Fungal Diversity and Community Shifts In

Molecular Approaches to Estimating Soil Fungal Diversity and Community Shifts in

Response to Land-Use Change

Jason Alexander Jackson

Program in Ecology Duke University

Date:______Approved:

______Daniel deB. Richter, Co-Chair

______Rytas J. Vilgalys, Co-Chair

______Emily S. Bernhardt

______Shuijin Hu

______Justin P. Wright

Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Program in Ecology in the Graduate School of Duke University

2010

ABSTRACT

Molecular Approaches to Estimating Soil Fungal Diversity and Community Shifts in

Response to Land-Use Change

Jason Alexander Jackson

Program in Ecology Duke University

Date:______Approved:

______Daniel deB. Richter, Co-Chair

______Rytas J. Vilgalys, Co-Chair

______Emily S. Bernhardt

______Shuijin Hu

______Justin P. Wright

An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Program in Ecology in the Graduate School of Duke University

2010 i

Abstract

The Piedmont region of the southeastern United States has undergone considerable land-use change since settlement by Europeans and Africans. Forests were cleared for agriculture, followed centuries later by land abandonment. Following abandonment, natural recruitment, plantings for erosion control, and plantation forestry have resulted in a large area of the region covered by loblolly pine, Pinus taeda. Today, the Piedmont is a mosaic of farm fields, pastures, pine forests, and relic woodlots. The

Calhoun Experimental Forest, located in Union County, SC, has provided a unique history of land use change’s alteration of soil properties and processes, the ability of reforestation to restore or deplete soil fertility, and provided insights into the effects this change has on biological diversity.

In this work, the diversity of fungi living in soil is examined in the context of land-use change and soil biogeochemical change in and around the Calhoun Forest. This study uses molecular tools to identify fungal species from soil and to identify mycorrhizal associates of loblolly pine in a bioassay of propagule diversity, and proposes a novel use of quantitative PCR to quantify the relative abundance of major fungal families affected by land-use change.

Fungal diversity in soils is high in all land uses, but fungal communities shift from agricultural field communities largely comprised of unicellular ascomycetes and

basal lineages to forest communities dominated by saprophytic and symbiotic basidiomycetes. In addition to this shift across a land use gradient, fungal communities are also responding to changes in carbon quantity and quality, biologically available nitrogen and phosphorus, pH, acidity and texture.

ECM propagule communities also differ across a land use gradient of cultivated fields, grasslands, pine forests, and mixed hardwood stands. There are few ECM propagules able to associate with loblolly pine in cultivated and grassland soils. There is a trend towards higher ECM diversity in the hardwood and pine soils, and both of those soil communities are distinct from each other as well as from soils from field treatments.

Quantitative PCR, coupled with a nested set of taxon-specific, fungal primers, is a potential way to estimate the abundance of the given taxon relative to all fungi in an environmental DNA. Primers specific to several taxonomic level of fungi were tested to confirm amplification in PCR, then were tested for taxonomic specificity by generating clone libraries with environmental DNA. Several of the successful primers were tested with soil DNA extracts in QPCR and the calculated ratios of fungal abundance varied widely by method of analysis. The results suggest that many repeated measurements and many replicates are required for a robust estimate of the relative abundance of a specific taxon.

Dedication

To William and Luke.

Be bold, my sons, but always compassionate and clever in your boldness.

Contents

Abstract ...... iv

List of Tables ...... xi

List of Figures ...... xiv

List of Abbreviations ...... xvii

Acknowledgements ...... xviii

1. Introduction ...... 1

1.1 An old issue in a new light ...... 1

1.2 Fungi in forests ...... 3

1.3 Soils of the Piedmont ...... 5

1.4 Land use change ...... 6

1.5 Molecular methods ...... 7

1.6 Diversity and land use change ...... 8

1.7 Study Outline ...... 9

2. Using DNA libraries to estimate diversity and change in eukaryotic and fungal communities ...... 11

2.1 Introduction ...... 12

2.2 Methods ...... 13

2.2.1 Site description ...... 13

2.2.2 Soil collection ...... 14

2.2.3 Edaphic properties ...... 14

vii

2.2.4 Clone library construction and sequencing ...... 15

2.2.5 Data analysis ...... 16

2.2.5.1 Fungal ITS libraries ...... 16

2.2.5.2 Eukaryotic SSU libraries ...... 17

2.3 Results ...... 18

2.3.1 Soil properties ...... 18

2.3.2 Diversity of soil communities ...... 19

2.3.3 Ordination of soil communities ...... 32

2.4 Discussion ...... 38

2.4.1 Land use and edaphic properties ...... 38

2.4.2 Communities and environmental gradients ...... 39

2.4.3 Land use and taxonomic diversity ...... 42

2.4.4 Challenges for molecular microbial ecology ...... 44

2.5 Summary ...... 45

3. A seedling bioassay to measure diversity of ECM propagules ...... 47

3.1 Introduction ...... 47

3.2 Methods ...... 50

3.2.1 Soil collection and seedling plantings ...... 50

3.2.2 Seedling harvest ...... 51

3.2.3 Root tip clone libraries ...... 52

3.2.4 Data analysis ...... 54

3.3 Results ...... 55

viii

3.3.1 Plant biomass and root colonization ...... 55

3.3.2 Dominant species of ECM on roots...... 57

3.3.3 Greenhouse contaminants ...... 57

3.3.4 Diversity and overlap of fungal ECM propagules ...... 61

3.3.5 Ordination of fungal communities ...... 62

3.4 Summary ...... 64

4. Estimating fungal abundance with real-time PCR and taxon-specific primers ...... 67

4.1 Introduction ...... 67

4.1.1 Real-time PCR in ecology ...... 68

4.1.2 Calculations for real time PCR ...... 69

4.1.3 Estimating efficiency and cycle threshold ...... 70

4.1.2 Taxon-specific QPCR ...... 71

4.1.3 Testing Taxon specific QPCR with Piedmont soils ...... 72

4.2 Methods ...... 73

4.2.1 Primer design and testing ...... 73

4.2.2 Real time PCR reactions ...... 74

4.3 Results ...... 75

4.3.1 Primer amplification and specificity ...... 75

4.3.2 Amplification efficiency and ratio calculations using serial dilutions ...... 78

4.3.2 Comparing Ct to linear regression ...... 82

4.4 Conclusions ...... 86

4.4.1 Primer specificity ...... 86

4.4.2 Error on QPCR measurements ...... 86

4.4.3 Challenges of estimating E and Ct ...... 87

4.4.4 Best practices for future applications ...... 89

4.4.5 Summary ...... 90

5. Conclusions ...... 92

5.1 Summary of Results ...... 92

5.2 Future Research ...... 93

Appendix 1: ITS clone libraries from field soils ...... 96

Appendix 2: SSU clone libraries from field soils ...... 111

Appendix 3: ITS clone libraries from the pine seedling bioassay ...... 133

Appendix 4: Clone libraries for taxon-specific primers ...... 163

References ...... 177

Biography ...... 187

List of Tables

Table 1: Location, age and organic horizon properties for plots of four land uses in Union County, SC. Age is an indicator of land use history, and is estimated time since last tillage for fields, pastures and pines; hardwood plots are untilled, where ages are estimated from minimum tree age. %C and %N, percent Carbon and Nitrogen by mass; DOC, water extractable organic carbon (µg/g). P-values are between-group differences by one-way ANOVA, and letters following values denote significant differences among land uses by paired student’s t-tests (JMP8, SAS Institute, North Carolina). GPS coordinates and ages from (Callaham et al. 2006)...... 20

Table 2: Mineral soil properties for plots of four land uses in Union County, SC. Mineral soil defined as 0-15 cm depth. %C and %N, percent Carbon and Nitrogen by mass; pH, water pH; Acid, KCL extractable acidity (cmolc/kg); P, phosporus (µg/g); DOC, water extractable organic carbon (µg/g); sand, silt, and clay are texture as percent. P-values are between-group differences by one-way ANOVA, and letters following values denote significant differences among land uses by paired student’s t-tests (JMP8, SAS Institute, North Carolina)...... 21

Table 3: Sampling effort, richness, and diversity measures for ITS soil clone libraries from four land uses. Sequences=number clones sequenced, OTU=operational taxonomic units defined as 96% sequence similarity. H and ACE are Simpson’s Diversity and Abundance-based Coverage Estimator calculated in EstimateS (Colwell 1994-2004)...... 23

Table 4: Shared species pooled by land use treatment. (a) Number of shared ITS OTUs. (b) Number of shared SSU OTUs. Number in parentheses indicates total number of OTUs in each treatment...... 24

Table 5: Sampling effort, richness, and diversity measures for SSU soil clone libraries from four land uses. Sequences=number of clones sequenced, OTU=operational taxonomic units defined as 96% sequence similarity. H and ACE are Simpson’s Diversity and Abundance-based Coverage Estimator calculated in EstimateS (Colwell 1994-2004)...... 25

Table 6: Number of higher order taxa by land use type. (a) taxonomic diversity of ITS libraries. Approximately 17% of the ITS sequences were non-fungal. (b) taxonomic diversity of only fungi from ITS libraries. Six fungal phyla are listed, as several basal lineages could not be reliably assigned to one of the five accepted fungal phyla. (c)

taxonomic diversity of SSU libraries. Groupings are according to NCBI’s Taxonomy Database...... 30

Table 7: Land use treatment differences in ITS (Fungal) and SSU (Eukaryote) species composition. P-value below heading is the between-group significance for all treatments, and P values in the table are p-values for pair-wise comparisons of treatments. Bottom row compares species grouped as Fields (Cultivated and Pasture) or Forests (Pine and Hardwood). MRPP is Multiple Response Permutation Procedure implemented in PC-ORD (McCune and Grace 2002, McCune and Mefford 2006). Unifrac Significance utilizes the Unifrac distance measure and is corrected for multiple comparisons. P test is the parsimony test implemented in Unifrac (Lozupone et al. 2006)...... 34

Table 8: Rank order of mycorrhizal colonization. Relative root cover is estimated qualitatively from the number of roots on a plant that show mycorrhizal colonization. Relative biomass is a qualitative estimate of the amount of fungal tissue on each root. .. 55

Table 9: Top five genera of ECM fungi found on bioassay root tips. Counts are based on pooled treatment data, and identities are based on closest BLAST match...... 57

Table 10: Species counts for bioassay treatments. The top line is the tally of total number of species. For individual species below, the first two columns are abundances, and the second two are number of plots in which the species occurred. There were 16 species in the autoclaved controls and 54 in the experimental, but only three that were shared between controls and treatments. Of the three shared, Rhizopogon was almost exclusively found in the treatment roots, whereas Thelephora and Suillus were likely greenhouse contaminants. Species were based on 96% sequence similarity...... 59

Table 11: Count data of all ECM root tips found in the control pots, grouped to genus. There were only 5 genera found in the control plots...... 59

Table 12: Shared OTUs grouped by land use. Numbers in parentheses indicate total number of OTUs in each land use treatment...... 62

Table 13: PCR recipe for QPCR assays. Reaction Volumes are 50% of manufacturer recommended volumes. BSA is bovine serum albumin. ROX dye is at 1/2 concentration to increase sensitivity. Mastermix is the Absolute QPCR Mix (Thermo Scientific, Surrey, UK)...... 75

xii

Table 14: Taxon specific primers targeting the fungal ITS gene. Reverse refers to generic ITS primer paired with each specific primer. Primer test results list whether a PCR product of expected length was generated using a mixed DNA template from soil...... 76

Table 15: Taxon specific primers targeting the fungal LSU gene. Reverse refers to generic LSU primer paired with each specific primer. Primer test results list whether a PCR product of expected length was generated using a mixed DNA template from soil...... 77

Table 16: Clone library sequence data summary for taxon specific primers. Taxa + are those sequences with a BLAST match to the correct taxa using NCBI’s taxonomy. Only libraries with greater than 85% specificity will be used for QPCR...... 78

Table 17: Ratio of copy numbers for (a) euagaric LSU and (b) Suillus LSU primer pairs in three hardwood soil DNA samples as determined by real time PCR. Amplification efficiencies were determined by logistic regression (Ruijter et al. 2009). The three right hand columns are the fold values and standard error used to calculate the ratios...... 83

Table 18: Fold and ratio calculations for a hypothetical comparison of a specific primer set (Taxa) compared to a generic primer set (All). Fold calculations assume that ‘Taxa’ Ct=33.3 and ‘All’ Ct=30, which corresponds to approximately 10 times less ‘Taxa’ DNA than ‘All’ DNA. A difference in E of only 0.1 can lead to ratios 5 times higher, and differences in E for both primer pairs in both soils could result in a 50 fold increase in the estimate of E...... 89

xiii

List of Figures

Figure 1: Rarified Shannon diversity across land uses for ITS and SSU OTUs (a) ITS diversity by plot, (b) ITS diversity pooled by treatment, (c) SSU diversity by plot, and (d) SSU diversity pooled by treatment. Totals are rarified to control for uneven sample sizes using EcoSim (Gotelli and Entsminger 2000). Error bars are 95% confidence intervals. .. 22

Figure 2: Average Morisita-Horn community similarity for ITS OTUs (a) by land use comparison (C-Cultivated, G-Grass, H-Hardwood, P-Pine) and (b) comparing forests (F) to grasslands and fields (G). Similarity is based on presence-absence data. Error bars are standard error. Groups are different by one-way ANOVA and letters above bars indicate significant groups...... 26

Figure 3: Average Morisita-Horn community similarity for SSU OTUs (a) by land use comparison (C-Cultivated, G-Grass, H-Hardwood, P-Pine) and (b) comparing forests (F) to grasslands and fields (G). Error bars are standard error. Groups are different by one- way ANOVA and letters above bars indicate significant groups...... 27

Figure 4: Diversity by land use. (a) Eukaryotic kingdoms represented in SSU libraries, grouped by land use, (b) Phyla from only kingdom Fungi from the SSU libraries in (a), grouped by land use (c) Fungal phyla represented in ITS libraries, grouped by land use. Lineages according to NCBI’s Taxonomy database. Values calculated as percent of total OTUs...... 31

Figure 5: NMS ordination of ITS OTUs based on sequence similarity. (a) Axis 1 vs. 2, (b) Axis 1 vs. 3. Axis percentages are coefficients of determination, a measure of the proportion of the variation from the original species matrix that each ordination axis represents. Vectors represent environmental variables significantly correlated to species space (r2 >.200), where length indicates strength of correlation. Final stress = 11.79. C=Cultivated, G=Pasture, P=Pine, H=Hardwood...... 35

Figure 6: NMS ordination of SSU OTUs based on sequence similarity. (a) Axis 1 vs. 2, (b) Axis 2 vs. 3. Axis percentages are coefficients of determination, a measure of the proportion of the variation from the original species matrix that each ordination axis represents. Vectors represent environmental variables significantly correlated to species space (r2>.200), where length of vector indicates strength of correlation. Final stress =7.60. C=Cultivated, G=Pasture, P=Pine, H=Hardwood...... 36

xiv

Figure 7: NMS ordination of Unifrac distances based on SSU maximum likelihood tree. (a) Axis 1 vs. 2, (b) Axis 2 vs. 3. Axis percentages are coefficients of determination, a measure of the proportion of the variation from the original species matrix that each ordination axis represents. Vectors represent environmental variables significantly correlated to species space (r2>.200), where length of vector indicates strength of correlation. Final stress = 7.61. C=Cultivated, G=Pasture, P=Pine, H=Hardwood ...... 37

Figure 8: Biomass measurements for loblolly pine seedlings. Values on the left are averages of 3 plots by treatment. Error bars are SE. Results from seedlings grown in autoclaved soils are on the right. C=cultivated, G=grass, P=pine and H=hardwood...... 56

Figure 9: NMS ordination of experimental and autoclaved plots in ITS OTU ordination space. This ordination includes the greenhouse contaminants, and illustrates that the communities from autoclaved soils are quite distinct from the remaining experimental plots. This suggests that greenhouse contaminants were not established on experimental seedlings. C is cultivated, G is grass, H is hardwood, and P is pine. Autoclaved plots are designated ‚–A‛...... 60

Figure 10: Estimated species diversity averaged by land use. ACE is the Abundance- based Coverage Estimator, calculated in EstimateS (Colwell 1994-2004). Error bars are standard error. An ANOVA finds no significant difference among treatments...... 61

Figure 11: Average Morisita-Horn community similarity for ITS OTUs from root tips (a) by land use comparison (C-Cultivated, G-Grass, H-Hardwood, P-Pine) and (b) comparing forests (F) to grasslands and fields (G). Error bars are standard error. Groups are different by one-way ANOVA and letters above bars indicate significant groups. ... 63

Figure 12: NMS ordination of experimental plots in ITS OTU space. These two axes explain about 50%of the original variation in the dataset. Ovals around land uses indicate significant groups using MRPP...... 64

Figure 13: Efficiency calculations using serial dilutions. The taxon specific primers for Suillus ITS2 and euagaric LSU (see table 14) are tested on two different soil DNA extractions along with the all-fungi pair LR0R-LR3. (a) Pine soil DNA composited from 3 plots and (b) Hardwood soil DNA composited from three plots. The Suillus line in (a) illustrates the effect of PCR inhibitors that generates an efficiency well above the theoretical maximum of 2...... 80

Figure 14: Calculating a fold increase using two primer pairs from the same soil. (a) Is the same data from Figure 10 (b), including only the two primers with efficiencies near 2.

(b) Calculated ratios of LSU amplicons for euagarics to Suillus. Three replicate dilutions of composited soil DNA were used to calculate the ratio. There is considerable between- replicate and between-dilution variation, but all calculations are of similar magnitude. Arrow stresses the relationship of data from (a) used in the table. To compare a second environment, another set of efficiency graphs is necessary...... 81

Figure 15: Efficiency calculations for Suillus, euagaric, and all-fungal primer sets across three piedmont soils using serial dilutions. These results are based on the same raw data used in Table 16, and are in agreement with the linear regression approach as to which efficiencies were insufficient for use. All primers from H1 (a) exhibited inhibition, as did the Suillus primer from H2 (b) and both Suillus and Euagaric primers from H3 (b). Primer kinetics differ depending upon soil...... 85

Figure 16: Efficiency calculation for H1 soil as in Figure 12. If only 3 points are used to calculate E, the estimate can range from 2.06 to 3.11! ...... 88

xvi

List of Abbreviations

C – Carbon

CTAB – Hexadecyltrimethylammonium bromide

DOC – Dissolved organic carbon

ECM – Ectomycorrhiza

ITS – Nuclear Ribosomal Intertranscribed Spacer Region

N – Nitrogen

NMS – Nonmetric multidimensional scaling

P – Phosphorus

PCR – Polymerase Chain Reaction

QPCR – Quantitative PCR

SSU – Nuclear Ribosomal Small Subunit

xvii

Acknowledgements

Having two advisors is a little like having two families. Luckily, both of my families have supported me with open arms through this journey. Thanks to Rytas

Vilgalys for his guidance, kindness, and infectious excitement. Thanks to Dan Richter, who taught me the power of positive statements. Your patience and kindness are beyond compare. You two have trained another scientist, and taught me so much more.

The Duke community is creative, supportive, and a hell of a lot of fun. There are not enough pages here to thank them all. Thanks especially to Duke Mycology past and present: Jean-Marc Moncalvo, Heath O’Brien, Jeri Parrent, Becky Yahr, Tim James, Dan

Henk, Michelle Hersh, Terri Porter, Hannah Reynolds, Gwen Williams, Elizabeth

Pekarek, Andrii Grygansky, and especially Greg Bonito. An equal thanks to the Forest,

Soil, and Water Lab: Mike Hofmockel, Paul Heine, Julie Demeester, Jianwei Li, Allan

Bacon, and my friend Megan Mobley. Your support extends well outside of the lab, and

I and my family are indebted to you all.

I would like to thank the Forest History Society for generous funding. Thanks for taking the risk on a crazy idea. You can add another loyal supporter and steward to your admirable cause.

xviii

1. Introduction

1.1 An old issue in a new light

Mark Twain often credited with a favorite quote of mine; that ‚History doesn’t repeat itself, but it often rhymes‛. In many respects, this study of fungal richness and turnover rhymes with vegetation science’s classic studies of plant diversity patterns across landscapes. Just as many before have wondered why there are so many species of plants, why they assemble in predictable ways, and how they interact with each other, I attempt to catalog the amazing diversity of fungi in soils, to ask how that diversity is organized, and to suppose which mechanisms are driving the patterns I observe.

Ecological succession is a fascinating pattern to emerge from early studies in vegetation science. Usually defined as the predictable replacement of species in a community following disturbance, the concept has a storied history (Morin 1999).

People have long observed that vegetation changes after disturbance, but the first formal definition of the concept of ecological succession can be attributed to Cowles account of vegetation change in the Lake Michigan sand dunes over a century ago (Cowles 1899).

Early debates arose from Clements' assertion that climax communities were ‚organisms‛ that assembled in exactly the same order of species, a notion that was slowly abandoned for Gleason’s concept of communities as a collection of individual species that could vary depending on abiotic and biotic forces (Gleason 1927, Clements 1936). Numerous mechanisms, all with merit and very few mutually exclusive, have been proposed to

explain the phenomenon. Competition was one of the first mechanisms recognized as influencing the presence and abundance of species, and was soon expanded to include concepts of facilitation and inhibition, priority effects, and dispersal, to name a few

(Egler 1954, Hutchinson 1959, Connell and Slatyer 1977).

Old-field succession, one variant on the theme, is particularly relevant to this study. Defined as the change in biota following agricultural abandonment (‚old fields‛), old-field succession was first studied in the same piedmont region of North America where this study takes place (Oosting 1942, Johnston and Odum 1956). Vegetation change in piedmont old fields followed a particularly predictable pattern: dominance of grasses, then forbes, replacement with pines, finally aggrading into mature oak-hickory forests (Keever 1950, Christensen and Peet 1984). During the process of old-field succession, it is clear that plots quickly increase in species richness but do not necessarily resemble each other (Oosting 1942). In diversity terms, initially, there is high alpha diversity (within a plot) and also high beta diversity, as the plots share few of the same species (Whittaker 1960). As the plots succeed to forests, they converge in terms of community structure, that is, alpha diversity remains unchanged as beta diversity decreases (Christensen and Peet 1984).

Community ecology owes much to vegetation science. Fungi are intimately tied to plants, and it stands to reason that fungal communities are subject to many of the same influences that structure plant communities (Bruns 1995). This has traditionally

been difficult to address, however, as fleshy fungi spend much of their existence belowground, and many unicellular fungi are nearly invisible to the ecologist (Peter et al. 2001, Richard et al. 2004).

Molecular tools have opened a new lens on the world that is belowground, and have taught us that there is much cryptic diversity in that world (Hawksworth 2001,

Horton and Bruns 2001). To my mind, the simple question is whether organisms belowground, especially the fungi, follow the same rules of community assembly. Does diversity increase during succession belowground as it does above? Though levels of microbial diversity are higher than aboveground, is species turnover of the same magnitude? Do fungal communities organize along gradients of fertility? This study of fungal diversity, with molecular tools as the lens, attempts to catalog the diversity in soils in the South Carolina Piedmont, and explore the patterns of diversity across a complex, realistic landscape formed by nature and man.

1.2 Fungi in forests

Southeastern forests are home to thousands of species of fungi. Their cryptic coloration and hidden habits render them invisible to the casual observer save a few charismatic species. The amateur collector, however, has come to appreciate the diversity of mushroom form, not to mention the flavor! It is the diversity of function, however, that makes fungi a critical component of the forest ecosystem. Fungi are important pathogens, primary decomposers, and mutualists in forest systems.

Fungal pathogens can have devastating effects on forests. Dutch elm disease, chestnut blight, and sudden oak death are among the most notorious examples, but others abound (Deacon 2005): Heterobasidion annosum is a major root rot of conifers, and

Armillaria mellea, the honey mushroom, is known for its ability to grow root-like rhizomorphs that can attack nearby healthy trees.

From an ecosystem view, fungi are critical to the cycling of carbon in soil (Fahey et al. 2005, Hanson et al. 2008). They play a central role in the breakdown and assimilation of organic compounds in the rhizosphere and are the main group of organisms capable of breaking down cellulose and lignin, which account for at least half of all plant biomass returned to the soil each year (Wardle 2002, de Boer et al. 2005,

Deacon 2005).

Equally important, most trees form mycorrhizae, an obligate root symbiosis with fungi where the tree provides sugars to the fungi, which, in turn, provides the plant with greater access to nutrients such as phosphorus and nitrogen. Both trees and fungi may provide water for the other depending on climatic conditions, and mycorrhizae may shield plants from metal toxicity (Allen et al. 2003, Walker et al. 2004). Some mycorrhizal associations are specific to one species of plant and one species of fungi, a few fungi are true generalists, and the majority are intermediate in host specificity (Allen et al. 2003). Fungal hypahe may interconnect two trees and can even facilitate the exchange of nutrients and other resources between them. The roots of a single tree are

likely to be inhabited by many species of fungi and this community changes naturally over successional time (Peter et al. 2001, Lilleskov and Bruns 2003, Cline et al. 2005).

Furthermore, the magnitude of fungal colonization of roots is often inversely proportional to soil fertility (Edwards et al. 2004). Because species distributions of fungi on roots and in soils are often patchy and change over time (Horton and Bruns 2001), interactions between fungi and the forest ecosystem are complex. These interactions have great impact on forest structure and an understanding of their influence on forest health and survival are critical.

1.3 Soils of the Piedmont

The Piedmont province of the southeastern United States stretches from northern

Alabama to the eastern edge of Pennsylvania, bordered by the Appalachian Highlands to the west and the coastal plains to the east. Southern piedmont soils overlie a bed granitic gneiss parent material. The soils of this ancient physiographic province have been acted on by climate and biota for millions of years to produce the coarse, highly weathered, acidic soils characteristic of northwestern South Carolina.

Soils of the region are generally categorized as Ultisols, especially of Cecil and

Appling series (Richter and Markewitz 2001). They are well drained, acidic, with moderate cation exchange capacity, and low levels of important nutrients like nitrogen, calcium, magnesium, and phosphorus (Richter et al. 1994). Lower soil horizons are

characterized by high levels of kaolinite clay and red iron oxides so characteristic of the region.

1.4 Land use change

Anthropogenic change has greatly impacted the Piedmont region’s soils. Native

Americans inhabited the area for centuries, but established large settlements mainly in riparian areas (Richter and Markewitz 2001). European settlement resulted in rapid clearing of uplands for both subsistence and commercial agriculture. For most of the 19th and early 20th century, cotton was king, and the Southeast was the world’s largest supplier of cotton for many of the later decades (Richter et al. 2000). Since the 1930’s, tens of millions of acres of former cotton fields were abandoned to old field succession, while millions more remain in agricultural or silvicultural use (Metz 1958). Silviculture may well be called the new cotton, as the southeastern US ranks among the largest producers of secondary growth timber in the world (Schultz 1999). The southeastern US today is a mosaic of farms, fields, pine plantations, and remnant stands of once- dominant, mixed-hardwood forests.

The historical legacy of this land use change is evident today both in terms of soil fertility and community structure of soil microbiota. Agricultural activities helped to deplete soils of litter and organic matter, increase available N and P, raise soil pH by lime addition, and homogenize the distribution of remaining soil nutrients in the plow layer (Markewitz and Richter 2000, Richter et al. 2000, Richter et al. 2006, Li et al. 2008).

Secondary forests growing on agricultural fields in this system can become nitrogen limited within decades, but are likely to remain enriched in phosphorus and calcium and artificially high in pH due to agricultural amendments of fertilizer and lime.

Agriculture also acts to homogenize soil decomposer communities, lowering diversity, and simplifying soil food webs (Buckley and Schmidt 2001, Callaham et al. 2006). These changes can persist for decades, where secondary forest soils harbor a fraction of the eukaryotic diversity found in untilled forest soils (Foster et al. 2003, Fraterrigo et al.

2005).

1.5 Molecular methods

Community analysis using molecular data has become widely applied in soil ecology. Studies of fungal communities employing clone libraries often PCR-amplify one of three regions of the ribosomal gene (rDNA), namely the small subunit (SSU), large subunit (LSU), or internal transcribed spacer (ITS) regions (Anderson et al. 2003,

Martin and Rygiewicz 2005, O'Brien et al. 2005, U'Ren et al. 2009). The ITS region has been championed as a barcode for fungi, and often allows identification to species, as long as the species is represented in public databases (Vilgalys 2003, Seifert 2009).

Subsequent analysis of ITS data depends on this identification to assign species, or on a user-defined percent sequence similarity to define operational taxonomic units (OTUs) as a proxy for species (O'Brien et al. 2005, Hughes et al. 2009). Studies utilizing SSU or

LSU can take advantage of additional phylogenetic analyses. These two regions are

highly conserved across all three domains of life, and can therefore be aligned to infer evolutionary changes in gene sequence (Hibbett et al. 2007, Baldauf 2008). This alignment can be used to directly define OTUs, or can be used to construct phylogentic trees (Lauber et al. 2009b). Community distances calculated from these trees provide an index of evolutionary relatedness between places that does not depend on the delineation of species (Schloss 2008). These phylogenetic metrics, which are based on evolutionary history, may better illustrate community shifts across ecological gradients than metrics based on shared taxa alone (Martin 2002).

1.6 Diversity and land use change

Molecular studies of soil diversity are beginning to address relationships between land use and microbial community structure, despite the extreme diversity of microbial communities and the large proportion of organisms in those communities known only from their DNA sequence (Schadt et al. 2003, Nilsson et al. 2005). However, the patterns these studies reveal remain equivocal. For example, many taxa have been shown to be ubiquitous in soils, while communities that are geographically distant tend to share fewer species (Walker et al. 2005, Fulthorpe et al. 2008). Bacterial diversity has been shown to be correlated to pH, with optimal diversity in slightly acidic soils (Fierer et al. 2009, Lauber et al. 2009a). Fungal diversity, however, is generally positively correlated with soil organic carbon, and particularly with increasing C:N ratios

(Waldrop et al. 2006, Lauber et al. 2008). Fungal diversity is also positively correlated

with plant diversity, indirectly due to increases in both the quantity and quality of C inputs from plants, and directly due to an increase in mycorrhizal and pathogenic hosts

(Kasel et al. 2008). Finally, several studies indicate that fungal diversity is generally negatively associated with nutrient availability, and that microbial community structure and function are influenced by abiotic factors such as soil texture and moisture availability (Progar et al. 2000, Allison et al. 2007, Grandy et al. 2009).

1.7 Study Outline

The following pages examine changes in fungal communities across a gradient of land use from agriculture to mature forests. In chapter two, fungal community change is measured by constructing clone libraries from all soil eukaryotes and libraries from only kingdom Fungi. This data is used to define operational taxonomic units that are used as species in community analyses. Richness and diversity is examined across the land use gradient, and species turnover is considered across sampling plots. Ordination of plots in species space and subsequent correlation to soil properties is used to examine the influence of soil fertility on the shift in soil fungal communities.

Chapter three uses a seedling bioassay in the greenhouse to identify a subset of diversity in soils, namely the community of ECM propagules able to associate symbiotically with pine seedlings. Using molecular methods, this study seeks to examine the richness in propagules across the land use gradient, and to describe species turnover across the landscape.

Chapter four adapts real-time PCR to estimate the relative abundance of common fungal taxonomic groups from soil. This approach uses PCR primers specially designed to amplify only specific clades of fungi, and estimates their relative abundance in soils by calculating the ratio of the target clade to a gene that amplifies a higher taxonimc level. By careful replication, these ratios can be used to infer changes in abundances of common, phylogenetically-conserved groups of fungal taxa belowground.

2. Using DNA libraries to estimate diversity and change in eukaryotic and fungal communities

Land use change in the Southeastern United States has resulted in a landscape mosaic of croplands, pastures, commercial forests and remnant woodlots. These human- driven changes have resulted in altered soil conditions and vegetation cover that directly and indirectly influence soil microbial communities. In this study, I have employed molecular methods to describe the changes in eukaryotic and fungal microbial communities across a land use gradient from farm to forest. The land use plots are part of an ongoing, 50+ year study of forest and soil change at the Calhoun Experimental

Forest in the South Carolina Piedmont, USA (Metz 1958, Richter et al. 2000, Callaham et al. 2006, Li et al. 2010). Soil clone libraries of internal transcribed spacer and small subunit ribosomal DNA genes were employed to characterize the fungal and eukaryotic communities, respectively, of each soil. These data were used to infer ecological distance both by individual-based operational taxonomic units and by a measure of phylogenetic distance. These data illustrate a diverse community of eukaryotes and fungi in all land use types. Nonmetric multidimensional scaling revealed a distinct shift in communities from agricultural fields to forests, driven by a proliferation of basidiomycete fungi in forests. The pattern held equally for both gene regions, and methods of analyses based on either OTUs or phylogenetic-based measures of community similarity. In addition, soil carbon (C), nitrogen (N), phosphorus (P), and C:N ratios (CN) were correlated to

land use, whereas the variation in soil acidity and texture were not. Joint plots in ordination space suggest that all of these factors are correlated with the structure of microbial communities in soil. The presence of trees alone explains about half the variation in fungal species space across this landscape, which also involves a shift in dominance to saprotrophic and mycorrhizal fungi in the forest plots. One-quarter of the variation in fungal species space is correlated to carbon quantity and quality, texture, or

N availability. This study demonstrates that land use is an important determinant of eukaryotic community structure in soils, and suggests that this influence is mediated by changes in soil carbon and nutrient availability.

2.1 Introduction

The aim of this study was to determine whether historical transitions from upland, oak-hickory forests to agriculture in southeastern piedmont soils has altered belowground eukaryotic and fungal communities, and to understand how these communities respond to reforestation of cultivated land. I use soil DNA from four land uses common to the South Carolina piedmont region to build clone libraries of the SSU gene from all eukaryotes, and ITS libraries of soil fungi to describe these soil communities. Specifically I aim to examine the following: (1) Does fungal diversity increase in forests relative to fields? (2) Do forested and agricultural soils differ in their microbial community structure? (3) Do these shifts correlate more readily with changes

in edaphic conditions or changes in vegetation cover? and (4) Are OTU or phylogenetic distance measures are more informative at making these inferences?

2.2 Methods

In brief, soils were collected from four land uses in the southern piedmont, and clone libraries targeting fungal ITS and eukaryotic LSU were constructed. DNA sequences from these libraries were identified taxonomically using BLAST, and grouped into OTUs using a percent similarity definition. Finally, richness, turnover, and taxonomic identity between sites are compared and correlated to soil physical and chemical properties.

2.2.1 Site description

The Calhoun Long-Term Soil Ecosystem Study is located in the Sumter National

Forest in southwestern Union County, South Carolina (http://calhoun.env.duke.edu/).

Twelve plots were established across four land uses that represented ecological trajectories common to the Piedmont region of the southeastern United States. There were three replicate sites of each land use: row crops maintained by the US Forest

Service (USFS), pasture maintained by the USFS or private landowners, ca. 50 year old loblolly pine stands, and mixed oak-hickory plots that had never been farmed (Richter et al. 2000, Callaham et al. 2006). For cultivated fields and pastures, the time under current use was estimated from a combination of forest service records and owner

information, whereas the forests were dated from records, tree coring, and soil profiles that indicated the presence or absence of historical cultivation.

2.2.2 Soil collection

Plots 30m x 30m were established at each site and sampled quarterly for two years. At each sampling, four 15cm x 15cm randomly placed subsamples were excavated to 15 cm depth and separated into litter, organic, 0-7.5 and 7.5-15cm layers. In addition, litter and organic horizons were collected from forest sites. All samples were stored on ice 1-2 days during transport and then immediately frozen to -70ºC upon return to

Durham, NC, where they were composited and a subsample sieved to 2mm.

Approximately 250 grams of each composite sample was air dried for chemical analysis, and 0.25 g was used for DNA extraction using the MoBio Powersoil DNA Extraction kit

(MO BIO Laboratories, Inc, Carlsbad, CA, USA), according to manufacturer’s instructions, except that DNA was eluted in water in the final step. All DNA extractions were stored at -20ºC until use.

