (NCBI) and included in the alignment accounted for 85.69% of the total variance (64.13% in DF1 and (Table 1). Sites where gaps were required to maintain the 21.56% in DF2). All of the morphological characteristics were alignment of the sequences were treated as missing data. loaded heavily on the positive ends of the plot. As in an earlier analysis, Mitostemma brevifilis and Paropsia We produced a scatter plot of 230 specimens for the madagascariensis were chosen as outgroups [32]. first two discriminant functions based on morphological Phylogenetic relationships were developed using maxi- characteristics; the samples were densely arranged, and no mum likelihood (ML) and maximum parsimony (MP) with overlapping characteristics were observed. The discriminant the MEGA 5.1 software40 [ ]. Maximum likelihood is a factors grouped the Passiflora species into five main clusters. method that seeks the tree that makes the data most likely. It The specimens belonging to Group 1 comprised cultivars of applies an explicit criterion—the log—likelihood to compare P. e du li s (PE1, PE2, PE3, and PE4) were highly discriminated the various models of nucleotide substitution in the presence with respect to leaf, stem, sepal, and petal sizes. Accordingly, of a large number of short sequences. Maximum likelihood with the exception of fruit color and fruit sizes, we found tries to infer an evolutionary tree by finding the tree which no significant differences in morphological variables among maximizes the probability of observing the data [41]. The cultivars of P. e du li s .Atripening,P. e du li s (PE1), P. e du li s ML analysis using the Tamura 3-parameter model with (PE2), P. e du li s (PE3), and P. e du li s (PE4) turn purple, dark gamma distributions (T92+G) was selected as the best-fitting purple, pink red, and yellow, respectively. The mean fruit substitution model. The best-fitting substitution method was sizes were also significantly different among cultivars. The chosen based on the Akaike information criterion (AIC), the fruit sampled from Ba’kelalan (PE4) was oval-shaped; conse- Bayesian information criterion (BIC), and ln 𝐿 criterion. The quently, the length of the fruit was statistically comparable to model with the lowest AIC and BIC scores and the highest that of other P. e du li s cultivars that produced round fruits. The ln 𝐿 was chosen to best describe the substitution pattern [41]. fruits of P. e du li s (PE3) (5.92 × 5.57 cm) and P. e du li s (PE2) Likelihood analysis was performed by initially determining (5.48 × 4.68 cm) were smaller than those of P. e du li s (PE1) the transition : transversion ratio (ts : tv) that maximized the (7.95×6.68 cm) and P. e du li s (PE4) (9.02×6.49 cm). Group 2, log-likelihood value; more specifically, the range of ts : tv which was composed of P. incarnata accessions, was related values was plotted against the corresponding inferred log- to the positive ends of the DF1 axis and the negative ends likelihoods. The sequences were analyzed using a heuristic of the DF2 axis. The species of this group were also highly search with bootstrap analysis based on 1000 replicates of discriminated by number of outer corona rows; in addition, the dataset. The resulting trees were saved and used as this cluster was closely related to the P. e du li s cluster. starting trees for random addition following nearest neighbor Group 3, consisting of P. qu adrang u l ar i s accessions,was intersection (NNI) branch swapping. Maximum parsimony locatedattherightendoftheDF1axis,andthemembers isbasedontheassumptionthatthemostlikelytreeisthe of this group were highly discriminated by flower, fruit, and one that requires the fewest number of changes to explain seed variables. Passiflora quadrangularis produced the largest thenucleotidesequencedatainthealignment.Insteadof flowers with longest coronas of all analyzed species; this The Scientific World Journal 5 b c d b e d c d d b d c b d e b g cd cd (PF2) 1.47 0.14 0.11 1.04 0.02 0.25 0.02 6.19 0.37 0.00 0.26 0.20 0.35 0.04 0.26 0.04 0.04 0.18 0.86 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 1.38 1.45 1.43 2.05 2.33 1.29 2.35 3.86 6.42 0.29 0.61 0.41 0.25 0.72 0.06 2.00 2.73 7. 