DOCSLIB.ORG

Core Domain Apoptotic Cells Is Mediated by the Annexin The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Core Domain Apoptotic Cells Is Mediated by the Annexin The The Tolerogenic Function of Annexins on Apoptotic Cells Is Mediated by the Annexin Core Domain This information is current as Björn Linke, Lucie Abeler-Dörner, Veronika Jahndel, of September 28, 2021. Alexandra Kurz, Andrea Mahr, Sandra Pfrang, Linda Linke, Peter H. Krammer and Heiko Weyd J Immunol published online 27 April 2015 http://www.jimmunol.org/content/early/2015/04/25/jimmun ol.1401299 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2015/04/25/jimmunol.140129 Material 9.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published April 27, 2015, doi:10.4049/jimmunol.1401299 The Journal of Immunology The Tolerogenic Function of Annexins on Apoptotic Cells Is Mediated by the Annexin Core Domain Bjo¨rn Linke, Lucie Abeler-Do¨rner,1 Veronika Jahndel,2 Alexandra Kurz, Andrea Mahr,3 Sandra Pfrang, Linda Linke,4 Peter H. Krammer, and Heiko Weyd Immunological tolerance is constantly being maintained in the periphery by dendritic cells processing material from apoptotic cells (ACs) in the steady-state. Although research has focused on the uptake of ACs by phagocytes, tolerogenic signals exposed by the ACs are much less well defined. In this article, we show that the annexin (Anx) family members AnxA5 and AnxA13 translocate to the surface of ACs to function as redundant tolerogenic signals in vitro and in vivo. Exposure of bone marrow–derived dendritic cells to AnxA5 or AnxA13 in vitro resulted in the inhibition of both proinflammatory cytokine secretion and the upregulation of costimulatory molecules upon TLR stimulation. The highly conserved Anx core domain was sufficient to mediate these effects, whereas recognition by N-formyl peptide receptor family members was dispensable. In vivo, coinjection of OVA-expressing and Downloaded from Anx-expressing ACs prevented induction of Ag-specific CD8+ T cells. Moreover, mice immunized with Anx-expressing ACs became refractory to an antigenic challenge. These results suggest that several Anxs contribute to AC-induced suppression of dendritic cell activation. Therefore, manipulating Anx-mediated immunosuppression may prove beneficial for patients with cancer or autoimmune diseases and chronic inflammatory disorders. The Journal of Immunology, 2015, 194: 000–000. ne crucial mechanism of peripheral tolerance induction is AnxA1 belongs to an evolutionarily conserved family of proteins http://www.jimmunol.org/ the uptake, processing, and presentation of apoptotic cell that binds to negatively charged phospholipids in a Ca2+-dependent O (AC)-derived Ags by professional phagocytes (1). In the manner (12). Lipid binding is mediated by the C-terminal core steady-state, immature dendritic cells (DCs) continuously engulf domain, which is highly conserved among all Anx family mem- ACs and present self-Ags from peripheral tissues in the draining bers (12, 13). The N-terminal domain is unique for each Anx and lymph nodes (2, 3). In the absence of inflammation or infection, the is proposed to mediate specific functions of individual Anxs (12, presentation of self-Ags to naive T cells induces tolerance (4–6). 14). Peptides corresponding to the AnxA1 N terminus were shown Defects in AC uptake, AC processing, or tolerization of phagocytes to bind to members of the N-formyl peptide receptor (FPR) family, after AC uptake have been implicated in the development of au- resulting in a reduction of neutrophil transmigration in several toimmune diseases and chronic inflammatory disorders (7–10). models of acute and chronic inflammation (15–18). Downstream by guest on September 28, 2021 Although a plethora of eat-me signals and their uptake receptors on signaling induced by binding of AnxA1 N-terminal peptides to FPR phagocytes are well characterized, little is known about molecules family members causes activation of ERK but not of p38 or JNK (19, on ACs that mediate DC tolerization. Recently, we identified the 20). Additional anti-inflammatory properties of AnxA1 have been early exposure of the cytosolic protein annexin (Anx)1 (AnxA1) as attributed to the inhibition of cytosolic phospholipase A2 (cPLA2) a tolerogenic signal on the surface of ACs (11). and secretory phospholipase A2 (sPLA2) activity (21–23). Inhibition of sPLA2 is mediated by the antiflammin-2 (AF-2) sequence, which also negatively regulates polymorphonuclear leukocyte adhesion to Division of Immunogenetics, Tumor Immunology Program, German Cancer Re- search Center, 69120 Heidelberg, Germany activated endothelium by binding to human FPR2 (24). 