2.2.3 Edaphic properties

A suite of soil fertility, acidity, and texture measures were performed on all mineral soils as in previous studies at the Calhoun Experimental Forest (Li et al. ,

Richter et al. 1994, Richter et al. 2000, Richter et al. 2006). In brief, total soil C and N were measured directly on powdered samples using a CHN analyzer (AT21 Comparator,

Mettler TOLEDO, Switzerland). Soil P was measured as Mehlich III extractable

phosphorus. Dissolved organic carbon was water extracted from air-dried soil and subsequent determination on a total organic carbon analyzer (Shimadzu TOC-VCPN,

Shimadzu Corporation, Japan). Soil pH was measured by adding 5g dried soil to 10g water, and exchangeable acidity was measured by KCl extraction and titration. Soil texture was determined gravimetrically by pipetting a known volume and determining dry mass. For the litter samples, only C, N, and extractable DOC were possible to determine, and were performed as above.

2.2.4 Clone library construction and sequencing

Each soil DNA was PCR amplified once using the fungal primers ITS1F and ITS4 and once using the eukayotic small subunit primers NS1 and NS4 (White 1990, Gardes and Bruns 1993). Reaction conditions were described by O’Brien et. al. (O'Brien et al.

2005). PCR products were ligated into the TOPO 2.1 vector and transformed into chemically competent TOP 10 E. coli cells using Invitrogen’s TOPO TA cloning kit

(Invitrogen, Carlsbad, CA, USA). Growing colonies from each library were harvested and direct amplified using PCR with the plasmid primers M13F (-20) and M13R according to the manufacturer’s instructions. PCR products were cleaned using the

QIAquick 96 PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). All PCR products were sequenced using the primer ITS4 and the BigDye Terminator Kit version 3.1 and run on an ABI 3730 automated sequencer (Applied Biosystems, Foster City, CA, USA).

Each sequence was trimmed of vector sequence and proofread by eye using Sequencher

v4 (Gene Codes, Ann Arbor, MI). SSU sequence data was checked for chimeric sequences using Bellerophon (Huber et al. 2004). ITS chimeras were checked by BLAST.

ITS sequences <90% similar to known taxa were then parsed into ITS1 and ITS2 regions, and sequences with conflicting matches were discarded. Approximately 3% of all sequences were discarded as chimeric.

2.2.5 Data analysis

2.2.5.1 Fungal ITS libraries

Fungal sequences were identified using BLAST from NCBI. OTU determinations were made by first generating pairwise Needleman-Wunsch distances between entire

ITS sequences (O'Brien et al. 2005). The distances were converted to a matrix and used with DOTUR for a nearest neighbor grouping of OTUs (Schloss and Handelsman 2005).

A 96% similarity cutoff for OTUs was empirically determined by examining the agreement of BLAST hits of each OTU and/or alignment of closely related taxa and construction of a neighbor joining tree for two common genera (data not shown). OTU- based numbers of shared species, Morisita-Horn community similarity, and ACE estimated richness were calculated using EstimateS (Colwell 1994-2004). To control for the effect of unequal sample sizes on calculations of Shannon diversity, the metric was rarified to the smallest sample number using Ecosim (Gotelli and Entsminger 2000).

NMS ordination of plots by OTU was performed using PC-ORD Version 5 (McCune and

Mefford 2006). The species abundance matrix was relativized by maximum, and NMS

was performed three times in autopilot mode using Sørensen dissimilarities as the distance measure. The dataset converged on a three-dimensional solution, and a final run was performed using the starting configuration from the three dimensional solution.

To test for significant differences among land use types, a multi-response permutation procedure (MRPP) test on the Sørensen distance matrix was also performed in PC-Ord.

This resampling procedure tests whether the average community distance between groups is smaller than would be expected by chance. Significance is determined by comparing group distances to a distribution of distances based on randomly reshuffling the distance matrix (McCune and Grace 2002).

2.2.5.2 Eukaryotic SSU libraries

Eukaryotic sequences were also identified using BLAST from NCBI. To define

OTUs, sequences were grouped by 95% sequence similarity in Sequencher. OTU-based diversity, shared species, and estimated richness were calculated using EstimateS and rarified using Ecosim. NMS ordination of plots by OTU and MRPP tests were performed using PC-ORD. As above, the species abundance matrix was relativized by the maximum and Sørensen distances were used. NMS converged on a three-dimensional solution.

For phylogenetic tree construction, SSU sequences were aligned in Muscle, then manually improved using Mesquite (Maddison 2009). A phylogenetic tree was constructed using RaxML, employing a maximum likelihood search of 1000 bootstrap

replicates with a GTR GAMMA+P-Invar model to estimate rates of substitution

(Stamatakis et al. 2008). The best tree was used to calculate phylogenetic distances between plots using the Unifrac distance measure (Lozupone et al. 2006). Because PC-

ORD cannot use a distance matrix for input, an NMS ordination was performed on the unifrac distance matrix in R using the package Ecodist, then the results were graphed in

PC-ORD. Differences between land use types were tested using both the Unifrac test and

Parsimony test. In brief, the unifrac significance test calculates the unifrac distance between plots, and determines the probability by comparing the result to a random distribution of distances calculated by reshuffling the environment associated with each taxa on the tree (Lozupone et al. 2006). The parsimony test assigns each node in the tree to an environment, and calculates the minimum number of changes in environment needed to explain the data, again determining significance by random reshuffling of the environment associated with each taxa (Martin 2002).

2.3 Results

2.3.1 Soil properties

Many soil properties differed as a function of land use. This agrees with previous observations at these sites (Richter and Markewitz 2001). Total C, N, C:N ratios, and extractable DOC all differed among land uses, with forests tending to have much higher organic matter (Tables 1 & 2). Soil total nitrogen was relatively high in uncultivated hardwood forests and in periodically fertilized pastures and cultivated fields (Table 2).

Pine mineral soils had notably low concentrations of N, a pattern attributable to the uptake and depletion of N during pine forest development (Richter et al. 2000).

Extractable P was lowest in hardwood forests that had never been fertilized, highest in periodically fertilized pastures and cultivated fields and intermediate in the historically fertilized pine forests (Table 2). Water extractable DOC was significantly elevated in mineral soils under forests compared to fields (Table 2). In contrast to previous samplings of these land uses, measures of acidity were not related to land use, and large inter-site variation was observed in soil pH and exchangeable acidity (Tables 1 &2). All soils are coarse sandy loams and loamy sands, although there are subtle differences among land uses with pines being notably sandy and cultivated fields having significantly higher clay (Table 2).

2.3.2 Diversity of soil communities

Fungal libraries reveal high diversity in all plots. There were 251 unique OTUs identified from 402 ITS sequences (Table 3). The Shannon diversity index across all plots was 5.35, and total diversity (ACE) was estimated at over 2000 species. At the plot level, alpha diversity, estimated as rarified Shannon diversity, was equal across all plots (Figure 1a).

Treatment level diversity, calculated as rarified Shannon diversity pooled by land use, was equal across cultivated fields, pastures, and pines, but significantly lower in hardwood plots (Figure 1b). This implies that the hardwood plots, though high in alpha diversity, harbored more of the same species across plots than the other land uses, an

Plot Information Organic Horizon Properties Land Use Type Plot # Latitude Longitude Age %C* %N* C:N* DOCns p=0.002 p=0.036 p<0.0001 p=0.193

Cultivated Field C1 34.610°N 81.727°W 1 33.9 1.07 31.9 292.4 Cultivated Field C2 34.603°N 81.772°W 1 34.1 A 0.93 A 36.8 A 565.2 A Cultivated Field C3 34.420°N 81.561°W 1 42.6 1.73 24.7 404.6

20 Pasture G1 34.621°N 81.743°W ~40 42.1 1.15 36.6 828.6

Pasture G3 34.630°N 81.763°W ~40 42.0 B 1.13 A 37.2 AB 546.0 AB Pasture G7 34.637°N 81.667°W ~40 42.6 1.02 41.7 833.6

Loblolly Pine P1 34.647°N 81.734°W ~50 49.7 0.54 91.8 721.8 Loblolly Pine P2 34.608°N 81.721°W ~50 49.2 C 0.58 B 84.3 C 579.6 AB Loblolly Pine P3 34.605°N 81.716°W ~50 48.8 0.66 73.4 765.4

Mixed Hardwood H1 34.648°N 81.732°W >100 45.8 1.09 42.2 413.8 Mixed Hardwood H2 34.605°N 81.723°W >80 46.1 BC 1.17 A 39.4 B 1084.2 B Mixed Hardwood H4 34.574°N 81.663°W >75 45.6 0.94 48.4 1053.2

Table 2: Mineral soil properties for plots of four land uses in Union County, SC. Mineral soil defined as 0-15 cm depth. %C and %N, percent Carbon and Nitrogen by mass; pH, water pH; Acid, KCL extractable acidity (cmolc/kg); P, phosporus (µg/g); DOC, water extractable organic carbon (µg/g); sand, silt, and clay are texture as percent. P-values are between-group differences by one- way ANOVA, and letters following values denote significant differences among land uses by paired student’s t-tests (JMP8, SAS Institute, North Carolina).

(a) ITS Diversity by Plot (c) SSU Diversity by Plot 3.5 3.5 3 3 2.5 2.5 2 2

1.5 1.5

Rarified H Rarified Rarified H Rarified 1 1 0.5 0.5 0 0 Cultivated Pasture Pine Hardwood Cultivated Pasture Pine Hardwood

(b) ITS Diversity by Land Use (d) SSU Diversity by Land Use 4.5 4.5

4 4 Rarified H Rarified 3.5 H Rarified 3.5

3 3 Cultivated Pasture Pine Hardwood Cultivated Pasture Pine Hardwood

Plot Totals Fungal Diversity Land Use Type Plot Sequences OTU H RareH ACE

Cultivated Field C1 42 32 3.31 2.57 410 Cultivated Field C2 43 38 3.58 2.70 336 Cultivated Field C3 no sample

Pasture G1 46 39 3.59 2.68 151 Pasture G3 61 46 3.59 2.56 477 Pasture G7 41 40 3.68 2.76 411

Loblolly Pine P1 16 15 2.69 2.28 61 Loblolly Pine P2 44 39 3.61 2.49 188 Loblolly Pine P3 20 14 2.31 2.37 92

Mixed Hardwood H1 21 13 2.31 2.69 36 Mixed Hardwood H2 48 34 3.29 2.71 84 Mixed Hardwood H4 20 15 2.52 2.16 54

Totals 11 402 251 5.35 * 2059 *

Table 4: Shared species pooled by land use treatment. (a) Number of shared ITS OTUs. (b) Number of shared SSU OTUs. Number in parentheses indicates total number of OTUs in each treatment.

(a) Shared Fungal OTU's Grass (120) Pine (65) Hardwood (58) Cultivated (69) 8 7 4 Grass (120) 3 3 Pine (65) 9

(b) Shared Eukaryote OTU's Grass (78) Pine (49) Hardwood (42) Cultivated (101) 25 14 12 Grass (78) 13 11 Pine (49) 17

Plot Totals Eukaryotic Diversity Land Use Type Plot Sequences OTU H RareH ACE

Cultivated Field C1 46 28 3.03 2.46 115 Cultivated Field C2 70 48 3.72 2.73 134 Cultivated Field C3 23 20 2.96 2.75 77

Pasture G1 45 29 3.26 2.65 47 Pasture G3 64 42 3.59 2.75 93 Pasture G7 42 34 3.45 2.76 118

Loblolly Pine P1 22 14 2.50 2.39 27 Loblolly Pine P2 65 34 3.18 2.47 120 Loblolly Pine P3 23 13 2.28 2.16 44

Mixed Hardwood H1 18 10 2.03 2.09 28 Mixed Hardwood H2 51 30 3.20 2.57 67 Mixed Hardwood H4 20 10 1.96 1.91 26

Totals 12 489 203 4.81 550

(a) ITS Similarity across Land Uses 0.3500 A 0.3000 0.2500

AB Horn

- 0.2000 BC BC BC BC 0.1500

Morisita 0.1000 C C C C 0.0500 0.0000 C-C C-G C-H C-P G-G G-H G-P H-H H-P P-P

Land Use Comparison

(b) ITS Similarity Forest to Grasses

0.2 A 0.18 0.16 0.14

Horn 0.12 - 0.1 B B 0.08

Morisita 0.06 0.04 0.02 0 F-F G-F G-G

Land Use Comparison

(a) SSU Similarity across land uses 0.35 A A AB 0.3 ABC ABC ABC

0.25 Horn

- 0.2 CD BC 0.15

Morisita 0.1 D D 0.05 0 CC CG CH CP GG GH GP HH HP PP

Land Use Type

(b) SSU Similarity Forests to Grasses 0.3 A A 0.25

0.2

Horn - 0.15

0.1 B Morisita 0.05

0 FF GF GG

Land Use Type

Figure 3: Average Morisita-Horn community similarity for SSU OTUs (a) by land use comparison (C-Cultivated, G-Grass, H-Hardwood, P-Pine) and (b) comparing forests (F) to grasslands and fields (G). Error bars are standard error. Groups are different by one-way ANOVA and letters above bars indicate significant groups.

Indication of lower beta diversity in the hardwood land use (Whittaker 1960).

This is further illustrated by examining community similarity among and between land use types. There was minimal overlap in shared fungal species between land uses, with pines and hardwoods sharing nine OTUs (Table 4a). Morisita-Horn similarity values illustrated that hardwood plots were significantly more similar to each other than any other land use, followed by pine plots, with cultivated fields and grasslands having low similarity (Figure 2a). Grouping pine and hardwood plots into forests and grass and cultivated plots into fields, it can be shown that forest plots harbor more similar communities of soil fungi than they do compared to agricultural fields or than agricultural fields do with themselves (Figure 2b). This suggests that the forest fungal communities are more similar to each other, but that there is little convergence within any of the field plots.

SSU libraries reveal a similar diversity pattern, with 203 unique OTUs identified from 489 SSU sequences (Table 5). Shannon diversity across all plots was 4.81, with an estimated total of 550 species present. Plot-level diversity was equally high across all plots, and similar in magnitude to values in the ITS dataset (Figure 1c). At the treatment level, both grasses and pastures had high diversity levels, whereas pine and hardwood treatments were significantly lower, indicating low eukaryotic beta diversity in the forested treatments (Figure 1d).

This is further illustrated by examining shared species within and among treatments. About twice as many eukaryotic taxa were shared between land uses as in the fungal libraries (Table 4b). Morisita-Horn similarity values for eukaryotic communities illustrate that communities within land uses are most similar to themselves, and that among land uses, there was high similarity between plots within forested or agricultural treatments (Figure 3a). Comparisons at the treatment level further demonstrated that within-forest and within-field comparisons were much higher that the similarity of communities between the land use types (Figure 3b).

Higher order taxonomy of both fungal and eukaryotic libraries show striking evolutionary breadth. OTUs from the fungal libraries comprised 8 Kingdoms and 74

Families (Table 6a). Approximately 12% of the ITS OTUs were from non-fungi. These sequences were equally rare in all plots, and mainly represented alveolates, amoeba, rhizaria, stramenopiles, and green algae. Within Kingdom Fungi, all five phyla and several basal lineages were found, and comprised 50 different fungal families (Table 6b).

Eukaryotic libraries contained 11 Kingdoms and 110 distinct family lineages (Table 6c).

It is notable that in the fungal libraries, hardwood plots had lower diversity for all higher taxonomic levels, and in the Eukaryote libraries, this was true for both pines and hardwoods. Furthermore, at the highest taxonomic level, eukaryotic libraries from forested plots (pines and hardwoods) are dominated by fungal taxa (Figure 4b). Within

Kingdom Fungi, the Ascomycota and basal fungi are most abundant in libraries from

fields (cultivated and pasture), and the Basidiomycota dominate in both Eukaryotic and

Fungal libraries from forest plots (Figure 4a,c).

(a) Taxonomic Diversity of nrITS Libraries Kingdom Phylum Class Order Family Total 8 17 34 63 74

Cultivated 7 8 19 25 28 Pasture 7 6 27 38 36 Pine 2 5 8 21 21 Hardwood 2 4 9 13 14

(b) Fungal Taxa from nrITS Libraries Phylum Class Order Family Total 6 19 41 50

Cultivated 6 11 17 20 Pasture 5 13 21 22 Pine 3 7 18 20 Hardwood 3 6 10 13

Cultivated 7 16 25 39 46 Pasture 10 16 27 46 57 Pine 4 10 15 27 32 Hardwood 5 10 19 25 31

(a) Eukaryotic Kingdom and Land Use 100%

Other Eukaryotes 75% Amoebozoa Viridiplantae 50% Alveolata Rhizaria 25% Metazoa

0% Fungi Cultivated Pasture Pine Hardwood

(b) Eukaryotic Fungal Phyla and Land Use 100%

75% Glomeromycota Chytridiomycota 50% Basal Lineages

25% Ascomycota Basidiomycota 0% Cultivated Pasture Pine Hardwood

75% Zygomycota Glomeromycota 50% Chytridiomycota Basal Lineages 25% Ascomycota Basidiomycota 0% Cultivated Pasture Pine Hardwood

2.3.3 Ordination of soil communities

NMS ordination of plots in Fungal OTU space represented 73% of the variation in species distributions (Figure 5). Axis 1 and 3 represent 23% and 46% of the variation, respectively. The diagonal of these two axes clearly separate the land use plots into two groups: forests (pine and hardwood) and fields (cultivated and pasture). An MRPP test confirms that these two groups are significantly different (p=.0031, Table 7). Axis 2, representing 4% of the variation in the original data, is not correlated to land use, but is correlated to texture and mineral N content. The shift from fields to forests is correlated with several environmental variables. Soil fungal communities from fields are correlated with elevated mineral soil pH, soil P, and soil and organic horizon N. Fungal communities from forests are correlated with high C and C:N ratios from both mineral and organic horizons, as well as high water extractable DOC from mineral soil.

NMS ordination of plots in Eukaryotic OTU space represented 84% of the variation in species distribution (Figure 6). Axes 2 and 3, which represent 51% and 28% of the variation, respectively, separate the plots along a land use gradient. Axis 1, which represents about 5% of the variation in species space, does not separate plots according to land use, and is correlated to mineral soil nitrogen content. MRPP results significantly group the Eukaryotic communities into three groups: hardwoods, pines, and fields

(cultivated and pasture, Table 7). Eukaryotic communities from field soils are correlated to increasing mineral P. Pine and hardwood eukaryotic communities are correlated to

increases in DOC, C, and C:N in both organic and mineral soil horizons. Soil texture is not significantly correlated with any axis.

NMS ordination of Unifrac distances between communities reveals a similar separation of fields and forests along Axis 1, but not Axis 2 or 3 (Figure 7). This ordination employs the Unifrac distance measure between plots – based on phylogenetic distance, not presence of shared species – and therefore illustrates the amount of shared evolutionary history between plots. Axis 1 and Axis 3 do not separate plots along the land use gradient, and are not significantly correlated to any environmental variables measured. Axis 2 does separate plots according to land use. Both the Unifrac significance and Parsimony tests significantly separate all four land use types (Table 7), and this gradient from fields to forests is positively correlated to C:N ratios, total C and

N, and water-extractable DOC, and negatively to extractable soil P.

Fungal MRPP Eukaryote MRPP Unifrac Significance P Test p=0.23 p=0.004 p<0.001 p<0.001 Treatment 1 Treatment 2 Cultivated Pasture 1.000 0.475 <0.006 <0.001 Cultivated Pine 1.000 0.023 <0.006 <0.001 Cultivated Hardwood 1.000 0.029 <0.006 <0.001 Pasture Pine 0.094 0.031 <0.006 <0.001 Pasture Hardwood 0.103 0.027 <0.006 <0.001 Pine Hardwood 0.654 0.198 0.018 <0.001 Fields Forests 0.0031 0.0003 <0.001 <0.001

Fungal Species Space Fungal Species Space (a) G1 (b) P3 H1 P1 H2 H4 mDOC P3 G3

oC Silt mCN

mN 46% 4% oCN

– H4 - mAcid mpH mC P2 mCN oC C1 H2

C2 H1 mAcid Axis 3Axis Axis 2Axis Sand mN mpH

35 P2

oN G1 mP C2 P1 G7C1 G7 G3

Axis 1 - 23% Axis 1 - 23%

Eukaryotic Species Space Eukaryotic Species Space

(a) H1H4 (b) C1

C3 H2 P1 H4 mDOC mP mC mCN P2 G7 C2

oC P1 28%

51% oCN – - P3 G3 mN H1 G1 oCN C1 P2

Axis 3Axis mCmDOC Axis 2Axis mAcidoDOC oC mP mCN

G3 C3 C2 P3

G1 G7 H2

Axis 1 - 5% Axis 2 - 51%

Eukaryotic Phylogenetic Space Eukaryotic Phylogenetic Space (a) G7 (b) G3 C1 C2 H2

G1 C3 G7 mP G1

G3 10%

19% P3 C2

– - P2 P1 mC mCNoC

Axis 3Axis mDOC Axis 2Axis mP

H3 H1 P3 mDOC mC P2 C1 oC mCN P1 C3 H2 H1 H3

Axis 1 – 11.5% Axis 2 - 19%

2.4 Discussion

2.4.1 Land use and edaphic properties

Soil properties in the Piedmont are influenced by abiotic, biotic, and anthropogenic processes. Like all studies across a real landscape, these properties have great variation among plots, but nonetheless form gradients across the landscape. In this study, soil gradients of C, N, C:N and DOC are significantly correlated to land use.

Mineral soil C:N ratios range from about 12.5 in fields to almost 30 in pine forests, and organic horizon C:N ranges from about 30 in fields to almost 90 in pines. C:N ratio is a useful index of both C and N availability, and the gradient on this landscape is the result of both human and natural influences. Cultivated fields and pastures, for example, have

N inputs from humans, and result in substrates of lower C:N ratios that are more easily consumed by microbes. Forests, and pine plots especially, tend to produce more recalcitrant litter and therefore have higher C:N ratios in organic and mineral soil horizons (Richter and Markewitz 2001). In contrast, soil pH and acidity are not correlated to land use. All soils in this study shared similar parent material and are therefore acidic, but form a pH gradient ranging from 4.3 to 6.5 that results from differences in litter inputs, as well as liming and N additions by humans. Likewise, fractions of sand, silt, and clay were not significantly correlated to land use in this study.

Though all soils are relatively coarse, there is an environmental gradient from 61-84% sand and 4-12% clay. In general, pine and cultivated fields were the most sandy. In

cultivated fields, this is directly due to human caused erosion, and in the pines, this could indirectly be due to human use (or, more appropriately, human abandonment) as pines were planted to stabilize highly degraded farmland (Li et al. 2010). This land was abandoned because it was sandy, and therefore the least suited for growing crops (Metz

1958).

2.4.2 Communities and environmental gradients

In this study, I demonstrate that fungal and eukaryotic communities from the

South Carolina Piedmont differ along several ecological gradients, many of which are correlated to land use. About half of the variation in fungal species space is significantly correlated to the shift from fields to forests (Figure 3). The fungal community is likely responding to the plant gradient directly, mediated by the relationship between ectomycorrhizal diversity and host plant abundance and diversity (Allen et al. 2003,

Morris et al. 2008), as well as the influence of root exudates and litter inputs on soil carbon (Deacon et al. 2006, Broeckling et al. 2008). Several other environmental gradients are positively correlated with the shift from fields to forests, namely C, DOC, and CN ratios from both organic and mineral soil horizons. These measures of carbon availability and quality have previously been shown to influence total diversity and community structure of fungi (Waldrop et al. 2006, Hartmann et al. 2009). Similarly, fungal communities of fields are associated with increasing N and P, nutrients known to alter fungal communities and decrease diversity (Parrent et al. 2006, Allison et al. 2007).

There are two gradients correlated to fungal species space that are not tied to land use. Soil texture correlates to a minor amount of the variation, and has been demonstrated to be important in explaining enzymatic activity in soil fungi (Grandy et al. 2009). The lack of strong correlation in this study may reflect the fact that, although there is a difference in texture among land uses, all soils here represent some of the most coarse soil types, therefore representing only a small end of the biologically relevant range of soil textures. Soil pH is associated with about one quarter of the variation.

While pH is less likely to affect fungal diversity than bacterial diversity, it has been shown to influence fungal community structure, and the relatively weak relationship here may reflect the fact that there is a narrow range of soil pH values across the land use gradient (Kennedy et al. 2005, Lauber et al. 2008).

A second gene region reinforces the observations from our fungal libraries.

Sampling of total eukaryotic communities across the land use gradient significantly separates land uses into fields (cultivated and pastured), pines, and hardwoods. This transition represents almost 80% of the variation in eukaryotic species space (Figure 4).

As above, the transition from fields to pines to hardwoods is positively correlated to carbon quality and quantity in soil, and negatively associated with soil P. Few studies of microeukaryotes have directly examined land use effects on community structure, but many soil eukaryotes are likely feeding on soil bacteria and fungi and should therefore shift in community structure in kind (Paul 2007). A minor ordination axis, with 5%

variation, is correlated to N and not aligned with land use change. Interestingly, the influence of N on eukaryotic structure is of minor importance in this study, and soil texture is not significantly correlated to our eukaryotic ordination.

Phylogenetic analysis of Eukaryotic libraries allows for an ordination independent of species delineation, and, strikingly, produces a similar pattern (Figure 5).

Based on evolutionary distance, this ordination significantly separates the four land uses from each other. As above, the transition from fields to forests is positively correlated to mineral C quality and quantity, and negatively correlated to mineral P. Unlike the OTU based ordination, there is no correlation to organic horizon properties. This could simply reflect low representation of litter eukaryotes in our libraries, but may instead suggests that the soil eukaryotes across the land uses are from more phylogenetically distant lineages in mineral horizons.

It is heartening to note that two independent sampling methods, and both OTU- based and phylogenetic approaches, reveal a similar pattern: Soil eukaryotic communities are correlated to land use, and that this change is positively correlated to soil organic carbon quality and quantity and negatively correlated to the availability of

N and P. This not only strengthens our conclusions, but also illustrates the utility of both approaches. Furthermore, the fact that OTU based ordinations of SSU data largely agree with ordinations of the Unifrac distances suggests that our definition of OTU was robust.

2.4.3 Land use and taxonomic diversity

A taxonomic evaluation of our sequence data demonstrates that both fungal and eukaryotic libraries exhibit high diversity across all land uses (Figure 1). In each library, every second clone represented a new OTU. This is consistent with other surveys of soil diversity utilizing molecular methods, and stresses the incredible magnitude of undescribed organisms residing in soil (O'Brien et al. 2005, Buee et al. 2009, Jumpponen et al. 2010). Although sampling of this high diversity was limited, a clear pattern of decreasing beta diversity across land uses was evident. At least one study of

Ascomycete diversity found a similar pattern, with high alpha diversity in all plots, but little regional variation in the species pool (Green et al. 2004). In both ITS and SSU clone libraries, diversity was high in cultivated fields, peaked in pastures, then decreased significantly in pine and especially hardwood plots. This change in beta diversity was driven by the dominance of Kingdom Fungi, especially Basidiomycete fungi, in pine and hardwood libraries.

In eukaryotic libraries from fields, less than half the taxa were from kingdom

Fungi, and 10 other eukaryotic Kingdoms were represented (Figure 2). Cultivated fields contained 21 fungal families and 25 non-fungal families. Pastures similarly contained 24 fungal families and 25 non-fungal families. The non-fungal lineages were dominated by members of the Alveolata, Metazoa, and Amoebazoa, taxa commonly found in molecular studies from soil (Bailly et al. 2007). In both types of fields, the majority of

fungal families were comprised of single celled, free living yeasts, chytrids, and basal

Mucorales and Mortieralles, all known to be common in soil (O'Brien et al. 2005,

Jumpponen et al. 2010). In contrast, Eukaryotic libraries from pines harbored 21 fungal families and 11 non-fungal families from 3 kingdoms. Of the 21 fungal families, 13 are lineages that are multicellular and mycorrhizal (e.g. Russulaceae, Cortinariaceae) or saprophytic (e.g. Tricholomataceae, Marasmiaceae). Hardwood plots mirrored this pattern, as well, with only 12 families from 4 non-fungal kingdoms, and 19 fungal families comprised of 13 mycorrhizal or saprophytic lineages.

In fungal libraries from fields, the majority of OTUs were from Phylum

Ascomycota or basal lineages in the Mortierellales and Mucorales (Figure 2). Cultivated fields had 20 fungal families, and pastures had 22 families. In both cases, over 90% of the

OTUs were yeasts or basal fungi. Fungal libraries from pines were comprised of 11 fungal families, 8 of which were mycorrhizal or saprophytic basidiomycetes. Similarly, hardwood libraries had 20 fungal families, 10 of which were mycorrhizal or saprophytic basidiomycetes. Both libraries demonstrated a similar pattern in fungal diversity, with field plots harboring a more diverse, more evenly distributed sampling of fungal and non-fungal taxa that are mostly unicellular and free-living. Forest plots harbored many of these same free-living taxa, but with less total diversity and a concentration of OTUs in fungal families that are either symbiotic with plants or specialized to decompose plant litter.

Changes in fungal communities along the land use gradient are consistent with vegetation patterns during old field succession (Schafale and Christensen 1986). Though the cultivated fields, pastures, pines, and hardwoods at the Calhoun have been under their current land use for decades, they reflect four distinct stages in the succession of old fields to mature forests. Early-successional fields are dominated by fast growing, small bodied organisms, and late-stage organisms should be large and perennial. This is also the case with the dominant fungal taxa in forest soils. Furthermore, theory predicts a rise in diversity, peaking in mid-successional stages and lowering to a plateau of fewer, dominant species. This pattern is reflected in the beta diversity of our land-use treatments (Figure 1). Similar patterns were found in a spruce rotation in Germany, where a decrease in evenness and increase dominance of fungi occurred over 65 years

(Chauvat et al. 2003).

2.4.4 Challenges for molecular microbial ecology

Sequence based studies of soil communities are invaluable for enumerating diversity, and effective at addressing ecological questions. Nonetheless, challenges remain in using either method. Sequence similarity approaches to defining OTUs provide adequate means to infer shared taxa and ecological distance, but identifying those OTUs remains limited by the identified sequences in public databases. In this study, over 80 taxa were identified only to Kingdom, either because they lack a representative sequence in Genbank and/or because they are entirely unknown to

science. Studies using this approach may identify a new locale for taxa known only from soils, but do little to advance knowledge of the biology and life history of the organism.

A phylogentic approach may circumvent some of that challenge, as a phylogenetic tree that includes known taxa may place an unknown sequence in a clade with well described organisms, suggesting form and function. This approach may be intractable, however, as datasets using next generation sequencing platforms can generate greater than 100,000 sequences, too many to curate by hand. If history is a guide, these computational challenges will likely quickly be overcome. There is a great need for public databases with quality sequences from well annotated, vouchered organisms, however, will take more time, and should be the very highest priority for the taxonomic community.

2.5 Summary

Sampling soil communities across a land use gradient has revealed a striking level of diversity. Using two independent genes to sample the diversity, it is clear that there is shift from free living, diverse eukaryotic communities in pastures and cultivated fields to a community dominated by fungal taxa that are symbiotically associated with trees and their litter inputs in forested plots. The large fraction of variation explained by ordination axes across the land use gradient suggests that the presence of trees is critical in structuring fungal dominated systems. Besides the direct effect of trees as symbiotic partners for fungi, the fact that carbon quality and quantity are positively correlated to

the shift from fields to forests suggests that trees also mediate fungal community change indirectly by litter and root inputs. The negative correlation of P to this field to forest transition illustrates the lasting influence that agriculture can have on belowground communities. Finally, soil communities respond weakly to environmental gradients such as pH and texture, which are influenced by land use to a far smaller extent.

Although trees were the main influence on soil communities in this study, future work should be directed at identifying other environmental gradients that influence soil community structure, and strive to tease apart their relative importance. It is likely that no one gradient is dominant in all systems, but there may be a predictable ranking of the relative importance of many commonly measured soil properties. Next generation sequencing makes possible studies magnitudes larger than this one, and should focus on the variation in soil communities not only across land uses, but seasonally, spatially, and between soil horizons.

3. A seedling bioassay to measure diversity of ECM propagules

This chapter examines fungal diversity by focusing on ECM propagules across the land use gradient that are resistant to disturbance and able to symbiotically associate with loblolly pine seedlings. In the greenhouse, pine seeds were planted in soils from uncultivated forests, cultivated fields, and previously cultivated fields now under grass for pasture or 50 year old pine stands. After one year, roots from each pine seedling were harvested for DNA extraction, and identified by constructing clone libraries from

DNA extracted from pooled root tips. Seedlings planted in sterilized, control soils were successfully used to identify and remove greenhouse contaminants. About half of the

OTS’s recovered were from only five genera, with two species of Rhizopogon dominant across all land uses. Although not statistically significant, there was a trend toward higher diversity in both forested treatments. There was also a trend toward higher beta diversity in forested plots as inferred from low levels of community similarity between fields and forests. Ordination of communities in species space demonstrated that the communities of ECM propagules in fields were similar, while both forest types harbored distinct communities of ECM.

3.1 Introduction

Soil fungal communities are extremely diverse (Buee et al. 2009, Jumpponen et al.

2010). These communities are functionally diverse, as well. Many taxa are identified only

from sequence data, and their life histories can only be inferred by their phylogenetic affinity to known taxa. Due to this, sequence based surveys have limited ability to categorize OTUs into functional groups. One strategy to address the diversity of a functional group is to sample only that group. This ‚filtering‛ can be done by enrichment, selective culturing, or a seedling bioassay.

In seedling bioassays, sterile seeds are planted into soils in the greenhouse and later harvested to characterize the community of potential mycorrhizal symbionts able to survive as propagules once disconnected from their plant hosts. The method was applied first applied by Jasper et. al. (1987) to survey arbuscular mycorrhizae, and later adapted to ECM by Brundrett et. al. (1994) by planting tree seeds into soil (Jasper et al.

1987, Brundrett and Abbott 1994). Baar et. al. (1999) were the first to employ molecular methods to identify the ECM community on seedling roots, and the method has become more popular with advances in PCR technology (Baar et al. 1999).

A bioassay with obligate mycorrhizal trees is an effective way to identify those propagules available in soil (Avis and Charvat 2005, Bruns et al. 2009). These propagules may only be detected in low numbers in sequence libraries, yet are critical to survivorship in seedlings colonizing after an ecological disturbance. Pinus taeda is an obligate mycorrhizal species, and as such, its fitness depends directly on the ability to associate with appropriate symbiotic partners. Conversely, invasion into new habitat is limited by available ECM partners (Dickie et al. 2010). Loblolly pine is also the most

abundant tree in the southeast, and understanding the communities of ECM it will encounter in different land uses may help to predict the effect of continued harvest and recolonization of pine on fungal diversity in the region (Allen et al. 2005).

Studies of ECM on tree roots have taught us much about the structure of these

ECM communities. Direct sequencing of ECM root tips demonstrates that cryptic diversity is often overlooked with morphotyping alone. ECM community are structured by differences between closely related host tree species, seasonal differences, by soil horizon, and between urban and rural sites (Koide et al. 2005, Smith et al. 2007,

Jumpponen et al. 2010). Several studies have demonstrated that increased N and P inputs into soils decreases ECM species richness, and that increases in plant photosynthate influences the structure of ECM communities without necessarily decreasing diversity (Lilleskov et al. 2002, Parrent et al. 2006).

Loblolly pine invasions and range expansions occur worldwide, and have illustrated the influence of ECM communities on plant population viability. Loblolly are unable to establish unless they can associate with a suitable ECM partner, and experience increased fitness when associated with a diverse set of symbionts from their native range (Dickie and Reich 2005, Geml et al. 2010). These pines make up the majority of natural recruits and plantation trees in a region that is one of the largest producers of forest products in the world. As plantation forestry increases in the Southeast, replanting pines after harvest will become more economically attractive. Understanding

the propagule community unique to pine systems, as well as other land uses, may influence choices for land managers seeking to balance efficient growth and preservation of native diversity.