2 7 13.38 P. fo eti d a b e d b d d d c c c b e b d c b cd cd fg (PF1) 1.23 0.15 0.01 0.02 0.71 7. 4 5 0.44 0.03 0.03 0.00 0.57 0.47 0.23 0.26 0.89 0.14 0.22 0.03 0.49 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 8.21 1.34 1.38 2.49 1.32 2.16 0.28 7. 3 4 2.32 1.44 0.32 0.77 0.62 4.20 0.06 2.00 16.03 2.73 0.43 a a a b b d f b a d d c b d bc b de cd b 1.15 0.10 0.07 0.05 0.00 0.57 0.32 0.47 0.06 0.10 0.27 0.04 0.05 0.09 0.48 0.75 0.05 0.03 0.66 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± m), PTW-petal width (cm), SPL-sepal length (cm), SPW- accessions. LL-leaf length (cm), LW-leaf width (cm), STW- ), and SW-seed width (cm). 2.1 2.45 1.22 1.28 4.15 8.71 8.37 2.32 6.57 3.42 5.00 4.04 0.42 23.52 0.83 0.07 0.39 2.80 0.56 Passiflora a a a a a b a c a a a a c d a a a a ab 2.53 51.57 0.27 0.70 0.60 0.42 0.11 0.96 0.14 0.12 0.50 0.00 0.01 0.16 0.19 0.06 0.03 0.03 1.08 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± accessions. 4.16 1.85 0.15 4.13 1.22 1.97 2.59 0.98 0.74 6.26 3.00 0.63 12.16 22.38 12.96 13.66 10.42 26.63 2175.0 Passiflora a b a d a b d b a a e b c a e b b a bc species 1.51 0.87 0.49 0.12 0.16 0.14 6.12 0.57 0.05 0.16 0.03 0.85 0.00 0.02 0.02 0.30 0.69 0.03 0.92 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 1.77 35.5 3.88 1.98 0.14 0.41 6.69 4.06 0.61 4.23 3.79 9.93 0.38 4.30 23.87 2.00 Passiflora 12.03 0.49 10.54 P.maliformis P.quadrangularis P.incarnata P.foetida 0.05) among the means of each variable of the a a b a b b b b c b c b a b a b b bc bc ≤ P Vegetative morphology 0.35 0.52 1.04 (PE4) 4.55 0.51 0.37 0.13 0.48 0.02 0.20 0.02 0.08 0.49 0.26 0.77 0.04 0.38 0.37 Reproductive morphology 0.04 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 3.55 0.57 1.37 0.13 2.53 9.09 9.02 0.63 0.45 3.46 2.49 3.66 4.00 13.85 1.22 14.67 6.49 124.4 23.56 P. edu li s a a b a b b b b c b b a b ab cd cd cd b bc 0.63 (PE3) 0.92 0.37 0.11 0.01 0.16 0.01 0.05 Table 2: Morphological parameters of nine 0.48 0.09 0.33 0.45 10.91 0.12 0.02 0.23 0.34 0.67 0.42 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 3.52 0.12 1.37 2.56 2.13 1.34 0.40 0.59 3.63 3.70 13.12 3.30 5.57 8.77 5.92 64.4 14.26 0.58 25.83 P. edu li s a a b a b b b a d b c c c cd ab bc b ab bcd 3.65 0.36 0.91 (PE2) 1.36 0.18 0.02 0.03 0.48 0.09 0.03 0.31 0.58 0.71 0.18 0.07 13.35 0.89 0.04 0.07 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 1.19 1.15 2.72 9.18 0.14 0.61 4.68 3.57 13.71 3.70 0.40 3.89 1.73 0.56 49.8 5.48 14.08 26.95 2.89 P. edu li s a a b a c b b b b a b b ab bc bc bc b cd bc (PE1) 2.06 0.16 0.69 0.11 0.83 0.03 0.08 0.40 0.08 0.02 0.05 0.02 0.52 1.39 0.54 0.41 14.55 0.07 0.04 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± P. edu li s Parameter LWSTWTLTW 14.12 0.59 24.43 BW 0.13 FLSPTLPTW 2.15 SPL 8.91 SPW 3.64 OCR 1.23 CL 3.59 FM 1.27 FL 3.40 FD 2.45 SL 83.3 SW 7.95 6.68 0.63 0.41 BL 3.37 LL 13.82 stem width (cm), TL-tendril length (cm),sepal TW-tendril width width (cm), (cm), ORC-outer corona BL-bract rows, length CL-corona (cm), length BW-bract (cm), width FM-fruit (cm), mass FLS-flower (g), size FL-fruit (cm), length PTL-petal (cm), length FD-fruit (c diameter (cm), SL-seed length (cm Differentsuperscript letters within same the row indicate significant differences (Tukey’s test, 6 The Scientific World Journal