1 The presence of multiple Anx family members in all higher Current address: Peter Gorer Department of Immunobiology, King’s College Lon- don, London, U.K. eukaryotes suggests a fundamental role for Anxs in cell biology. 2Current address: BioNTech, Mainz, Germany. However, mice deficient in individual Anx family members have 3Current address: immatics biotechnologies, Tubingen,€ Germany. no severe phenotype, suggesting that several Anxs have (partially) 4 overlapping functions (12, 25). In fact, functional redundancy of Current address: Division of Pediatric Neurooncology, German Cancer Research Center, Heidelberg, Germany. Anxs was proved in the context of membrane trafficking, inhibition Received for publication May 20, 2014. Accepted for publication March 30, 2015. of phospholipase A2 activity, and blood coagulation (12). Whether Address correspondence and reprint requests to Dr. Heiko Weyd and Dr. Peter H. tolerance induction, which we showed to be mediated by AnxA1, is Krammer, Division of Immunogenetics, Tumor Immunology Program, German Cancer a property shared by several Anx family members and, therefore, Research Center, Im Neuenheimer Feld 280, Heidelberg, Baden-Wurttemberg€ 69120, represents an additional redundant function of Anxs is unknown (11). Germany. E-mail addresses: [email protected] (H.W.) and [email protected] (P.H.K.) In this article, we describe two novel tolerogenic signals on the The online version of this article contains supplemental material. surface of ACs, AnxA5 and AnxA13, promoting the development of Abbreviations used in this article: 7-AAD, 7-aminoactinomycin D; AC, apoptotic DCs with a tolerogenic phenotype (i.e., DCs with an impaired cell; AF-2, antiflammin-2; Anx, annexin; aS2 AnxA1, AnxA1-expressing apoptotic S2 cell; aS2 AnxA5, AnxA5-expressing apoptotic S2 cell; aS2 AnxA13, AnxA13- upregulation of costimulatory molecules and with low proin- expressing apoptotic S2 cell; aS2 mock, mock-transfected apoptotic S2 cell; aS2 flammatory cytokine secretion upon TLR stimulation). These mOVA, apoptotic, membrane-anchored OVA–expressing S2 cell; BM, bone marrow; effects were mediated by the Anx core domain and were inde- BMDC, BM-derived DC; cPLA2, cytosolic phospholipase A2; DC, dendritic cell; FPR, N-formyl peptide receptor; lpr, lymphoproliferation; m, mouse; mOVA, pendent of N-terminal peptides of AnxA1 or the AF-2 sequence. In membrane-anchored OVA; o/n, overnight; PD-L, programmed cell death ligand; line with this, AnxA1, AnxA5, and AnxA13 inhibit the induction sPLA , secretory phospholipase A ; S2, Schneider 2; WT, wild-type. 2 2 of Ag-specific CD8+ T cell responses in vivo. Importantly, mice Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 immunized with AnxA5- or AnxA13-expressing ACs showed www.jimmunol.org/cgi/doi/10.4049/jimmunol.1401299 2 ANNEXINS ARE REDUNDANT TOLEROGENIC SIGNALS ON ACs a significantly reduced population of CD8+ T cells specific for AC- into a modified version of pET41a harboring a C-terminal FLAG tag, a associated Ags and became refractory to an antigenic challenge. PreScission Protease cleavage site, and a protein A tag. Recombinant proteins Based on these results, we propose that several Anxs contribute to wereexpressedintheEscherichia coli strain BL21 (DE3) pLysS (Promega). Removal of LPS during protein purification was achieved by washing with AC-induced immunosuppression in a functionally redundant man- TBS containing 0.1% Triton X-114 (Sigma-Aldrich). Residual LPS concen- ner and, thus, contribute to peripheral tolerance induction. trations in the protein preparations were determined by the Limulus Amebocyte Lysate Assay (Lonza). The mAnxA1-pAc5.1 V5/HisA, mAnxA5- pAc5.1 V5/HisA, and mAnxA13 pAc5.1/V5-HisA plasmids were gen- Materials and Methods erated by cloning mAnxA1, mAnxA5, and mAnxA13, respectively, Mice into pAc5.1/V5-HisA (Life Technologies). Drosophila melanogaster Tlr42/2, AnxA12/2, wild-type (WT), OT-I, and lymphoproliferation (lpr) Schneider 2 (S2) cells were transfected with Ca3(PO4)2,accordingtothe mice (all on a C57BL/6 background) were maintained and bred under manufacturer’s instructions (Life Technologies). To generate