Specifically, this chapter aims to ask: (1) Are the ECM propagule communities able to associate with loblolly pine the most diverse in soils under loblolly pine? (2) Do forest soils harbor greater ECM diversity than grasslands and crop fields? And (3) Is there a community of pioneer fungal taxa able to associate with loblolly pine that invade fields?

3.2 Methods

3.2.1 Soil collection and seedling plantings

The soils used in this experiment were collected during the sampling utilized in the previous chapter (Section 2.2.2). At this sampling, soils were returned in bulk to

Durham, NC, where they were stored at 4°C for 1-6 days. Soils from the four pits at each site were homogenized, and one ~500g subsample was sieved and dried for analysis.

This sample provided the soil for DNA extraction above, and also the inoculum for planting.

All plantings were with soil mixtures consisting of approximately 1:1:1 soil inoculum:sand:coarse gravel by volume. For each plot, twenty pots were lined with newspaper, filled with soil mixture, and planted with three surface-sterilized seeds of

Pinus taeda (240 pots in total). Seeds were all full siblings, and were sterilized by bathing

in a 5% hydrogen peroxide solution for 1 min. All pots were thinned to one plant after germination. In addition, autoclaved treatments were constructed to identify greenhouse contaminants by combining soils from all three plots of each land-use treatment, then mixing 1:1:1 with sand and gravel as above. These soil mixtures were autoclaved three consecutive times with an overnight incubation between each autoclaving to minimize the presence of ECM propagules from the field (Bidartondo et al. 2001). Ten autoclaved pots were planted per land use treatment. All plants were grown for one year in the Duke Biology greenhouse with no nutrient supplements and minimal watering. Plants were repositioned periodically to compensate for greenhouse bias.

3.2.2 Seedling harvest

At harvest, plants were gently shaken free of soil, soaked in buckets of water, and washed thoroughly in tap water to remove soil particles from roots. The aboveground portion was removed for drying. The roots of each plant were bagged by plot and refrigerated over two days during harvest of root tips. After removal of tips, roots were dried as well. Both above- and below-ground dry weight were measured per plot by weighing 20 plants in bulk and reporting an average weight per plant.

Roots were examined for mycorrhizal colonization and were ranked on a relative scale of 1 to 5 for both the number of roots colonized per plant and extent of mycorrhizal root tip development on each root. Using a dissecting microscope, three root tips were

randomly picked, washed in 95% ethanol, and stored in a single microcentrifuge tube containing 500 µl of 2xCTAB buffer for subsequent DNA extraction. Three tips from each plant were placed in this tube, resulting in a pooled root sample of 60 tips from 20 plants. Three replicate pooled samples were taken for each treatment. Autoclaved treatments consisted of only ten plants, therefore sampling consisted of 30 tips per sample, and ten individual tips per treatment.

3.2.3 Root tip clone libraries

Pooled root tips were ground by hand with a plastic pestle, then transferred to a new tube containing an additional 400 µl of 2xCTAB buffer and 5 or 6 2.5 mm zirconia beads. Tubes were fixed horizontally on a vortex and shaken for 10 minutes at full speed. Extracted DNA was precipitated by centrifugation for 15 minutes with one volume of 24:1 Chloroform:Isoamyl Alcohol. The supernatant was removed to a new tube and DNA precipitated with 0.6 volumes of ice cold isopropanol. Pellets were washed with 300 µl cold 80% ethanol, air dried, and re-suspended in 100 µl sterile, deionized water. Samples were stored at -20˚C until use.

Each pooled DNA sample was amplified by PCR using the following reaction mixture and conditions: 5 µl DNA extract, 8.375 µl sterile H2O, 4 µl dNTP’s (1.25 mM each), 2.5 µl of 10x PCR buffer, 2.5 µl 10mg/ml BSA, 1.25 µl of 10 µM ITS1 primer, 1.25 µl of 10 µM ITS4 primer and 0.125 µl of Abgene Red Hot Taq Polymerase (Advanced

Biotechnologies, LTD., Epsom, Surrey, U.K.). Reaction conditions were 3 minutes at 95˚C followed by 20 cycles of 1 minute at 94˚C, 30 seconds at 50˚C, 2 minutes at 72˚C.

Two PCR reactions were performed for each pooled DNA. In turn, one PCR reaction from each of the three replicate DNA samples was mixed for use in subsequent cloning. This resulted in two DNA libraries from each plot, each one of the two libraries being formed from three PCR reactions from replicate DNA extractions. PCR mixtures were cloned using the TOPO TA Cloning Kit with PCR2.1 chemically competent cells

(Invitrogen Corporation, Carlsbad, CA, USA) according to manufacturer’s instructions.

Overnight E. coli colonies (48 per library) were plucked by hand from plates directly into a second PCR reaction using sterile pipette tips. The PCR mixture and conditions were as follows: 10.7 µl sterile H2O, 3.2 µl dNTP’s (1.25 mM each), 2 µl of 10x PCR buffer, 2 µl 10mg/ml BSA, 1 µl of 10 µM M13F (-20) primer, 1 µl of 10 µM M13R primer, and 0.1 µl of Red Hot Taq Polymerase. Conditions were 3 minutes at 95˚C followed by

35 cycles of 1 minute at 94˚C, 30 seconds at 50˚C, 2 minutes at 72˚C.

PCR reactions were purified using the QIAquick 96 PCR Purification Kit (Qiagen

Inc, Valencia, CA, USA) according to the manufacturers’ instructions, except DNA was eluted in 100ul of sterile water. Each PCR product was sequenced in one direction using the ITS4 primer. Sequencing was done using the Big Dye V.3 dye terminator reaction on an ABI 3700 automated sequencer.

3.2.4 Data analysis

Sequences were proofread using Sequencher 4.2 (Gene Codes Corp, Ann Arbor,

MI, USA). Sequences were trimmed of ends and vector contamination, and exported as

FASTA files. Sequences were identified by BLAST against NCBI’s nucleotide database using Blast Client 3. The resulting file was parsed into tabular formula with a visual basic macro written in Microsoft Excel.

OTU determinations for this study were done simultaneously with the ITS clone libraries from Chapter 2. This was done to ensure that sequences found in both experiments would be considered the same OTU. OTUs were calculated by first generating pairwise Needleman-Wunsch distances between entire ITS sequences, then grouping by nearest neighbor in DOTUR using a 96% similarity cutoff. It is the grouping step that required the analysis of both ITS datasets at the same time, as OTUs are determined only from the current dataset, and more taxa cannot easily be added to the group once they have been defined. As above, OTU-based numbers of shared species,

Morisita-Horn community similarity, and ACE estimated richness were calculated using

EstimateS (Colwell 1994-2004). To control for the effect of unequal sample sizes on calculations of Shannon diversity, the metric was rarified to the smallest sample number using Ecosim (Gotelli and Entsminger 2000). NMS ordination of plots by OTU was performed using PC-ORD Version 5 (McCune and Mefford 2006). Species abundances were relativized by the maximum value so that all abundances were between zero and

one. The ordination converged on a three-dimensional solution. To test for significant differences among land use types, a multi-response permutation procedure (MRPP) test on the Sørensen distance matrix was also performed in PC-Ord.

3.3 Results

3.3.1 Plant biomass and root colonization

All seedlings were heavily colonized by ECM fungi (Table 8). Mycorrhizae were characterized by a swollen mantle of hyphae surrounding each root tip. Roots grown in soils from pine treatments had the least number of ECM tips per root length, and had the lowest ECM biomass, as well. Interestingly, seedlings from the autoclaved soils for all four land use types had the highest level of coverage and ECM biomass, sometimes easily doubling the amount of tissue found on the roots from any other treatment.

Rank Order of EM Root Colonization Lowest Highest Relative Root Coverage Pine < Grass < Hardwood < Cultivated < All Controls Relative EM Biomass Pine < Grass < Hardwood < Cultivated < All Controls

Seedlings grown in soil from fields had about twice the total biomass as forests, with seedlings grown in pine soils showing a significantly lower dry weight at harvest

(Figure 6). Furthermore, seedlings from pine soils had the highest root to shoot ratio.

Seedlings grown in pines soils grew the least and allocated a significantly larger portion of their biomass to roots, indicating the lowest nutrient availability relative to the other three treatments. Seedlings grown in hardwood and grassland soils had intermediate root to shoot ratios, and seedlings from cultivated soils had a significantly lower ratio.

Seedling biomass Root:Shoot ratio 4.0 1.6 3.5 1.4 3.0 1.2 2.5 1.0

2.0 0.8

Grams Grams 1.5 0.6 1.0 0.4 0.5 0.2 0.0 0.0 C G P H A-C A-G A-P A-H C G P H A-C A-G A-P A-H

Root biomass Shoot biomass 2.5 2.5

2.0 2.0

1.5 1.5 Grams 1.0 Grams 1.0 . 0.5 0.5

0.0 0.0 C G P H A-C A-G A-P A-H C G P H A-C A-G A-P A-H

3.3.2 Dominant species of ECM on roots

Nearly half of all OTUs were one of five species, and about a third were in the genus Rhizopogon. This genus is known for production of resistant propagules, and has been documented to survive intense wildfires (Baar et al. 1999). Rhizopogon was ubiquitous, showing up in all land uses and nearly every clone library, which is likely due to resistant spores that are long-lived and readily dispersed (Bruns et al. 2009).

Rhizopogon, Wilcoxina, and Cenococcum are common, ruderal ECM often associated with pine roots in disturbed sites, and are frequently the most abundant taxa in seedling bioassays (Sylvia and Jarstfer 1997, Bidartondo et al. 2001, Matsuda et al. 2009). At least one Athelia species has been described as a plant pathogen, but seedlings did not show signs of illness, and the isolates here were only identifiable to genus (Dodd et al. 2000).

Table 9: Top five genera of ECM fungi found on bioassay root tips. Counts are based on pooled treatment data, and identities are based on closest BLAST match.

Cultivated Grass Pine Hardwood Rhizopogon cf fuscorubrens 96 43 1 65 Rhizopogon c.f. pseudoroseolus 12 17 9 21 Wilcoxina 52 Athelia 1 19 13 Cenococcum geophilum 2 11

3.3.3 Greenhouse contaminants

Seedlings from all four autoclaved soils were heavily colonized by mycorrhiza.

Duke’s greenhouse is an open system, and at one point during nearby construction an established loblolly pine stand was cut and graded. Even faced with these conditions,

only 16 species from five genera of mycorrhizal taxa were recovered across all autoclaved pots (Table 11). Furthermore, the vast majority were a 96% or greater sequence similarity match to Thelephora terrestris, a common, ubiquitous fungus known to disperse rapidly and to colonize pine in disturbed sites (Bois et al. 2005).

Only three species were found in both autoclaved soils and our experimental plots (Table 10). The most abundant, a Rhizopogon species, occurred 205 times in nine experimental plots, but only five times in one of the four autoclaved plots. Based on this, it was assumed that inoculum from this species indeed came from the experimental soils, and the occurrence in one control plot is likely due to incomplete sterilization of that soil. Rhizopogon spores are known to survive desiccation, extended dormancy, and even severe wildfires. In contrast, Thelephora terrestris was found in about equal proportions in both control and experimental soils, in 3 of 4 autoclaved treatments and

10 of 12 experimental treatments. A similar pattern was found for the third fungal partner, a Suillus. Both of these species are readily found on pine and are likely contaminants introduced in the greenhouse. Sequences of these two species were therefore removed from the dataset for all subsequent analyses. Only one library from one autoclaved soil contained sequences of Rhizopogon, whereas 9 of 12 experimental clone libraries contained this genus. It is likely the source of these propagules is the forest soils, and not greenhouse contamination, therefore Rhizopogon sequences were left in the dataset.

To confirm the validity of this removal, an NMS ordination was performed on all sequences, including contaminants. MRPP confirms that the fungal communities in the autoclaved soils are significantly different from all experimental plots, and excluding these sequences is entirely reasonable (Figure 9).

Control Experimental Control Plot Experimental Plot Number of Species 16 54 -- --

Species Counts Number of Plots Rhizopogon cf. fuscorubrens 5 205 1 9 Thelephora terrestris 107 97 3 10 Suillus cf. variegatus 15 7 2 2

Table 11: Count data of all ECM root tips found in the control pots, grouped to genus. There were only 5 genera found in the control plots.

Genus Count Thelephora 115 Suillus 20 Tomentella 7 Rhizopogon 5 Fungus 2 Total 149

Bioassay ITS Species Space

C3 H4 C2 G3 C1 G1 P3 P1 H2

GCG-A G7

26% -

P2 Axis 2

CCC-A

HHC-A

PPC-A

Axis 1 - 31%

3.3.4 Diversity and overlap of fungal ECM propagules

Hardwood soils harbored the highest richness of ECM propagules, although the differences were not significant (Figure 10, One-way ANOVA, p = 0.2908, alpha=0.05).

The average value for the ACE diversity estimator was 25 in hardwoods, 15 in pine, and

7 or less in fields. These richness estimates are similar in magnitude to other studies of

ECM taxa on loblolly pine in piedmont soils (Edwards et al. 2004, Parrent et al. 2006).

Estimated ECM Richness 40 35 30 25 20 15 10 ACE DiversityACE Estimator 5 0 Cultivated Grass Hardwood Pine

Figure 10: Estimated species diversity averaged by land use. ACE is the Abundance-based Coverage Estimator, calculated in EstimateS (Colwell 1994-2004). Error bars are standard error. An ANOVA finds no significant difference among treatments.

There was considerable overlap in ECM species between cultivated and grassland soils (Table 12). For example, there were only 10 OTUs in the grass fields, and

3 of these overlapped with OTUs from cultivated fields. Less overlap was observed between fields and forests or between pine and hardwoods, and this is reflected in the

low values for Morisita-Horn similarity when contrasting within-land-use and between- land-use (Figure 11a). Grouped by treatment, there is high similarity among fields, but low similarity between fields and forests or between forest types (Figure 11b).

Table 12: Shared OTUs grouped by land use. Numbers in parentheses indicate total number of OTUs in each land use treatment.

Shared ECM Species Grass (10) Pine (22) Hardwood (23) Cultivated (9) 3 3 3 Grass (10) 3 2 Pine (22) 4

3.3.5 Ordination of fungal communities

NMS ordination of treatments in ITS OTU ordination space confirms that communities of ECM propagules from pine soils are unique, as are communities from hardwood soils (Figure 12). Communities from fields were significantly different from either forest, but indistinguishable from each other. Within-habitat ordination distances were smaller within pine and hardwood land-use types than in fields, indicating a more specialized community of ECM propagules in either forest type than in fields.

(a) Root tip similarity across land uses A 1.2 AB 1 ABC 0.8 BC BC

Horn C - 0.6 CD

0.4 Morisita D D D 0.2

0 CC CG CH CP GG GH GP HH HP PP

Land Use Comparison

(b) Root tip similarity forest to grasses 0.8 A A A 0.7 0.6

0.5

Horn - 0.4 0.3

Morisita 0.2 0.1 0 FF GF GG

Land Use Comparison

Bioassay ITS Species Space

27% P3P1 - H1 G7

Axis 2 H4

G3 G1 C2 Axis 1 - 24%

3.4 Summary

Land use change in the South Carolina piedmont has resulted in vast amounts of land colonized by loblolly pine. This pine has naturally regenerated on tens of millions 64

of acres of abandoned agricultural land and has been planted on millions more (Fox et al. 2007). When land is converted from agricultural use to pine in the piedmont, either naturally or through plantation forestry, soils experience a disturbance similar to this experiment. Organic material is removed, soils are desiccated, and vegetation is removed, effectively removing any actively growing fungal inoculum (Edwards et al.

2004). This study identifies the community of resistant propagules available to pine symbionts naturally regenerating or planted in soils from cultivated fields, grasslands, pine stands, and hardwood forests.

From these results it is clear that pines planted in a cleared hardwood forest have access to a unique community of ECM partners, and would be different still from a pine re-planted on cutover pine forest. In either case, there is a greater and unique diversity of ECM propagules available to the newly establishing seedlings than is available in grasslands or cultivated fields. Furthermore, the difference in ECM communities between pine and hardwood soils suggests that 50 years of pine regeneration from agriculture has created a community of symbionts unique to the pine system.

Grasslands have the lowest potential inoculum diversity. It is likely that the grassland community is dominated by fungi associated with grasses, whereas the cultivated fields only harbor propagules recently colonizing the sites.

Interestingly, seedlings planted in field soils showed the greatest overall growth, and seedlings from pine soils the least. I attribute this to periodic inputs of lime and

fertilizers to these soils (see Table 2). It is also a possibile that the ECM symbionts from pine soils may be more specialized to associate with loblolly and are able to extract a greater amount of photosynthate from their host plants, but that conclusion is beyond the scope of the experiment.

My results suggest that the mosaic of land uses found at the Calhoun

Experimental forest may help preserve the greatest diversity of ECM species in the region, as communities from each land use are distinct. This also illustrates the profound effect that vegetation has on belowground communities. ECM communities are distinct depending on the type of plant community in the area, and changes to vegetation cover will significantly impact the community of ECM propagules and fungal diversity in its entirety.

4. Estimating fungal abundance with real-time PCR and taxon-specific primers

This study proposes the use of selective PCR primers with real-time PCR to quantify the relative abundance of fungal taxa across soils. The approach models relative quantitation often applied to cDNA libraries in molecular biology, and requires that taxon-specific primers be quantified relative to a generic primer in which they are phylogenetically nested. Specific primers were identified from the latest phylogeny of

Kingdom fungi, then carefully tested first in silico, then confirmed for specificity using clone libraries from soil DNA. At least five of these primers have the potential to be used to estimate fungal abundance using QPCR, however care must be taken to ensure accurate estimates of PCR efficiencies and thresholds for every primer and environmental DNA combination. A proposed best practice requires both sampling and methodological replication and calculation of error on ratio estimates to ensure ecological relevance in the results.

4.1 Introduction

PCR and sequencing are powerful tools to detect environmental isolates, but can be time intensive. Another approach that harnesses the specificity of oligonucleotide primers and the sensitivity of PCR is real time PCR. Primers can be designed that only amplify a taxonomically distinct group of organisms. These phylogenetic groups often conserve function, as well. Applied to environmental DNA isolates such as those from

soil, a real time PCR assay employing taxon-specific primers can estimate the abundance of that group relative to total sample DNA.

4.1.1 Real-time PCR in ecology

Real-time PCR technology is a direct extension of the polymerase chain reaction

(Valasek and Repa 2005). Using fluorescent dyes that bind to newly formed PCR products, a special thermocycler coupled to a CCD camera can measure the increase in fluorescence as more dye binds product with each iteration of PCR. The rate at which product accumulates is directly proportional to the starting number of copies of DNA template. The process is very sensitive, often able to detect as little as one to five copies of a gene, and offers great potential at characterizing the abundance and function microbes in the environment (Pfaffl 2004, Arya et al. 2005, Smith and Osborn 2009).

When real time PCR is used to estimate starting copy number, it is called quantitative PCR (QPCR). Absolute quantitation occurs when copy number is estimated from a standard curve constructed from a DNA of known concentration, often a plasmid containing the gene of interest (Wong and Medrano 2005). An extension of this approach, commonly used in medicine, is relative quantitation. This approach compares accumulation of a gene of interest relative to a ‘housekeeping’ gene that is constitutively expressed and reports the results as a ratio (Wong and Medrano 2005). This method is subject to less error than absolute quantitation, as relative quantitation reports a ratio,

commonly referred to as a ‚fold‛ increase, without relying on determination from standard curves.

Recent ecological applications have relied upon the sensitivity of real-time PCR to detect rare organisms such as plant pathogens in soil or leaf endophytes. Landeweert et. al (2003) designed new primers specific to two fungal species and were able to quantify their relative abundance in potted soils. Using previously published primers specific to phyla of bacteria and fungi, Fierer et. al. were able to measure the relative abundance of each and to characterize the general structure of microbial populations in soils from a North American forest, desert and prairie (Fierer et al. 2005).

4.1.2 Calculations for real time PCR

Real-time PCR involves several steps that can be broken down into distinct phases of the reaction. The initial cycles of a PCR reaction, where no measurable product accumulates. This is called the linear or ground phase (Rebrikov and Trofimov 2006).

Fluorescent signal from the ground phase is used to determine the background that must be subtracted from the proceeding phases (Ruijter et al. 2009). As product accumulates, PCR enters the log linear phase, where the number of copies of PCR product nearly doubled each cycle. Finally, as reagents are consumed, the reaction reaches a plateau phase after which no appreciable amount of product is accumulated.

The cycle threshold (Ct ) is defined as the first cycle in which the number of PCR copies, Nc, has reached the exponential phase. The Ct is directly proportional to the

starting amount of DNA, No. The more DNA template in a reaction, the lower the Ct value will be. In most applications, PCR product accumulates at less than a doubling per cycle. This rate, empirically determined, is called the efficiency of the reaction, E, as represented by the formula:

To express the relative accumulation of product Rq, the equation is rearranged to:

and the ‘fold’ increase of a gene of interest is simply the Rq of the target gene divided by the Rq of the reference gene. This supplies a ratio that can be compared across samples by dividing the fold increase of the target gene from one DNA sample to the fold increase of the same gene in another DNA sample.

4.1.3 Estimating efficiency and cycle threshold

Although real time PCR can accurately detect the accumulation of PCR products, the values of both E and Ct are user defined. Small differences in either can lead to large differences in estimated abundance (Ruijter et al. 2009). In fact, a difference in E of 0.15 can lead to a ten-fold increase in the estimated fold increase of a target gene (Rebrikov and Trofimov 2006).

Two types of approaches to estimating efficiency are employed here. The first uses serial dilutions of the target DNA, graphing the relationship of DNA concentration

(log transformed) to estimate cycle threshold (Ramakers et al. 2003). The slope of this

line is the reaction efficiency, and this number is used in the fold calculation. The strength of this approach is that the efficiencies of each reaction are known, and reactions with poor kinetics can be identified and disregarded. There are two drawbacks to this method: Ct must still be estimated by the user, and many reactions are needed, requiring more reagents and more PCR runs.

A second approach is to use linear regression on each accumulation curve to extrapolate the starting copy number and to model the reaction efficiency. This method frees the user from estimating Ct, and does not require a serial dilution of DNA, saving reaction space and resources. Several computer programs are available to calculate these values from raw reaction data (Rebrikov and Trofimov 2006, Ruijter et al. 2009).

4.1.2 Taxon-specific QPCR

Taxon specific QPCR requires only a selective primer that reliably amplifies a targeted clade of fungi while not amplifying non-target DNA, and a generic primer set that amplifies all fungi. Again, the resulting ratio is relative, so comparisons should be made across samples. Essentially, two environmental DNA samples can be compared by determining the ratio of the target group of fungi relative to the total amount of fungi in the sample, then comparing the environments to see which has more of the target group.

For the method to be successful, the target genes must be a nested subset of the taxa amplified by the ‘all fungal’ primer. This allows comparisons to be made across samples that differ in total amounts of DNA or fungal DNA in the sample.

Applying this approach to soils requires careful testing at every step. Primers must be tested for specificity, and then confirmed as having satisfactorily high amplification efficiency. The key point is that this method targets the same gene for all primers, and that there is a nested phylogenetic hierarchy to the selective primers. The nested hierarchy is critical for meaningful ratios to be estimated. Finally, they must be used on extremely clean DNA samples, as even a small amount of inhibition of PCR amplification can have profound effects on estimates of DNA abundance.

This method can produce an estimate of the relative abundance of one taxonomic group between two environmental DNA samples. Ideally, this index would be used with an independent estimate of fungal abundance. This allows an estimation of both the total amount of fungi in a soil and the relative amount of that biomass coming from a specific taxonomic group. This index can be applied to estimate the impact of disturbance on ecosystems and to identify which taxonomic groups are most impacted and therefore warrant the use of more extensive methods of examining community change, such as the clone library approach. The primers identified here are also valuable for sequence-based studies with limited resources, as they allow for sampling within targeted taxonomic groups.

4.1.3 Testing Taxon specific QPCR with Piedmont soils

The goal of this study is to design and test a suite of taxon specific primers that can be used to estimate the relative abundance of common soil fungi. Specifically, this

study seeks to: (1) identify primers that are specific to the correct clade, (2) test whether efficiency correction or linear regression is a more robust way to calculate gene ratios, and (3) to explore the feasibility of using this method with environmental DNA.

4.2 Methods

4.2.1 Primer design and testing

All primers were designed by Jean-Marc Moncalvo and Rytas Vilgalys using a

DNA alignment of ITS and LSU gene sequences from 877 taxa in 126 recognized genera

(Moncalvo et al. 2002). Variable regions from both the 5’ and 3’ end of the ITS region, as well as the D1/D2 region of the LSU gene were targeted. Primers were initially tested for specificity in silico using BLAST from NCBI. Primers that returned matches to taxa outside the target group were excluded from further analysis.

Next, each specific primer was paired with a complementary, generic fungal primer that would produce a product from 100-300 base pairs. Primers were tested directly by standard PCR amplification of environmental DNA extracted from soil. For testing purposes, a composite ‚Soil DNA‛ sample was constructed by pooling equal volumes of all soil DNA extractions from the land use study in chapter two. This was done to increase the odds that the Soil DNA would contain template DNA for each selective primer, and to produce a large volume of DNA for methods development.

Clone libraries were constructed for each primer set as in section 2.2.3 and 24 clones were sequenced for each primer pair using the reverse primer. Sequences were

identified using BLAST and assigned to groups based on NCBI’s taxonomy. Primer pairs that amplified group members at least 85% of the time and did not amplify organisms outside of kingdom fungi were considered sufficiently selective.

4.2.2 Real time PCR reactions

Next, the same primer pairs were tested for amplification efficiencies using real- time PCR. Two test panels of reactions were performed, first using a serial dilution of composite soil DNA ranging from 10-1 to 10-6-fold dilutions performed three times independently to test for amplification efficiency over a wide range of concentrations, and second with three soil DNA extractions from the three Hardwood plots to examine differences in amplicon abundances in Piedmont soils. Reaction conditions were 15 minutes at 95°C followed by 40 cycles of 1 minute at 95°C, 30 seconds at 50°C, and 1 minute at 72°C. Reactions were run on an ABI Prism 7000 sequence detection system

(Applied Biosystems, CA, USA) using Sequence detection software version 1.2.3, and reaction conditions are in Table 13.

Reagent Concentration Volume (ul) [Final] Mastermix 2x 12.5 1x BSA 10 mg/ml 2.5 1mg/ml Forward Primer 10 mM 1.25 0.5 uM Reverse Primer 10 mM 1.25 0.5 uM ROX 1:80 1 1:2000 Syber Green I (1:1600) 6.25x 1 0.25x Water 0.5 DNA (10-1 to 10-6) 5 Total 25

4.3 Results

4.3.1 Primer amplification and specificity

Thirty-five taxon specific primers were tested for standard PCR amplification from piedmont soils using a composited DNA (Tables 14 and 15). Four primers were excluded from further analysis because they did not produce a product or amplified a fragment of incorrect length.

Thirteen of these primers were tested for specificity by construction of clone libraries (Table 16). Only 5 of the 13 pairs produced sequences with BLAST matches to the appropriate taxonomic groups at least 85% of the time. The other seven primers were deemed nonspecific, amplifying taxa across taxonomic levels.

Target taxa Primer Name Primer Sequence Target Region Reverse PCR test Amanita section Amanita aman_ITS1 cacttgtgcactgcttgtaggcag ITS1 5.8s Yes Mycena myc_ITS1 cttgtgcaccttttgtagtc ITS1 5.8s Yes Pleurotus pleur_ITS1 tgtgcacgcttcactagt ITS1 5.8s Yes Suilloid Boletales suill_ITS1 cttcgtgtagaaagtctttgaatg ITS1 5.8s No Laccaria lacc_ITS1 ctgcttcacatccacggcgta ITS1&2 ITS4 Yes Thelephoraceae thel_ITS1 gtgcacgctctgttcacacatcca ITS1&2 ITS2 Yes Amanita section Vaginata Vag_ITS ttccacctgtgcactgcctgtagac ITS1&2 ITS2 Yes Boletales bolete_5.8S tcgcgatatgtaatgtgaattgcagatc ITS2 ITS4 Yes

76 Craterellus crat_5.8S tctatgtaactctaatttacg ITS2 ITS4 Yes

ITS4B ITS4B caggagacttgtacacggtccag ITS2 ITS3 Yes ITS4NA (JL Parrent) ITS4NA cttttcatctttccctcacgg ITS2 ITS3 Yes Viriplantidae plant_5.8s agttgcgcccgaagccattag ITS2 ITS4 Yes Saccharomycetales sacch_5.8S attgcgataagtattgtgaatt ITS2 ITS4 No Sebacina seb_5.8s accctttggcattccgaagggtatg ITS2 ITS4 No Sebacina/salal root associate sebacina_5.8s gtatgtggacttggatgttgccgt ITS2 ITS4 Yes Uridiniomycetes ured_5.8S caaaaggcacacctgtttga ITS2 ITS4 Yes

Target taxa Primer Name Primer Sequence Target Region Reverse PCR test Amanita section Amanita aman_ITS2 agtcacttctgcctttccattggtgt LSU LR3 Yes Cenococcum ceno_ITS2 tcggggccccgtctgccggaag LSU LR3 Yes Euagaric euag_LSU cgcaaggccgggtttcgaccacg LSU LR5 Yes Euagaric euag_LSU4 ctcagcacgccgcaaggccggg LSU LR5 Yes Euagaric euag_LSU5 gcaaggccgggtttyaaccacg LSU LR5 Yes Gymnopus gymno_LSU gagctataccgtgtataagtctc LSU LR3 Yes Salal root associate/helotiales helo_its2 gccttaaaatcagtggcggtgcc LSU LR3 Yes Agaricus/Lycoperdaceae lyco_LSU agccaaataatgtttagagtag LSU LR3 Yes

77 Macrocybe/Callistosporium macro_LSU gatcaggatctctgtcatggagagcact LSU LR5 Yes

Mycena myc_ITS2 ggtctgctccctttaaattcattagtgggat LSU LR3 Yes Pleurotus pleur_ITS2 gtccagctctctaatcgtc LSU LR3 No Pluteus plut_LSU ctaccagtgcattgtgatatgc LSU LR3 Yes Russulaceae russ_LSU cccttggtgcttctgtgatgcgct LSU LR3 Yes Salal root associate salal4_ITS gccttaaaatcagtggcggtgc LSU LR3 Yes Suilloid suill_ITS2 ggcgtgataatgatcgccgctcgc LSU LR3 Yes Suilloid suill_LSU1 gacctyagggttcggggcttc LSU LR5 Yes Suilloid suill_LSU2 cggcccaygttaacgtgctta LSU LR5 Yes Xerulaceae Xeru_LSU actcatcagagtgcatcgacgcccgg LSU LR5 Yes Termitomyces termito_LSU tcagcacttgtgcttaggatg LSU LR5 No

Taxa Primer Region Taxa + Total % Cenococcum ceno_ITS2 LSU 15 15 100 Euagaric euag_LSU5 LSU 22 22 100 Mycena myc_ITS2 LSU 24 24 100 Suilloid suill_ITS2 LSU 16 17 94 Amanita section Vaginata Vag_ITS ITS1&2 40 45 89 Suilloid Boletales suill_ITS1 ITS1 12 15 80 Russulaceae russ_LSU LSU 11 24 46 Boletales bol_LSU nLSU 3 24 13 Lycoperdales lyco_LSU nLSU 2 24 8 Amanita section amanita aman_ITS1 ITS1 0 33 0 Mycena myc_ITS1 ITS1 0 39 0 Salal root associate helo_its2 LSU 0 21 0 Thelephoraceae thel_ITS1 ITS1&2 0 22 0

4.3.2 Amplification efficiency and ratio calculations using serial dilutions

Two primer sets amplifying the LSU of all Euagarics and Suilloid fungi, respectively, were used to test the feasibility of this approach on soil DNA, and were compared to the generic fungal primer set LR0R-LR5 (Vilgalys and Hester 1990). These primers were chosen because they represent a nested hierarchy of taxonomic groups, where the genus Suillus is within the order Agaricales (euagaricales) and both are within kingdom Fungi (Moncalvo et al. 2002). The euagarics contain fungal families common to forest soils and containing saprophytic, ECM, and pathogenic clades all likely to be encountered in the Calhoun Forest (Cannon and Kirk 2007). Suillus was chosen because

it is common and ubiquitous ECM genus often associated with both pine and hardwood trees, and species of the genus are commonly found fruiting in the study area (JAJ, personal observation). First, a serial dilution of DNA composited from three hardwood and three pine plots was amplified with both primer sets, along with a generic primer pair, to estimate their amplification efficiency (Figure 13). Three independent serial dilutions demonstrate that amplification results were highly reproducible. The suilloid primer in Pine soils, as well as all three ‚All fungi‛ primer pairs, displayed an efficiency much greater than the theoretical maximum of 2, however, suggesting that PCR inhibitors at higher DNA concentrations lead to an overestimation of E (Ramakers et al.

2003). Unfortunately, ratios comparing the fold of Suillus from Pine soil to Hardwood soil cannot be calculated on this set due to the artificially high efficiencies.

As both the Suillus and euagaric primers from the hardwood DNA had efficiencies near two, their ratio could be compared to understand the amount of uncertainty in the calculation (Figure 14). Taking data from any one dilution and calculating the ratio of euagaric DNA to Suillus DNA gives a result between 85 and 209 times more euagaric DNA. While this is a considerably large range, it is not unusual for

QPCR studies from environmental isolates (Smith and Osborn 2009). This illustrates the importance of generating dilution curves to verify amplification efficiency. In this case,

DNA would likely have to be further purified and re-tested for efficiency to generate comparisons to the all-fungal primer set required for cross-sample ratio calculations.

(a) Pine Soil Efficiency 40 y = -3.3832x + 19.41 38 R² = 0.9702 36 E=1.975 y = -2.3023x + 24.645 34 R² = 0.9677 32 E=2.71

30 Ct Euagaric 28 Suillus 26 y = -2.0129x + 19.764 All 24 R² = 0.9112 22 E=3.14 20 -2.00 -2.50 -3.00 -3.50 -4.00 -4.50 -5.00

Dilution Factor

(b) Hardwood Soil Efficiency 40 38

36 y = -3.4448x + 20.595 34 R² = 0.9801 32 E=1.951

30 Ct Euagaric 28 Suillus 26 All 24 y = -3.5756x + 13.609 R² = 0.9965 22 y = -2.0763x + 19.754 R² = 0.9488, E=3.14 E=1.904 20 -2.00 -2.50 -3.00 -3.50 -4.00 -4.50 -5.00

Dilution Factor

(a) Hardwood Soil Efficiency 40 38 y = -3.4448x + 20.595 R² = 0.9801 36 E=1.951 34 32

30 Ct 28 Euagaric 26 y = -3.5756x + 13.609 Suillus 24 R² = 0.9965 22 E=1.904 20 -2.00 -2.50 -3.00 -3.50 -4.00 -4.50 -5.00

Dilution Factor

(b)

Replicate Dilution Factor Averages -5 -4 -3 -2 Average S t dev S t error stdev/avg 1 185.01 228.21 159.06 219.07 197.84 31.84 15.92 16.10 2 89.61 177.64 113.14 218.76 149.79 59.15 29.58 39.49 3 224.23 99.38 84.56 107.27 128.86 64.28 32.14 49.88 Average 142.69 149.45 111.31 162.53 141.49 21.74 10.87 15.37

Figure 14: Calculating a fold increase using two primer pairs from the same soil. (a) Is the same data from Figure 10 (b), including only the two primers with efficiencies near 2. (b) Calculated ratios of LSU amplicons for euagarics to Suillus. Three replicate dilutions of composited soil DNA were used to calculate the ratio. There is considerable between-replicate and between-dilution variation, but all calculations are of similar magnitude. Arrow stresses the relationship of data from (a) used in the table. To compare a second environment, another set of efficiency graphs is necessary.