Variables (axes DF1 and DF2: 85.69%) 1 Bract width Bract length

0.5 Fruit mass Corona length Fruit length Tendril width Fruit width

%) Seed width Seed length Flower size 0 Stem width

21.56 Leaf length ( Petal width 2 Leaf width Sepal length

DF Sepal width Tendril length

−0.5 Petal length

Outer corona rows −1 −1 −0.5 0 0.5 1 DF1 (64.13%) (a)

Observations (axes F1 and F2: 85.69%) 30

20 Group 4 Group 5 Group 3 P. malifor mi s 10 (PF2) P. foetida P. qu adrang u l ar i s

%) Group 1 0 (PF1) (PE3) (PE1) 21.56 P. foetida P. e du li s P. e du li s ( (PE4) 2 P. e du li s

DF P. e du li s (PE2) −10 Group 2

P. incarnata −20

−30 −30 −20 −10 0 10 20 30 DF1 (64.13%) (b)

Figure 1: (a) Plot of the morphological parameters of the Passiflora accessions. Percentages in parentheses represent the variation in each component. (b) Positions of the DF scores of nine Passiflora accessions relative to DF1 and DF2. species also produced the largest fruit (22.38 × 12.96 cm, maliformis wasclearlyseparatedintoGroup4nearthe with an average weight of 2.0 kg). Simultaneously, the size positive ends of the DF2 axis, and the members of this group of the seed also was statistically different from all other were highly correlated with respect to bract length and width. species assessed. In all species except P. qu adrang u l ar i s ,the The bract structure of P. malifor mi s differed from that of other pulp represented 50–58% of the weight of the fruit; in P. species; in particular, the three bracts of this species fused quadrangularis, the pulp represented 11–15% of the fruit together and formed large cups around the bud or flowers. weight. The exocarp of the fruits of this group was thin, and The bract of P. malifor mi s was twice as large (6.69 ± 0.16 cm) thepulpwasacidic,paleorange,andsweet.Theripened as that of P. e du li s (3.37 ± 0.07 cm). The last group consisted mesocarp was 2.5–3.0 cm thick which is edible. Passiflora of cultivars of P. fo eti d a : P. fo eti d a with green bracts (PF1) The Scientific World Journal 7 and P. fo eti d a with red bracts (PF2). These species clearly rangeofts:tvvaluewasfoundtobe1.515andthisvalue diverged from the other cultivated Passiflora accessions that was used in all subsequent maximum likelihood analyses. were located at the negative ends of the DF1 and DF2 axes. The obtained ML tree was constructed using a heuristic Few differences in plant morphology were observed between search that was performed using the NNI branch swapping these two wild Passiflora cultivars with different bracts and option (− ln 𝐿 = 1426.54). For the MP analysis, the most fruit colors. The plant parts of both species were covered with parsimonious tree generated by phylogenetic analysis had a numerous, small sticky glands and sticky hairs. consistency index (CI) of 0.708, a retention index (RI) of According to Martins et al. [42], the variation observed in 0.805, and a rescaled consistency index (RCI) of 0.569. The fruit morphology is very common even at intraspecific level. bootstrap analyses indicated high support for the main clades The variation may be attributed to environmental factors within the phylogenetic tree. or genetic differences or both. The variations in the fruit The results of algorithms applied (ML and MP) showed traits were attributed to differences in the age of the plant, that samples examined were distributed into two distinct fruit maturation stage, geographical sites, climatic condition, well-supported clades. All of the Passiflora accessions occu- soil properties, and also seed origin [10]. Additionally, the pied separate topological positions; that is, no overlap among complex nondominant inheritance of the external color of species was observed. The resultant MLFigure ( 2(a))and the fruit renders species identification even more challenging, MP trees (Figure 2(b)) were very similar; yet variation in the asanumberofintermediatecolorscanbeproducedinP. bootstrap support values and positioning of certain species edulis [43]. In the present study, the cultivars of P. e du li s were was observed. Subgenus Passiflora was supported as mono- recognized and named accordingly with the International phyletic linkage in both ML and MP trees obtained. This is Code of Botanical Nomenclature based on their significant agreeable with finding of Muschner et al. [32]andKrosnick