Load more

Recommended publications
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Folliculo-Stellate Cells: Paracrine Communicators in the Anterior Pituitary John Morris* and Helen Christian*
    The Open Neuroendocrinology Journal, 2011, 4, 77-89 77 Open Access Folliculo-stellate Cells: Paracrine Communicators in the Anterior Pituitary John Morris* and Helen Christian* Department of Physiology, Anatomy & Genetics, University of Oxford, South Parks Road, Oxford OX1 3QX, UK Abstract: Most research on the anterior pituitary (adenohypophysis) has concentrated on the endocrine cells characterized by their complement of cytoplasmic dense-cored vesicles containing the classic anterior pituitary hormones. However it has become increasingly clear over the last 20 years that cells first identified more than 50 years ago in the basis that they lack such dense-cored vesicles and now known generically as folliculo-stellate or follicular cells have important physiological functions and act as an adenohypophysis wide communication system. This brief review reveals the need for this communication system, what we know of the plethora of products secreted by Folliculo-Stellate cells, the many receptors to which they respond, and in particular, the role of these enigmatic cells in the physiology of the stress/immune axis, the gonadotroph cells and the pituitary vasculature. Finally we review the current evidence that cells in this category can act as stem cells in the adult pituitary. Keywords: Annexin 1, ABC-transporter, folliculo-stellate. THE NEED FOR COMMUNICATION IN THE basis of morphological criteria [4]. They were named for ANTERIOR PITUITARY their extensive star-like radiating processes and for the microvillus-lined follicles which are formed where the F-S The need for local communication in the nervous system has always been accepted, but has often been overlooked in cells come together.
    [Show full text]
  • Gene Expression Signature for Biliary Atresia and a Role for Interleukin-8
    SUPPLEMENTARY “PATIENTS AND METHODS” “Gene expression signature for biliary atresia and a role for Interleukin-8 in pathogenesis of experimental disease” Bessho K, et al. PATIENTS AND METHODS Patients. Liver biopsies, serum samples and clinical data were obtained from infants with cholestasis enrolled into a prospective study (ClinicalTrials.gov Identifier: NCT00061828) of the NIDDK-funded Childhood Liver Disease Research and Education Network (www.childrennetwork.org) or from infants evaluated at Cincinnati Children’s Hospital Medical Center. For subjects with biliary atresia (BA), liver biopsies were obtained from 64 infants during the preoperative workup or at the time of intraoperative cholangiogram, with ages ranging from 22-169 days after birth (Supplementary Table 7). For subjects with intrahepatic cholestasis (serving as diseased controls, and referred to as non- BA), liver biopsy samples were obtained percutaneously or intraoperatively from 14 infants at the time of diagnostic evaluation, with ages ranging from 19-189 days. Their diagnosis were Alagille syndrome (N=1), multidrug resistance protein-3 deficiency (N=2), alpha-1-antitrypsin deficiency (N=2) and cholestasis with unknown etiology (N=9) (Supplementary Table 7). Representative liver biopsy photomicrographs are shown in Supplementary Figure 6A-D. A third group of normal controls (NC) consisted of liver biopsy samples obtained from 7 deceased-donor children aged 22-42 months as described previously (1). This group serves as a reference cohort, with the median levels of gene expression used to normalize gene expression across all patients in the BA and non-BA groups. This greatly facilitates the visual identification of key differences in gene expression levels between BA and non-BA groups.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Folliculostellate Cell Network: a Route for Long- Distance Communication in the Anterior Pituitary