4.3.2 Comparing Ct to linear regression

In a second experiment, the same primer set was tested on individual soil DNA extractions from the three Hardwood plots. This assay was used to determine if the ratio calculations based on linear regression could sufficiently detect differences in abundance of suilloid and euagaric ribosomal DNA copy number across plots of the same land use

(Table 17). Two independent dilutions of soil DNA were used as replicates, and dilutions were used to compute E values to compare to the regression method (Figure11)

(Ruijter et al. 2009).

Using linear regression based estimates of E and Ct, the first replicate predicted that there was about 50 times more euagaric DNA in H2 than H1, and 30 times more in

H3 than H1 (Table 16a). The fold calculations on which these are based, however, illustrate an extremely large error around these estimates, dwarfing actual measurement differences. A second, independent run produced an estimate of euagarics in H2 an order of magnitude less than in the first replicate, though in the same direction. Both estimates are below the error in the calculations (Table 17).

The suilloid primer set estimated that there was about 1.8 times as much suilloid

DNA in H3 compared to H1, and both replicates were in agreement (Table17b). The estimates for H2, however, contradicted each other, with one replicate estimating less suilloid DNA in H2 than in H1 and the other estimating 1.6 times more.

(a) Euagaric Primer DNA Source Ratio to H1 Fold Fold SE % Error H1 Soil 1 0.0027 0.0019 70.0 Replicate 1 H2 Soil 52.29 0.1429 1.1672 816.7 H3 Soil 30.05 0.0821 0.2965 361.0 H1 Soil 1 0.0039 Replicate 2 H2 Soil 2.97 0.0115 0.0707 616.6

(b) Suillus Primer DNA Source Ratio to H1 Fold Fold SE % Error H1 Soil 1 0.0489 0.0419 85.8 Replicate 1 H2 Soil 1.63 0.0797 H3 Soil 1.81 0.0886 0.2617 295.4 H1 Soil 1 0.0510 0.2747 538.8 Replicate 2 H2 Soil 0.68 0.0348 0.0649 186.3 H3 Soil 1.76 0.0897 0.3878 432.3

Ratio calculations on the same raw data using the serial dilution method demonstrated inhibition in the reactions, as above (Figure 15). In all three soils, the

Suillus primer set showed efficiencies well above 2, inferring inhibition in reactions with higher DNA concentrations. The euagaric primer had a satisfactory value of E only in

H2, and the All Fungal primer pair had a satisfactory value in H2 and H3. This demonstrates that primer pairs are not predictable in their amplification efficiencies across samples.

Since no soil DNA had reaction efficiencies for both a taxon specific primer and the all fungal primer set, no ratios could be calculated. This may explain why so many of the reactions were not of use in the linear regression approach, and suggests that both methods allow the user to identify questionable results.

(a) H1 Soil Efficiency 40

35 y = -2.831x + 27.82

30 y = -1.723x + 29.815 Ct All Fungi R² = 0.9952 y = -2.115x + 26.755 R² = 0.9635 E=2.26 Euagarics 25 R² = 0.9582 E=3.8 E=2.97 Suillus 20 -1 -1.5 -2 -2.5 -3 -3.5 -4

Dilution Factor

(b) H2 Soil Efficiency 40

35 y = -3.825x + 26.973

30 R² = 0.9998 Ct y = -2.5x + 28.377 E=1.83 R² = 0.9568 25 y = -3.63x + 22.96 All Fungi R² = 1 E=2.51 Euagarics E=1.88 20 Suillus -1 -1.5 -2 -2.5 -3 -3.5 -4 Dilution Factor

y = -1.872x + 28.955

30 Ct y = -2.862x + 26.38 R² = 0.9686 All Fungi 25 y = -3.196x + 21.6 R² = 0.9896 E=3.42 Euagarics R² = 0.998, E=2.05 E=2.23 Suillus 20 -1 -1.5 -2 -2.5 -3 -3.5 -4 Dilution Factor

4.4 Conclusions

4.4.1 Primer specificity

Thirty taxon specific primers were demonstrated to produce amplicons in standard PCR. Furthermore, 13 of these were tested for specificity, and five were indeed specific to the targeted taxonomic group. Based on this 40% success rate, it is likely that 6 or 7 more of the remaining primer pairs will be specific to group, but they remain to be tested at the time of writing.

Two of the five primer pairs were extensively investigated for use in this assay.

Both primer pairs displayed reaction efficiencies near 2 in at least one of the test soils, but also demonstrated that efficiency in one soil sample is not comparable to another soil DNA.

4.4.2 Error on QPCR measurements

Estimates of the ratio of both euagaric and Suilloid LSU DNA in soils varied greatly across samples and replicates. Estimates of fold increase exhibited relative errors ranging from 70-800%, and were of a magnitude greater than the measured increase in

DNA abundance. This error rate is similar to critical reviews of QPCR in the environment (Love et al. 2006, Smith and Osborn 2009). In this experiment, the sensitivity of the QPRC assay is above the detection limit of the targeted groups. The reasons for this error likely stem from PCR inhibition and methodological errors in

estimating the values of Ct and E, both of which can change estimates of starting DNA copy number by orders of magnitude (Ramakers et al. 2003, Rutledge and Stewart 2010).

When considered in isolation, estimates of starting copy number using linear regression varied considerably, and even led to estimates of ratios that differed in magnitude and sign. This suggests that copy number estimates based on single reactions are not robust to differences in soil type and gene efficiency. The serial dilution method provided a robust and visual method for determining reaction efficiencies, and illustrates the unpredictable nature of PCR kinetics.

4.4.3 Challenges of estimating E and Ct

Though it appears that the dilution method is a more reasonable approach that takes in to account a larger number of reactions, there is still considerable noise in the calculation of fold differences in soils. As the ratio is the quotient of two fold calculations, the error is magnified when comparing between soils.

Determining the efficiency of a primer pair in any soil DNA requires building a dilution series curve, but remains subject to user input that could tremendously alter the results. Users must still specify a baseline from which to calculate Ct, and although robust to large error, small differences in calculated Ct can arise depending on software used and user preference.

Even after Ct values are calculated, efficiency graphs are subject to interpretation that can have profound effects. For example, consider the H1 data from the second

experiment (Figure 12). The efficiency calculation for the All fungal primer results in an estimate of E = 2.3. Dropping a point from the calculation greatly increases the fit of the line, but results in values of E from 2.05 to 3.11. This is problematic, as very small differences in efficiency can result in large differences in ratio calculations.

The magnitude of this effect is further illustrated in Table 17. This table contains calculations for a theoretical ratio calculation of a taxon specific primer across two soils.

If there is ten times less target DNA than all DNA and the reaction efficiencies are all at the ideal value of 2, then the ratio across soils is one. Changing that estimate by as little as 0.1 can change the ratio anywhere from 0.18 to over 500.

H1 Soil Efficiency 40

38 E=2.06 36 34 32

30 E=3.11 Ct 28 All Fungi 26 24 y = -2.761x + 25.194 R² = 0.9538 22 E=2.30 20 -2 -2.5 -3 -3.5 -4 -4.5 -5

Dilution Factor

Figure 16: Efficiency calculation for H1 soil as in Figure 12. If only 3 points are used to calculate E, the estimate can range from 2.06 to 3.11!

Soil DNA 1 Soil DNA 2 Taxa E All E Fold Taxa E All E Fold Ratio Ideal 2 2 9.85 2 2 9.85 1.00 Low E 1.9 2 45.89 2 2 9.85 4.66 2 1.9 1.78 2 2 9.85 0.18 Inhibitors 2 2.1 50.00 2 2 9.85 5.08 2.1 2 2.28 2 2 9.85 0.23 Both 1.9 2.1 232.97 2 2 9.85 23.65 1.9 2.1 232.97 2.1 1.9 0.41 564.13

4.4.4 Best practices for future applications

It is clear that using estimates of E and Ct from only one or a few samples using a linear regression approach can lead to large errors in the calculation of relative ratios of

DNA abundance across soils. There remains a great deal of potential in the current study. It is likely that estimation of error for samples can be minimized with further

DNA cleanup and optimization of primer concentrations (Love et al. 2006, Rutledge and

Stewart 2010). Using a dilution series is a more robust option, and could be improved by using linear regression to calculate individual Ct calculations from which efficiency curves are based. Because of the high variation between samples, efficiency calculations for each DNA and primer combination should be computed from at least three dilution series. Furthermore, estimates of taxon abundance should be made from at least three independent DNA extractions. 89

To test the relative abundance of three groups of fungal taxa, a minimum of 144 reactions should be performed (3 DNA extractions, 4 dilutions, 3 reps, 4 genes). For a test of 12 soils, this requires 18, 96-well plates to be processed. This would enable rigorous testing of efficiencies, and the calculation of error for each measurement.

Testing of this scale, after optimization, means that this approach takes considerable effort. A study of the changes of abundance across a land use gradient, and over four seasons would require the optimization of 192 primer and soil combinations. This could become operationally infeasible for a large number of environments. The approach is likely still worthwhile in controlled experiments where DNA extractions are more uniform, where the target taxon are in greater abundance, or where the target is a specific organism that allows for probes other than Syber Green to be used (Love et al.

2006, Kennedy et al. 2007, Smith and Osborn 2009, Stefani et al. 2010).

4.4.5 Summary

Designing and implementing taxon-specific QPCR to estimate the relative abundance of specific fungal groups in soil requires careful attention. Primers must be tested directly in soils and specificity confirmed with sequence libraries. To survey a soil, multiple DNA extractions should be performed, and each subjected to multiple serial dilutions to establish a reliable estimate of reaction efficiency and Ct. For ecological studies examining multiple soils and multiple target taxa, it is critical to calculate amplification efficiency for every DNA and primer combination. Finally, error should be

estimated for each ratio calculation to ensure that the inference gained from the measurement is valid. Microbial ecology studies using QPCR may be flawed if they have not calculated amplification efficiencies for each DNA. Many studies calculate only one efficiency for a primer pair and apply this to all soil combinations, or make no mention of the approach they have used, and therefore are subject to considerable error

(Rutledge and Stewart 2008, 2010).

In addition, this study contributes at least five and up to 11 new primers designed to amplify ribosomal genes from specific fungal clades. These primers can be used to construct clone libraries from environmental isolates in an approach similar to that of the last two chapters. This is a valuable and effective way to examine the ecology of these groups, especially considering the availability of next generation sequencing technologies.

5. Conclusions

5.1 Summary of Results

Soil fungal communities are diverse, and they are influenced directly and indirectly by land use change. In this study, belowground communities in agricultural plots are distinct from those under pine or hardwood. Transition to forests selects for a specialized community of Basidiomycete fungi adapted to associate with forest trees as well as degrade the complex organic inputs from them (Chapter 2). In the transition from fields to forests, fungal communities are also responding to gradients of fertility, carbon availability, pH and texture. These gradients work in concert to structure the communities found in each land-use type. Although diversity is high in all soils, cultivated fields and grasslands plots are all equally different from each other, whereas plots under forests, either pine or hardwood, harbor communities that are more similar to each other. Agricultural fields, then, contribute most to beta diversity.

Vast amounts of land in the southeastern piedmont are under loblolly pine, and these forests contain a set of ECM propagules unique from other land uses. The diversity of ECM propagules in hardwood plots is high, as well, and both forest types contain communities that are similar within land use and unique from the other land-use types

(Chapter 3). Landscape level diversity of ECM propagules able to associate with pine is maintained by the heterogeneity in land use types across the region.

QPCR allows for estimation of relative abundances of fungal taxa in soils. By nesting taxon-specific primers within clades of more generic primer sets, it is possible to infer levels of fungal abundance across plots (Chapter 4). The inference is highly sensitive to error, however, and great care must be taken to replicate samples. In addition, efficiency of the PCR reaction must be determined for each primer in each soil, and the error in measurement must be reported. The method of taxon-specific QPCR is highly sensitive, but also highly sensitive to miscalculation, and care must be taken not to over-extend inference.

5.2 Future Research

Further testing is needed to determine the sensitivity of the QPCR assay. Better

DNA cleanup will likely help minimize the variation across reactions, lowering the error to an acceptably small magnitude. Furthermore, tests with artificially constructed DNA libraries can identify the limits to detection, and could even be combined with extracts from a soil matrix to understand the complex relationship between soil DNA and amplification efficiency.

Second-generation sequencing technology offers orders of magnitude more data than was possible in this study, and more importantly, enough sampling to detect the majority of abundant fungal OTUs in soil (Buee et al. 2009, Jumpponen et al. 2010). I may never describe all the rare microbes, but 10 times more coverage has the potential to identify 90% of the diversity (Chao et al. 2009). Furthermore, tagged primers offer the

ability to run several samples in tandem, making it feasible to generate soil libraries of sufficient scale and in sufficient quantity to examine effects on fungal communities at a finer scale, such as seasonally, by depth, or spatially (Jumpponen et al. 2010).

The OTU-based approach to ecology is sound, and our method of defining OTUs is robust and easily scalable, especially considering the rate at which new software tools are developed to deal with large amounts of data. Ordination is a powerful approach for reducing these large datasets to meaningful subsets of variation, for addressing community similarity and changes in diversity across a landscape, and has become commonplace in microbial ecology. The use of joint plots allow us to correlate shifts in fungal communities to environmental gradients.

I’m intrigued by using multivariate habitat partitioning models on OTU data to prioritize the effects that edaphic factors that influence community change. One can easily demonstrate that fungal communities are organized along several environmental gradients, but it is more difficult to define which gradient is the most important, or whether the relative influence of each changes depending on the environment, vegetation cover, or soil type. Habitat partitioning ranks the effect of each environmental factor, identifying those factors most likely to explain the distribution of communities I find on the landscape.

These tools have great potential to inform us on the relationship between diversity and function in soil microbial communities. At the least, I can accurately

describe these communities and link them to important microbial processes like decomposition and denitrification. This is truly an exciting era for microbial ecology.

Appendix 1: ITS clone libraries from field soils

The following table lists each ITS sequence generated from the land use study in chapter two. The OTU number represents

96% groupings, and is assigned only for this study. OTU numbers in this table do correspond to OTU numbers for ITS sequences

from the pine seedling bioassay in Appendix 3. The %ID is from the top BLAST hit from NCBI’s Genbank, accessed March 2010

(Altschul et al. 1997). Lineage information is according to NCBI’s Taxonomy database.

Treatment Plot Clone Name OTU %ID Accession Lineage Cultivated C1 C1-023-its 437 97 gi|83722498|gb|DQ309188 Fungi; Cultivated C1 C1-003-its 445 98 gi|90102986|gb|DQ421302 Fungi;

96 Cultivated C1 C1-005-its 446 91 gi|63408430|gb|AY969584 Fungi;

Cultivated C1 C1-008-its 448 97 gi|90102840|gb|DQ421156 Fungi; Cultivated C1 C1-017-its 452 91 gi|150035685|gb|EF619902 Fungi; Cultivated C1 C1-019-its 420 97 gi|82568476|dbj|AB213418 Metazoa; Cultivated C1 C1-021-its 454 98 gi|170516777|gb|EU490150 Fungi; Cultivated C1 C1-029-its 457 90 gi|28269294|gb|AF504879 Fungi; Cultivated C1 C1-041-its 462 92 gi|213054517|gb|FJ411416 Metazoa;Arthropoda;Hexapoda;Collembola;Arthropleona Cultivated C1 C1-014-its 301 95 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Cultivated C1 C1-016-its 301 95 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Cultivated C1 C1-040-its 301 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Cultivated C1 C1-036-its 251 99 gi|171855162|gb|EU409892 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Davidiellaceae Cultivated C1 C1-039-its 251 98 gi|171855162|gb|EU409892 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Davidiellaceae Cultivated C1 C1-047-its 251 99 gi|171855162|gb|EU409892 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Davidiellaceae Cultivated C1 C1-012-its 404 98 gi|221164183|gb|FJ571462 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Treatment Plot Clone Name OTU %ID Accession Lineage Cultivated C1 C1-022-its 433 98 gi|34809408|gb|AY373928 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Cultivated C1 C1-013-its 299 99 gi|189176093|gb|EU680530 Fungi;Ascomycota;Dothideomycetes; Cultivated C1 C1-046-its 421 98 gi|163257680|emb|AM901745 Fungi;Ascomycota; Cultivated C1 C1-002-its 444 98 gi|53125456|emb|AJ608987 Fungi;Ascomycota; Cultivated C1 C1-015-its 451 100 gi|209972663|gb|FJ266734 Fungi;Ascomycota;Dothideomycetes;Pleosporales; Cultivated C1 C1-024-its 455 99 gi|189176112|gb|EU680549 Fungi;Ascomycota;Dothideomycetes; Cultivated C1 C1-030-its 458 99 gi|157419213|gb|EF694661 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Leptosphaeriaceae Cultivated C1 C1-033-its 460 99 gi|150035472|gb|EF619689 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Cultivated C1 C1-034-its 461 97 gi|220966792|gb|FJ545250 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Cultivated C1 C1-044-its 464 95 gi|41615387|gb|AF444362 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Cultivated C1 C1-042-its 463 99 gi|154968338|gb|EF174373 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Cercomonadidae Cultivated C1 C1-009-its 449 95 gi|63408462|gb|AY969616 Alveolata;Ciliophora;Oligohymenophorea;Philasterida;Uronematidae Cultivated C1 C1-020-its 453 92 gi|145308004|gb|EF392540 Fungi;Entomophthoromycotina;Entomophthoromycotina;Entomophthorales;Basidiobolaceae Cultivated C1 C1-028-its 456 98 gi|8101484|gb|AF133780 Fungi;Glomeromycota; Glomeromycetes; Diversisporales; Acaulosporaceae Cultivated C1 C1-004-its 219 97 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae 97 Cultivated C1 C1-006-its 219 98 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C1 C1-018-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C1 C1-043-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C1 C1-045-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C1 C1-025-its 250 99 gi|196159021|dbj|AB381937 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae Cultivated C1 C1-035-its 250 99 gi|196159021|dbj|AB381937 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae Cultivated C1 C1-010-its 450 96 gi|82796572|gb|DQ273435 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Cultivated C1 C1-037-its 327 98 gi|116744371|dbj|AB279763 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae Cultivated C1 C1-027-its 300 99 gi|57869775|gb|AY883085 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Plantaginaceae Cultivated C1 C1-031-its 300 99 gi|57869775|gb|AY883085 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Plantaginaceae Cultivated C1 C1-038-its 300 99 gi|57869775|gb|AY883085 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Plantaginaceae Cultivated C2 C2-018-its 474 98 gi|90102975|gb|DQ421291 Fungi; Cultivated C2 C2-054-its 347 96 gi|156145879|gb|EU076938 Fungi;

Treatment Plot Clone Name OTU %ID Accession Lineage Cultivated C2 C2-003-its 467 99 gi|212276684|gb|FJ025264 Fungi; Cultivated C2 C2-002-its 466 90 gi|170516509|gb|EU490044 Fungi; Cultivated C2 C2-004-its 219 96 gi|197113890|gb|EU690934 Fungi; Cultivated C2 C2-036-its 206 99 gi|94383921|emb|AM260817 Fungi; Cultivated C2 C2-039-its 482 98 gi|162311602|gb|EU292407 Fungi; Cultivated C2 C2-045-its 485 94 gi|219523338|gb|FJ475781 Fungi; Cultivated C2 C2-050-its 487 100 gi|193298392|gb|EU806722 Fungi; Cultivated C2 C2-031-its 480 97 gi|157325612|gb|EU035416 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Cultivated C2 C2-056-its 440 93 gi|118084443|gb|DQ914697 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Cultivated C2 C2-008-its 427 96 gi|20531672|gb|AF502865 Fungi;Ascomycota; Cultivated C2 C2-027-its 476 98 gi|170516678|gb|EU490094 Fungi;Ascomycota; Cultivated C2 C2-013-its 427 96 gi|20531672|gb|AF502865 Fungi;Ascomycota; Cultivated C2 C2-007-its 469 99 gi|221361628|emb|FM991735 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Leptosphaeriaceae Cultivated C2 C2-017-its 473 94 gi|67644110|gb|AY999135 Fungi;Ascomycota;Sordariomycetes;Sordariales;Lasiosphaeriaceae Cultivated C2 C2-030-its 479 98 gi|157325670|gb|EU035474 Fungi;Ascomycota;Dothidiomycetes;Dothidiomycetes;Venturiaceae 98 Cultivated C2 C2-034-its 481 93 gi|145308843|gb|EF521221 Fungi;Ascomycota;Leotiomycetes;Helotiales;Hyaloscyphaceae

Cultivated C2 C2-046-its 370 98 gi|219813599|gb|FJ553813 Fungi;Ascomycota;Leotiomycetes;Helotiales;Dermateaceae Cultivated C2 C2-009-its 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae Cultivated C2 C2-035-its 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Cultivated C2 C2-043-its 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Cultivated C2 C2-041-its 12 100 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Cultivated C2 C2-047-its 194 90 gi|87244874|gb|DQ377372 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae Cultivated C2 C2-019-its 475 97 gi|171855159|gb|EU409889 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales Cultivated C2 C2-021-its 398 98 gi|61657758|emb|AJ633584 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae Cultivated C2 C2-038-its 207 99 gi|87244930|gb|DQ377428 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae Cultivated C2 C2-048-its 486 96 gi|111608694|gb|DQ822808 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Cultivated C2 C2-029-its 478 97 gi|118639548|gb|EF114298 Alveolata;Ciliophora;Intramacronucleata;Peniculida;Urocentridae Cultivated C2 C2-011-its 470 93 gi|163937820|dbj|AB330066 Heterolobosea;Heterolobosea;Heterolobosea;Schizopyrenida;Vahlkampfiidae

Treatment Plot Clone Name OTU %ID Accession Lineage Cultivated C2 C2-026-its 327 97 gi|219687757|dbj|AB440601 Fungi;Mucoromycotina;Mucormycotina;Mucorales;Mucoraceae Cultivated C2 C2-005-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-023-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-024-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-049-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-037-its 306 99 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-051-its 306 99 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-055-its 306 98 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-052-its 488 95 gi|160213638|gb|EU240150 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Cultivated C2 C2-001-its 465 95 gi|160213557|gb|EU240069 stramenopiles;stramenopiles;Oomycetes;Pythiales;Pythiaceae Cultivated C2 C2-015-its 471 96 gi|56089974|gb|AY796244 Viridiplantae;Streptophyta;Bryopsida;Pottiales;Pottiaceae Cultivated C2 C2-040-its 483 96 gi|126360695|gb|EF040832 Fungi;Zygomycota; Cultivated C2 C2-044-its 484 97 gi|145308868|gb|EF521246 Fungi;Zygomycota; Grass G1 G1-039-its 508 91 gi|193298762|gb|EU807092 Fungi; Grass G1 G1-029-its 501 91 gi|188496719|emb|AM999716 Fungi; 99 Grass G1 G1-036-its 506 96 gi|170516756|gb|EU489943 Fungi;

Grass G1 G1-042-its 510 91 gi|82568476|dbj|AB213418 Metazoa; Grass G1 G1-005-its 301 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G1 G1-020-its 214 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G1 G1-026-its 214 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G1 G1-038-its 214 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G1 G1-015-its 299 99 gi|189176093|gb|EU680530 Fungi;Ascomycota;Dothideomycetes; Grass G1 G1-004-its 438 97 gi|3170088|gb|AF037436 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Grass G1 G1-046-its 438 95 gi|3170088|gb|AF037436 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Grass G1 G1-030-its 350 93 gi|87332001|gb|DQ275616 Fungi;Ascomycota;Saccharomycotina;Saccharomycetales;Lipomycetaceae Grass G1 G1-006-its 493 97 gi|63409124|gb|AY970278 Fungi;Ascomycota; Grass G1 G1-031-its 502 99 gi|63409028|gb|AY970182 Fungi;Ascomycota; Grass G1 G1-044-its 512 99 gi|63409081|gb|AY970235 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage Grass G1 G1-001-its 311 98 gi|154082186|gb|EU003010 Fungi;Ascomycota; Grass G1 G1-009-its 496 90 gi|219813920|gb|FJ554134 Fungi;Ascomycota;Pezizomycotina;Pleosporales; Grass G1 G1-013-its 311 99 gi|154082186|gb|EU003010 Fungi;Ascomycota; Grass G1 G1-034-its 504 94 gi|63409041|gb|AY970195 Fungi;Ascomycota; Grass G1 G1-035-its 505 92 gi|63409041|gb|AY970195 Fungi;Ascomycota; Grass G1 G1-040-its 509 96 gi|170516717|gb|EU490177 Fungi;Ascomycota; Grass G1 G1-045-its 513 95 gi|110564278|gb|DQ683978 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Grass G1 G1-047-its 514 92 gi|3170088|gb|AF037436 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Grass G1 G1-008-its 495 98 gi|63408940|gb|AY970094 Fungi;Basidiomycota; Grass G1 G1-010-its 166 92 gi|186469969|gb|EU435149 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G1 G1-012-its 349 92 gi|75863901|gb|DQ112620 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Lycoperdaceae Grass G1 G1-021-its 166 92 gi|186469969|gb|EU435149 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G1 G1-022-its 349 93 gi|75863901|gb|DQ112620 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Lycoperdaceae Grass G1 G1-024-its 166 92 gi|186469969|gb|EU435149 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G1 G1-041-its 349 92 gi|75863901|gb|DQ112620 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Lycoperdaceae

100 Grass G1 G1-048-its 12 99 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus

Grass G1 G1-043-its 511 91 gi|92087143|gb|DQ457087 Rhizaria;Cercozoa;Cercozoa;Cercozoa;Cercozoa Grass G1 G1-003-its 399 92 gi|6066288|gb|AF182428 Viridiplantae;Chlorophyta;Chlorophyceae;Tetrasporales;Tetrasporales Grass G1 G1-017-its 399 91 gi|6066288|gb|AF182428 Viridiplantae;Chlorophyta;Chlorophyceae;Tetrasporales;Tetrasporales Grass G1 G1-007-its 494 99 gi|87047579|gb|DQ377088 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Chlamydomonadaceae Grass G1 G1-019-its 498 93 gi|219814228|gb|FJ554442 Fungi;Chytridiomycota;Chytridiomycetes;Spizellomycetales;Spizellomycetales Grass G1 G1-032-its 503 90 gi|219814048|gb|FJ554262 Alveolata;Ciliophora;Intramacronucleata;Spirotrichea;Oxytrichidae Grass G1 G1-016-its 330 95 gi|14517703|gb|AF293700 Metazoa;Ctenophora;Cyclocoela;Lobata;Bolinopsidae Grass G1 G1-028-its 330 95 gi|14517703|gb|AF293700 Metazoa;Ctenophora;Cyclocoela;Lobata;Bolinopsidae Grass G1 G1-002-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G1 G1-025-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G1 G1-011-its 497 96 gi|82571057|gb|DQ275361 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G1 G1-014-its 389 99 gi|7381408|gb|AF171183 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Poaceae

Treatment Plot Clone Name OTU %ID Accession Lineage Grass G1 G1-023-its 389 99 gi|7381408|gb|AF171183 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Poaceae Grass G1 G1-037-its 507 93 gi|19550|emb|Z15097 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Phrymaceae Grass G1 G1-033-its 215 97 gi|63408878|gb|AY970032 Fungi;Zygomycota; Grass G3 G3-018-its 271 98 gi|63408739|gb|AY969893 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae Grass G3 G3-069-its 271 98 gi|63408739|gb|AY969893 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae Grass G3 G3-038-its 170 98 gi|90102607|gb|DQ420923 Fungi;Ascomycota; Grass G3 G3-071-its 548 99 gi|170516774|gb|EU490132 Fungi; Grass G3 G3-026-its 525 94 gi|90102939|gb|DQ421255 Fungi; Grass G3 G3-027-its 526 97 gi|63408430|gb|AY969584 Fungi; Grass G3 G3-031-its 527 99 gi|212725703|gb|FJ213503 Fungi; Grass G3 G3-032-its 528 95 gi|170516756|gb|EU489943 Fungi; Grass G3 G3-035-its 531 96 gi|210063808|gb|FJ386951 Fungi; Grass G3 G3-037-its 533 99 gi|150035675|gb|EF619892 Fungi; Grass G3 G3-042-its 536 96 gi|90102400|gb|DQ420716 Fungi; Grass G3 G3-045-its 537 98 gi|63408430|gb|AY969584 Fungi;

101 Grass G3 G3-065-its 348 99 gi|154082204|gb|EU003028 Fungi;

Grass G3 G3-070-its 420 96 gi|82568476|dbj|AB213418 Metazoa; Grass G3 G3-016-its 429 98 gi|213054527|gb|FJ411426 Metazoa;Arthropoda;Hexapoda;Collembola;Bourletiellidae Grass G3 G3-043-its 429 98 gi|213054527|gb|FJ411426 Metazoa;Arthropoda;Hexapoda;Collembola;Bourletiellidae Grass G3 G3-047-its 429 98 gi|213054527|gb|FJ411426 Metazoa;Arthropoda;Hexapoda;Collembola;Bourletiellidae Grass G3 G3-048-its 214 96 gi|90102756|gb|DQ421072 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G3 G3-004-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-008-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-021-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-023-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-066-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-068-its 169 91 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-022-its 524 92 gi|63409041|gb|AY970195 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage Grass G3 G3-011-its 354 98 gi|170516665|gb|EU490073 Fungi;Ascomycota; Grass G3 G3-015-its 523 92 gi|145453574|gb|EF218791 Fungi;Ascomycota;Leotiomycetes;Helotiales;Helotiaceae Grass G3 G3-024-its 354 98 gi|170516665|gb|EU490073 Fungi;Ascomycota; Grass G3 G3-067-its 350 94 gi|87332001|gb|DQ275616 Fungi;Ascomycota;Saccharomycotina;Saccharomycetales;Lipomycetaceae Grass G3 G3-056-its 544 97 gi|116804989|gb|EF029228 Fungi;Ascomycota; Grass G3 G3-001-its 169 94 gi|18461388|gb|AF333126 Fungi;Ascomycota;Eurotiomycetes;Verrucariales;Verrucariaceae Grass G3 G3-036-its 532 98 gi|63408942|gb|AY970096 Fungi;Ascomycota; Grass G3 G3-050-its 539 94 gi|116294369|gb|EF010926 Fungi;Ascomycota;Dothideomycetes;Dothideomycetes;Tubeufiaceae Grass G3 G3-020-its 414 99 gi|16209525|gb|AY052487 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Grass G3 G3-005-its 517 98 gi|54695084|gb|AY634128 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Ceratobasidiaceae Grass G3 G3-007-its 518 91 gi|63408628|gb|AY969782 Fungi;Basidiomycota; Grass G3 G3-009-its 519 97 gi|219814203|gb|FJ554417 Fungi;Basidiomycota;Agaricomycetes; Grass G3 G3-017-its 12 99 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Grass G3 G3-039-its 534 91 gi|9295403|gb|AF231915 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G3 G3-060-its 547 93 gi|162417283|emb|AM922292 Fungi;Basidiomycota;Cystobasidiomycetes;Erythrobasidiales;

102 Grass G3 G3-034-its 530 98 gi|173608|gb|K00471 Amoebozoa;Centramoebida;Acanthamoebidae;Acanthamoeba;Acanthamoeba

Grass G3 G3-053-its 543 98 gi|89515353|gb|DQ417535 Viridiplantae;Chlorophyta;Chlorophyceae;Sphaeropleales;Scenedesmaceae Grass G3 G3-058-its 545 93 gi|111073396|emb|AJ749619 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Chlamydomonadaceae Grass G3 G3-059-its 546 98 gi|217416827|gb|FJ170764 Viridiplantae;Chlorophyta;Trebouxiophyceae;Microthamniales;Trebouxiophyceae Grass G3 G3-051-its 541 94 gi|195931901|gb|EU873019 Fungi;Chytridiomycota;unclassified;Chytridiomycota;Lobulomycetaceae Grass G3 G3-003-its 516 93 gi|133753205|gb|EF434111 Fungi;Chytridiomycota;Chytridiomycota;Chytridiomycota;Chytridiomycota Grass G3 G3-010-its 520 99 gi|164421754|gb|EU352773 Fungi;Chytridiomycota;Chytridiomycetes;Chytridiales;Lobulomycetaceae Grass G3 G3-046-its 538 90 gi|157063225|gb|EF585664 Fungi;Chytridiomycota;Chytridiomycetes;Rhizophydiales;Kappamycetaceae Grass G3 G3-014-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-019-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-025-its 219 99 gi|170516488|gb|EU489953 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-029-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-030-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Treatment Plot Clone Name OTU %ID Accession Lineage Grass G3 G3-041-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-044-its 219 99 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-049-its 219 98 gi|219813072|gb|FJ553286 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-054-its 403 98 gi|183206696|gb|EU437424 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G3 G3-028-its 355 94 gi|75708903|gb|DQ146429 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G3 G3-052-its 542 90 gi|75708901|gb|DQ146427 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G3 G3-040-its 535 94 gi|126952500|gb|EF441743 stramenopiles;stramenopiles;Xanthophyceae;Vaucheriales;Vaucheriaceae Grass G3 G3-033-its 529 99 gi|172073115|gb|EU395916 Viridiplantae;Streptophyta;Embryophyta;Liliopsida;Poaceae Grass G7 G7-047-its 170 98 gi|90102607|gb|DQ420923 Fungi;Ascomycota; Grass G7 G7-018-its 559 98 gi|154082256|gb|EU003080 Fungi; Grass G7 G7-019-its 560 97 gi|154002613|gb|EF505582 Fungi; Grass G7 G7-020-its 561 91 gi|159034010|gb|EU222976 Fungi; Grass G7 G7-031-its 567 93 gi|63408322|gb|AY969476 Metazoa; Grass G7 G7-036-its 572 93 gi|63409009|gb|AY970163 Fungi; Grass G7 G7-037-its 573 100 gi|154001470|gb|EF504439 Fungi;

103 Grass G7 G7-040-its 576 98 gi|90102972|gb|DQ421288 Fungi;

Grass G7 G7-007-its 251 99 gi|170516668|gb|EU490076 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Davidiellaceae Grass G7 G7-023-its 251 99 gi|220898254|gb|FJ556911 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Davidiellaceae Grass G7 G7-014-its 433 99 gi|2677846|gb|AF033463 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Grass G7 G7-003-its 549 90 gi|154002655|gb|EF505624 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G7 G7-005-its 421 97 gi|163257680|emb|AM901745 Fungi;Ascomycota; Grass G7 G7-022-its 35 99 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G7 G7-012-its 555 97 gi|63409019|gb|AY970173 Fungi;Ascomycota; Grass G7 G7-027-its 565 99 gi|6841009|gb|AF120257 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Grass G7 G7-008-its 552 98 gi|129561462|gb|EF160066 Fungi;Ascomycota;Pezizomycotina;Magnaporthales;Magnaporthaceae Grass G7 G7-010-its 554 96 gi|63408414|gb|AY969568 Fungi;Ascomycota; Grass G7 G7-013-its 556 96 gi|118566332|gb|EF094556 Fungi;Ascomycota; Grass G7 G7-021-its 562 98 gi|163257737|emb|AM901802 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage Grass G7 G7-030-its 35 99 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Grass G7 G7-032-its 568 99 gi|156068986|gb|EF540752 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Grass G7 G7-038-its 574 98 gi|32527833|gb|AY251068 Fungi;Ascomycota; Grass G7 G7-039-its 575 95 gi|219523062|gb|FJ439578 Fungi;Ascomycota;Sordariomycetes;Coniochaetales;Coniochaetales Grass G7 G7-045-its 578 98 gi|63409050|gb|AY970204 Fungi;Ascomycota; Grass G7 G7-043-its 414 99 gi|163257722|emb|AM901787 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Grass G7 G7-006-its 551 94 gi|63408628|gb|AY969782 Fungi;Basidiomycota; Grass G7 G7-017-its 558 96 gi|158978075|gb|EU113201 Fungi;Basidiomycota;Agaricomycotina;Agaricomycetes;Russulales Grass G7 G7-029-its 430 97 gi|209870878|gb|EU784354 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G7 G7-044-its 430 97 gi|209870878|gb|EU784354 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae Grass G7 G7-028-its 566 96 gi|183206242|gb|EU434040 Viridiplantae;Chlorophyta;Trebouxiophyceae;Trebouxiophyceae;Trebouxiophyceae Grass G7 G7-034-its 570 91 gi|89515389|gb|DQ417571 Viridiplantae;Chlorophyta;Chlorophyceae;Sphaeropleales;Scenedesmaceae Grass G7 G7-033-its 569 90 gi|157931162|gb|EU032354 Alveolata;Ciliophora;Oligohymenophorea;Pleuronematida;Cyclidiidae Grass G7 G7-035-its 571 94 gi|115335010|gb|DQ914418 Fungi;Glomeromycota;Glomeromycetes;Glomerales;Glomeraceae Grass G7 G7-041-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