agronomic characteristics [43]. Assessments of morpholog- et al. [44]. The MP topology was chosen for discussion as ical characteristics grouped the species according to their it showed stronger bootstrap supports and gave insight into similarities. In accordance with the current study, Viana et al. relationship within the subgenus Passiflora with Passiflora [10] assessed the morphological diversity in six wild Passiflora accessions examined arranged following their supersection species and stated the interspecific variability was observed and section or series recognized by Feuillet and MacDougal fornumberofflowers,numberoffruits,seeds,fruitlength, [7]. fruit width, leaf area, and leaf length. Crochemore et al. [9] The MP analysis yielded a most parsimonious tree with obtained clear separation among the 55 accessions consisting high proportion informative sites (37.2%) and resulted in two of 11 species from subgenus Passiflora by using morphological well resolved major clades. As was observed with the ML approach. The authors also recorded high divergence of P. analysis, a similar topological pattern was recorded for the foetida from other Passiflora probably due to the diversity of cultivars of P. fo eti d a in clade 1 (bootstrap score of 99%), species studied and this was agreeable with Viana et al. [16] which was basal to the clade containing other Passiflora who worked with different accessions of cultivated and wild accessions (i.e., P. caerulea, P. incarnata, P. maliformis, P. species of Passiflora. quadrangularis,P.vitifolia,P.alata,P.platyloba,and P. e du li s ). The constructed phylogeny tree was in agreement with the morphological assessment, confirming the divergence of wild 3.2. Sequences Characteristics. The PCR products for all of P. fo eti d a from all other cultivated species. Clade 2 con- the studied species were approximately 680 base pairs in sisted of other Passiflora accessions with moderately strong length. The final dataset of aligned ITS sequence (including bootstrap scores of 87%. In this clade, six well-separated outgroup) used for the phylogenetic analysis consisted of subclades based on species similarities were formed. Subclade 39 accessions from 13 Passiflora species. The final align- 1 consisted of all P. e du li s individuals that clustered as a single ment was highly variable, with 37.2% of sites that were group. The four accessions of P. e du li s from East Malaysia parsimony informative. The guanine-cytosine (GC) content were clustered in the same group and all of these accessions of the Passiflora species ranged from 60% to 64% and were well segregated based on their genetic similarity. In averaged 63%. Muschner et al. [32] reported similar GC agreement with the ML analysis, P. e du li s (PE4) occupied the contents in the Passiflora subgenusandstatedthattheGC base of this subclade. Subclade 2 consisted of P. incarnata content of Passiflora was higher than the GC content (53%) accessions. Subclades 1 and 2 belonged to the Passiflora encountered in other subgenera (i.e., Decaloba, Adopogyne, supersection. Passiflora vitifolia, which is a member of the Murucuja, Pseudomurucuja, and Deidamioides). The genetic Coccinea supersection, was clustered in subclade 3 and pairwise distance among taxa estimated with the Tamura 3- formed an independent lineage. Accessions of P. cae r u l e a parameter model was calculated using complete sequence were clustered in subclade 4, with scores of 99%. Passiflora data (including data from outgroups); this distance ranged caerulea was assigned to categories based on morphological from 0 to 45.5% and averaged 16.1%. characteristics belonging to the Stipulata supersection and the Granadillastrum section, as proposed by Feuillet and 3.3. Phylogenetic Analysis. Phylogenetic analyses were per- MacDougal [7]. Passiflora foetida, which belongs to the formed using maximum likelihood (ML) and maximum StipulatasupersectionandtheDysosmiaseries,evolved parsimony (MP) method. For ML analysis using the Tamura separately from P. cae r u l e a . A similar pattern was recorded 3-parameter model with gamma distributions (T92+G) was by Muschner et al. [32],whoobservedhighdivergence selected as the best-fitting substitution model. The optimal between P. cae r u l e a and P. fo eti d a .Becauseofitsdivergence 8 The Scientific World Journal