    Folliculostellate cell network: A route for long- distance communication in the anterior pituitary Teddy Fauquier*, Nathalie C. Gue´ rineau*, R. Anne McKinney†, Karl Bauer‡, and Patrice Mollard*§ *Institut National de la Sante´et de la Recherche Me´dicale (INSERM) Unite´469, Centre National de la Recherche Scientifique–INSERM de Pharmacologie–Endocrinologie, 141 Rue de la Cardonille, 34094 Montpellier Cedex 5, France; †Brain Research Institute, University of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland; and ‡Max-Planck-Institut fu¨r Experimentelle Endokrinologie, Feodor-Lynen-Strasse 7, 30625 Hannover, Germany Edited by Michael V. L. Bennett, Albert Einstein College of Medicine, Bronx, NY, and approved May 9, 2001 (received for review July 21, 2000) All higher life forms critically depend on hormones being rhyth- transfer within the gland. FS cells display a star-shaped cyto- mically released by the anterior pituitary. The proper functioning plasmic configuration intermingled between hormone-secreting of this master gland is dynamically controlled by a complex set of cells. The organization of FS cells within the parenchyma forms regulatory mechanisms that ultimately determine the fine tuning a three-dimensional anatomical network, in the meshes of which of the excitable endocrine cells, all of them heterogeneously the endocrine cells reside (15, 16). Very little is known about the distributed throughout the gland. Here, we provide evidence for functioning of this FS cell network, in particular with regard to an intrapituitary communication system by which information is the dynamics of cellular͞intercellular messages. To study the transferred via the network of nonendocrine folliculostellate (FS) behavior of this network, we measured multicellular changes in 2ϩ cells.
    [Show full text]
  • Involvement of the Gp130 Cytokine Transducer in Mtt/S Pituitary
    European Journal of Endocrinology (2004) 151 595–604 ISSN 0804-4643 EXPERIMENTAL STUDY Involvement of the gp130 cytokine transducer in MtT/S pituitary somatotroph tumour development in an autocrine-paracrine model Mariana Graciarena, Alberto Carbia-Nagashima, Chiara Onofri1, Carolina Perez-Castro, Damiana Giacomini, Ulrich Renner1,Gu¨nter K Stalla1 and Eduardo Arzt Laboratorio de Fisiologı´a y Biologı´a Molecular, Departamento de Fisiologı´a y Biologı´a Molecular y Celular, FCEN, Universidad de Buenos Aires, C1428EHA Buenos Aires, Argentina and 1Department of Endocrinology, Max Planck Institute of Psychiatry, 80804 Munich, Germany (Correspondence should be addressed to E Arzt; Email: [email protected]) (M Graciarena and A Carbia-Nagashima contributed equally to this paper) Abstract Objective: gp130 cytokines are placed as auto-paracrine regulators of pituitary function, since they, as well as their receptors, have been shown to be expressed in and to act in normal and tumoral anterior pituitary cells. The objective of this work was to study their involvement in a model that shows the interaction between different cellular types that participate in a tumorigenic process. Design: The dependence of a pituitary somatotrophic cell line (MtT/S) on a gp130 cytokine-producing folliculostellate (FS) cell line (TtT/GF) for tumorigenesis in vivo has been described. In order to study the participation of gp130 cytokines in the auto-paracrine stimulation of MtT/S growth, we gener- ated MtT/S gp130 sense (gp130-S) and gp130 antisense (gp130-AS) clones stably transfected with pcDNA3/gp130 sense and pcDNA3/gp130 antisense vectors respectively. Methods and results: Functional characterization studies revealed that gp130-AS clones have an inhib- ited gp130 signalling, and proliferation studies showed that they have an impaired response to gp130 cytokines but respond normally to other independent stimuli.