104 Grass G7 G7-004-its 550 97 gi|189031485|gb|EU688962 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G7 G7-026-its 564 96 gi|11121249|emb|AJ271629 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Grass G7 G7-025-its 563 97 gi|75708901|gb|DQ146427 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G7 G7-002-its 355 93 gi|75708903|gb|DQ146429 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G7 G7-046-its 355 94 gi|75708903|gb|DQ146429 Metazoa;Nematoda;Chromadorea;Rhabditida;Cephalobidae Grass G7 G7-048-its 579 99 gi|139539073|gb|EF153036 Viridiplantae;Streptophyta;Liliopsida;Poales;Poaceae Hardwood H1 H1-015-its 106 96 gi|90102874|gb|DQ421190 Fungi; Hardwood H1 H1-021-its 106 96 gi|90102874|gb|DQ421190 Fungi; Hardwood H1 H1-023-its 106 96 gi|90102874|gb|DQ421190 Fungi; Hardwood H1 H1-007-its 583 91 gi|189473127|gb|EU709515 Fungi; Hardwood H1 H1-024-its 587 99 gi|90102912|gb|DQ421228 Fungi; Hardwood H1 H1-017-its 188 95 gi|157086775|gb|EF634067 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum Hardwood H1 H1-020-its 586 94 gi|78459662|gb|DQ182451 Fungi;Ascomycota;Pezizomycotina;Pleosporales;

Treatment Plot Clone Name OTU %ID Accession Lineage Hardwood H1 H1-003-its 582 98 gi|63409043|gb|AY970197 Fungi;Ascomycota; Hardwood H1 H1-001-its 176 90 gi|28269270|gb|AF504855 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-002-its 176 90 gi|28269270|gb|AF504855 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-005-its 176 90 gi|28269270|gb|AF504855 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-009-its 361 95 gi|28269277|gb|AF504862 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-012-its 176 90 gi|28269270|gb|AF504855 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-016-its 361 95 gi|28269278|gb|AF504863 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-013-its 89 94 gi|21304917|gb|AF377191 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-022-its 89 94 gi|21304917|gb|AF377191 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-006-its 89 94 gi|21304917|gb|AF377191 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H1 H1-011-its 584 91 gi|63408372|gb|AY969526 Fungi;Basidiomycota; Hardwood H1 H1-019-its 219 98 gi|63409114|gb|AY970268 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H1 H1-010-its 100 99 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Hardwood H1 H1-004-its 106 96 gi|90102874|gb|DQ421190 Fungi;Zygomycota; Hardwood H2 H2-009-its 286 97 gi|167966471|gb|EU444550 Fungi;Basidiomycota;Agaricomycetes;

105 Hardwood H2 H2-050-its 286 98 gi|167966471|gb|EU444550 Fungi;Basidiomycota;Agaricomycetes;

Hardwood H2 H2-030-its 408 91 gi|197112538|gb|EU689569 Fungi; Hardwood H2 H2-053-its 408 91 gi|197112538|gb|EU689569 Fungi; Hardwood H2 H2-042-its 606 95 gi|220967583|gb|EU977316 Fungi; Hardwood H2 H2-044-its 607 97 gi|51557348|gb|AY656928 Fungi; Hardwood H2 H2-001-its 589 91 gi|88660337|gb|DQ388863 Fungi; Hardwood H2 H2-004-its 590 97 gi|63408458|gb|AY969612 Metazoa; Hardwood H2 H2-012-its 593 96 gi|188496633|emb|AM999630 Fungi; Hardwood H2 H2-019-its 596 98 gi|154082256|gb|EU003080 Fungi; Hardwood H2 H2-023-its 599 96 gi|150035680|gb|EF619897 Fungi; Hardwood H2 H2-025-its 601 96 gi|219523339|gb|FJ475782 Fungi; Hardwood H2 H2-032-its 604 94 gi|167966471|gb|EU444550 Fungi; Hardwood H2 H2-036-its 286 98 gi|167966471|gb|EU444550 Fungi;

Treatment Plot Clone Name OTU %ID Accession Lineage Hardwood H2 H2-040-its 347 96 gi|156145879|gb|EU076938 Fungi; Hardwood H2 H2-018-its 404 98 gi|213876667|gb|FJ430754 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Hardwood H2 H2-035-its 404 98 gi|213876667|gb|FJ430754 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Hardwood H2 H2-055-its 365 98 gi|219813631|gb|FJ553845 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Hardwood H2 H2-056-its 365 99 gi|219813631|gb|FJ553845 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Hardwood H2 H2-011-its 592 93 gi|63408541|gb|AY969695 Fungi;Ascomycota; Hardwood H2 H2-029-its 603 93 gi|114414820|emb|AM087276 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Elaphomycetaceae Hardwood H2 H2-046-its 439 94 gi|133753175|gb|EF434081 Fungi;Basidiomycota;Pucciniomycotina;Erythrobasidiales; Hardwood H2 H2-048-its 439 94 gi|133753175|gb|EF434081 Fungi;Basidiomycota;Pucciniomycotina;Erythrobasidiales; Hardwood H2 H2-039-its 364 97 gi|205364284|gb|FJ157109 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Hardwood H2 H2-007-its 591 97 gi|38156234|gb|AY312981 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Hardwood H2 H2-015-its 594 95 gi|13650056|gb|AF350064 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Hardwood H2 H2-016-its 595 94 gi|194304374|gb|EU819536 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H2 H2-020-its 597 99 gi|111219419|gb|DQ778000 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Hardwood H2 H2-024-its 600 94 gi|27803334|emb|AJ408370 Fungi;Basidiomycota;Agaricomycetes;Gomphales;Gomphaceae

106 Hardwood H2 H2-026-its 602 96 gi|63408637|gb|AY969791 Fungi;Basidiomycota;

Hardwood H2 H2-027-its 364 97 gi|205364284|gb|FJ157109 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Hardwood H2 H2-037-its 12 99 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Hardwood H2 H2-041-its 605 99 gi|7769662|gb|AF241522 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Hardwood H2 H2-052-its 609 99 gi|219523121|gb|FJ475564 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Hardwood H2 H2-002-its 403 97 gi|63409069|gb|AY970223 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-005-its 285 98 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-021-its 285 98 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-033-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-034-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-043-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-047-its 403 97 gi|63409069|gb|AY970223 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-051-its 285 98 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Treatment Plot Clone Name OTU %ID Accession Lineage Hardwood H2 H2-054-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-038-its 306 99 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H2 H2-003-its 100 100 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Hardwood H2 H2-028-its 100 100 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Hardwood H2 H2-017-its 100 99 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Hardwood H2 H2-045-its 215 97 gi|63408878|gb|AY970032 Fungi;Zygomycota; Hardwood H4 H4-002-its 106 98 gi|90102874|gb|DQ421190 Fungi; Hardwood H4 H4-016-its 618 95 gi|51947593|gb|AY704759 Fungi; Hardwood H4 H4-004-its 611 91 gi|194354265|gb|EU825637 Fungi; Hardwood H4 H4-008-its 613 95 gi|63408946|gb|AY970100 Fungi;Ascomycota; Hardwood H4 H4-010-its 614 98 gi|205364172|gb|EU930010 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Pleosporaceae Hardwood H4 H4-011-its 615 97 gi|198448293|gb|FJ171717 Fungi;Ascomycota;Dothideomycetes;Botryosphaeriales; Botryosphaeriaceae Hardwood H4 H4-014-its 616 99 gi|218932561|gb|FJ442667 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Hypocreaceae Hardwood H4 H4-017-its 619 97 gi|63408273|gb|AY969427 Fungi;Ascomycota; Hardwood H4 H4-006-its 612 95 gi|209870803|gb|EU784279 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

107 Hardwood H4 H4-015-its 617 93 gi|116282526|gb|DQ990866 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Hardwood H4 H4-020-its 622 98 gi|194304274|gb|EU819436 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Hardwood H4 H4-012-its 219 96 gi|90102542|gb|DQ420858 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H4 H4-013-its 219 99 gi|63408483|gb|AY969637 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Hardwood H4 H4-018-its 620 93 gi|32134771|emb|AJ491193 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Begoniaceae Hardwood H4 H4-001-its 106 96 gi|90102874|gb|DQ421190 Fungi;Zygomycota; Hardwood H4 H4-003-its 106 99 gi|90102874|gb|DQ421190 Fungi;Zygomycota; Hardwood H4 H4-019-its 106 99 gi|90102874|gb|DQ421190 Fungi;Zygomycota; Hardwood H4 H4-022-its 339 96 gi|126360699|gb|EF040836 Fungi;Zygomycota; Hardwood H4 H4-023-its 339 97 gi|126360699|gb|EF040836 Fungi;Zygomycota; Hardwood H4 H4-021-its 215 97 gi|63408878|gb|AY970032 Fungi;Zygomycota; Pine P1 P1-011-its 627 91 gi|187939492|gb|EU686205 Fungi; Pine P1 P1-013-its 215 94 gi|63409049|gb|AY970203 Fungi;

Treatment Plot Clone Name OTU %ID Accession Lineage Pine P1 P1-021-its 433 97 gi|2668697|gb|AF033457 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Pine P1 P1-003-its 405 92 gi|160552290|gb|EU139127 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Pine P1 P1-018-its 405 91 gi|160552290|gb|EU139127 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Pine P1 P1-008-its 440 94 gi|118084443|gb|DQ914697 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Pine P1 P1-009-its 625 92 gi|160552295|gb|EU139132 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae Pine P1 P1-010-its 626 94 gi|63408780|gb|AY969934 Fungi;Ascomycota; Pine P1 P1-004-its 361 95 gi|28269277|gb|AF504862 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Pine P1 P1-017-its 12 100 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus Pine P1 P1-005-its 624 98 gi|4106104|gb|AF042424 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Sirobasidiaceae Pine P1 P1-016-its 629 99 gi|150035521|gb|EF619738 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae Pine P1 P1-023-its 443 99 gi|219813624|gb|FJ553838 Fungi;Basidiomycota;Agaricomycetes; Pine P1 P1-024-its 443 96 gi|219813624|gb|FJ553838 Fungi;Basidiomycota;Agaricomycetes; Pine P1 P1-022-its 630 95 gi|50542023|gb|AY627832 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Ericaceae Pine P1 P1-014-its 215 98 gi|63409049|gb|AY970203 Fungi;Zygomycota; Pine P2 P2-014-its 437 97 gi|83722498|gb|DQ309188 Fungi;

108 Pine P2 P2-012-its 635 95 gi|220967533|gb|EU977258 Fungi;

Pine P2 P2-005-its 633 91 gi|188496719|emb|AM999716 Fungi; Pine P2 P2-019-its 637 94 gi|63408997|gb|AY970151 Metazoa; Pine P2 P2-039-its 206 99 gi|94383921|emb|AM260817 Fungi; Pine P2 P2-049-its 206 99 gi|94383921|emb|AM260817 Fungi; Pine P2 P2-050-its 647 99 gi|162311439|gb|EU292244 Fungi; Pine P2 P2-047-its 436 97 gi|204306523|gb|FJ152539 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum Pine P2 P2-020-its 365 98 gi|219813631|gb|FJ553845 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Pine P2 P2-015-its 370 98 gi|219813599|gb|FJ553813 Fungi;Ascomycota;Leotiomycetes;Helotiales;Dermateaceae Pine P2 P2-017-its 370 98 gi|219813599|gb|FJ553813 Fungi;Ascomycota;Leotiomycetes;Helotiales;Dermateaceae Pine P2 P2-028-its 641 93 gi|39979890|gb|AY394669 Fungi;Ascomycota; Pine P2 P2-032-its 376 96 gi|219814045|gb|FJ554259 Fungi;Ascomycota;Leotiomycetes;Leotiomycetes;Leotiomycetes Pine P2 P2-035-its 642 96 gi|63408698|gb|AY969852 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage Pine P2 P2-036-its 643 97 gi|219813575|gb|FJ553789 Fungi;Ascomycota; Pine P2 P2-048-its 376 96 gi|219814045|gb|FJ554259 Fungi;Ascomycota;Leotiomycetes;Leotiomycetes;Leotiomycetes Pine P2 P2-051-its 648 97 gi|57157612|dbj|AB176639 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Pine P2 P2-016-its 256 94 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Pine P2 P2-053-its 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Pine P2 P2-056-its 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Pine P2 P2-007-its 194 90 gi|87244874|gb|DQ377372 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae Pine P2 P2-046-its 194 90 gi|87244874|gb|DQ377372 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae Pine P2 P2-038-its 644 98 gi|219523262|gb|FJ475705 Fungi;Basidiomycota;Agaricomycetes;Polyporales;Polyporales Pine P2 P2-054-its 649 99 gi|150035412|gb|EF619629 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae Pine P2 P2-001-its 410 97 gi|205364281|gb|FJ157106 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Pine P2 P2-002-its 631 94 gi|95107053|gb|DQ494699 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae Pine P2 P2-004-its 632 99 gi|219523349|gb|FJ475792 Fungi;Basidiomycota;Agaricomycetes;Trechisporales;Trechisporales Pine P2 P2-008-its 198 93 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae Pine P2 P2-011-its 194 90 gi|87244874|gb|DQ377372 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae

109 Pine P2 P2-013-its 198 93 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2-023-its 638 96 gi|116272296|gb|DQ900954 Fungi;Basidiomycota;Agaricomycetes;Agaricomycetes;Agaricomycetes Pine P2 P2-029-its 207 100 gi|87244930|gb|DQ377428 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae Pine P2 P2-030-its 194 93 gi|87244874|gb|DQ377372 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae Pine P2 P2-040-its 410 97 gi|205364281|gb|FJ157106 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae Pine P2 P2-044-its 645 92 gi|31745647|gb|AY296257 Fungi;Basidiomycota;Agaricomycetes;Sebacinales;Sebacinaceae Pine P2 P2-045-its 646 92 gi|219814161|gb|FJ554375 Fungi;Basidiomycota;Agaricomycetes; Pine P2 P2-052-its 207 99 gi|87244930|gb|DQ377428 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae Pine P2 P2-024-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Pine P2 P2-043-its 285 99 gi|219814148|gb|FJ554362 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Pine P2 P2-021-its 306 99 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Pine P2 P2-041-its 306 99 gi|160213528|gb|EU240040 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae Pine P2 P2-031-its 100 100 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;

Treatment Plot Clone Name OTU %ID Accession Lineage Pine P2 P2-022-its 100 99 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Pine P2 P2-006-its 339 95 gi|126360699|gb|EF040836 Fungi;Zygomycota; Pine P3 P3-006-its 657 97 gi|188496755|emb|AM999752 Fungi; Pine P3 P3-018-its 321 98 gi|204306522|gb|FJ152538 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum Pine P3 P3-004-its 433 98 gi|2668697|gb|AF033457 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae Pine P3 P3-008-its 659 99 gi|150035630|gb|EF619847 Fungi;Ascomycota; Pine P3 P3-019-its 663 95 gi|118084482|gb|DQ914736 Fungi;Ascomycota;Dothideomycetes;Pleosporales; Pine P3 P3-007-its 658 94 gi|206601299|gb|FJ008032 Fungi;Ascomycota;Pezizomycetes;Pezizales;Tuberaceae Pine P3 P3-014-its 661 96 gi|63408915|gb|AY970069 Fungi;Ascomycota; Pine P3 P3-001-its 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae Pine P3 P3-009-its 246 98 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-011-its 246 99 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-012-its 246 99 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-015-its 246 99 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-016-its 246 99 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

110 Pine P3 P3-017-its 246 98 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-023-its 246 99 gi|63408730|gb|AY969884 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-003-its 655 98 gi|63408544|gb|AY969698 Fungi;Basidiomycota; Pine P3 P3-005-its 656 95 gi|148828512|gb|EF411130 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae Pine P3 P3-022-its 207 99 gi|87244930|gb|DQ377428 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae Pine P3 P3-010-its 100 99 gi|219813464|gb|FJ553678 Fungi;Mucoromycotina;Mucoromycotina;Mucorales; Pine P3 P3-021-its 215 98 gi|63409049|gb|AY970203 Fungi;Zygomycota;

Appendix 2: SSU clone libraries from field soils

The following table lists each SSU sequence generated from the land use study in chapter two. The OTU number represents

96% groupings, and is assigned only for this study. The %ID is from the top BLAST hit from NCBI’s Genbank, accessed March 2010

(Altschul et al. 1997). Lineage information is according to NCBI’s Taxonomy database.

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C1 C1-021-18s 180 96 gb|GQ122368 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Chlamydomonadaceae

Cultivated C1 C1-039-18s 185 95 gb|FJ384817 Metazoa;Platyhelminthes;Turbellaria;Catenulida;Stenostomidae

Cultivated C1 C1-038-18s 184 95 gb|GQ864273 Metazoa;Arthropoda;Arachnida;Prostigmata;Eupodidae

Cultivated C1 C1-003-18s 49 96 gb|EF023937 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

111 Cultivated C1 C1-027-18s 27 98 emb|AJ966490 Metazoa;Nematoda;Enoplea;Dorylaimida;Dorylaimidae

Cultivated C1 C1-002-18s 33 98 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-019-18s 33 98 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-022-18s 33 98 gb|EF023163 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-023-18s 33 97 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-025-18s 33 97 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-032-18s 33 97 gb|EF023448 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-035-18s 33 99 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-042-18s 33 98 gb|EF023163 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-029-18s 24 97 gb|AY969144 Alveolata;Apicomplexa;

Cultivated C1 C1-030-18s 181 96 gb|DQ459878 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Chlamydomonadaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C1 C1-036-18s 183 97 gb|AF113423 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Cunninghamellaceae

Cultivated C1 C1-037-18s 43 97 gb|GU250317 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C1 C1-016-18s 179 91 gb|AY620296 Rhizaria;Cercozoa;

Cultivated C1 C1-011-18s 178 94 gb|GQ995264 Fungi;Chytridiomycota;

Cultivated C1 C1-004-18s 175 94 gb|EF136905 Fungi;Glomeromycota;Glomeromycetes;Glomerales;Glomeraceae

Cultivated C1 C1-006-18s 161 94 dbj|AB425947 Amoebozoa;Tubulinea;Euamoebida;Echinamoebidae

Cultivated C1 C1-043-18s 142 98 gb|FJ866597 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Cultivated C1 C1-014-18s 54 98 dbj|AB454217 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Cultivated C1 C1-040-18s 54 98 dbj|AB454203 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Cultivated C1 C1-001-18s 82 98 gb|EF023881 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Cultivated C1 C1-018-18s 88 98 gb|FJ969135 Metazoa;Nematoda;Chromadorea;Araeolaimida;Plectidae

Cultivated C1 C1-028-18s 88 96 gb|AY284705 Metazoa;Nematoda;Chromadorea;Araeolaimida;Plectidae

112 Cultivated C1 C1-045-18s 93 99 gb|DQ009758 Viridiplantae;Chlorophyta;Chlorophyceae;Chlorosarcinales;Chlorosarcinopsis

Cultivated C1 C1-047-18s 33 98 gb|U38315 Viridiplantae;Streptophyta;Embryophyta;Lamiales;Plantaginaceae

Cultivated C1 C1-020-18s 10 98 gb|FJ216403 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C1 C1-033-18s 182 97 gb|DQ244008 Fungi;

Cultivated C1 C1-034-18s 23 96 gb|EU433994 Metazoa;Arthropoda;Arachnida;Oribatida;Gehypochthoniidae

Cultivated C1 C1-007-18s 9 99 gb|EU434028 Viridiplantae;Streptophyta;Klebsormidiophyceae;Klebsormidiales;Klebsormidiaceae

Cultivated C1 C1-048-18s 9 98 gb|EU434028 Viridiplantae;Streptophyta;Klebsormidiophyceae;Klebsormidiales;Klebsormidiaceae

Cultivated C1 C1-012-18s 10 98 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C1 C1-017-18s 10 98 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C1 C1-024-18s 10 99 gb|FJ216403 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C1 C1-046-18s 187 98 emb|AJ549228 Viridiplantae;Streptophyta;Zygnemophyceae;Zygnematales;Mesotaeniaceae

Cultivated C1 C1-010-18s 14 97 gb|EU709201 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C1 C1-015-18s 23 96 gb|EU433994 Metazoa;Arthropoda;Arachnida;Oribatida;Gehypochthoniidae

Cultivated C1 C1-013-18s 10 99 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C1 C1-044-18s 18 98 gb|AF411895 Metazoa;Annelida;Clitellata;Oligochaeta;Haplotaxida

Cultivated C1 C1-026-18s 12 98 gb|EU709218 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Cultivated C1 C1-008-18s 14 97 emb|AM114805 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Cultivated C1 C1-041-18s 186 98 gb|AY620298 Rhizaria;Cercozoa;

Cultivated C1 C1-005-18s 23 97 gb|EU433994 Metazoa;Arthropoda;Arachnida;Oribatida;Gehypochthoniidae

Cultivated C2 C2-143-18s 129 97 gb|DQ534692 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillineae

Cultivated C2 C2-117-18s 200 97 gb|EF456752 Rhizaria;Cercozoa;Silicofilosea;Euglyphida;Trinematidae

Cultivated C2 C2-010-NS4 190 99 emb|AM114800 Rhizaria;Cercozoa;

Cultivated C2 C2-108-18s 198 99 dbj|AB425953 Amoebozoa;Tubulinea;Euamoebida;Tubulinida;Hartmannellidae

Cultivated C2 C2-100-18s 103 96 gb|EU091877 Fungi;Basidiomycota;Microbotryomycetes;Sporidiobolales;

113 Cultivated C2 C2-110-18s 199 94 gb|AY082981 ;

Cultivated C2 C2-107-18s 197 98 gb|EU545715 ;

Cultivated C2 C2-136-18s 103 98 gb|EU091868 Fungi;Basidiomycota;Microbotryomycetes;Sporidiobolales;

Cultivated C2 C2-146-18s 103 98 gb|FJ517759 Fungi;Basidiomycota;Microbotryomycetes;Sporidiobolales;

Cultivated C2 C2-013-NS4 113 98 gb|EF025029 ;

Cultivated C2 C2-130-18s 113 97 gb|EF024274 ;

Cultivated C2 C2-105-18s 196 95 gb|EF023703 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Cultivated C2 C2-102-18s 195 91 gb|FJ482441 Fungi;

Cultivated C2 C2-022-NS4 194 88 gb|EU091865 ;

Cultivated C2 C2-151-18s 151 85 gb|EU733605 Fungi;

Cultivated C2 C2-144-18s 157 94 gb|EU733605 Fungi;

Cultivated C2 C2-020-NS4 193 83 gb|EU271963 stramenopiles;Oomycetes;Myzocytiopsidales;Myzocytiopsidaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C2 C2-003-NS4 161 98 dbj|AB425947 Amoebozoa;Tubulinea;Euamoebida;Echinamoebidae

Cultivated C2 C2-015-NS4 191 79 gb|AY082976 ;

Cultivated C2 C2-009-NS4 189 91 gb|DQ174731 Alveolata;Chromera;

Cultivated C2 C2-004-NS4 188 82 gb|GQ140604 Fungi;Glomeromycota;Glomeromycetes;Glomerales;Glomeraceae

Cultivated C2 C2-111-18s 102 98 dbj|AB008397 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Cultivated C2 C2-018-NS4 192 96 gb|AY620297 Rhizaria;Cercozoa;

Cultivated C2 C2-098-18s 6 97 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Cultivated C2 C2-008-NS4 24 97 gb|AY969144 Alveolata;Apicomplexa;

Cultivated C2 C2-016-NS4 12 98 gb|U42447 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Cultivated C2 C2-138-18s 10 98 gb|GU199043 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C2 C2-133-18s 10 98 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Cultivated C2 C2-007-NS4 10 99 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

114 Cultivated C2 C2-014-NS4 7 99 gb|AF026582 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Cultivated C2 C2-123-18s 50 96 gb|EU815932 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Cultivated C2 C2-099-18s 6 99 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Cultivated C2 C2-135-18s 27 97 emb|AM086688 Metazoa;Nematoda;Enoplea;Dorylaimida;Longidoridae

Cultivated C2 C2-120-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C2 C2-116-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C2 C2-017-NS4 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C2 C2-005-NS4 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C2 C2-024-NS4 2 98 gb|EF024979 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthuridae

Cultivated C2 C2-012-NS4 2 99 gb|EF024979 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthuridae

Cultivated C2 C2-011-NS4 2 99 gb|EF024979 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthuridae

Cultivated C2 C2-113-18s 6 99 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C2 C2-125-18s 50 97 gb|EU815932 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Cultivated C2 C2-106-18s 82 98 gb|EF023881 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Cultivated C2 C2-150-18s 66 98 gb|EU484240 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Cultivated C2 C2-134-18s 66 98 gb|EU484240 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Cultivated C2 C2-119-18s 66 98 gb|EU484240 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Cultivated C2 C2-021-NS4 60 97 gb|FJ820583 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Cultivated C2 C2-114-18s 54 98 gb|FJ439576 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Cultivated C2 C2-141-18s 50 98 gb|EU815932 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Cultivated C2 C2-118-18s 26 96 dbj|AB032621 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Cultivated C2 C2-101-18s 50 98 gb|EU815932 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Cultivated C2 C2-147-18s 26 97 dbj|AB032621 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Cultivated C2 C2-152-18s 47 98 gb|DQ851584 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Strophariaceae

115 Cultivated C2 C2-142-18s 47 98 gb|DQ437683 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Bolbitiaceae

Cultivated C2 C2-148-18s 43 97 gb|FJ358307 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C2 C2-097-18s 43 99 gb|FJ358307 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C2 C2-103-18s 34 98 gb|EF024586 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Cultivated C2 C2-019-NS4 34 99 gb|EF024586 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Cultivated C2 C2-006-NS4 93 99 gb|EF024728 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Dunaliellaceae

Cultivated C2 C2-121-18s 201 95 gb|EU709136 Rhizaria;Cercozoa;

Cultivated C2 C2-122-18s 202 96 gb|AF026637 Fungi;Basidiomycota;Agaricomycetes;Gomphales;Gomphaceae

Cultivated C2 C2-124-18s 203 97 gb|FJ439584 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Arthopyreniaceae

Cultivated C2 C2-126-18s 204 98 gb|AY620273 Rhizaria;Cercozoa;

Cultivated C2 C2-127-18s 205 90 gb|AY960120 Amoebozoa;Centramoebida;Acanthamoebidae;Protacanthamoeba;

Cultivated C2 C2-129-18s 206 89 gb|AY032608 Fungi;Chytridiomycota;Chytridiomycetes;Chytridiales;Chytridiaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C2 C2-132-18s 207 90 gb|AY082998 ;

Cultivated C2 C2-139-18s 208 99 emb|AJ301962 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Nectriaceae

Cultivated C2 C2-145-18s 209 95 gb|GQ251041 Metazoa;Nematoda;Enoplea;Dorylaimida;Longidoridae

Cultivated C2 C2-149-18s 210 84 gb|EF024540 Rhizaria;Cercozoa;

Cultivated C2 C2-109-18s 50 96 gb|EU815932 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Cultivated C3 C3-006-18s 94 98 gb|GU292343 Viridiplantae;Chlorophyta;Chlorophyceae;Chlorococcales;Ettlia

Cultivated C3 C3-009-18s 26 98 gb|EU091863 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Cultivated C3 C3-012-18s 26 99 gb|EU091863 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Cultivated C3 C3-017-18s 27 97 emb|AJ966490 Metazoa;Nematoda;Enoplea;Dorylaimida;Dorylaimidae

Cultivated C3 C3-005-18s 82 97 gb|EF363152 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Cultivated C3 C3-018-18s 122 97 gb|EU091843 Metazoa;Nematoda;Enoplea;Enoplida;Prismatolaimidae

Cultivated C3 C3-020-18s 34 98 gb|EF024586 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

116 Cultivated C3 C3-011-18s 43 98 gb|GU250317 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C3 C3-003-18s 5 97 gb|EF025004 ;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C3 C3-016-18s 104 97 gb|AY969221 Rhizaria;Cercozoa;

Cultivated C3 C3-010-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Cultivated C3 C3-008-18s 41 97 gb|EU940080 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Cultivated C3 C3-023-18s 217 89 gb|FJ592255 ;

Cultivated C3 C3-004-18s 211 97 gb|AF202284 Fungi;Basidiomycota;

Cultivated C3 C3-007-18s 212 92 gb|GQ995264 Fungi;Chytridiomycota;

Cultivated C3 C3-015-18s 213 94 gb|EF024871 Rhizaria;Cercozoa;

Cultivated C3 C3-019-18s 214 90 gb|U07400 Amoebozoa;Centramoebida;Acanthamoebidae

Cultivated C3 C3-021-18s 215 77 gb|AY082989 ;

Cultivated C3 C3-001-18s 103 98 gb|EU091868 Fungi;Basidiomycota;Microbotryomycetes;Sporidiobolales;

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C3 C3-022-18s 216 98 gb|EF025022 ;

Cultivated C3 C3-024-18s 103 98 gb|EU091877 Fungi;Basidiomycota;Microbotryomycetes;Sporidiobolales;

Cultivated C3 C3-002-18s 9 99 dbj|AB512174 Viridiplantae;Streptophyta;Klebsormidiophyceae;Klebsormidiales;Klebsormidiaceae

Cultivated C3 C3-013-18s 12 98 gb|DQ211596 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G1 G1-031-18s 47 98 gb|AY293141 Fungi;Basidiomycota;Agaricomycetes;Russulales;Stereaceae

Grass G1 G1-036-18s 115 98 gb|EU675633 Metazoa;Arthropoda;Arachnida;Acari;Alicorhagiidae

Grass G1 G1-029-18s 44 93 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G1 G1-014-18s 44 94 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G1 G1-015-18s 115 99 gb|EU675633 Metazoa;Arthropoda;Arachnida;Acari;Alicorhagiidae

Grass G1 G1-008-18s 93 96 gb|U63106 Viridiplantae;Chlorophyta;Chlorophyceae;Chlorococcales;Ascochloris

Grass G1 G1-004-18s 44 94 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G1 G1-009-18s 93 99 gb|AY220577 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Chlamydomonadaceae

117 Grass G1 G1-040-18s 27 99 emb|AM086688 Metazoa;Nematoda;Enoplea;Dorylaimida;Longidoridae

Grass G1 G1-041-18s 44 93 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G1 G1-033-18s 47 99 gb|AY293141 Fungi;Basidiomycota;Agaricomycetes;Russulales;Stereaceae

Grass G1 G1-012-18s 10 98 gb|GU072555 Fungi;Ascomycota;Sordariomycetes;Hypocreales;Fusarium

Grass G1 G1-035-18s 14 97 gb|EU709189 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G1 G1-023-18s 6 97 emb|FN598332 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G1 G1-001-18s 6 99 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G1 G1-024-18s 22 96 gb|EU179935 Fungi;Ascomycota;SoilCloneGroupI

Grass G1 G1-048-18s 22 96 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Grass G1 G1-047-18s 27 99 emb|AM086684 Metazoa;Nematoda;Enoplea;Dorylaimida;Longidoridae

Grass G1 G1-027-18s 24 97 gb|AY969144 Alveolata;Apicomplexa;

Grass G1 G1-020-18s 43 98 gb|DQ521605 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G1 G1-046-18s 27 98 gb|AY284826 Metazoa;Nematoda;Enoplea;Dorylaimida;Paractinolaiminae

Grass G1 G1-016-18s 35 92 gb|GQ864273 Metazoa;Arthropoda;Arachnida;Prostigmata;Eupodidae

Grass G1 G1-028-18s 35 92 gb|GQ864273 Metazoa;Arthropoda;Arachnida;Prostigmata;Eupodidae

Grass G1 G1-039-18s 35 91 gb|GQ864273 Metazoa;Arthropoda;Arachnida;Prostigmata;Eupodidae

Grass G1 G1-038-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G1 G1-032-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G1 G1-013-18s 24 97 gb|AY969144 Alveolata;Apicomplexa;

Grass G1 G1-010-18s 221 97 gb|FJ790710 Rhizaria;Cercozoa;Cercomonadida;Cercomonadidae

Grass G1 G1-019-18s 223 98 gb|DQ831012 Fungi;Basidiomycota;Ustilaginomycetes;Ustilaginales;Ustilaginaceae

Grass G1 G1-022-18s 224 82 gb|EF023424 Amoebozoa;Centramoebida;Acanthamoebidae;Acanthamoeba;environmentalsamples

Grass G1 G1-037-18s 140 98 gb|EU688964 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G1 G1-007-18s 140 97 gb|EU688964 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

118 Grass G1 G1-025-18s 225 93 gb|EF207254 Metazoa;Nematoda;Enoplea;Dorylaimida;Tylencholaimidae

Grass G1 G1-018-18s 222 97 gb|DQ487195 Alveolata;Ciliophora;Litostomatea;Haptoria;Haptorida

Grass G1 G1-017-18s 175 96 gb|DQ085262 Fungi;Glomeromycota;Glomeromycetes;Glomerales;Glomeraceae

Grass G1 G1-030-18s 226 83 dbj|AB243296 Fungi;Ascomycota;Schizosaccharomycetes;Schizosaccharomycetales;Schizosaccharomycetaceae

Grass G1 G1-026-18s 163 99 gb|EF688289 Viridiplantae;Chlorophyta;Trebouxiophyceae;Microthamniales;

Grass G1 G1-003-18s 219 88 gb|GQ864280 Metazoa;Arthropoda;Arachnida;Prostigmata;Trombidioidea

Grass G1 G1-002-18s 218 96 gb|AY620296 Rhizaria;Cercozoa;

Grass G1 G1-045-18s 230 93 gb|AY382467 Fungi;

Grass G1 G1-044-18s 229 96 gb|EU878374 Viridiplantae;Chlorophyta;Trebouxiophyceae;Parietochloris;

Grass G1 G1-011-18s 163 99 emb|AM167525 Viridiplantae;Chlorophyta;Trebouxiophyceae;Coccomyxaceae;Coccomyxa

Grass G1 G1-006-18s 220 95 dbj|AB037082 Viridiplantae;Chlorophyta;Chlorophyceae;Sphaeropleales;Scenedesmaceae

Grass G1 G1-043-18s 228 94 gb|EF023499 Amoebozoa;Tubulinea;Euamoebida;Tubulinida;Hartmannellidae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G1 G1-042-18s 227 98 gb|EF023178 Rhizaria;

Grass G2 G2-012-NS4 2 97 gb|AY555515 Metazoa;Arthropoda;Hexapoda;Collembola;Isotomidae

Grass G2 G2-020-NS4 41 99 gb|AF164354 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Grass G2 G2-024-NS4 22 95 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Grass G2 G2-007-NS4 24 97 gb|AY969144 Alveolata;Apicomplexa;

Grass G2 G2-010-NS4 44 94 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G2 G2-011-NS4 93 99 gb|EF023381 Viridiplantae;Chlorophyta;Chlorophyceae;Chlamydomonadales;Dunaliellaceae