1,2,3 EU258379.1 Passiflora edulis (Brazilian state ) 1,2,3 EU258378.1 Passiflora edulis (Brazilian state ) 1,2,3 EU258383.1 Passiflora edulis (Brazilian state ) Passiflora edulis (PE2) ∗ AF454803.1 Passiflora edulis (Netherland ) 1,2,3 EU258382.1 Passiflora edulis (Brazilian state ) 1,2,3 82 69 EU258381.1 Passiflora edulis (Brazilian state ) (PE1) Passiflora edulis 1,2,3 EU258384.1 Passiflora edulis (Brazilian state ) 1,2,3 EU258380.1 Passiflora edulis (Brazilian state ) 1,2,3 EU258376.1 Passiflora edulis (Brazilian state ) Passiflora edulis (PE3) 1,2,3 EU258375.1 Passiflora edulis (Brazilian state ) 2 Passiflora edulis (PE4) AF454796.1 Passiflora vitifolia (unknown) ∗ 85 99 AF454802.1 Passiflora caerulea (Netherland ) EU258315.1 Passiflora caerulea (RS Brazilian state) AF454801.1 Passiflora ambigua (unknown) AF454798.1 (USA) 91 Passiflora platyloba 99 Passiflora maliformis 85 AY210956.1 Passiflora maliformis (Dominica) 99 Passiflora incarnata DQ344630.1 Passiflora incarnata (Brazilian state) AY032826.1 Passiflora alata (Viamao, RS) Passiflora quadrangularis 65 AF454799.1 Passiflora quadrangularis (FrenchGuiana) AY636107.1 Passiflora quadrangularis (Ohio State) 1,2,4 EU258393.1 Passiflora foetida (Brazilian state ) 1,2,4 EU258389.1 Passiflora foetida (Brazilian state ) DQ521376.1 Passiflora foetida (United States) DQ238783.1 Passiflora foetida (Recife, PE) DQ238784.1 Passiflora palmeri (Brazilian state) 98 1,2,4 1 EU258394.1 Passiflora foetida (Brazilian state ) JQ723359.1 Passiflora foetida (Ecuador) DQ499117.1 Passiflora foetida (tropical regions) 73 Passiflora foetida (PF1) 95 Passiflora foetida (PF2) AY102365.1 Paropsia madagascariensis AY102359.1 Mitostemma brevifilis (a) 84 EU258382.1 (Brazilian state1,2,3) Passiflora edulis 1,2,3 EU258381.1 Passiflora edulis (Brazilian state ) EU258378.1 (Brazilian state1,2,3) Passiflora edulis 1,2,3 EU258383.1 Passiflora edulis (Brazilian state ) AF454803.1 Passiflora edulis (Netherland∗) Passiflora edulis (PE2) Passiflora 82 Passiflora edulis (PE1) 1,2,3 EU258379.1 Passiflora edulis (Brazilian state ) 71 EU258384.1 (Brazilian state1,2,3) Passiflora edulis 1,2,3 Passiflora EU258380.1 Passiflora edulis (Brazilian state ) Passilfora edulis (PE3) EU258375.1 (Brazilian state1,2,3) Passiflora edulis 1,2,3 EU258376.1 Passiflora edulis (Brazilian state ) 2 75 Passiflora edulis (PE4) 99 Passiflora incarnata Passiflora 87 DQ344630.1 Passiflora incarnata (Brazilian state) Coccinea AF454796.1 (unknown) Passiflora vitifolia ∗ 99 AF454802.1 Passiflora caerulea (Netherland ) Granadillastrum EU258315.1 Passiflora caerulea (RS,Brazilian state) 90 AF454801.1 Passiflora ambigua (unknown) Laurifoliae