    [Show full text]
  • Human/Mouse Annexin A13 Antibody Antigen Affinity-Purified Polyclonal Goat Igg Catalog Number: AF4149
    Human/Mouse Annexin A13 Antibody Antigen Affinity-purified Polyclonal Goat IgG Catalog Number: AF4149 DESCRIPTION Species Reactivity Human/Mouse Specificity Detects endogenous human and mouse Annexin A13 in Western blots. In Western blots, this antibody did not cross­react with recombinant human Annexin A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, or A11. Source Polyclonal Goat IgG Purification Antigen Affinity­purified Immunogen E. coli­derived recombinant human Annexin A13 Met1­His316 Accession # P27216 Formulation Lyophilized from a 0.2 μm filtered solution in PBS with Trehalose. See Certificate of Analysis for details. *Small pack size (­SP) is supplied either lyophilized or as a 0.2 μm filtered solution in PBS. APPLICATIONS Please Note: Optimal dilutions should be determined by each laboratory for each application. General Protocols are available in the Technical Information section on our website. Recommended Sample Concentration Western Blot 1 µg/mL See Below DATA Western Blot Detection of Human/Mouse Annexin A13 by Western Blot. Western blot shows lysates of human and mouse small intestine tissue. PVDF membrane was probed with 1 µg/mL of Human/Mouse Annexin A13 Antigen Affinity­purified Polyclonal Antibody (Catalog # AF4149) followed by HRP­conjugated Anti­Goat IgG Secondary Antibody (Catalog # HAF017). A specific band was detected for Annexin A13 at approximately 36 kDa (as indicated). This experiment was conducted under reducing conditions and using Immunoblot Buffer Group 1. PREPARATION AND STORAGE Reconstitution Reconstitute at 0.2 mg/mL in sterile PBS. Shipping The product is shipped at ambient temperature. Upon receipt, store it immediately at the temperature recommended below.
    [Show full text]
  • Time Course of Renal Transcriptomics After Subchronic Exposure to Ochratoxin a in Fisher Rats
    toxins Article Time Course of Renal Transcriptomics after Subchronic Exposure to Ochratoxin A in Fisher Rats Laura Pastor 1,2,†,‡, Ariane Vettorazzi 1,2,*,† , Elizabeth Guruceaga 2,3 and Adela López de Cerain 1,2,† 1 Department of Pharmacology and Toxicology, Faculty of Pharmacy and Nutrition, University of Navarra, CIFA Building, c/Irunlarrea 1, E-31008 Pamplona, Spain; [email protected] (L.P.); [email protected] (A.L.d.C.) 2 IdiSNA, Navarra Institute for Health Research, E-31008 Pamplona, Spain; [email protected] 3 Bioinformatics Platform, Center for Applied Medical Research (CIMA), University of Navarra, E-31008 Pamplona, Spain * Correspondence: [email protected]; Tel.: +34-948425600 † These authors contributed equally to this work. ‡ Current address: General Mills, 31570 San Adrián, Navarra, Spain. Abstract: The mycotoxin ochratoxin A (OTA) is a potent nephrocarcinogen, mainly in male rats. The aim of this study was to determine the time course of gene expression (GeneChip® Rat Gene 2.0 ST Array, Affymetrix) in kidney samples from male and female F344 rats, treated daily (p.o) with 0.50 mg/kg b.w. (body weight) of OTA for 7 or 21 days, and evaluate if there were differences between both sexes. After OTA treatment, there was an evolution of gene expression in the kidney over time, with more differentially expressed genes (DEG) at 21 days. The gene expression time course was different between sexes with respect to the number of DEG and the direction of expression (up or down): the female response was progressive and consistent over time, whereas males had a different early response with more DEG, most of them up-regulated.