Grass G2 G2-001-NS4 231 92 gb|AY555515 Metazoa;Arthropoda;Hexapoda;Collembola;Isotomidae

Grass G2 G2-003-NS4 94 99 gb|EF025001 Viridiplantae;Chlorophyta;Chlorophyceae;Chlorococcales;Ettlia

Grass G2 G2-021-NS4 88 99 gb|FJ474096 Metazoa;Nematoda;Chromadorea;Araeolaimida;Plectidae

Grass G2 G2-002-NS4 22 98 gb|AY969296 Fungi;Ascomycota;SoilCloneGroupI

Grass G2 G2-004-NS4 232 95 gb|DQ444862 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

119 Grass G2 G2-006-NS4 13 99 gb|L37533 Fungi;Ascomycota;Pezizomycetes;Pezizales;Ascobolaceae

Grass G2 G2-022-NS4 12 97 gb|EU709222 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G2 G2-005-NS4 12 97 gb|U42447 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G2 G2-019-NS4 6 99 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G2 G2-014-NS4 234 96 gb|EU733605 Fungi;

Grass G2 G2-018-NS4 113 97 gb|EF024274 ;

Grass G2 G2-009-NS4 23 97 gb|EU432216 Metazoa;Arthropoda;Arachnida;Oribatida;Atopochthoniidae

Grass G2 G2-015-NS4 235 93 gb|AY620296 Rhizaria;Cercozoa;

Grass G2 G2-016-NS4 236 96 gb|EF024949 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Grass G2 G2-017-NS4 237 96 gb|EU266926 Metazoa;Tardigrada;Eutardigrada;Parachela;Macrobiotidae

Grass G2 G2-023-NS4 6 95 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G2 G2-013-NS4 233 97 gb|AY635828 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G3 G3-042-18s 41 98 gb|EU883433 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Grass G3 G3-060-18s 6 97 gb|AY846367 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G3 G3-034-18s 41 98 gb|FJ215709 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Grass G3 G3-052-18s 6 96 ref|XM_002488993 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G3 G3-043-18s 43 98 gb|FJ358328 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Grass G3 G3-050-18s 255 94 gb|EU709266 Rhizaria;Cercozoa;

Grass G3 G3-048-18s 254 98 gb|EF024815 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Grass G3 G3-059-18s 256 97 gb|AY919722 ;

Grass G3 G3-044-18s 253 97 gb|AY749607 Centroheliozoa;Acanthocystidae

Grass G3 G3-041-18s 252 89 gb|EU392158 Amoebozoa;Tubulinea;Arcellinida;Difflugina;Hyalospheniidae

Grass G3 G3-035-18s 50 97 gb|AY641007 Fungi;Ascomycota;Sordariomycetes;Sordariales;Sordariaceae

Grass G3 G3-040-18s 251 98 gb|FJ009672 Fungi;Glomeromycota;Glomeromycetes;Diversisporales;Scutellosporaceae

120 Grass G3 G3-039-18s 250 99 gb|DQ457639 Fungi;Basidiomycota;Cystobasidiomycetes;Erythrobasidiales;Erythrobasidiales

Grass G3 G3-036-18s 249 96 gb|DQ207567 Apusozoa;Apusomonadidae

Grass G3 G3-006-18s 54 97 gb|GU296168 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Grass G3 G3-053-18s 1 97 gb|DQ851579 Fungi;Basidiomycota;Agaricomycetes;Polyporales;Lentinaceae

Grass G3 G3-038-18s 169 95 gb|AY884327 Rhizaria;Cercozoa;Cercomonadida;Cercomonadidae

Grass G3 G3-017-18s 18 96 gb|EF024636 Metazoa;Annelida;Clitellata;Oligochaeta;Haplotaxida

Grass G3 G3-020-18s 18 97 gb|EF025012 Metazoa;Annelida;Clitellata;Oligochaeta;Haplotaxida

Grass G3 G3-061-18s 14 99 gb|AY965866 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G3 G3-045-18s 14 97 gb|EU709182 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G3 G3-051-18s 54 99 emb|FM995624 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Grass G3 G3-005-18s 177 95 gb|GU296183 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Grass G3 G3-012-18s 14 99 gb|AY496043 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G3 G3-019-18s 5 98 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-049-18s 13 98 gb|AY544721 Fungi;Ascomycota;Pezizomycetes;Pezizales;Ascobolaceae

Grass G3 G3-010-18s 5 97 gb|EF025004 ;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-028-18s 27 96 gb|AY284799 Metazoa;Nematoda;Enoplea;Dorylaimida;Dorylaimidae

Grass G3 G3-063-18s 12 98 gb|EU709218 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Grass G3 G3-054-18s 5 98 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-033-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-014-18s 5 99 gb|EU428770 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-058-18s 157 94 gb|EU733605 Fungi;

Grass G3 G3-013-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-056-18s 13 99 gb|AY544721 Fungi;Ascomycota;Pezizomycetes;Pezizales;Ascobolaceae

Grass G3 G3-015-18s 89 84 gb|EF024467 Fungi;Ascomycota;

121 Grass G3 G3-047-18s 2 97 gb|AY596364 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthurididae

Grass G3 G3-037-18s 85 98 emb|Y17644 Fungi;Glomeromycota;Glomeromycetes;Glomerales;Glomeraceae

Grass G3 G3-004-18s 85 98 gb|DQ396724 Fungi;Glomeromycota;Glomeromycetes;Diversisporales;Diversisporaceae

Grass G3 G3-062-18s 84 93 gb|EF023937 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Grass G3 G3-021-18s 242 96 gb|AY552969 Metazoa;Nematoda;Enoplea;Dorylaimida;Belondiridae

Grass G3 G3-002-18s 84 93 gb|EF023937 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Grass G3 G3-009-18s 2 96 gb|AY596364 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthurididae

Grass G3 G3-032-18s 157 94 gb|EU733605 Fungi;

Grass G3 G3-016-18s 241 92 gb|EU733605 Fungi;

Grass G3 G3-046-18s 2 97 gb|AY596364 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthurididae

Grass G3 G3-027-18s 247 96 gb|AY546684 Fungi;Chytridiomycota;Chytridiomycetes;Spizellomycetales;Spizellomycetaceae

Grass G3 G3-007-18s 89 89 gb|EU733583 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G3 G3-022-18s 243 98 gb|AF164287 Fungi;Chytridiomycota;Chytridiomycetes;Cladochytriales;Cladochytriaceae

Grass G3 G3-031-18s 4 96 gb|EF025004 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G3 G3-001-18s 238 96 gb|DQ536484 Fungi;Chytridiomycota;Chytridiomycetes;Chytridiales;Chytridiaceae

Grass G3 G3-024-18s 245 75 gb|EF024332 Fungi;Basidiomycota;Agaricomycetes;Auriculariales;

Grass G3 G3-030-18s 248 98 gb|AF113442 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Saksenaeaceae

Grass G3 G3-026-18s 246 92 gb|GQ995333 Fungi;Chytridiomycota;

Grass G3 G3-008-18s 134 92 gb|AY642706 Fungi;Chytridiomycota;

Grass G3 G3-025-18s 118 98 emb|AM746202 Fungi;Ascomycota;

Grass G3 G3-064-18s 145 92 gb|FJ171957 Metazoa;Arthropoda;Insecta;Diptera;Mycetophilidae

Grass G3 G3-055-18s 134 93 gb|AY642706 Fungi;Chytridiomycota;

Grass G3 G3-023-18s 244 89 gb|DQ767650 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Grass G3 G3-057-18s 145 90 gb|FJ171950 Metazoa;Arthropoda;Insecta;Diptera;Mycetophilidae

122 Grass G3 G3-003-18s 239 90 gb|AY969139 Metazoa;Nematoda;

Grass G3 G3-011-18s 240 98 gb|EU567294 Rhizaria;Cercozoa;Vampyrellidae

Grass G3 G3-018-18s 89 89 gb|EU733583 Fungi;Ascomycota;

Grass G3 G3-029-18s 2 96 gb|AY596364 Metazoa;Arthropoda;Hexapoda;Collembola;Sminthurididae

Grass G7 G7-003-18s 82 99 emb|FM178254 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Grass G7 G7-013-18s 263 96 gb|AY749485 ;

Grass G7 G7-015-18s 5 99 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Grass G7 G7-032-18s 163 99 gb|EF159951 Viridiplantae;Chlorophyta;Trebouxiophyceae;Chlorellales;Chlorellaceae

Grass G7 G7-008-18s 261 97 gb|FJ790724 Rhizaria;Cercozoa;Cercomonadida;Cercomonadidae

Grass G7 G7-011-18s 262 96 gb|DQ411860 Alveolata;Ciliophora;Litostomatea;Haptoria;Haptorida

Grass G7 G7-016-18s 69 99 gb|GQ995710 Metazoa;Nematoda;Enoplea;Triplonchida;Trichodoridae

Grass G7 G7-014-18s 27 98 gb|GQ251041 Metazoa;Nematoda;Enoplea;Dorylaimida;Longidoridae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G7 G7-004-18s 6 96 ref|XM_002488993 Viridiplantae;Streptophyta;Embryophyta;Poales;Poaceae

Grass G7 G7-040-18s 122 99 gb|EU091843 Metazoa;Nematoda;Enoplea;Enoplida;Prismatolaimidae

Grass G7 G7-027-18s 113 97 gb|EF025029 ;

Grass G7 G7-023-18s 24 95 gb|AY969144 Alveolata;Apicomplexa;

Grass G7 G7-044-18s 24 97 gb|AY969144 Alveolata;Apicomplexa;

Grass G7 G7-048-18s 24 97 gb|AY969144 Alveolata;Apicomplexa;

Grass G7 G7-022-18s 26 98 dbj|D31659 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Grass G7 G7-033-18s 26 98 dbj|AB032621 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Grass G7 G7-039-18s 270 91 gb|EU709279 Rhizaria;Cercozoa;

Grass G7 G7-046-18s 272 96 dbj|AB433328 Nucleariidae;Nuclearia;

Grass G7 G7-018-18s 264 93 dbj|AB425947 Amoebozoa;Tubulinea;Euamoebida;Echinamoebidae

Grass G7 G7-001-18s 54 99 dbj|AB454232 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

123 Grass G7 G7-045-18s 271 96 gb|GQ995281 Fungi;Chytridiomycota;

Grass G7 G7-020-18s 41 98 gb|EU998928 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Grass G7 G7-038-18s 269 98 gb|FJ794897 ;

Grass G7 G7-034-18s 268 95 gb|EU736279 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Grass G7 G7-026-18s 267 94 gb|AF072883 stramenopiles;Bicosoecida;Siluaniidae

Grass G7 G7-025-18s 266 98 gb|EF024655 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Grass G7 G7-021-18s 265 91 gb|EF023594 stramenopiles;Eustigmatophyceae;

Grass G7 G7-036-18s 26 98 dbj|AB032621 Fungi;Basidiomycota;Tremellomycetes;Cystofilobasidiales;Cystofilobasidiales

Grass G7 G7-028-18s 43 98 gb|FJ358328 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Grass G7 G7-035-18s 146 92 gb|EF024801 Rhizaria;Cercozoa;

Grass G7 G7-002-18s 257 99 gb|FJ790653 ;

Grass G7 G7-030-18s 44 91 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G7 G7-009-18s 44 94 gb|AY037170 Metazoa;Arthropoda;Hexapoda;Protura;Protentomidae

Grass G7 G7-043-18s 146 95 gb|EF024801 Rhizaria;Cercozoa;

Grass G7 G7-041-18s 147 96 emb|AJ496248 Fungi;Ascomycota;Sordariomycetes;Coniochaetales;Coniochaetaceae

Grass G7 G7-042-18s 147 98 emb|AJ496248 Fungi;Ascomycota;Sordariomycetes;Coniochaetales;Coniochaetaceae

Grass G7 G7-024-18s 54 97 gb|DQ384067 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Phaeosphaeriaceae

Grass G7 G7-010-18s 151 93 gb|EU733583 Fungi;

Grass G7 G7-007-18s 260 91 gb|FJ790702 Rhizaria;Cercozoa;Cercomonadida;Cercomonadidae

Grass G7 G7-047-18s 154 98 gb|AY284798 Metazoa;Nematoda;Enoplea;Dorylaimida;Qudsianematidae

Grass G7 G7-005-18s 258 95 gb|EU734843 Rhizaria;Cercozoa;

Grass G7 G7-006-18s 259 89 gb|AY916571 ;

Hardwood H1 H1-004-18s 15 98 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-024-18s 47 98 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

124 Hardwood H1 H1-015-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H1 H1-022-18s 15 98 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-016-18s 1 98 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-012-18s 273 87 dbj|AB191432 ;

Hardwood H1 H1-013-18s 28 92 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H1 H1-007-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H1 H1-020-18s 49 98 gb|EU709247 Rhizaria;Cercozoa;

Hardwood H1 H1-023-18s 7 97 gb|AY707093 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Hardwood H1 H1-021-18s 4 98 gb|EU736292 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Hardwood H1 H1-018-18s 15 97 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-006-18s 129 96 gb|DQ534690 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillineae

Hardwood H1 H1-010-18s 15 97 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H1 H1-019-18s 15 97 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-011-18s 47 98 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H1 H1-014-18s 82 98 gb|EF023881 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Hardwood H1 H1-017-18s 15 98 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-122-18s 284 91 gb|EF025008 ;

Hardwood H2 H2-105-18s 19 98 gb|DQ898686 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-114-18s 20 96 gb|AY662658 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-117-18s 20 96 gb|AY662658 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-144-18s 20 94 gb|AY662658 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-110-18s 124 79 gb|FJ459741 Alveolata;Apicomplexa;Gregarinia;Eugregarinida;Gregarinidae

Hardwood H2 H2-009-NS4 19 99 gb|DQ898686 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-131-18s 285 95 gb|AY520195 Fungi;Ascomycota;Saccharomycetes;Saccharomycetales;Saccharomycetales

125 Hardwood H2 H2-115-18s 280 87 gb|GQ395297 ;

Hardwood H2 H2-112-18s 279 98 gb|AY623021 Alveolata;Dinophyceae;

Hardwood H2 H2-109-18s 278 97 gb|EF023636 Fungi;Basidiomycota;Dacrymycetes;Dacrymycetales;

Hardwood H2 H2-111-18s 124 82 gb|FJ459741 Alveolata;Apicomplexa;Gregarinia;Eugregarinida;Gregarinidae

Hardwood H2 H2-137-18s 286 97 gb|AF036607 Metazoa;Nematoda;Chromadorea;Rhabditida;Teratocephaloidea

Hardwood H2 H2-146-18s 132 95 gb|FJ459755 Alveolata;Apicomplexa;Gregarinia;Eugregarinida;Sphaerocystidae

Hardwood H2 H2-011-NS4 1 99 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-024-NS4 276 98 gb|AF026620 Fungi;Basidiomycota;Agaricomycetes;Geastrales;Geastraceae

Hardwood H2 H2-022-NS4 1 99 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-106-18s 277 99 gb|AY969312 Metazoa;Gastrotricha;

Hardwood H2 H2-003-NS4 1 99 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-020-NS4 1 99 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2-152-18s 122 96 gb|EU091843 Metazoa;Nematoda;Enoplea;Enoplida;Prismatolaimidae

Hardwood H2 H2-007-NS4 102 99 gb|U45440 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Elaphomycetaceae

Hardwood H2 H2-023-NS4 19 99 gb|DQ898686 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-118-18s 281 97 gb|DQ646542 Fungi;Ascomycota;Pezizomycetes;Pezizales;Pezizaceae

Hardwood H2 H2-108-18s 18 97 gb|EF025012 Metazoa;Annelida;Clitellata;Oligochaeta;Haplotaxida

Hardwood H2 H2-120-18s 283 94 gb|AY544712 Fungi;Ascomycota;Pezizomycetes;Pezizales;Pezizaceae

Hardwood H2 H2-015-NS4 1 98 gb|DQ367422 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-147-18s 60 98 gb|AF287840 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H2 H2-001-NS4 19 99 gb|DQ898686 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Cantharellaceae

Hardwood H2 H2-119-18s 282 89 gb|GQ411073 Alveolata;Apicomplexa;Colpodellidae

Hardwood H2 H2-010-NS4 7 98 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Hardwood H2 H2-138-18s 148 81 gb|EF660297 Rhodophyta;Stylonematophyceae;Stylonematales;Stylonemataceae

126 Hardwood H2 H2-149-18s 39 96 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Hardwood H2 H2-004-NS4 47 98 gb|EU708333 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-135-18s 90 97 gb|FJ435733 Metazoa;Tardigrada;Eutardigrada;Parachela;Hypsibiidae

Hardwood H2 H2-116-18s 90 98 gb|FJ435733 Metazoa;Tardigrada;Eutardigrada;Parachela;Hypsibiidae

Hardwood H2 H2-148-18s 132 99 gb|FJ459755 Alveolata;Apicomplexa;Gregarinia;Eugregarinida;Sphaerocystidae

Hardwood H2 H2-145-18s 148 82 gb|EF660297 Rhodophyta;Stylonematophyceae;Stylonematales;Stylonemataceae

Hardwood H2 H2-019-NS4 7 99 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Hardwood H2 H2-005-NS4 7 99 gb|AY969267 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Hardwood H2 H2-002-NS4 7 98 gb|AY969303 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Hardwood H2 H2-017-NS4 169 98 gb|AY884327 Rhizaria;Cercozoa;Cercomonadida;Cercomonadidae

Hardwood H2 H2-143-18s 4 97 gb|AF157145 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Hardwood H2 H2-133-18s 4 99 gb|EU736292 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2-013-NS4 275 96 gb|DQ444862 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Hardwood H2 H2-012-NS4 4 99 gb|AF157145 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Hardwood H2 H2-018-NS4 2 98 gb|EF023510 Metazoa;Arthropoda;Hexapoda;Collembola;Poduridae

Hardwood H2 H2-008-NS4 274 91 dbj|AB084609 Fungi;Basidiomycota;Agaricomycetes;Russulales;Stereaceae

Hardwood H2 H2-021-NS4 4 99 gb|AF157145 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Hardwood H2 H2-016-NS4 2 98 gb|EF023510 Metazoa;Arthropoda;Hexapoda;Collembola;Poduridae

Hardwood H2 H2-102-18s 4 98 gb|EU736292 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Hardwood H4 H4-001-18s 1 97 gb|FJ379282 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

Hardwood H4 H4-023-18s 60 97 gb|AY654887 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H4 H4-015-18s 177 98 gb|DQ813511 Fungi;Ascomycota;Dothideomycetes;Pleosporales;Massarinaceae

Hardwood H4 H4-002-18s 12 97 gb|EU709217 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Hardwood H4 H4-005-18s 60 98 gb|DQ521407 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

127 Hardwood H4 H4-024-18s 28 92 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-021-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-020-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-018-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-017-18s 28 92 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-007-18s 82 97 dbj|AB032646 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Hardwood H4 H4-008-18s 28 92 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-009-18s 53 98 gb|DQ851574 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Hardwood H4 H4-016-18s 1 98 gb|FJ379282 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

Hardwood H4 H4-013-18s 28 94 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-010-18s 28 93 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Hardwood H4 H4-019-18s 166 97 gb|AF130976 Fungi;Ascomycota;Sordariomycetes;Xylariales;Hyponectriaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H4 H4-011-18s 287 75 gb|EF023344 Alveolata;Apicomplexa;Coccidia;Eucoccidiorida;Eimeriidae

Hardwood H4 H4-006-18s 41 98 gb|DQ862047 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Hardwood H4 H4-022-18s 41 98 gb|EU940037 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Pine P1 P1-021-18s 53 99 gb|AY752965 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Pine P1 P1-008-18s 290 99 gb|EU545723 ;

Pine P1 P1-003-18s 102 98 dbj|AB032070 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Pine P1 P1-005-18s 154 98 gb|AY593946 Metazoa;Nematoda;Enoplea;Dorylaimida;Qudsianematidae

Pine P1 P1-007-18s 43 97 gb|FJ358327 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Pine P1 P1-020-18s 41 98 gb|EU940048 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Pine P1 P1-024-18s 41 99 gb|EU940080 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Pine P1 P1-001-18s 288 97 gb|GQ922277 Metazoa;Tardigrada;

Pine P1 P1-004-18s 289 99 gb|EF023503 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

128 Pine P1 P1-018-18s 15 98 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Pine P1 P1-022-18s 60 98 gb|AY654887 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1-017-18s 22 97 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Pine P1 P1-009-18s 60 97 gb|AY654887 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1-002-18s 53 98 gb|AY752965 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Pine P1 P1-013-18s 15 99 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Pine P1 P1-014-18s 53 97 gb|AY752965 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Pine P1 P1-011-18s 43 97 gb|FJ358315 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Pine P1 P1-006-18s 15 97 gb|DQ435798 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Tricholomataceae

Pine P1 P1-010-18s 14 97 gb|EU709188 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Pine P1 P1-015-18s 53 98 gb|AY752965 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Pine P1 P1-019-18s 135 96 gb|AF026583 Fungi;Basidiomycota;Agaricomycetes;Hymenochaetales;Hymenochaetaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P1 P1-023-18s 142 97 gb|FJ866597 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Pine P2 P2-002-NS4 7 99 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-005-NS4 7 98 gb|AY969303 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-010-NS4 7 98 gb|AY969303 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-106-18s 296 71 dbj|AB505573 ;

Pine P2 P2-105-18s 5 97 gb|AY129549 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P2 P2-107-18s 297 94 gb|GQ864271 Metazoa;Arthropoda;Arachnida;Prostigmata;Penthaleidae

Pine P2 P2-113-18s 298 96 gb|DQ234544 Fungi;Basidiomycota;Agaricomycetes;Auriculariales;Hyaloriaceae

Pine P2 P2-119-18s 299 96 gb|EF023364 Metazoa;Arthropoda;Arachnida;Ricinulei;

Pine P2 P2-139-18s 5 97 gb|AY129549 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P2 P2-109-18s 5 99 gb|AY129549 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P2 P2-145-18s 4 97 gb|AF157145 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

129 Pine P2 P2-148-18s 303 96 gb|AF518571 Fungi;Basidiomycota;Agaricomycetes;Polyporales;Lachnocladiaceae

Pine P2 P2-131-18s 302 93 gb|FJ358292 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Pine P2 P2-127-18s 301 98 gb|DQ372928 Metazoa;Platyhelminthes;Turbellaria;Lecithoepitheliata;Prorhynchidae

Pine P2 P2-124-18s 300 95 gb|EF456751 Rhizaria;Cercozoa;Silicofilosea;Euglyphida;Trinematidae

Pine P2 P2-134-18s 39 97 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-013-NS4 7 99 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-135-18s 5 97 gb|EF025003 ;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P2 P2-112-18s 60 97 gb|FJ171732 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2-140-18s 39 98 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-151-18s 39 98 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-015-NS4 7 99 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-120-18s 41 97 gb|EU940030 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P2 P2-115-18s 39 97 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-111-18s 47 98 gb|AY705950 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-118-18s 47 99 gb|AY752972 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-126-18s 47 96 gb|AY705950 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-129-18s 47 96 gb|AY705950 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-137-18s 47 98 gb|AY293125 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-141-18s 47 98 gb|AY705950 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-143-18s 47 97 gb|AY705950 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2-123-18s 39 96 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-099-18s 60 97 gb|FJ171732 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2-022-NS4 41 99 gb|EU940042 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Pine P2 P2-117-18s 60 98 gb|AY654887 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

130 Pine P2 P2-121-18s 60 97 gb|AF334913 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2-144-18s 60 97 gb|AY771600 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2-125-18s 82 98 gb|EF023881 Fungi;Basidiomycota;Tremellomycetes;Tremellales;Tremellaceae

Pine P2 P2-114-18s 90 98 gb|FJ435733 Metazoa;Tardigrada;Eutardigrada;Parachela;Hypsibiidae

Pine P2 P2-136-18s 92 98 gb|EU484211 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Pine P2 P2-138-18s 92 98 gb|EU484211 Fungi;Mucoromycotina;Mucoromycotina;Mucorales;Mucoraceae

Pine P2 P2-102-18s 102 98 dbj|AB474750 Fungi;Ascomycota;

Pine P2 P2-142-18s 104 97 gb|AY620264 Rhizaria;Cercozoa;

Pine P2 P2-110-18s 118 98 gb|AY251102 Fungi;Ascomycota;Dothideomycetes;Capnodiales;

Pine P2 P2-016-NS4 129 99 gb|DQ534693 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillineae

Pine P2 P2-132-18s 135 96 gb|AF026583 Fungi;Basidiomycota;Agaricomycetes;Hymenochaetales;Hymenochaetaceae

Pine P2 P2-147-18s 166 96 gb|AY190271 Fungi;Ascomycota;Sordariomycetes;

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P2 P2-146-18s 49 98 gb|FJ592311 Rhizaria;Cercozoa;

Pine P2 P2-024-NS4 17 96 gb|AY916745 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

Pine P2 P2-021-NS4 7 99 gb|AY969303 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P2 P2-104-18s 295 98 gb|AF372740 Rhizaria;Cercozoa;

Pine P2 P2-018-NS4 294 81 gb|GQ864271 Metazoa;Arthropoda;Arachnida;Prostigmata;Penthaleidae

Pine P2 P2-008-NS4 293 99 gb|EU484206 ;

Pine P2 P2-007-NS4 292 79 gb|AY969267 Fungi;Basidiomycota;

Pine P2 P2-152-18s 41 98 gb|EU940037 Fungi;Ascomycota;Dothideomycetes;Capnodiales;Teratosphaeriaceae

Pine P2 P2-023-NS4 14 98 gb|EU709182 Rhizaria;Cercozoa;Cercozoa;Cercomonadida;Heteromitidae

Pine P2 P2-108-18s 39 98 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-103-18s 17 95 gb|AY916745 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

Pine P2 P2-122-18s 17 95 gb|AY916745 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

131 Pine P2 P2-130-18s 17 96 gb|AY916745 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae

Pine P2 P2-149-18s 28 92 gb|DQ536471 Fungi;Mucoromycotina;Mucoromycotina;Endogonales;Endogonaceae

Pine P2 P2-100-18s 39 97 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-098-18s 39 98 gb|AY707096 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2-004-NS4 291 98 gb|DQ898720 Fungi;Basidiomycota;Agaricomycetes;Corticiales;Corticiaceae

Pine P2 P2-003-NS4 22 95 gb|AY969296 Fungi;Ascomycota;SoilCloneGroupI

Pine P3 P3-002-18s 7 97 gb|AY707093 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-003-18s 7 98 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-011-18s 7 98 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-013-18s 7 98 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-022-18s 7 97 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Pine P3 P3-024-18s 7 98 gb|AY293156 Fungi;Basidiomycota;Agaricomycetes;Russulales;Russulaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P3 P3-001-18s 1 97 gb|DQ444860 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Hygrophoraceae

Pine P3 P3-014-18s 306 96 gb|EU039887 Alveolata;Ciliophora;Colpodea;Bryometopida;Bryometopidae

Pine P3 P3-007-18s 305 87 gb|GQ488261 Metazoa;Arthropoda;Arachnida;Opiliones;Stylocellidae

Pine P3 P3-020-18s 22 96 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Pine P3 P3-016-18s 69 97 gb|GQ995710 Metazoa;Nematoda;Enoplea;Triplonchida;Trichodoridae

Pine P3 P3-023-18s 60 98 gb|FJ171728 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3-015-18s 22 97 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Pine P3 P3-008-18s 22 97 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Pine P3 P3-009-18s 43 97 gb|FJ358327 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Pine P3 P3-006-18s 22 96 gb|EU179936 Fungi;Ascomycota;SoilCloneGroupI

Pine P3 P3-010-18s 5 98 gb|EU428773 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P3 P3-019-18s 307 94 gb|EU736292 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

132 Pine P3 P3-012-18s 5 97 gb|EU688965 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P3 P3-018-18s 47 97 gb|DQ851578 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Bolbitiaceae

Pine P3 P3-021-18s 5 98 gb|AY129549 Fungi;Mucoromycotina;Mucoromycotina;Mortierellales;Mortierellaceae

Pine P3 P3-004-18s 18 97 gb|AF411895 Metazoa;Annelida;Clitellata;Oligochaeta;Haplotaxida

Pine P3 P3-005-18s 304 98 gb|AY284718 Metazoa;Nematoda;Chromadorea;Chromadorida;Cyatholaimidae

Appendix 3: ITS clone libraries from the pine seedling bioassay

The following table lists each ITS sequence generated from the pine seedling bioassay in chapter 3. Plots numbered CC, GC,

HC, and GC represent the autoclaved, composited samples used to identify greenhouse contaminants. The OTU number represents

96% groupings, and is assigned only for this study. OTU numbers in this table do correspond to OTU numbers for ITS sequences

from the field soils in Appendix 1. The %ID is from the top BLAST hit from NCBI’s Genbank, accessed March 2010 (Altschul et al.

1997). Lineage information is according to NCBI’s Taxonomy database.

Treatment Plot Clone Name OTU %ID Accession Lineage

133 Cultivated C1 C1.1-001 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-004 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-005 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-006 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-008 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-010 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-014 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-015 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-017 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-018 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-019 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-023 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C1 C1.2-003 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-004 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-007 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-010 2 97 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-013 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-016 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-021 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-023 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-024 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-003 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.1-007 1 100 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.1-011 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

134 Cultivated C1 C1.1-022 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.2-002 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.2-005 11 100 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.2-006 11 100 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.2-018 1 100 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.2-020 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C1 C1.1-009 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-013 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-016 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-020 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-021 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.1-024 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C1 C1.2-014 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-015 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-019 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-022 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C1 C1.2-008 90 97 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Cultivated C1 C1.1-012 3 98 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Cultivated C1 C1.2-011 3 98 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Cultivated C1 C1.2-012 12 99 gi|219968190|emb|FM866335 Fungi;Basidiomycota;Tremellomycetes;Filobasidiales;Cryptococcus

Cultivated C2 C2.2-001 489 99 gi|169639304|gb|EU497959 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Cultivated C2 C2.1-001 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-002 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-003 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

135 Cultivated C2 C2.1-004 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-005 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-006 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-008 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-009 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-010 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-011 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-012 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-014 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-015 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-016 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-017 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C2 C2.1-018 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-019 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-020 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-021 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-022 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-023 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-024 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-002 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-003 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-004 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-005 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-006 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

136 Cultivated C2 C2.2-007 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-008 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-009 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-010 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-011 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-012 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-013 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-015 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-017 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-019 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-020 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-021 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C2 C2.2-022 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-023 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.1-013 1 97 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C2 C2.2-016 1 100 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C2 C2.1-007 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C2 C2.2-024 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-001 491 100 gi|90102800|gb|DQ421116 Fungi;

Cultivated C3 C3.1-004 35 100 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C3 C3.1-006 35 100 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C3 C3.1-021 35 100 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C3 C3.2-002 35 100 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Cultivated C3 C3.1-008 490 100 gi|197941336|gb|EU910260 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

137 Cultivated C3 C3.1-002 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-003 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-005 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-007 2 97 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-009 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-010 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-011 2 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-012 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-013 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-015 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-016 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-018 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C3 C3.1-019 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-020 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-022 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-023 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-024 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-003 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-004 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-005 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-006 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-007 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-008 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-012 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

138 Cultivated C3 C3.2-013 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-015 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-016 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-017 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-018 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-019 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-020 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-022 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-023 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.2-024 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Cultivated C3 C3.1-001 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C3 C3.2-011 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated C3 C3.2-021 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated C3 C3.2-009 492 98 gi|122703714|dbj|AB290021 Fungi;Basidiomycota;Agaricomycetes;Cantharellales;Ceratobasidiaceae

Cultivated CC CC.2-021 348 100 gi|90102650|gb|DQ420966 Fungi;

Cultivated CC CC.1-003 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-006 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-007 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-008 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-013 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

139 Cultivated CC CC.1-016 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-019 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-024 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-003 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-006 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-011 1 98 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Cultivated CC CC.2-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-016 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-019 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-023 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-024 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-004 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-020 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-007 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.2-010 1 100 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

140 Cultivated CC CC.1-021 1 97 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-010 1 99 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Cultivated CC CC.1-022 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-003 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-005 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-006 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-016 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-017 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-022 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-024 27 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.2-007 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.2-010 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G1 G1.2-012 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.2-022 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-008 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-009 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-010 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

141 Grass G1 G1.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-004 1 97 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-006 1 97 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-014 1 98 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-016 1 97 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-019 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-021 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-023 1 97 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.2-024 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G1 G1.1-001 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-007 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.2-003 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.2-008 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G1 G1.1-012 3 98 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G1 G1.1-021 3 98 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G1 G1.1-023 3 97 gi|82491463|emb|AM109899 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G1 G1.2-013 3 97 gi|82491463|emb|AM109899 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G1 G1.2-015 3 99 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G1 G1.1-013 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G1 G1.1-019 398 99 gi|61657758|emb|AJ633584 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.1-002 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

142 Grass G3 G3.1-005 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-007 27 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-008 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-009 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-010 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-011 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-012 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-015 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-016 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-017 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-019 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-020 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G3 G3.1-023 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-024 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-001 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-003 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-004 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-007 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-008 432 96 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-011 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-012 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-014 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-015 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-017 2 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

143 Grass G3 G3.2-018 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-019 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-020 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-021 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-022 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-023 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-024 27 98 gi|27753448|emb|AJ515426 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-003 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.1-013 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.1-014 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.1-018 11 100 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.2-002 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G3 G3.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.2-006 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.2-009 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.2-010 11 100 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G3 G3.1-001 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-004 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-021 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.1-022 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G3 G3.2-016 432 97 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.1-017 35 98 gi|110951116|gb|DQ826739 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Grass G7 G7.1-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

144 Grass G7 G7.1-006 1 96 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-007 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-013 1 100 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-016 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-021 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-022 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-024 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-003 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G7 G7.2-007 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-010 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-017 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-019 1 98 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.2-022 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass G7 G7.1-003 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

145 Grass G7 G7.1-009 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.1-012 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.1-015 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.1-019 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.2-005 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.2-006 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.2-021 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.2-024 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass G7 G7.2-008 197 97 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass G7 G7.1-002 77 97 gi|87244939|gb|DQ377437 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Grass G7 G7.1-011 77 96 gi|150035628|gb|EF619845 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Grass G7 G7.1-023 77 96 gi|150035628|gb|EF619845 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass G7 G7.2-004 77 96 gi|150035628|gb|EF619845 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Grass G7 G7.2-011 77 96 gi|150035628|gb|EF619845 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Grass G7 G7.2-016 77 97 gi|150035628|gb|EF619845 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Grass G7 G7.2-013 580 100 gi|165988429|gb|EU274619 Viridiplantae;Streptophyta;Embryophyta;Tracheophyta;Oxalidaceae

Grass GC GC.2-001 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass GC GC.2-013 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass GC GC.2-019 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass GC GC.2-020 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass GC GC.2-022 2 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Grass GC GC.1-002 1 98 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-007 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-010 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

146 Grass GC GC.1-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-012 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-018 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-022 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-003 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-007 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-008 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Grass GC GC.2-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-016 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-017 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-021 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.2-024 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-021 197 97 gi|1246340|gb|L54088 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass GC GC.2-004 197 97 gi|1246340|gb|L54088 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

147 Grass GC GC.2-010 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass GC GC.1-015 1 99 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Grass GC GC.1-003 197 96 gi|1246344|gb|L54092 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass GC GC.1-005 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;

Grass GC GC.1-013 197 95 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Grass GC GC.1-019 1 97 gi|38455376|gb|AY456370 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H1 H1.2-009 588 98 gi|90102753|gb|DQ421069 Fungi;

Hardwood H1 H1.1-018 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H1 H1.2-007 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H1 H1.2-024 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H1 H1.2-010 95 97 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H1 H1.2-014 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H1 H1.1-002 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;(Ascomycota);(Ascomycota);(Ascomycota)