AF454798.1 Passiflora platyloba (USA) Stipulata 99 AY210956.1 Passiflora maliformis (Dominica) Tiliifolia 95 Passiflora maliformis Passiflora quadrangularis 78 AY636107.1 Passiflora quadrangularis (Ohio State) 68 AF454799.1 Passiflora quadrangularis (French Guiana) Quadrangulares AY032826.1 Passiflora alata (Viamao, RS) Laurifolia EU258389.1 (Brazilian state1,2,4) Passiflora foetida 1,2,4 EU258393.1 Passiflora foetida (Brazilian state ) 1 99 DQ238784.1 Passiflora palmeri (Brazilian state) DQ521376.1 Passiflora foetida (United State) DQ238783.1 Passiflora foetida (Recife, PE) Dysosmia JQ723359.1 Passiflora foetida (Ecuador) 1,2,4 EU258394.1 Passiflora foetida (Brazilian state ) DQ499117.1 Passiflora foetida (tropical regions) Stipulata 74 Passiflora foetida (PF1) 95 Passiflora foetida (PF2) AY102365.1 Paropsia madagascariensis AY102359.1 Mitostemma brevifilis

(b)

Figure 2: (a) Phylogenetic tree of Passiflora accessions inferred from the ML analysis using the Tamura three-parameter model. Only bootstrap scores greater than 60% are shown. Mitostemma brevifilis and Paropsia madagascariensis were used as outgroups. (b) Phylogenetic tree of Passiflora accessions inferred from parsimony analysis (full heuristic search with the tree bisection reconnection method). The Scientific World Journal 9 from other species in the Passiflora subgenus, the placement The level of variation observed in the ITS region dataset of Dysosmia into a separate subgenus, was proposed by was consistent with observations of Muschner et al. [32] Yockteng and Nadot [17] and is supported by the present and Krosnick and Freudenstein [46]andmaybeduetothe finding as evident in Figure 2(b). Subclade 5 comprised percentage of missing sequence data for the four reference P. ambig u a , P. pl at y l ob a , and P. malifor mi s , and subclade 6 sequences used by Muschner et al. [32]; this variation com- was composed of P. qu adrang u l ar i s and P. al ata , which both plicated the final alignment using MUSCLE with different belong to the Laurifolia supersection. The P. malifor mi s and gap extensions. The final alignment was chosen based on P. pl at y l ob a belonged to the same series (Tiliifolia), while P. thecongruenceinpublishedrelationshipsamongoutgroups quadrangularis was placed under series of Quadrangulares. [32, 46]. Besides the ITS region, other markers such RAPD, The present study revealed certain degree of variation AFLP, SSR, and, cpDNA also make a direct comparison detected in the ITS region sequence in all the individuals of these studies difficult and challenging; because of that examined. This is in agreement withader M¨ et al. [31], where intraspecific variation is not evenly distributed among species in Passiflora the ITS region resulted in more informative sites and led to different datasets for the same species (i.e., P. than other markers (i.e., cpDNA). The ITS region provided caerulea, P. e du li s , and P. malifor mi s ). This may be attributed greater resolution at the species level and was useful for to the complexities of the evolutionary history of the genus differentiating the major groups of the Passiflora subgenus. andindicatesthatrobustpatternswouldonlyemergewhen Krosnick et al. [44]alsohavereportedtheITSdataprovide different markers are considered together [31]. greaterresolutionthanncpGSandtrnL-trnFatthespecies The molecular phylogenetic placement of the individuals level within Passiflora.Krosnicketal.[44]alsoshowedthat in Passiflora subgenus were clearly separated than the sub- the subgenus Passiflora is monophyletic (97%) as observed genera of Astrophea or Distephana and was also supported in the present study compared to other subgenera (i.e., by the morphological classification [45]. The present study Deidamioides) which is polyphyletic. showed, the MP phylogenetic tree was congruent with the Pattern of intraspecific variability in Passiflora using ITS classification based on morphological descriptions of Feuillet region has been also studied by Muschner et al. [32]who and MacDougal [7]wherethesubgenusPassiflora are cate- investigate the relationship of 61 species of Passiflora com- gorized into six supersections. Morphologically, supersection posing the entire subgenera which was formally classified in Passiflora comprises those species that have serrate leaves, 11 subgenera and representatives of four other genera. Based free serrate bracts, and upright flowers with a dominating on the phylogenetic tree obtained from ML analysis yielded corona as observed in P. e du li s and P. incarnata.Thesuper- 3 major clades; representing subgenus Passiflora, Decaloba section Stipulata is divided into three sections and section and Astrophea and the position of subgenus Deidamioides Granadillastrum with the richest species comprised plant was undefined. The MP tree obtained was very similar to the with entire 3–5 lobed leaves and conspicuous upright flowers respective ML tree was agrees with the current finding. The with free bracts (i.e., P. cae r u l e a ). Essential characteristics of present results revealed some differences on the positioning the species from supersection Laurifolia are large pendent of few Passiflora species in both the trees. Muschner et al. flowers with predominant corona that surrounds the ovary [32] stated that, although there are some consistent species in a campanulate fashion. This group possessed 3 series. grouping within the Passiflora clade, only few of them Whenthebractsareconnate,atleastatbase,thischaracteris have high support and are consistent among markers and sufficient to assign the species to series Tiliifolia as recorded phylogenetic method, that is, P. qu adrang u l ar i s and P. al ata in P. malifor mi s .TheP. qu adrang u l ar i s is well known species group. Most of this subgroup however, are not consistence of series Quadrangulares because of its winged, angled stems with Killip’s [6] subgenera or sections. andpossesseslarge,unlobedleaveswithentiremargin. In accordance with the present finding, studies by Thus,theclassificationbasedonthemorphologicalchar- Ossowski [45] revealed that within Passiflora,thegroupP. acteristics supports our phylogenetic topology in subgenus menispermifolia, P. oerstedii, and P. cae r u l e a as well as the Passiflora. The present work provides the better integration species pairs P. pl at y l ob a with P. ambig u a and P. qu adrang u - of morphological data and ITS sequences to understand the relationship within subgenus Passiflora. Although our laris with P. al ata are relatively well supported. The authors analyses considered only nine species, our results can be used mentioned that the MP and ML trees obtained were not to study phylogenetic relationships of closely related species congruent and this was in contrast to the ML and MP topolo- and the separate topologies of different species. gies of present study. This contradicts the highly derived position in the parsimony tree. Mader¨ et al. [31]studied the intraspecific genetic diversity in 23 species of genus 4. Conclusion Passiflora consisting of subgenera Decaloba and Passiflora using ITS markers. The work by Mader¨ et al. [31]revealed This study provides an overview of a variety of genetically dif- that the Passiflora and Decaloba subgenera showed significant ferent individuals that could be commercialized in Malaysia differences in the sizes of the ITS regions and in GC content, andusedinfuturebreedingprograms.Ourresultsconfirm which can be related to reproductive characteristics of species that the ITS region provides high resolution at the species in these subgenera. The clear seperation obtained within level and is useful for differentiating the major groups of six species indicated that ITS may be a useful tool for the the Passiflora subgenus. Although the analysis presented here evaluation of intraspecific genetic variation in Passiflora. was based on a limited number of species, the ITS region 10 The Scientific World Journal