    [Show full text]
  • Annexin A13 (ANXA13) (NM 004306) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC223936 Annexin A13 (ANXA13) (NM_004306) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Annexin A13 (ANXA13) (NM_004306) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ANXA13 Synonyms: ANX13; ISA Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC223936 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCAATCGTCATGCTAAAGCGAGCAGTCCTCAGGGTTTTGATGTGGATCGAGATGCCAAAAAGCTGA ACAAAGCCTGCAAAGGAATGGGGACCAATGAAGCAGCCATCATTGAAATCTTATCGGGCAGGACATCAGA TGAGAGGCAACAAATCAAGCAAAAGTACAAGGCAACGTACGGCAAGGAGCTGGAGGAAGTACTCAAGAGT GAGCTGAGTGGAAACTTCGAGAAGACAGCGTTGGCCCTTCTGGACCATCCCAGCGAGTACGCCGCCCGGC AGCTGCAGAAGGCTATGAAGGGTCTGGGCACAGATGAGTCCGTCCTCATTGAGGTCCTGTGCACGAGGAC CAATAAGGAAATCATCGCCATTAAAGAGGCCTACCAAAGGCTATTTGATAGGAGCCTCGAATCAGATGTC AAAGGTGATACAAGTGGAAACCTAAAAAAAATCCTGGTGTCTCTGCTGCAGGCTAATCGCAATGAAGGAG ATGACGTGGACAAAGATCTAGCTGGTCAGGATGCCAAAGATCTGTATGATGCAGGGGAAGGCCGCTGGGG CACTGATGAGCTTGCGTTCAATGAAGTCCTGGCCAAGAGGAGCTACAAGCAGTTACGAGCCACCTTTCAA GCCTATCAAATTCTCATTGGCAAAGACATAGAAGAAGCCATTGAAGAAGAAACATCAGGCGACTTGCAGA AGGCCTATTTAACTCTCGTGAGATGTGCCCAGGATTGTGAGGACTATTTTGCTGAACGTCTGTACAAGTC GATGAAGGGTGCGGGGACCGATGAGGAGACGTTGATTCGCATAATCGTGACCAGGGCCGAGGTGGACCTT CAGGGGATCAAAGCAAAGTTCCAAGAGAAGTATCAGAAGTCTCTCTCTGACATGGTTCGCTCAGATACCT
    [Show full text]
  • Characterization of Immune Response in Corticosteroid-Refractory Severe Asthma in Humans and Mice
    Characterization of Immune Response in Corticosteroid-refractory Severe Asthma in Humans and Mice by Mahesh Raundhal Masters of Science (Biotechnology), V. G. Vaze College, 2008 Bachelors of Science (Biotechnology), Kishinchand Chellaram College, 2006 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2015 UNIVERSITY OF PITTSBURGH School of Medicine This thesis was presented by Mahesh Raundhal It was defended on August 24th, 2015 and approved by Dissertation Advisor and Chairperson: Prabir Ray, PhD Professor, Departments of Medicine and Immunology Anuradha Ray, PhD Professor, Departments of Medicine and Immunology Sally Wenzel, MD Professor, Department of Medicine Jay Kolls, MD Professor, Departments of Pediatrics and Immunology Saumendra Sarkar, PhD Associate Professor, Department of Microbiology & Molecular Genetics and Immunology ii Characterization of Immune Response in Corticosteroid-refractory Severe Asthma in Humans and Mice Mahesh Raundhal, M.Sc. University of Pittsburgh, 2015 Copyright © by Mahesh Raundhal 2015 iii Abstract Severe asthma (SA) remains a poorly controlled disease despite use of high doses of systemic corticosteroids (CS) although mild-moderate asthma (MMA) is responsive to low dose inhaled CS. This suggests that SA cannot be solely orchestrated by Th2 cells, which are dominant in milder disease. Analysis of broncholalveolar lavage cells isolated from MMA and SA patients revealed a significantly greater IFN- (Th1) immune response in the airways of severe asthmatics with lower Th2 and IL-17 responses. We modeled this complex immune response seen in human SA in mice including poor response to CS. Ifng-/- mice subjected to this SA model failed to mount airway hyperresponsiveness (AHR) without appreciable effect on airway inflammation.