Hardwood H1 H1.2-008 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H1 H1.1-001 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-007 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-010 6 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-012 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-013 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-014 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-017 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-020 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-021 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.1-024 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

148 Hardwood H1 H1.2-001 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-004 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-005 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-011 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-012 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-016 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-017 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-018 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-019 2 97 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-020 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-021 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H1 H1.2-022 6 99 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H1 H1.1-004 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.1-008 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.1-011 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.1-015 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.1-019 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.1-023 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.2-002 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.2-006 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.2-013 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.2-015 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H1 H1.2-003 215 97 gi|63408878|gb|AY970032 Fungi;Zygomycota;

Hardwood H2 H2.1-029 188 96 gi|171879756|gb|EU557322 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

149 Hardwood H2 H2.1-044 436 99 gi|78191271|gb|DQ233892 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-008 321 99 gi|63408487|gb|AY969641 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-009 188 97 gi|157086775|gb|EF634067 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-011 321 99 gi|150035428|gb|EF619645 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-017 321 99 gi|63408487|gb|AY969641 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-025 188 96 gi|61657773|emb|AJ633599 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-028 188 97 gi|157086775|gb|EF634067 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-029 188 97 gi|171879756|gb|EU557322 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-043 188 97 gi|157086775|gb|EF634067 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-047 188 96 gi|171879756|gb|EU557322 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Hardwood H2 H2.2-021 610 99 gi|21239409|gb|AF510496 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Hardwood H2 H2.1-020 180 97 gi|187403850|gb|EU649083 Fungi;Ascomycota;Leotiomycetes;Helotiales;Helotiaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2.1-032 180 97 gi|187403850|gb|EU649083 Fungi;Ascomycota;Leotiomycetes;Helotiales;Helotiaceae

Hardwood H2 H2.1-048 180 97 gi|187403850|gb|EU649083 Fungi;Ascomycota;Leotiomycetes;Helotiales;Helotiaceae

Hardwood H2 H2.2-012 405 92 gi|160552291|gb|EU139128 Fungi;Ascomycota;Eurotiomycetes;Chaetothyriales;Herpotrichiellaceae

Hardwood H2 H2.2-014 290 95 gi|204306513|gb|FJ152529 Fungi;Ascomycota;Pezizomycotina;Magnaporthales;Magnaporthaceae

Hardwood H2 H2.2-003 290 95 gi|204306513|gb|FJ152529 Fungi;Ascomycota;Sordariomycetes;Magnaporthales;Magnaporthaceae

Hardwood H2 H2.2-019 290 94 gi|204306513|gb|FJ152529 Fungi;Ascomycota;Pezizomycotina;Magnaporthales;Magnaporthaceae

Hardwood H2 H2.2-020 290 95 gi|204306513|gb|FJ152529 Fungi;Ascomycota;Pezizomycotina;Magnaporthales;Magnaporthaceae

Hardwood H2 H2.1-004 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-005 27 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-006 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-007 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-008 27 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

150 Hardwood H2 H2.1-009 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-010 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-012 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-014 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-016 27 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-017 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-021 27 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-024 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-031 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-033 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-034 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-035 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2.1-038 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-040 27 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-041 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-046 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-047 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-006 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-013 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-015 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-016 6 99 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-022 6 98 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-030 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-032 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

15 Hardwood H2 H2.2-041 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-045 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-046 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-001 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-003 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-013 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-025 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-030 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.1-042 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2.1-043 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-002 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-007 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-026 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-027 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-031 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-034 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-038 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-039 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

152 Hardwood H2 H2.1-002 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-018 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-019 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-022 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-036 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-037 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.1-039 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-010 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-024 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-036 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-040 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H2 H2.2-001 90 98 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H2 H2.1-027 182 98 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-004 182 98 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-035 182 98 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-037 182 98 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-042 182 99 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-044 182 99 gi|210161854|gb|FJ389452 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H2 H2.2-033 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-003 107 91 gi|63408997|gb|AY970151 Metazoa;

Hardwood H4 H4.2-007 107 91 gi|63408997|gb|AY970151 Metazoa;

Hardwood H4 H4.1-004 107 91 gi|63408997|gb|AY970151 Metazoa;

Hardwood H4 H4.1-012 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

Hardwood H4 H4.2-008 95 98 gi|206601305|gb|FJ008038 Fungi;Ascomycota;

153 Hardwood H4 H4.1-007 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-008 6 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-009 27 98 gi|27753448|emb|AJ515426 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-015 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-024 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-003 27 98 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-004 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-005 6 99 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-006 27 97 gi|60203084|gb|AY880943 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-009 6 99 gi|150035529|gb|EF619746 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-024 6 98 gi|18077768|gb|AF058313 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-018 1 97 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood H4 H4.1-019 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H4 H4.1-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H4 H4.1-023 11 99 gi|63408871|gb|AY970025 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H4 H4.2-002 1 97 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood H4 H4.1-006 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-011 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-014 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-016 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.1-021 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-001 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-011 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-013 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

154 Hardwood H4 H4.2-017 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-020 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Hardwood H4 H4.2-018 90 98 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood H4 H4.2-023 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Hardwood HC HC.1-001 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-006 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-007 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-010 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood HC HC.1-014 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-016 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-022 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-005 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-008 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-010 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

155 Hardwood HC HC.2-013 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-016 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-017 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-022 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.2-024 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-013 3 99 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Hardwood HC HC.1-021 3 99 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Hardwood HC HC.1-024 3 99 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Hardwood HC HC.2-011 3 99 gi|150035553|gb|EF619770 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Hardwood HC HC.1-003 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-008 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Hardwood HC HC.2-003 47 98 gi|150035606|gb|EF619823 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-011 1 98 gi|220061844|gb|FJ532478 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Hardwood HC HC.1-019 1 98 gi|220061844|gb|FJ532478 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P1 P1.1-002 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-006 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-007 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-010 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-011 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-012 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-016 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-019 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.1-020 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

156 Pine P1 P1.1-022 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-001 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-004 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-006 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-007 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-008 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-009 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-010 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-011 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-012 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-013 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-014 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P1 P1.2-015 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-020 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-022 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-023 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-024 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P1 P1.2-003 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P1 P1.1-014 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P1 P1.1-018 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P1 P1.1-023 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P1 P1.2-005 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P1 P1.1-001 90 99 gi|63408447|gb|AY969601 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.1-004 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

157 Pine P1 P1.1-008 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.1-013 90 99 gi|63408447|gb|AY969601 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.1-015 90 99 gi|63408447|gb|AY969601 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.1-017 90 99 gi|63408447|gb|AY969601 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.1-021 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.2-016 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P1 P1.2-017 90 98 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g2-001 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g2-002 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g2-008 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g2-010 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g2-015 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P2 P2g2-018 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g2-023 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P2 P2g1-012 321 99 gi|63408487|gb|AY969641 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Pine P2 P2g2-019 188 97 gi|171879756|gb|EU557322 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Pine P2 P2g1-008 195 93 gi|25988453|gb|AF454075 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Pine P2 P2g1-001 195 93 gi|25988453|gb|AF454075 Fungi;Ascomycota;Eurotiomycetes;Eurotiales;Trichocomaceae

Pine P2 P2g1-010 651 99 gi|219523220|gb|FJ475663 Fungi;Ascomycota;Sordariomycetes;Sordariomycetes;Sordariomycetes

Pine P2 P2g1-018 652 96 gi|219812670|gb|FJ552884 Fungi;Ascomycota;

Pine P2 P2g2-005 654 97 gi|219813385|gb|FJ553599 Fungi;Ascomycota;Dothideomycetes;Cenococcum;Cenococcum

Pine P2 P2g2-003 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-006 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-013 197 97 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

158 Pine P2 P2g2-014 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-017 197 97 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-020 197 97 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-021 197 97 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-022 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g2-024 197 98 gi|150035552|gb|EF619769 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine P2 P2g1-002 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2g1-011 256 95 gi|91199887|emb|AM161509 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Amanitaceae

Pine P2 P2g1-003 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-007 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-009 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-019 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P2 P2g1-022 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-023 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-024 196 98 gi|87244925|gb|DQ377423 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine P2 P2g1-005 242 95 gi|186908884|gb|EU668235 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-006 242 94 gi|186908884|gb|EU668235 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-013 242 93 gi|189419315|gb|EU570173 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-015 242 95 gi|186908884|gb|EU668235 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-016 242 95 gi|186908884|gb|EU668235 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-017 242 95 gi|186908884|gb|EU668235 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g2-004 198 94 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g2-007 198 93 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g2-009 198 95 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

159 Pine P2 P2g2-011 198 93 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g2-012 198 93 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g2-016 198 94 gi|150035419|gb|EF619636 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P2 P2g1-004 650 98 gi|83596123|gb|DQ294951 Fungi;Basidiomycota;

Pine P2 P2g1-014 293 93 gi|111608687|gb|DQ822801 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P2 P2g1-020 653 99 gi|219814206|gb|FJ554420 Fungi;Basidiomycota;Agaricomycetes;

Pine P2 P2g1-021 293 94 gi|111608687|gb|DQ822801 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Cortinariaceae

Pine P3 P3.1-001 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-006 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-007 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-010 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-011 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P3 P3.1-014 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-015 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-016 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-017 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-021 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.1-023 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-007 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-012 124 98 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-013 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-014 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-015 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-022 124 99 gi|60203083|gb|AY880942 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

160 Pine P3 P3.2-023 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-024 124 98 gi|219813614|gb|FJ553828 Fungi;Ascomycota;Pezizomycotina;Pezizales;Pyronemataceae

Pine P3 P3.2-020 666 98 gi|63408818|gb|AY969972 Fungi;Ascomycota;

Pine P3 P3.1-019 664 98 gi|98962362|gb|DQ508798 Fungi;Ascomycota;Pezizomycetes;Pezizales;Pyronemataceae

Pine P3 P3.1-022 665 99 gi|37624775|gb|AY394902 Fungi;Ascomycota;Pezizomycotina;

Pine P3 P3.2-019 2 98 gi|118420551|emb|AM412274 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.1-002 4 96 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.1-009 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.1-024 4 97 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.2-016 4 98 gi|121487811|emb|AJ810040 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.2-021 4 97 gi|121487813|emb|AJ810042 Fungi;Basidiomycota;Agaricomycetes;Boletales;Rhizopogonaceae

Pine P3 P3.1-005 90 98 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine P3 P3.1-012 90 98 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.1-020 90 99 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-003 90 99 gi|63408460|gb|AY969614 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-004 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-006 90 97 gi|189098256|gb|EU726283 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-008 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-011 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-017 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine P3 P3.2-018 94 99 gi|150035420|gb|EF619637 Fungi;Basidiomycota;Agaricomycetes;Atheliales;Atheliaceae

Pine PC PC.1-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-004 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-006 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

161 Pine PC PC.1-008 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-015 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-017 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-019 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-020 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-023 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.1-024 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-002 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-003 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-004 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Treatment Plot Clone Name OTU %ID Accession Lineage

Pine PC PC.2-007 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-008 1 98 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-009 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-010 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-011 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-012 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-016 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-017 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-018 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-021 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-023 1 98 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Pine PC PC.2-024 1 99 gi|199594081|gb|FJ013066 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

162 Pine PC PC.1-005 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.1-012 3 97 gi|82491463|emb|AM109899 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.1-018 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.1-021 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.1-022 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-001 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-013 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-014 3 97 gi|82491463|emb|AM109899 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-015 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-019 3 97 gi|82491463|emb|AM109899 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-020 3 98 gi|219813684|gb|FJ553898 Fungi;Basidiomycota;Agaricomycetes;Boletales;Suillaceae

Pine PC PC.2-022 1 98 gi|61657770|emb|AJ633596 Fungi;Basidiomycota;Agaricomycetes;Thelephorales;Thelephoraceae

Appendix 4: Clone libraries for taxon-specific primers

The following table lists each sequence generated from testing the specificity of taxon-specific primers in a soil DNA matrix

for chapter 4. The %ID is from the top BLAST hit from NCBI’s Genbank, accessed March 2006 (Altschul et al. 1997).

Taxa Primer Clone Name % ID Hit Name Accession Number

Amanita sect Amanita aman_ITS1 AM_its1_03 100 Amanita altipes voucher HKAS 36609 internal transcribed spacer 1, gb|AY436445.1|

Amanita sect Amanita aman_ITS1 AM_its1_04 100 Amanita ibotengutake genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S dbj|AB211057.1|

Amanita sect Amanita aman_ITS1 AM_its1_06 100 Fuscoporia ferruginosa 18S ribosomal RNA gene, partial sequence; gb|AY189700.1|

Amanita sect Amanita aman_ITS1 AM_its1_09 100 Fuscoporia ferruginosa 18S ribosomal RNA gene, partial sequence; gb|AY189700.1|

Amanita sect Amanita aman_ITS1 AM_its1_10 100 Amanita ibotengutake genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S dbj|AB211057.1|

Amanita sect Amanita aman_ITS1 AM_its1_12 100 Amanita ibotengutake genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S dbj|AB211057.1|

163 Amanita sect Amanita aman_ITS1 AM_its1_16 100 Amanita altipes voucher HKAS 36609 internal transcribed spacer 1, gb|AY436445.1|

Amanita sect Amanita aman_ITS1 AM_its1_18 100 Amanita altipes voucher HKAS 36609 internal transcribed spacer 1, gb|AY436445.1|

Amanita sect Amanita aman_ITS1 AM_its1_22 100 Amanita altipes voucher HKAS 36609 internal transcribed spacer 1, gb|AY436445.1|

Amanita sect Amanita aman_ITS1 AM_its1_23 100 Amanita ibotengutake genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S dbj|AB211057.1|

Amanita sect Amanita aman_ITS1 AM_its1_27 100 Uncultured Amanitaceae clone K11 18S ribosomal RNA gene, partial gb|DQ273350.1|

Amanita sect Amanita aman_ITS1 AM_its1_35 100 Amanita muscaria 5.8S ribosomal RNA gene, partial sequence; gb|AF438561.1|AF438561

Amanita sect Amanita aman_ITS1 AM_its1_37 100 Uncultured Amanitaceae clone K11 18S ribosomal RNA gene, partial gb|DQ273350.1|

Amanita sect Amanita aman_ITS1 AM_its1_44 100 Amanita muscaria 5.8S ribosomal RNA gene, partial sequence; gb|AF438561.1|AF438561

Amanita sect Amanita aman_ITS1 AM_its1_47 100 Amanita muscaria 5.8S ribosomal RNA gene, partial sequence; gb|AF438561.1|AF438561

Amanita sect Amanita aman_ITS1 AM_its1_48 100 Nitrobacter hamburgensis X14, complete genome gb|CP000319.1|

Amanita sect Amanita aman_ITS1 AM_its1_41 84 Chlorobium tepidum TLS, complete genome gb|AE006470.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Amanita sect Amanita aman_ITS1 AM_its1_30 85 Natronomonas pharaonis DSM 2160 complete genome emb|CR936257.1|

Amanita sect Amanita aman_ITS1 AM_its1_40 85 Natronomonas pharaonis DSM 2160 complete genome emb|CR936257.1|

Amanita sect Amanita aman_ITS1 AM_its1_42 85 Acidovorax sp. JS42, complete genome gb|CP000539.1|

Amanita sect Amanita aman_ITS1 AM_its1_25 91 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_26 91 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_33 91 Agrobacterium tumefaciens str. C58 circular chromosome, sect 162 gb|AE009136.1|

Amanita sect Amanita aman_ITS1 AM_its1_28 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_31 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_32 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_38 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_43 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_45 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

164 Amanita sect Amanita aman_ITS1 AM_its1_46 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Amanita aman_ITS1 AM_its1_01 93 Bacterial species 16S rRNA gene (clone 32-10) dbj|AB211057.1|

Amanita sect Amanita aman_ITS1 AM_its1_14 96 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Amanita aman_ITS1 AM_its1_11 99 Fuscoporia ferruginosa 18S ribosomal RNA gene, partial sequence; gb|AY189700.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_14 100 Amanita punctata genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 26S dbj|AB015693.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_33 100 Uncultured soil fungus clone 133-17 18S ribosomal RNA gene, partial gb|DQ421170.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_48 100 Uncultured soil fungus clone 133-17 18S ribosomal RNA gene, partial gb|DQ421170.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_31 100 Uncultured basidiomycete isolate dfmo1059_210 18S ribosomal RNA gb|AY970190.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_27 91 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_36 91 Cortinarius gracilior voucher TUB 011857 18S ribosomal RNA gene, gb|AY669525.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_34 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_25 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Amanita sect Vaginata Vag_ITS1 Vag_its1_28 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_32 92 Uncultured soil fungus clone 32-22 18S ribosomal RNA gene, partial gb|DQ421315.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_43 94 Agrocybe praecox internal transcribed spacer 1, partial sequence; gb|AF124713.1|AF124713

Amanita sect Vaginata Vag_ITS1 Vag_its1_46 95 Amanita flavipes voucher HKAS 36582 internal transcribed spacer 1, gb|AY436455.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_26 95 Uncultured cf. Hebeloma internal transcribed spacer 1, partial gb|AY097047.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_30 96 Uncultured ectomycorrhizal fungus isolate Orange 18S ribosomal RNA gb|EF031131.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_39 96 Tricholoma sp. Sil2154 internal transcribed spacer 1, partial gb|AF377191.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_42 96 Tricholoma sp. Sil2154 internal transcribed spacer 1, partial gb|AF377191.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_08 96 Inocybe cf. rimosa src514 voucher src514 18S ribosomal RNA gene, gb|DQ974801.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_37 97 Amanita umbrinolutea voucher HKAS 31451 internal transcribed spacer gb|AY436478.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_35 97 Amanita umbrinolutea voucher HKAS 31451 internal transcribed spacer gb|AY436478.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_38 97 Tricholoma sp. Sil2154 internal transcribed spacer 1, partial gb|AF377191.1|

165 Amanita sect Vaginata Vag_ITS1 Vag_its1_40 97 Tricholoma sp. Sil2154 internal transcribed spacer 1, partial gb|AF377191.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_05 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_06 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_13 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_11 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_07 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_09 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_10 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_17 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_21 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_01 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_04 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Amanita sect Vaginata Vag_ITS1 Vag_its1_12 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_15 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_16 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_22 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_23 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_24 97 Amanita atrofusca voucher HKAS 36610 internal transcribed spacer 1, gb|AY436446.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_19 98 Tricholoma sulphureum voucher MC94-023 internal transcribed spacer gb|AY462036.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_47 98 Uncultured Tricholomataceae clone W74 18S ribosomal RNA gene, gb|DQ273428.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_44 98 Uncultured ectomycorrhiza (Amanitaceae) isolate JLP2499 internal gb|DQ377370.1|

Amanita sect Vaginata Vag_ITS1 Vag_its1_45 99 Uncultured basidiomycete isolate dfmo1059_210 18S ribosomal RNA gb|AY970190.1|

Boletales bol_LSU bol_nLSU_16 100 Tricholoma sp. 'TJV 94-134' large-subunit nuclear ribosomal RNA gb|U86672.1|TSU86672

Boletales bol_LSU bol_nLSU_22 100 Camarophyllus aff. pratensis PBM 2752 isolate AFTOL-ID 1682 25S gb|DQ457650.1|

166 Boletales bol_LSU bol_nLSU_10 92 Ramariopsis kunzei isolate BD346 25S large subunit ribosomal RNA gb|DQ284902.1|

Boletales bol_LSU bol_nLSU_14 92 Mycena plumbea isolate AFTOL-ID 1631 25S large subunit ribosomal RNA gb|DQ470813.1|

Boletales bol_LSU bol_nLSU_04 95 Hygrocybe spadicea strain DAOM171030 25S large subunit ribosomal gb|AF261451.1|

Boletales bol_LSU bol_nLSU_03 96 Clavulinopsis helvola 28S ribosomal RNA gene, partial sequence gb|AY586647.1|

Boletales bol_LSU bol_nLSU_08 96 Termitomyces sp. ZA164 isolate AFTOL-ID 1384 25S ribosomal RNA gb|DQ110875.1|

Boletales bol_LSU bol_nLSU_15 96 Aspergillus niger contig An03c0110, complete genome emb|AM270052.1|

Boletales bol_LSU bol_nLSU_21 96 Termitomyces sp. ZA164 isolate AFTOL-ID 1384 25S ribosomal RNA gb|DQ110875.1|

Boletales bol_LSU bol_nLSU_12 97 Termitomyces sp. ZA164 isolate AFTOL-ID 1384 25S ribosomal RNA gb|DQ110875.1|

Boletales bol_LSU bol_nLSU_01 98 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Boletales bol_LSU bol_nLSU_02 98 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Boletales bol_LSU bol_nLSU_07 98 Geoglossum glabrum voucher ANK 1546 large subunit ribosomal RNA gb|AY533015.1|

Boletales bol_LSU bol_nLSU_09 98 Quadrispora sp. Trappe 20012 large subunit ribosomal RNA gene, gb|AF388745.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Boletales bol_LSU bol_nLSU_18 98 Arcangeliella parva 25S large subunit ribosomal RNA gene, partial gb|AF265531.1|AF265531

Boletales bol_LSU bol_nLSU_19 98 Gymnomyces sp. OSC-T14439 25S large subunit ribosomal RNA gene, gb|AF265537.1|AF265537

Boletales bol_LSU bol_nLSU_05 99 Athelia arachnoidea strain 815 25S large subunit ribosomal RNA gb|AF518601.1|

Boletales bol_LSU bol_nLSU_06 99 Arcangeliella parva 25S large subunit ribosomal RNA gene, partial gb|AF265531.1|AF265531

Boletales bol_LSU bol_nLSU_11 99 Uncultured ectomycorrhiza (Thelephoraceae) 4082 large subunit gb|AY634147.1|

Boletales bol_LSU bol_nLSU_13 99 Stropharia squamosa 28S large subunit ribosomal RNA gene, partial gb|AY207302.1|

Boletales bol_LSU bol_nLSU_17 99 Gloiodon nigrescens 5.8S ribosomal RNA gene, partial sequence; gb|AF506450.1|

Boletales bol_LSU bol_nLSU_20 99 Athelia arachnoidea strain 815 25S large subunit ribosomal RNA gb|AF518601.1|

Boletales bol_LSU bol_nLSU_23 99 Cortinarius sodagnitus isolate AFTOL-ID 811 25S ribosomal RNA gene, gb|AY684151.1|

Boletales bol_LSU bol_nLSU_24 99 Russula radicans 25S large subunit ribosomal RNA gene, partial gb|AF218547.1|AF218547

Cenococcum ceno_ITS2 cenocc_its2_01 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_03 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

167 Cenococcum ceno_ITS2 cenocc_its2_05 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_06 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_10 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_11 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_14 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_17 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_23 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_24 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_02 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_08 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_12 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_13 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Cenococcum ceno_ITS2 cenocc_its2_15 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Cenococcum ceno_ITS2 cenocc_its2_18 99 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Euagaric euag_LSU5 euag_nLSU5_09 75 Cystoderma amianthinum 28S large subunit ribosomal RNA gene, gb|DQ071703.1|

Euagaric euag_LSU5 euag_nLSU5_10 85 Tricholoma aestuans isolate AFTOL-ID 497 25S large subunit gb|AY700197.1|

Euagaric euag_LSU5 euag_nLSU5_02 95 Leucopaxillus albissimus strain DAOM182713 25S large subunit gb|AF261393.1|

Euagaric euag_LSU5 euag_nLSU5_05 95 Campanella sp. RV98/79 25S large subunit ribosomal RNA gene, gb|AF261340.1|

Euagaric euag_LSU5 euag_nLSU5_11 95 Xeromphalina brunneola strain TENN1179 25S large subunit ribosomal gb|AF261468.1|

Euagaric euag_LSU5 euag_nLSU5_13 97 Caripia montagnei strain JMCR.143 25S large subunit ribosomal RNA gb|AF261327.1|

Euagaric euag_LSU5 euag_nLSU5_16 98 Hygrocybe virginea isolate AFTOL-ID 472 25S large subunit ribosomal gb|AY700201.1|

Euagaric euag_LSU5 euag_nLSU5_19 98 Chlorophyllum agaricoides isolate AFTOL-ID 440 25S large subunit gb|AY700187.1|

Euagaric euag_LSU5 euag_nLSU5_20 98 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Euagaric euag_LSU5 euag_nLSU5_24 98 Amanita fulva large subunit ribosomal RNA gene, partial sequence gb|AF097373.1|AF097373

168 Euagaric euag_LSU5 euag_nLSU5_04 99 Leucocoprinus birnbaumii 28S large subunit ribosomal RNA gene, gb|AY207227.1|

Euagaric euag_LSU5 euag_nLSU5_06 99 Crepidotus sp. MCA 717 25S ribosomal RNA gene, partial sequence gb|AF367953.1|

Euagaric euag_LSU5 euag_nLSU5_07 99 Cortinarius alboviolaceus strain IB19950329 large subunit ribosomal gb|AY033136.1|

Euagaric euag_LSU5 euag_nLSU5_08 99 Cortinarius caperatus strain G96/3 25S large subunit ribosomal RNA gb|AF261497.1|

Euagaric euag_LSU5 euag_nLSU5_12 99 Cortinarius badiovinaceus IB19950278 large subunit ribosomal RNA gb|AF388786.1|

Euagaric euag_LSU5 euag_nLSU5_14 99 Rhodocollybia butyracea f. asema 28S large subunit ribosomal RNA gb|AY207163.1|

Euagaric euag_LSU5 euag_nLSU5_15 99 Gymnopus peronatus large subunit ribosomal RNA gene, partial gb|AF223173.1|

Euagaric euag_LSU5 euag_nLSU5_18 99 Leucocoprinus birnbaumii 28S large subunit ribosomal RNA gene, gb|AY207227.1|

Euagaric euag_LSU5 euag_nLSU5_21 99 Rhodocollybia butyracea f. asema 28S large subunit ribosomal RNA gb|AY207163.1|

Euagaric euag_LSU5 euag_nLSU5_22 99 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Euagaric euag_LSU5 euag_nLSU5_23 99 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Lycoperdales lyco_LSU lyco_nLSU_03 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Lycoperdales lyco_LSU lyco_nLSU_04 100 Saccharopolyspora erythraea NRRL2338 complete genome emb|AM420293.1|

Lycoperdales lyco_LSU lyco_nLSU_06 100 Bacteriophage N15 telomerase (telN) and secondary immunity gb|U63086.1|BNU63086

Lycoperdales lyco_LSU lyco_nLSU_07 100 Neosartorya fischeri NRRL 181 M protein repeat protein ref|XM_001264921.1|

Lycoperdales lyco_LSU lyco_nLSU_08 100 Zea mays subsp. parviglumis P-like protein (P-like) gene, exon 3 gb|AF210618.1|AF210619S2

Lycoperdales lyco_LSU lyco_nLSU_14 100 Desulfovibrio desulfuricans G20, complete genome gb|CP000112.1|

Lycoperdales lyco_LSU lyco_nLSU_15 100 Desulfovibrio desulfuricans G20, complete genome gb|CP000112.1|

Lycoperdales lyco_LSU lyco_nLSU_16 100 Bacteriophage N15 telomerase (telN) and secondary immunity gb|U63086.1|BNU63086

Lycoperdales lyco_LSU lyco_nLSU_18 100 Bacteriophage N15 telomerase (telN) and secondary immunity gb|U63086.1|BNU63086

Lycoperdales lyco_LSU lyco_nLSU_19 100 Saccharopolyspora erythraea NRRL2338 complete genome emb|AM420293.1|

Lycoperdales lyco_LSU lyco_nLSU_20 100 Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 dbj|AP008213.1|

Lycoperdales lyco_LSU lyco_nLSU_21 100 Saccharopolyspora erythraea NRRL2338 complete genome emb|AM420293.1|

Lycoperdales lyco_LSU lyco_nLSU_22 100 Mus musculus dynein, axonemal, heavy chain 8 (Dnahc8), mRNA ref|NM_013811.2|

169 Lycoperdales lyco_LSU lyco_nLSU_12 81 Uncultured ectomycorrhiza (Cenococcum geophilum) clone SWUBC867 18S gb|DQ474378.1|

Lycoperdales lyco_LSU lyco_nLSU_13 96 Crimean-Congo hemorrhagic fever virus strain AP92 segment L, complete gb|DQ211612.1|

Lycoperdales lyco_LSU lyco_nLSU_01 97 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Lycoperdales lyco_LSU lyco_nLSU_11 98 Cenococcum geophilum isolate cl2.19 18S ribosomal RNA gene, partial gb|AY394919.1|

Lycoperdales lyco_LSU lyco_nLSU_02 99 Caripia montagnei strain JMCR.143 25S large subunit ribosomal RNA gb|AF261327.1|

Mycena myc_ITS1 Myc_its1_05 100 Uncultured Russulaceae isolate IT1B-10r internal transcribed gb|DQ061931.1|

Mycena myc_ITS1 Myc_its1_31 88 Hohenbuehelia petalodes strain T-104 18S ribosomal RNA gene, gb|AF139956.2|

Mycena myc_ITS2 myc_its2_01 92 Uncultured fungus clone TD2_OTU150 small subunit ribosomal RNA gene, gb|EF434073.1|

Mycena myc_ITS2 myc_its2_13 92 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS1 Myc_its1_37 93 Leucoagaricus melanotrichus internal transcribed spacer 1, partial gb|AY176417.1|

Mycena myc_ITS2 myc_its2_10 93 Mycena cf. epipterygia F15203 18S ribosomal RNA gene, partial gb|DQ384586.1|

Mycena myc_ITS1 Myc_its1_26 94 Uncultured fungus clone F1-21 18S ribosomal RNA gene, partial gb|DQ054572.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Mycena myc_ITS1 Myc_its1_44 94 Uncultured fungus clone F1-21 18S ribosomal RNA gene, partial gb|DQ054572.1|

Mycena myc_ITS2 myc_its2_09 95 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS1 Myc_its1_34 96 Cortinarius fulvocitrinus voucher TF2001-045 18S ribosomal RNA gb|DQ083785.1|

Mycena myc_ITS1 Myc_its1_47 96 Uncultured fungus clone F1-21 18S ribosomal RNA gene, partial gb|DQ054572.1|

Mycena myc_ITS2 myc_its2_02 96 Uncultured fungus clone TD2_OTU150 small subunit ribosomal RNA gene, gb|EF434073.1|

Mycena myc_ITS2 myc_its2_05 96 Uncultured fungus clone TD2_OTU150 small subunit ribosomal RNA gene, gb|EF434073.1|

Mycena myc_ITS2 myc_its2_11 97 Uncultured fungus clone TD2_OTU150 small subunit ribosomal RNA gene, gb|EF434073.1|

Mycena myc_ITS1 Myc_its1_12 98 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_20 98 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_25 98 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_33 98 Uncultured basidiomycete isolate dfmo0723_040 18S ribosomal RNA gb|AY969697.1|

Mycena myc_ITS1 Myc_its1_35 98 Uncultured basidiomycete isolate dfmo0723_040 18S ribosomal RNA gb|AY969697.1|

170 Mycena myc_ITS1 Myc_its1_40 98 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_45 98 Uncultured fungus clone F3-39 18S ribosomal RNA gene, partial gb|DQ054563.1|

Mycena myc_ITS1 Myc_its1_48 98 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS2 myc_its2_18 98 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_19 98 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_21 98 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_22 98 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_24 98 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS1 Myc_its1_01 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_02 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_03 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_04 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Mycena myc_ITS1 Myc_its1_07 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_09 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_10 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_11 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_14 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_15 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_17 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_18 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_27 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_28 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_29 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_30 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

171 Mycena myc_ITS1 Myc_its1_32 99 Uncultured basidiomycete isolate dfmo0726_079 18S ribosomal RNA gb|AY969982.1|

Mycena myc_ITS1 Myc_its1_36 99 Uncultured basidiomycete isolate dfmo0723_092 18S ribosomal RNA gb|AY969732.1|

Mycena myc_ITS1 Myc_its1_38 99 Uncultured fungus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, emb|AM260817.1|

Mycena myc_ITS1 Myc_its1_39 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_41 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_42 99 Uncultured basidiomycete isolate dfmo0723_092 18S ribosomal RNA gb|AY969732.1|

Mycena myc_ITS1 Myc_its1_43 99 Leucoagaricus fragilissimus internal transcribed spacer 1, partial gb|U85324.1|LFU85324

Mycena myc_ITS1 Myc_its1_46 99 Laccaria trichodermophora isolate tri42523 18S ribosomal RNA gene, gb|DQ149868.1|

Mycena myc_ITS2 myc_its2_03 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS2 myc_its2_04 99 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_06 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS2 myc_its2_07 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Mycena myc_ITS2 myc_its2_08 99 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Mycena myc_ITS2 myc_its2_12 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS2 myc_its2_14 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS2 myc_its2_15 99 Mycena rutilanthiformis isolate JM96/26 25S large subunit ribosomal gb|AF042606.1|

Mycena myc_ITS2 myc_its2_23 99 Mycena pura 28S large subunit ribosomal RNA gene, partial sequence gb|AF291347.1|

Russulaceae russ_LSU Russ_nLSU_04 89 Trechispora nivea 28S ribosomal RNA gene, partial sequence gb|AY586720.1|

Russulaceae russ_LSU Russ_nLSU_11 92 Hygrocybe spadicea strain DAOM171030 25S large subunit ribosomal gb|AF261451.1|

Russulaceae russ_LSU Russ_nLSU_10 93 Hygrocybe spadicea strain DAOM171030 25S large subunit ribosomal gb|AF261451.1|

Russulaceae russ_LSU Russ_nLSU_21 93 Montagnea radiosa strain EK13 25S large subunit ribosomal RNA gene, gb|AF261480.1|

Russulaceae russ_LSU Russ_nLSU_20 95 Pseudotomentella ochracea large subunit ribosomal RNA gene, partial gb|AF092847.1|AF092847

Russulaceae russ_LSU Russ_nLSU_08 96 Gymnomyces redolens 25S large subunit ribosomal RNA gene, partial gb|AF265536.1|AF265536

Russulaceae russ_LSU Russ_nLSU_17 96 Gymnomyces redolens 25S large subunit ribosomal RNA gene, partial gb|AF265536.1|AF265536

172 Russulaceae russ_LSU Russ_nLSU_07 97 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Russulaceae russ_LSU Russ_nLSU_12 97 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Russulaceae russ_LSU Russ_nLSU_13 97 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Russulaceae russ_LSU Russ_nLSU_01 98 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Russulaceae russ_LSU Russ_nLSU_03 98 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Russulaceae russ_LSU Russ_nLSU_06 98 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Russulaceae russ_LSU Russ_nLSU_15 98 Tricholoma apium voucher EL37-99 5.8S ribosomal RNA gene, partial gb|DQ389736.1|

Russulaceae russ_LSU Russ_nLSU_18 98 Russula emetica voucher UE05.10.2003-11 18S ribosomal RNA gene, gb|DQ421997.1|

Russulaceae russ_LSU Russ_nLSU_23 98 Russula nauseosa strain SJ97015 5.8S ribosomal RNA gene, partial gb|AF506462.1|

Russulaceae russ_LSU Russ_nLSU_24 98 Russula aff. sapinea UE2005.09.07-03 18S ribosomal RNA gene, partial gb|DQ422031.1|

Russulaceae russ_LSU Russ_nLSU_02 99 Lactarius deceptivus isolate AFTOL-ID 682 25S large subunit ribosomal gb|AY631899.1|

Russulaceae russ_LSU Russ_nLSU_09 99 Anamika lactariolens 25S ribosomal RNA gene, partial sequence gb|AY818353.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Russulaceae russ_LSU Russ_nLSU_14 99 Lactarius leonis strain SJ91016 5.8S ribosomal RNA gene, partial gb|AF506411.1|

Russulaceae russ_LSU Russ_nLSU_16 99 Anamika lactariolens 25S ribosomal RNA gene, partial sequence gb|AY818353.1|