provided good resolution. Further studies using more species of Passiflora in Andean countries,” Genetic Resources and Crop should be undertaken to obtain a good understanding of the Evolution,vol.50,no.6,pp.555–566,2003. evolutionary history of this plant at the species level and to [13]P.P.Abreu,M.M.Souza,E.A.Santos,M.V.Pires,M.M.Pires, enable the conservation of this economically important crop. and A.-A. F. de Almeida, “Passion flower hybrids and their use in the ornamental plant market: perspectives for sustainable development with emphasis on Brazil,” Euphytica,vol.166,no. Conflict of Interests 3,pp.307–315,2009. [14] V. C. Muschner, A. P. Lorenz-Lemke, M. Vecchia, S. L. Bonatto, The authors declare that there is no conflict of interests F. M. Salzano, and L. B. Freitas, “Differential organellar inher- regarding the publication of this paper. itance in Passiflora's (Passifloraceae) subgenera,” Genetica,vol. 128, no. 1–3, pp. 449–453, 2006. Acknowledgments [15] S. Segura, G. C. d'Eeckenbrugge, A. Bohorquez, P. Ollitrault, and J. Tohme, “An AFLP diversity study of the genus Passiflora This study was funded by the Ministry of Higher Education focusing on subgenus Tacsonia,” Genetic Resources and Crop Malaysia and Universiti Putra Malaysia (UPM) under the Evolution,vol.49,no.2,pp.111–123,2002. RUGS-01-01-12-1592RU titled “Comparative studies on pas- [16] A. P. Viana, T. N. S. Pereira, M. G. Pereira, M. M. Souza, J. F. M. sion fruit species and their potential uses.” The authors are Maldonado, and A. T. Amaral, “Genetic diversity among yellow grateful to the American Journal Expert (AJE), for revising passion fruit commercial genotypes and among Passiflora and checking the English in this paper. species using RAPD,” Revista Brasileira de Fruticultura,vol.25, no.3,pp.489–493,2003. [17] R. Yockteng and S. Nadot, “Phylogenetic relationships among References Passiflora species based on the glutamine synthetase nuclear gene expressed in chloroplast (ncpGS),” Molecular Phylogenetics [1] T. Ulmer and J. M. MacDougal, Passiflora: Passionflowers of the and Evolution,vol.31,no.1,pp.379–396,2004. World, Timber Press, Portland, Ore, USA, 1st edition, 2004. [18] H. M. Paikrao, A. S. Patil, V. J. Gaikwad et al., “Comparative [2] J. Ocampo, D. G. Coppens, M. Restrepo, A. Jarvis, M. Salazar, phylogenetic analysis of Passiflora based on protein marker and C. Caetano, “Diversity of Colombia Passifloraceae: bio- chloroplast expressed glutamine synthetase and ribosomal pro- geography and an updated list for conservation,” Biota Colom- tein S4 (rpS4),” JournalofAdvancedBioinformaticsApplications biana,vol.8,pp.1–45,2007. and Research,vol.1,pp.1–6,2010. [3] F. W. Martin and H. Y. Nakasone, “The edible species of [19]E.J.Oliveira,J.G.Padua,M.I.Zucchi,L.E.A.Camargo,´ Passiflora,” Economic Botany,vol.24,no.3,pp.333–343,1970. M. H. P. Fungaro, and M. L. C. Vieira, “Development and [4]D.C.Ortiz,A.Bohorquez,M.C.Duque,J.Tohme,D.Cu´ ellar,´ characterization of microsatellite markers from the yellow and T. Mosquera Vasquez,´ “Evaluating purple passion fruit passion fruit (Passiflora edulis f. flavicarpa),” Molecular Ecology (Passiflora edulis Sims f. edulis) genetic variability in individuals Notes,vol.5,no.2,pp.331–333,2005. from commercial plantations in Colombia,” Genetic Resources [20] D. Fajardo, F. Angel, M. Grum et al., “Genetic variation analysis and Crop Evolution,vol.59,no.6,pp.1089–1099,2012. of the genus Passiflora L. using RAPD markers,” Euphytica,vol. [5] H. Harms, Passifloraceae, Wilhelm Engelmann, Leipzig, Ger- 101, no. 3, pp. 341–347, 1998. many, 1925. [21] A. P. A. Aukar, E. G. M. Lemos, and J. C. Oliveira, “Genetic [6]E.P.Killip,The American Species of Passifloraceae,vol.19of variations among passion fruit species using RAPD markers,” Botanical Series, Publications of the Field Museum of Natural Revista Brasileira de Fruticultura,vol.24,no.3,pp.738–740, History, 1938. 2002. [22] M. L. Crochemore, H. B. C. Molinari, and L. G. E. Vieira, [7] C. Feuillet and J. M. MacDougal, “Anew infrageneric classifica- “Genetic diversity in passion fruit (Passiflora spp.) evaluated by tion of Passiflora L., (Passifloraceae),” Studia Geomorphologica RAPD markers,” Brazilian Archives of Biology and Technology, Carpatho-Balcanica,vol.13,pp.34–38,2004. vol. 46, no. 4, pp. 521–527, 2003. [8] I. Sanchez,F.Angel,M.Grumetal.,“Variabilityofchloroplast´ [23] C. B. M. Cerqueira-Silva, C. B. Cardoso-Silva, E. S. L. Santos et DNA in the genus Passiflora L.,” Euphytica,vol.106,no.1,pp. al., “Genetic diversity in wild species of passion fruit (Passiflora 15–26, 1999. trintae)basedonmolecularmarkers,”Genetics and Molecular [9]M.L.Crochemore,H.B.Molinari,andN.M.Stenzel,“Agro- Research,vol.9,no.4,pp.2123–2130,2010. morphological characterization of passion fruit (Passiflora spp.) [24] B. G. Baldwin, “Phylogenetic utility of the internal transcribed germplasm,” Revista Brasileira de Fruticultura,vol.25,no.1,pp. spacers of nuclear ribosomal DNA in plants: an example from 5–10, 2003. the compositae,” Molecular Phylogenetics and Evolution,vol.1, [10] A. J. C. Viana, M. M. Souza, I. S. Araujo,´ R. X. Correa,ˆ and no.1,pp.3–16,1992. D. Ahnert, “Genetic diversity in Passiflora species determined [25] I. Alvarez´ and J. F. Wendel, “Ribosomal ITS sequences and plant by morphological and molecular characteristics,” Biologia Plan- phylogenetic inference,” Molecular Phylogenetics and Evolution, tarum,vol.54,no.3,pp.535–538,2010. vol.29,no.3,pp.417–434,2003. [11] L. F. dos Santos, E. J. de Oliveira, A. dos Santos Silva, F. M. de [26] M. Calonje, S. Mart´ın-Bravo, C. Dobeˇs et al., “Non-coding Carvalho,J.L.Costa,andJ.G.Padua,´ “ISSR markers as a tool nuclear DNA markers in phylogenetic reconstruction,” Plant for the assessment of genetic diversity in Passiflora,” Biochemical Systematics and Evolution,vol.282,no.3-4,pp.257–280,2009. Genetics, vol. 49, no. 7-8, pp. 540–554, 2011. [27] G. Sonnante, I. Galasso, and D. Pignone, “ITS sequence analysis [12] S. Segura, G. C. d'Eeckenbrugge, L. Lopez,´ M. Grum, and L. and phylogenetic inference in the genus Lens mill,” Annals of Guarino, “Mapping the potential distribution of five species Botany,vol.91,no.1,pp.49–54,2003. The Scientific World Journal 11