    [Show full text]
  • Existence of Long-Lasting Experience-Dependent Plasticity in Endocrine Cell Networks
    ARTICLE Received 3 May 2011 | Accepted 24 Nov 2011 | Published 3 Jan 2012 DOI: 10.1038/ncomms1612 Existence of long-lasting experience-dependent plasticity in endocrine cell networks David J. Hodson1 , 2 , 3 , Marie Schaeffer 1 , 2 , 3 , 4 , N i c o l a R o m a n ò 1 , 2 , 3 , Pierre Fontanaud 1 , 2 , 3 , Chrystel Lafont1 , 2 , 3 , Jerome Birkenstock1 , 2 , 3 , Fran ç ois Molino1 , 2 , 3 , Helen Christian5 , J o e L o c k e y 5 , Danielle Carmignac 6 , Marta Fernandez-Fuente6 , Paul Le Tissier6 & Patrice Mollard1 , 2 , 3 Experience-dependent plasticity of cell and tissue function is critical for survival by allowing organisms to dynamically adjust physiological processes in response to changing or harsh environmental conditions. Despite the conferred evolutionary advantage, it remains unknown whether emergent experience-dependent properties are present in cell populations organized as networks within endocrine tissues involved in regulating body-wide homeostasis. Here we show, using lactation to repeatedly activate a specifi c endocrine cell network in situ in the mammalian pituitary, that templates of prior demand are permanently stored through stimulus- evoked alterations to the extent and strength of cell – cell connectivity. Strikingly, following repeat stimulation, evolved population behaviour leads to improved tissue output. As such, long-lasting experience-dependent plasticity is an important feature of endocrine cell networks and underlies functional adaptation of hormone release. 1 CNRS, UMR-5203, Institut de G é nomique Fonctionnelle , Montpellier F-34000, France . 2 INSERM , U661, Montpellier F-34000, France . 3 UMR-5203, Universit é s de Montpellier 1 & 2 , Montpellier F-34000, France .
    [Show full text]
  • A Comparative Quantitative LC-MS/MS Profiling Analysis Of
    proteomes Article A Comparative Quantitative LC-MS/MS Profiling Analysis of Human Pancreatic Adenocarcinoma, Adjacent-Normal Tissue, and Patient-Derived Tumour Xenografts Orla Coleman 1,* , Michael Henry 1, Fiona O’Neill 1 , Sandra Roche 1, Niall Swan 2, Lorraine Boyle 2, Jean Murphy 2, Justine Meiller 1, Neil T. Conlon 1, Justin Geoghegan 2, Kevin C. Conlon 2,3, Vincent Lynch 1,2, Ninfa L. Straubinger 4, Robert M. Straubinger 4, Gerard McVey 2,5, Michael Moriarty 1,5,†, Paula Meleady 1,† and Martin Clynes 1,† 1 National Institute for Cellular Biotechnology, Dublin City University, Glasnevin, Dublin 9, Ireland; [email protected] (M.H.); fi[email protected] (F.O.); [email protected] (S.R.); [email protected] (J.M.); [email protected] (N.T.C.); [email protected] (V.L.); [email protected] (M.M.); [email protected] (P.M.); [email protected] (M.C.) 2 St. Vincent’s University Hospital, Dublin 4, Ireland; [email protected] (N.S.); [email protected] (L.B.); [email protected] (J.M.); [email protected] (J.G.); [email protected] (K.C.C.); [email protected] (G.M.) 3 Trinity College Dublin, College Green, Dublin 2, Ireland 4 Department of Pharmaceutical Sciences, University at Buffalo, State University of New York, Buffalo, NY 14214, USA; [email protected] (N.L.S.); [email protected] (R.M.S.) 5 St. Luke’s Hospital, Highfield Road, Rathgar, Dublin 6, Ireland * Correspondence: [email protected]; Tel.: +353-01-700-5700 † These authors contributed equally to this work.
    [Show full text]