Russulaceae russ_LSU Russ_nLSU_19 99 Anamika lactariolens 25S ribosomal RNA gene, partial sequence gb|AY818353.1|

Russulaceae russ_LSU Russ_nLSU_22 99 Cortinarius laetus IB19990518 large subunit ribosomal RNA gene, gb|AF388776.1|

Salal root associate helo_its3 helo_nLSU_02 100 Roesleria subterranea strain CBS 271.82 18S ribosomal RNA gene, gb|EF060309.1|

Salal root associate helo_its4 helo_nLSU_03 100 Sporobolomyces lactosus genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, dbj|AB038132.1|

Salal root associate helo_its5 helo_nLSU_04 100 Solanum lycopersicum genomic DNA, chromosome 8, clone: C08SLm0023K18, dbj|AP009323.1|

Salal root associate helo_its7 helo_nLSU_06 100 Pan troglodytes BAC clone CH251-480J2 from chromosome 7, complete gb|AC187622.2|

Salal root associate helo_its8 helo_nLSU_07 100 Fungal sp. V-Teta2 internal transcribed spacer 1, partial sequence; gb|DQ068357.1|

Salal root associate helo_its13 helo_nLSU_14 100 Hymenoscyphus sp. HB7034 18S ribosomal RNA gene, partial sequence; gb|DQ431179.1|

Salal root associate helo_its20 helo_nLSU_22 100 Heyderia abietis strain HMAS71954 internal transcribed spacer 1, gb|AY789297.1|

Salal root associate helo_its21 helo_nLSU_23 100 Hymenoscyphus sp. HB7034 18S ribosomal RNA gene, partial sequence; gb|DQ431179.1|

173 Salal root associate helo_its6 helo_nLSU_05 9 Bradyrhizobium japonicum USDA 110 DNA, complete genome dbj|BA000040.2|

Salal root associate helo_its14 helo_nLSU_15 9 Mycobacterium avium 104, complete genome gb|CP000479.1|

Salal root associate helo_its9 helo_nLSU_10 81 Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome dbj|AP008229.1|

Salal root associate helo_its22 helo_nLSU_24 81 Suillus luteus 28S ribosomal RNA gene, partial sequence gb|AY586715.1|

Salal root associate helo_its15 helo_nLSU_16 82 Solibacter usitatus Ellin6076, complete genome gb|CP000473.1|

Salal root associate helo_its11 helo_nLSU_12 85 Herminiimonas arsenicoxydans chromosome, complete sequence emb|CU207211.1|

Salal root associate helo_its12 helo_nLSU_13 89 Geobacter metallireducens GS-15, complete genome gb|CP000148.1|

Salal root associate helo_its2 helo_nLSU_01 91 Acidobacteria bacterium Ellin345, complete genome gb|CP000360.1|

Salal root associate helo_its17 helo_nLSU_18 91 Moss transformation vector p35S-Zeo, complete sequence gb|EF451822.1|

Salal root associate helo_its16 helo_nLSU_17 93 Plectosphaera eucalypti strain CBS 120063 18S ribosomal RNA gene, gb|DQ923538.1|

Salal root associate helo_its18 helo_nLSU_19 93 Bacterial species 16S rRNA gene (clone 32-10) gb|EF093155.1|

Salal root associate helo_its10 helo_nLSU_11 96 Myxococcus xanthus DK 1622, complete genome gb|CP000113.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Salal root associate helo_its19 helo_nLSU_20 96 Shewanella loihica PV-4, complete genome gb|CP000606.1|

Suilloid Boletales suill_ITS1 suill_its1_31 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_33 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_34 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_37 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_43 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_48 100 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its2_03 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_05 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

Suilloid Boletales suill_ITS1 suill_its2_06 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_07 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

Suilloid Boletales suill_ITS1 suill_its2_12 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

174 Suilloid Boletales suill_ITS1 suill_its2_13 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_15 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

Suilloid Boletales suill_ITS1 suill_its2_16 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

Suilloid Boletales suill_ITS1 suill_its2_17 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_18 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_19 100 Uncultured basidiomycete isolate dfmo0690_152 18S ribosomal RNA gb|AY969587.1|

Suilloid Boletales suill_ITS1 suill_its2_20 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_22 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its2_24 100 Suillus tomentosus 18S ribosomal RNA gene, partial sequence; gb|EF458018.1|

Suilloid Boletales suill_ITS1 suill_its1_46 81 Uncultured ectomycorrhiza (Amanitaceae) isolate JLP2499 internal gb|DQ377370.1|

Suilloid Boletales suill_ITS1 suill_its2_23 87 Methylococcus capsulatus str. Bath, complete genome gb|AE017282.2|

Suilloid Boletales suill_ITS1 suill_its1_28 94 Uncultured ectomycorrhizal fungus genes for ITS1, 5.8S rRNA, ITS2, dbj|AB251817.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Suilloid Boletales suill_ITS1 suill_its1_35 95 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 suill_its1_44 95 Suillus cothurnatus 18S rRNA gene, 5.8S rRNA gene, 28S rRNA gene, emb|AJ419218.1|SCO419218

Suilloid Boletales suill_ITS1 Suill_its1_03 98 Suillus variegatus isolate CCMA-58 18S ribosomal RNA gene, partial gb|AY898622.1|

Suilloid Boletales suill_ITS1 Suill_its1_04 98 Suillus sp. WT 5.8S rRNA gene, ITS1 and ITS2, isolate WT emb|AM502982.1|

Suilloid Boletales suill_ITS1 Suill_its1_06 98 Uncultured ectomycorrhizal fungus ITS1, 5.8S rRNA gene and ITS2, emb|AM412274.1|

Suilloid Boletales suill_ITS1 Suill_its1_07 98 Suillus sp. WT 5.8S rRNA gene, ITS1 and ITS2, isolate WT emb|AM502982.1|

Suilloid Boletales suill_ITS1 suill_its1_32 99 Uncultured ectomycorrhizal fungus ITS1, 5.8S rRNA gene and ITS2, emb|AM412274.1|

Suilloid Boletales suill_ITS1 suill_its2_04 99 Suillus luteus 28S ribosomal RNA gene, partial sequence gb|AY612825.1|

Suilloid Boletales suill_ITS1 suill_its2_08 99 Suillus luteus 28S ribosomal RNA gene, partial sequence gb|AY612825.1|

Thelephoraceae thel_ITS1 thel_its1_26 100 Uncultured mycorrhizal fungus RUSSUL08 18S ribosomal RNA gene, gb|AY656946.1|

Thelephoraceae thel_ITS1 thel_its1_28 100 Uncultured ectomycorrhiza (Thelephoraceae) 5.8S rRNA gene, 28S rRNA emb|AJ893325.1|

Thelephoraceae thel_ITS1 thel_its1_36 100 Artomyces microsporus voucher A.Fraiture2943 18S ribosomal RNA gb|DQ449944.1|

175 Thelephoraceae thel_ITS1 thel_its1_39 100 Uncultured Tomentella sp. 5.8S rRNA gene, 18S rRNA gene, 28S rRNA emb|AJ581544.1|UTO581544

Thelephoraceae thel_ITS1 thel_its1_40 100 Uncultured basidiomycete isolate dfmo0725_100 18S ribosomal RNA gb|AY969899.1|

Thelephoraceae thel_ITS1 thel_its1_45 100 Uncultured ectomycorrhiza (Thelephoraceae) 18S rRNA gene emb|AM113451.1|

Thelephoraceae thel_ITS1 thel_its1_30 83 Pelobacter carbinolicus DSM 2380, complete genome gb|CP000142.2|

Thelephoraceae thel_ITS1 thel_its1_27 92 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_34 94 Russula olivacea 18S ribosomal RNA gene, partial sequence; internal gb|AF418635.1|

Thelephoraceae thel_ITS1 thel_its1_37 94 Russula olivacea 18S ribosomal RNA gene, partial sequence; internal gb|AF418635.1|

Thelephoraceae thel_ITS1 thel_its1_43 94 Uncultured fungus clone C17_OTU29 small subunit ribosomal RNA gene, gb|EF433973.1|

Thelephoraceae thel_ITS1 thel_its1_25 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_29 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_35 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_41 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Taxa Primer Clone Name % ID Hit Name Accession Number

Thelephoraceae thel_ITS1 thel_its1_42 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_46 95 Uncultured basidiomycete isolate dfmo0726_042 18S ribosomal RNA gb|AY969947.1|

Thelephoraceae thel_ITS1 thel_its1_31 98 Russula basifurcata voucher src553 18S ribosomal RNA gene, partial gb|DQ974829.1|

Thelephoraceae thel_ITS1 thel_its1_32 98 Russula basifurcata voucher src553 18S ribosomal RNA gene, partial gb|DQ974829.1|

Thelephoraceae thel_ITS1 thel_its1_44 98 Uncultured mycorrhizal fungus RUSSUL08 18S ribosomal RNA gene, gb|AY656946.1|

Thelephoraceae thel_ITS1 thel_its1_47 98 Russula basifurcata voucher src553 18S ribosomal RNA gene, partial gb|DQ974829.1|

Thelephoraceae thel_ITS1 thel_its1_38 99 Tomentella cinerascens ITS1, 5.8S ribosomal RNA gene, and ITS2, gb|U83483.1|TCU83483

176

References . Allen, H. L., T. R. Fox, and R. G. Campbell. 2005. What is ahead for intensive pine plantation silviculture in the south? Southern Journal of Applied Forestry 29:62- 69. Allen, M. F., W. Swenson, J. I. Querejeta, L. M. Egerton-Warburton, and K. K. Treseder. 2003. Ecology of mycorrhizae: A conceptual framework for complex interactions among plants and fungi. Annual Review of Phytopathology 41:271-303. Allison, S. D., C. A. Hanson, and K. K. Treseder. 2007. Nitrogen fertilization reduces diversity and alters community structure of active fungi in boreal ecosystems. Soil Biology & Biochemistry 39:1878-1887. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25:3389-3402. Anderson, I. C., C. D. Campbell, and J. I. Prosser. 2003. Potential bias of fungal 18S rDNA and internal transcribed spacer polymerase chain reaction primers for estimating fungal biodiversity in soil. Environmental Microbiology 5:36-47. Arya, M., I. S. Shergill, M. Williamson, L. Gommersall, N. Arya, and H. R. H. Patel. 2005. Basic principles of real-time quantitative PCR. Expert Review of Molecular Diagnostics 5:209-219. Avis, P. G. and I. Charvat. 2005. The response of ectomycorrhizal fungal inoculum to long-term increases in nitrogen supply. Mycologia 97:329-337. Baar, J., T. R. Horton, A. M. Kretzer, and T. D. Bruns. 1999. Mycorrhizal colonization of Pinus muricata from resistant propagules after a stand-replacing wildfire. New Phytologist 143:409-418. Bailly, J., L. Fraissinet-Tachet, M. C. Verner, J. C. Debaud, M. Lemaire, M. Wesolowski- Louvel, and R. Marmeisse. 2007. Soil eukaryotic functional diversity, a metatranscriptomic approach. Isme Journal 1:632-642. Baldauf, S. L. 2008. An overview of the phylogeny and diversity of eukaryotes. Journal of Systematics and Evolution 46:263-273. Bidartondo, M. I., J. Baar, and T. D. Bruns. 2001. Low ectomycorrhizal inoculum potential and diversity from soils in and near ancient forests of bristlecone pine (Pinus longaeva). Canadian Journal of Botany-Revue Canadienne De Botanique 79:293-299.

177

Bois, G., Y. Piche, M. Y. P. Fung, and D. P. Khasa. 2005. Mycorrhizal inoculum potentials of pure reclamation materials and revegetated tailing sands from the Canadian oil sand industry. Mycorrhiza 15:149-158. Broeckling, C. D., A. K. Broz, J. Bergelson, D. K. Manter, and J. M. Vivanco. 2008. Root Exudates Regulate Soil Fungal Community Composition and Diversity. Appl. Environ. Microbiol. 74:738-744. Brundrett, M. C. and L. K. Abbott. 1994. Mycorrhizal fungus propagules in the Jarrah forest .1. Seasonal study of inoculum levels. New Phytologist 127:539-546. Bruns, T. D. 1995. Thoughts on the Processes That Maintain Local Species-Diversity of Ectomycorrhizal Fungi. Plant and Soil 170:63-73. Bruns, T. D., K. G. Peay, P. J. Boynton, L. C. Grubisha, N. A. Hynson, N. H. Nguyen, and N. P. Rosenstock. 2009. Inoculum potential of Rhizopogon spores increases with time over the first 4 yr of a 99-yr spore burial experiment. New Phytologist 181:463-470. Buckley, D. H. and T. M. Schmidt. 2001. The structure of microbial communities in soil and the lasting impact of cultivation. Microbial Ecology 42:11-21. Buee, M., M. Reich, C. Murat, E. Morin, R. H. Nilsson, S. Uroz, and F. Martin. 2009. 454 Pyrosequencing analyses of forest soils reveal an unexpectedly high fungal diversity. New Phytologist 184:449-456. Callaham, M. A., D. D. Richter, D. C. Coleman, and M. Hofmockel. 2006. Long-term land-use effects on soil invertebrate communities in Southern Piedmont soils, USA. European Journal of Soil Biology 42:S150-S156. Cannon, P. F. and P. M. Kirk. 2007. Fungal Families of the World. CAB International, Cambridge,MA. Chao, A., R. K. Colwell, C. W. Lin, and N. J. Gotelli. 2009. Sufficient sampling for asymptotic minimum species richness estimators. Ecology 90:1125-1133. Chauvat, M., A. S. Zaitsev, and V. Wolters. 2003. Successional changes of Collembola and soil microbiota during forest rotation. Oecologia 137:269-276. Christensen, N. L. and R. K. Peet. 1984. Convergence during secondary forest succession. Journal of Ecology 72:25-36. Clements, F. E. 1936. Nature and structure of the climax. Journal of Ecology 24:252-284. Cline, E. T., J. F. Ammirati, and R. L. Edmonds. 2005. Does proximity to mature trees influence ectomycorrhizal fungus communities of Douglas-fir seedlings? New Phytologist 166:993-1009.

178

Colwell, R. K. 1994-2004. EstimateS: Statistical estimation of species richness and shared species from samples. Connell, J. H. and R. O. Slatyer. 1977. Mechanisms of succession in natural communities and their role in community stability and organization. American Naturalist 111:1119-1144. Cowles, H. C. 1899. Ecological relation of the vegetation on sand dunes of Lake Michigan. Botanical Gazette 27:95-117. de Boer, W., L. B. Folman, R. C. Summerbell, and L. Boddy. 2005. Living in a fungal world: impact of fungi on soil bacterial niche development. Fems Microbiology Reviews 29:795-811. Deacon, J. 2005. Fungal Biology. 4th edition. Blackwell Publishing, Malden, MA. Deacon, L. J., E. J. Pryce-Miller, J. C. Frankland, B. W. Bainbridge, P. D. Moore, and C. H. Robinson. 2006. Diversity and function of decomposer fungi from a grassland soil. Soil Biology & Biochemistry 38:7-20. Dickie, I. A., N. Bolstridge, J. A. Cooper, and D. A. Peltzer. 2010. Co-invasion by Pinus and its mycorrhizal fungi. New Phytologist 187:475-484. Dickie, I. A. and P. B. Reich. 2005. Ectomycorrhizal fungal communities at forest edges. Journal of Ecology 93:244-255. Dodd, S. L., R. A. Hill, and A. Stewart. 2000. Control of Athelia rolfsii disease on lentil seedlings using 6-pentyl-alpha-pyrone. Soil Biology & Biochemistry 32:1033- 1034. Edwards, I. P., J. L. Cripliver, A. R. Gillespie, K. H. Johnsen, M. Scholler, and R. F. Turco. 2004. Nitrogen availability alters macrofungal basidiomycete community structure in optimally fertilized loblolly pine forests. New Phytol 162:755-770. Egler, F. E. 1954. Vegetation science concepts I. Initial floristic compostion - a factor in old-field vegetation development. Vegetatio 4:412-417. Fahey, T. J., T. G. Siccama, C. T. Driscoll, G. E. Likens, J. Campbell, C. E. Johnson, J. J. Battles, J. D. Aber, J. J. Cole, M. C. Fisk, P. M. Groffman, S. P. Hamburg, R. T. Holmes, P. A. Schwarz, and R. D. Yanai. 2005. The biogeochemistry of carbon at Hubbard Brook. Biogeochemistry 75:109-176. Fierer, N., J. A. Jackson, R. Vilgalys, and R. B. Jackson. 2005. Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays. Applied and Environmental Microbiology 71:4117-4120. Fierer, N., M. S. Strickland, D. Liptzin, M. A. Bradford, and C. C. Cleveland. 2009. Global patterns in belowground communities. Ecology Letters 12:1238-1249. 179

Foster, D., F. Swanson, J. Aber, I. Burke, N. Brokaw, D. Tilman, and A. Knapp. 2003. The importance of land-use legacies to ecology and conservation. BioScience 53:77-88. Fox, T. R., E. J. Jokela, and H. L. Allen. 2007. The development of pine plantation silviculture in the southern United States. Journal of Forestry 105:337-347. Fraterrigo, J. M., M. G. Turner, S. M. Pearson, and P. Dixon. 2005. Effects of past land use on spatial heterogeneity of soil nutrients in Southern Appalachian forests. Ecological Monographs 75:215-230. Fulthorpe, R. R., L. F. W. Roesch, A. Riva, and E. W. Triplett. 2008. Distantly sampled soils carry few species in common. Isme Journal 2:901-910. Gardes, M. and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes - Application to the identification of mycorrhizae and rusts. Molecular Ecology 2:113-118. Geml, J., G. A. Laursen, I. C. Herriott, J. M. McFarland, M. G. Booth, N. Lennon, H. C. Nusbaum, and D. L. Taylor. 2010. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota). New Phytologist 187:494-507. Gleason, H. A. 1927. Further views on the succession-concept. Ecology 8:299-326. Gotelli, N. J. and G. L. Entsminger. 2000. EcoSim: Null models software for ecology. Acquired Intelligence Inc. & Kesey-Bear. Grandy, A. S., M. S. Strickland, C. L. Lauber, M. A. Bradford, and N. Fierer. 2009. The influence of microbial communities, management, and soil texture on soil organic matter chemistry. Geoderma 150:278-286. Green, J. L., A. J. Holmes, M. Westoby, I. Oliver, D. Briscoe, M. Dangerfield, M. Gillings, and A. J. Beattie. 2004. Spatial scaling of microbial eukaryote diversity. 432:747- 750. Hanson, C. A., S. D. Allison, M. A. Bradford, M. D. Wallenstein, and K. K. Treseder. 2008. Fungal taxa target different carbon sources in forest soil. Ecosystems 11:1157-1167. Hartmann, M., S. Lee, S. J. Hallam, and W. W. Mohn. 2009. Bacterial, archaeal and eukaryal community structures throughout soil horizons of harvested and naturally disturbed forest stands. Environmental Microbiology 11:3045-3062. Hawksworth, D. L. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited. Mycol Res 105:1422 - 1432.

180

Hibbett, D. S., M. Binder, J. F. Bischoff, M. Blackwell, P. F. Cannon, O. E. Eriksson, S. Huhndorf, T. James, P. M. Kirk, R. Lucking, H. T. Lumbsch, F. Lutzoni, P. B. Matheny, D. J. McLaughlin, M. J. Powell, S. Redhead, C. L. Schoch, J. W. Spatafora, J. A. Stalpers, R. Vilgalys, M. C. Aime, A. Aptroot, R. Bauer, D. Begerow, G. L. Benny, L. A. Castlebury, P. W. Crous, Y. C. Dai, W. Gams, D. M. Geiser, G. W. Griffith, C. Gueidan, D. L. Hawksworth, G. Hestmark, K. Hosaka, R. A. Humber, K. D. Hyde, J. E. Ironside, U. Koljalg, C. P. Kurtzman, K. H. Larsson, R. Lichtwardt, J. Longcore, J. Miadlikowska, A. Miller, J. M. Moncalvo, S. Mozley-Standridge, F. Oberwinkler, E. Parmasto, V. Reeb, J. D. Rogers, C. Roux, L. Ryvarden, J. P. Sampaio, A. Schussler, J. Sugiyama, R. G. Thorn, L. Tibell, W. A. Untereiner, C. Walker, Z. Wang, A. Weir, M. Weiss, M. M. White, K. Winka, Y. J. Yao, and N. Zhang. 2007. A higher-level phylogenetic classification of the Fungi. Mycological Research 111:509-547. Horton, T. R. and T. D. Bruns. 2001. The molecular revolution in ectomycorrhizal ecology: peeking into the black-box. Molecular Ecology 10:1855-1871. Huber, T., G. Faulkner, and P. Hugenholtz. 2004. Bellerophon: a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20:2317- 2319. Hughes, K. W., R. H. Petersen, and E. B. Lickey. 2009. Using heterozygosity to estimate a percentage DNA sequence similarity for environmental species' delimitation across basidiomycete fungi. New Phytologist 182:795-798. Hutchinson, G. E. 1959. Homage to Santa-Rosalia or Why are there so many kinds of animals? American Naturalist 93:145-159. Jasper, D. A., A. D. Robson, and L. K. Abbott. 1987. The effect of surface mining on the infectivity of vesicular-arbuscular mycorrhizal fungi. Australian Journal of Botany 35:641-652. Johnston, D. W. and E. P. Odum. 1956. Breeding bird populations in relation to plant succession on the piedmont of Georgia. Ecology 37:50-62. Jumpponen, A., K. L. JONES, J. D. MATTOX, and C. YAEGE. 2010. Massively parallel 454-sequencing of fungal communities in Quercus spp. ectomycorrhizas indicates seasonal dynamics in urban and rural sites. Molecular Ecology 19:41-53. Kasel, S., L. T. Bennett, and J. Tibbits. 2008. Land use influences soil fungal community composition across central Victoria, south-eastern Australia. Soil Biology & Biochemistry 40:1724-1732. Keever, C. 1950. Causes of succession on old fields of the piedmont, North Carolina. Ecological Monographs 20:231-250.

181

Kennedy, N., J. Connolly, and N. Clipson. 2005. Impact of lime, nitrogen and plant species on fungal community structure in grassland microcosms. Environmental Microbiology 7:780-788. Kennedy, P. G., S. E. Bergemann, S. Hortal, and T. D. Bruns. 2007. Determining the outcome of field-based competition between two Rhizopogon species using real- time PCR. Molecular Ecology 16:881-890. Koide, R. T., B. Xu, and J. Sharda. 2005. Contrasting below-ground views of an ectomycorrhizal fungal community. New Phytologist 166:251-262. Landeweert, R., P. Leeflang, T. W. Kuyper, E. Hoffland, A. Rosling, K. Wernars, and E. Smit. 2003. Molecular identification of ectomycorrhizal mycelium in soil horizons. Applied and Environmental Microbiology 69:327-333. Lauber, C. L., M. Hamady, R. Knight, and N. Fierer. 2009a. Pyrosequencing-Based Assessment of Soil pH as a Predictor of Soil Bacterial Community Structure at the Continental Scale. Applied and Environmental Microbiology 75:5111-5120. Lauber, C. L., R. L. Sinsabaugh, and D. R. Zak. 2009b. Laccase Gene Composition and Relative Abundance in Oak Forest Soil is not Affected by Short-Term Nitrogen Fertilization. Microbial Ecology 57:50-57. Lauber, C. L., M. S. Strickland, M. A. Bradford, and N. Fierer. 2008. The influence of soil properties on the structure of bacterial and fungal communities across land-use types. Soil Biology and Biochemistry 40:2407-2415. Li, J., D. d. Richter, A. Mendoza, and P. Heine. Effects of land-use history on soil spatial heterogeneity of macro- and trace elements in the Southern Piedmont USA. Geoderma In Press, Corrected Proof. Li, J. W., D. D. Richter, A. Mendoza, and P. Heine. 2008. Four-decade responses of soil trace elements to an aggrading old-field forest: B, Mn, Zn, Cu, and Fe. Ecology 89:2911-2923. Li, J. W., D. D. Richter, A. Mendoza, and P. Heine. 2010. Effects of land-use history on soil spatial heterogeneity of macro- and trace elements in the Southern Piedmont USA. Geoderma 156:60-73. Lilleskov, E. A. and T. D. Bruns. 2003. Root colonization dynamics of two ectomycorrhizal fungi of contrasting life history strategies are mediated by addition of organic nutrient patches. New Phytologist 159:141-151. Lilleskov, E. A., T. J. Fahey, T. R. Horton, and G. M. Lovett. 2002. Belowground ectomycorrhizal fungal community change over a nitrogen deposition gradient in Alaska. Ecology 83:104-115.

182

Love, J. L., P. Scholes, B. Gilpin, M. Savill, S. Lin, and L. Samuel. 2006. Evaluation of uncertainty in quantitative real-time PCR. Journal of Microbiological Methods 67:349-356. Lozupone, C., M. Hamady, and R. Knight. 2006. UniFrac - An online tool for comparing microbial community diversity in a phylogenetic context. Bmc Bioinformatics 7. Maddison, W. P. a. D. R. M. 2009. Mesquite: a modular system for evolutionary analysis. Markewitz, D. and D. D. Richter. 2000. Long-term soil potassium availability from a Kanhapludult to an aggrading loblolly pine ecosystem. Forest Ecology and Management 130:109-129. Martin, A. P. 2002. Phylogenetic approaches for describing and comparing the diversity of microbial communities. Applied and Environmental Microbiology 68:3673- 3682. Martin, K. J. and P. T. Rygiewicz. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. Bmc Microbiology 5. Matsuda, Y., Y. Noguchi, and S. Ito. 2009. Ectomycorrhizal fungal community of naturally regenerated Pinus thunbergii seedlings in a coastal pine forest. Journal of Forest Research 14:335-341. McCune, B. and J. B. Grace. 2002. Analysis of Ecological Communities. MJM Software Design, Gleneden Beach, Oregon, USA. McCune, B. and M. Mefford. 2006. PC-ORD. Multivariate Analysis of Ecological Data. MjM Software, Gleneden Beach, Oregon. USA. Metz, L. J. 1958. The Calhoun Experimental Forest. USDA Forest Service, Southern Research Station. Moncalvo, J. M., R. Vilgalys, S. A. Redhead, J. E. Johnson, T. Y. James, M. C. Aime, V. Hofstetter, S. J. W. Verduin, E. Larsson, T. J. Baroni, R. G. Thorn, S. Jacobsson, H. Clemencon, and O. K. Miller. 2002. One hundred and seventeen clades of euagarics. Molecular Phylogenetics and Evolution 23:357-400. Morin, P. J. 1999. Community Ecology. Blackwell Science, Inc., Malden, MA. Morris, M. H., M. E. Smith, D. M. Rizzo, M. Rejmánek, and C. S. Bledsoe. 2008. Contrasting ectomycorrhizal fungal communities on the roots of co-occurring oaks (Quercus spp.) in a California woodland. New Phytologist 178:167- 176. Nilsson, R. H., E. Kristiansson, M. Ryberg, and K.-H. Larsson. 2005. Approaching the taxonomic affiliation of unidentified sequences in public databases - an example from the mycorrhizal fungi. Bmc Bioinformatics 6:178. 183

O'Brien, H. E., J. L. Parrent, J. A. Jackson, J. M. Moncalvo, and R. Vilgalys. 2005. Fungal community analysis by large-scale sequencing of environmental samples. Applied and Environmental Microbiology 71:5544-5550. Oosting, H. J. 1942. An ecological analysis of the plant communities of Piedmont, NC. American Midland Naturalist 28:1-26. Parrent, J. L., W. F. Morris, and R. Vilgalys. 2006. CO2-enrichment and nutrient availability alter ectomycorrhizal fungal communities. Ecology 87:2278-2287. Paul, E. A., editor. 2007. Soil Microbiology, Ecology, and Biochemistry. 3rd edition. Elsevier, New York. Peter, M., F. Ayer, S. Egli, and R. Honegger. 2001. Above- and below-ground community structure of ectomycorrhizal fungi in three Norway spruce (Picea abies) stands in Switzerland. Canadian Journal of Botany-Revue Canadienne De Botanique 79:1134-1151. Pfaffl, M. W. 2004. Quantification strategies in real-time PCR. Page 910 in S. A. Bustin, editor. A-Z of Quantitative PCR. International University Line. Progar, R. A., T. D. Schowalter, C. M. Freitag, and J. J. Morrell. 2000. Respiration from coarse woody debris as affected by moisture and saprotroph functional diversity in Western Oregon. Oecologia 124:426-431. Ramakers, C., J. M. Ruijter, R. H. L. Deprez, and A. F. M. Moorman. 2003. Assumption- free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters 339:62-66. Rebrikov, D. V. and D. Y. Trofimov. 2006. Real-time PCR: A review of approaches to data analysis. Applied Biochemistry and Microbiology 42:455-463. Richard, F., P. A. Moreau, M. A. Selosse, and M. Gardes. 2004. Diversity and fruiting patterns of ectomycorrhizal and saprobic fungi in an old-growth Mediterranean forest dominated by Quercus ilex L. Canadian Journal of Botany-Revue Canadienne De Botanique 82:1711-1729. Richter, D. D., H. L. Allen, J. W. Li, D. Markewitz, and J. Raikes. 2006. Bioavailability of slowly cycling soil phosphorus: major restructuring of soil P fractions over four decades in an aggrading forest. Oecologia 150:259-271. Richter, D. d. and D. Markewitz. 2001. Understanding soil change : soil sustainability over millennia, centuries, and decades. Cambridge University Press, Cambridge. Richter, D. D., D. Markewitz, P. R. Heine, V. Jin, J. Raikes, K. Tian, and C. G. Wells. 2000. Legacies of agriculture and forest regrowth in the nitrogen of old-field soils. Forest Ecology and Management 138:233-248.

184

Richter, D. D., D. Markewitz, C. G. Wells, H. L. Allen, R. April, P. R. Heine, and B. Urrego. 1994. Soil chemical-change during 3 decades in an old-field loblolly-pine (Pinus-taeda l) ecosystem. Ecology 75:1463-1473. Ruijter, J. M., C. Ramakers, W. M. H. Hoogaars, Y. Karlen, O. Bakker, M. J. B. van den Hoff, and A. F. M. Moorman. 2009. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic Acids Research 37. Rutledge, R. G. and D. Stewart. 2008. Critical evaluation of methods used to determine amplification efficiency refutes the exponential character of real-time PCR. Bmc Molecular Biology 9. Rutledge, R. G. and D. Stewart. 2010. Assessing the Performance Capabilities of LRE- Based Assays for Absolute Quantitative Real-Time PCR. PLoS ONE 5. Schadt, C. W., A. P. Martin, D. A. Lipson, and S. K. Schmidt. 2003. Seasonal dynamics of previously unknown fungal lineages in tundra soils. Science 301:1359-1361. Schafale, M. and N. L. Christensen. 1986. Vegetational Variation among Old Fields in Piedmont North-Carolina. Bulletin of the Torrey Botanical Club 113:413-420. Schloss, P. D. 2008. Evaluating different approaches that test whether microbial communities have the same structure. Isme Journal 2:265-275. Schloss, P. D. and J. Handelsman. 2005. Introducing DOTUR, a computer program for defining operational taxonomic units and estimating species richness. Applied and Environmental Microbiology 71:1501-1506. Schultz, R. P. 1999. Loblolly - the pine for the twenty-first century. New Forests 17:71-88. Seifert, K. A. 2009. Progress towards DNA barcoding of fungi. Molecular Ecology Resources 9:83-89. Smith, C. J. and A. M. Osborn. 2009. Advantages and limitations of quantitative PCR (Q- PCR)-based approaches in microbial ecology. FEMS Microbiology Ecology 67:6- 20. Smith, M. E., G. W. Douhan, and D. M. Rizzo. 2007. Ectomycorrhizal community structure in a xeric Quercus woodland based on rDNA sequence analysis of sporocarps and pooled roots. New Phytologist 174:847-863. Stamatakis, A., P. Hoover, and J. Rougemont. 2008. A Rapid Bootstrap Algorithm for the RAxML Web Servers. Syst Biol 57:758-771. Stefani, F. O. P., P. Tanguay, G. Pelletier, Y. Piche, and R. C. Hamelin. 2010. Impact of Endochitinase-Transformed White Spruce on Soil Fungal Biomass and Ectendomycorrhizal Symbiosis. Applied and Environmental Microbiology 76:2607-2614. 185

Sylvia, D. M. and A. G. Jarstfer. 1997. Distribution of myrcorrhiza on competing pines and weeds in a southern pine plantation. Soil Science Society of America Journal 61:139-144. U'Ren, J. M., J. W. Dalling, R. E. Gallery, D. R. Maddison, E. C. Davis, C. M. Gibson, and A. E. Arnold. 2009. Diversity and evolutionary origins of fungi associated with seeds of a neotropical pioneer tree: a case study for analysing fungal environmental samples. Mycological Research 113:432-449. Valasek, M. A. and J. J. Repa. 2005. The power of real-time PCR. Advances in Physiology Education 29:151-159. Vilgalys, R. 2003. Taxonomic misidentification in public DNA databases. New Phytologist 160:4-5. Vilgalys, R. and M. Hester. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal dna from several Cryptococcus species. Journal of Bacteriology 172:4238-4246. Waldrop, M. P., D. R. Zak, C. B. Blackwood, C. D. Curtis, and D. Tilman. 2006. Resource availability controls fungal diversity across a plant diversity gradient. Ecology Letters 9:1127-1135. Walker, J. F., O. K. Miller, and J. L. Horton. 2005. Hyperdiversity of ectomycorrhizal fungus assemblages on oak seedlings in mixed forests in the southern Appalachian Mountains. Molecular Ecology 14:829-838. Walker, R. F., S. B. McLaughlin, and D. C. West. 2004. Establishment of sweet birch on surface mine spoil as influenced by mycorrhizal inoculation and fertility. Restoration Ecology 12:8-19. Wardle, D. A. 2002. Communities and Ecosystems: linking the aboveground and belowground components. 1st edition. Princeton University Press, Princeton. White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White, editor. PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., New York. Whittaker, R. H. 1960. Vegetation of the Siskiyou Mountains, Oregon and California. Ecological Monographs 30:279-338. Wong, M. L. and J. F. Medrano. 2005. Real-time PCR for mRNA quantitation. Biotechniques 39:75-85.

186

Biography

I was born to Richard Henry Jackson and Karen Linda Marx in St. Joseph, MI on

July 15th, 1973. The hospital overlooked Lake Michigan, and its waters will always run through my blood. I was raised by divorced parents, one in Detroit, one in Chicago, and owe much of my sanity to my loving stepmother, Jill McDowell Mawhinney, and my little brother, Michael Robert Hamilton. I am also indebted to my experiences, and value what I learned in the dunes of Lake Michigan and the streets of Detroit and Chicago as much as I value my formal education.

I attended college at the University of Illinois, Urbana-Champaign, and graduated in January 1996 with a BS in Biology. After working for several years as a lab coordinator, field researcher, and even pizza delivery man, I returned to graduate school in 1998 in the department of Ecology, Ethology, and Evolution at the U of I under Ken

N. Paige. Ken was a wonderful advisor, but I left the program after two years for the best of reasons. I married Sarah Catherine Schmid, who was to attend the University of

North Carolina for a PhD in Biochemistry. This was one of the better decisions I’d ever made. Sarah turned out to be not only a great wife and mother, but the best friend I’ve ever known. Two children, several moves, and a few jobs later, I find myself in this moment. I wouldn’t trade a single day. Well, maybe one or two.

187

Awards

Frederick K. Weyerhaeuser Forest History Fellowship (2006)

Publications

Fierer, N., J. A. Jackson, R. Vilgalys, and R. B. Jackson. 2005. Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays. Applied and Environmental Microbiology 71:4117-4120.

Richter, D. D., NH Oh, R Fimmen and JA Jackson (2007). The Rhizosphere and Soil Formation. In Z. G. Cardon and JL Whitbeck (Eds.), The Rhizospere: An Ecological Perspective. Academic Press.

188