[28]C.T.Wang,X.Z.Wang,Y.Y.Tangetal.,“Phylogeny [44] S. E. Krosnick, K. E. Porter-Utley, J. M. MacDougal, P. E. of Arachis based on internal transcribed spacer sequences,” Jorgensen, and L. A. McDade, “New insights into the evolution Genetic Resources and Crop Evolution,vol.58,no.2,pp.311–319, of Passiflora subgenus Decaloba (Passifloraceae): phylogenetic 2011. relationships and morphological synapomorphies,” Systematic [29] E. S. Buckler IV and T. P. Holtsford, “Zea ribosomal repeat Botany,vol.38,no.3,pp.692–713,2013. evolution and substitution patterns,” Molecular Biology and [45] A. Ossowski, Coevolution of Heliconius spp. and Passiflora spp.: Evolution,vol.13,no.4,pp.623–632,1996. a phylogenetic comparison [M.S. thesis],BrockUniversity,St. [30] F. T. Short, G. E. Moore, and K. A. Peyton, “Halophila ovalis in Catharines, Canada, 2002. the Tropical Atlantic Ocean,” Aquatic Botany,vol.93,no.3,pp. [46] S. E. Krosnick and J. V. Freudenstein, “Monophyly and flo- 141–146, 2010. ral character homology of old world Passiflora (Subgenus [31] G. Mader,P.M.Zamberlan,N.J.R.Fagundesetal.,“Theuse¨ Decaloba: Supersection Disemma),” Systematic Botany,vol.30, and limits of ITS data in the analysis of intraspecific variation no. 1, pp. 139–152, 2005. in Passiflora L. (Passifloraceae),” Genetics and Molecular Biology, [47] D. J. Hearn, “Adenia (Passifloraceae) and its adaptive radiation: vol.33,no.1,pp.99–108,2010. phylogeny and growth form diversification,” Systematic Botany, [32] V.C. Muschner, A. P.Lorenz, A. C. Cervi et al., “Afirst molecular vol. 31, no. 4, pp. 805–821, 2006. phylogenetic analysis of Passiflora (Passifloraceae),” American [48] M. Thulin, S. G. Razafimandimbison, P. Chafe, N. Heidari, Journal of Botany,vol.90,no.8,pp.1229–1238,2003. A. Kool, and J. S. Shore, “Phylogeny of the turneraceae clade [33]A.K.Hansen,L.E.Gilbert,B.B.Simpson,S.R.Downie, (Passifloraceae s.l.): trans-atlantic disjunctions and two new A. C. Cervi, and R. K. Jansen, “Phylogenetic relationships genera in Africa,” Taxon,vol.61,no.2,pp.308–323,2012. and chromosome number evolution in Passiflora,” Systematic [49] S. Wright, J. Keeling, and L. Gillman, “The road from Santa Botany,vol.31,no.1,pp.138–150,2006. Rosalia: a faster tempo of evolution in tropical climates,” [34] E. A. Santos, M. M. Souza, A. P. Viana, A. A. Almeida, J. C. Proceedings of the National Academy of Sciences of the United Freitas, and P. R. Lawinscky, “Multivariate analysis of morpho- States of America,vol.103,no.20,pp.7718–7722,2006. logical characteristics of two species of passion flower with ornamental potential and of hybrids between them,” Genetics and Molecular Research,vol.10,no.4,pp.2457–2471,2011. [35] I. Feliciello and G. Chinali, “A modified alkaline lysis method for the preparation of highly purified plasmid DNA from Escherichia coli,” Analytical Biochemistry,vol.212,no.2,pp. 394–401, 1993. [36] T. J. White, T. Bruns, S. Lee, and J. Taylor, “Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics,” in PCR Protocols: A Guide to Methods and Applications, M. Innis, D. Gelfand, J. Sninsky, and T. J. White, Eds., Academic Press, San Diego, Calif, USA, 1990. [37] K. R. Paithankar and K. S. N. Prasad, “Precipitation of DNA by polyethylene glycol and ethanol,” Nucleic Acids Research,vol.19, no.6,p.1346,1991. [38] D. A. Nickerson, V. O. Tobe, and S. L. Taylor, “PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing,” Nucleic Acids Research,vol.25,no.14,pp.2745–2751,1997. [39] R. C. Edgar, “MUSCLE: a multiple sequence alignment method with reduced time and space complexity,” BMC Bioinformatics, vol. 5, article 113, 2004. [40] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, and S. Kumar, “MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and max- imum parsimony methods,” Molecular Biology and Evolution, vol. 28, no. 10, pp. 2731–2739, 2011. [41] B. G. Hall, Phylogenetic Trees Made Easy: A How-to Manual, Sinauer Associates, Sunderland, Mass, USA, 4th edition, 2011. [42]M.R.Martins,J.C.Oliveira,A.O.diMauro,andP.C.Silva, “Assessment of populations of sweet passion fruit (Passiflora alata Curtis) obtained from open pollination,” Revista Brasileira de Fruticultura,vol.25,no.1,pp.111–114,2003. [43] L. C. Bernacci, M. D. Soares-Scott, N. T. V. Junqueira, I. R. D. S. Passos, and L. M. M. Meletti, “Passiflora edulis Sims: the correct taxonomic way to cite the yellow passion fruit (and of others colors),” Revista Brasileira de Fruticultura,vol.30,no.2,pp. 566–576, 2008. International Journal of International Journal of Peptides Genomics

Advances in BioMed Stem Cells Research International International Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 Virolog y http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Journal of Nucleic Acids

Zoology International Journal of Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Submit your manuscripts at http://www.hindawi.com

Journal of The Scientific Signal Transduction World Journal Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Genetics Anatomy International Journal of Biochemistry Advances in Research International Research International Microbiology Research International Bioinformatics Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014

Enzyme International Journal of Molecular Biology Journal of Archaea Research Evolutionary Biology International Marine Biology Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation Hindawi Publishing Corporation http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014 http://www.hindawi.com Volume 2014