DOCSLIB.ORG

Recherche De Gènes Candidats Responsables Du Syndrome D'aicardi : Complémentarité Des Approches Expérimentales Et Bioinformatiques

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Recherche De Gènes Candidats Responsables Du Syndrome D'aicardi : Complémentarité Des Approches Expérimentales Et Bioinformatiques Recherche de gènes candidats responsables du Syndrome d’Aicardi : Complémentarité des approches expérimentales et bioinformatiques Saliha Yilmaz To cite this version: Saliha Yilmaz. Recherche de gènes candidats responsables du Syndrome d’Aicardi : Complémentarité des approches expérimentales et bioinformatiques. Génétique. Université Henri Poincaré - Nancy 1, 2007. Français. NNT : 2007NAN10149. tel-01748514 HAL Id: tel-01748514 https://hal.univ-lorraine.fr/tel-01748514 Submitted on 29 Mar 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. AVERTISSEMENT Ce document est le fruit d'un long travail approuvé par le jury de soutenance et mis à disposition de l'ensemble de la communauté universitaire élargie. Il est soumis à la propriété intellectuelle de l'auteur. Ceci implique une obligation de citation et de référencement lors de l’utilisation de ce document. D'autre part, toute contrefaçon, plagiat, reproduction illicite encourt une poursuite pénale. Contact : [email protected] LIENS Code de la Propriété Intellectuelle. articles L 122. 4 Code de la Propriété Intellectuelle. articles L 335.2- L 335.10 http://www.cfcopies.com/V2/leg/leg_droi.php http://www.culture.gouv.fr/culture/infos-pratiques/droits/protection.htm FACULTE DES SCIENCES & TECHNIQUES U.F.R Sciences & Techniques biologiques Ecole Doctorale Biologie, Santé et Environnement (BioSE) Thèse présentée pour l’obtention du titre de Docteur de l’Université Henri Poincaré, Nancy‐I Spécialité Génomique par Saliha YILMAZ Recherche de gènes candidats responsables du Syndrome d'Aicardi : Complémentarité des approches expérimentales et bioinformatiques Soutenue publiquement le 7 Novembre2007 Directeur de thèse : Professeur Philippe JONVEAUX Membres du jury : Rapporteurs : Professeur Yves MOREAU Professeur Joris Robert VERMEESCH Examinateurs : Docteur Marie‐Dominique DEVIGNES Docteur John Louis McGREGOR Docteur Roberto INCITTI Professeur Bruno LEHEUP Professeur Philippe JONVEAUX Invité d’honneur : Professeur Jean AICARDI Laboratoire de Génétique Médicale, CHU Nancy‐Brabois, Rue du Morvan, 54511 Vandoeuvre‐lès‐Nancy A Annick Perroux, ma tata… Sans toi ce travail n’existerait pas Quel bonheur de t’avoir connue A la jolie Anne­Lorène… … à toutes les filles Aicardi de part le monde et aux familles qui ont participé à ce projet… Remerciements Je remercie tout particulièrement mon Directeur de thèse, le Professeur Philippe Jonveaux. Merci de m’avoir accueillie dans votre laboratoire, de m’avoir accordé votre confiance et de m’avoir permis de confirmer mon goût (devenue passion) pour la génétique humaine. Mes remerciements vont également à Christophe Philippe. Tu as été présent à chaque fois que j’ai eu besoin de toi, merci pour ta générosité et ton altruisme. Je remercie également Marie‐José Grégoire. Merci de m’avoir fait profiter de votre esprit cartésien. Clarté et simplicité … Toute ma profonde gratitude pour Monsieur Jean Aicardi. Merci Monsieur de me faire l’honneur de votre présence dans mon jury. Yves Moreau et Joris Robert Vermeesch m’ont fait l’honneur d’être les rapporteurs de cette thèse, et je les en remercie, de même que pour leur participation au Jury. Bien sur, je remercierai les deux représentantes de l’équipe orpailleur Marie‐Dominique Devignes et Malika Smaïl‐Tabbone. Merci à vous, très sincèrement je n’ai cessé d’apprendre et j’ai encore soif… Je tiens à remercier Roberto Incitti pour les conseils stimulants et les suggestions enrichissantes que j’ai reçus de sa part. Je remercie également Bruno Leheup d’avoir accepté de participer au Jury de soutenance. Votre savoir m’a toujours impressionnée. Je tiens à dire un grand Merci à John Louis McGregor. Merci de m’avoir si naturellement et si gentiment accueillie dans votre équipe à Londres. Je suis impatiente à l’idée de commencer un tel projet avec vous et Sophie. Une nouvelle aventure dans une nouvelle vie et une ville où, quoi qu’on en dise, il ne pleut pas* * autant qu’à Nancy. J’en profite pour remercier Flo, Marion, Sophie, Chris, Kira et Thibault pour tous les bons moments que nous avons partagés ensemble durant mes séjours à Londres. Un grand merci à Karène pour sa gentillesse et sa disponibilité. Merci à Hervé et Cédric. Et bien sur à Stéphane, un vrai cadeau en tant que premier stagiaire… Et puis, il y a tout ce monde autour de moi, dont beaucoup de personnes d’exception. Des personnes que je connaissais ou que j’ai rencontrées et qui ont fait que ces années ont été aussi riches et agréables. Mes amis de toujours, Eléonore et Manu, Valérie et Gaby. Je suis à la traîne mais j’ai presque fini… Marie Jo, merci pour ton amitié et ta sincérité. Ilham. Je ne désespère pas de te voir un jour chez moi…idem, tu vas me dire… Micheline. Toi heureusement que tu es là…et pour beaucoup de monde j’en suis sur. Aline et son petit bout de chou…qui va bientôt nous rejoindre. Merci à Khaled, Cindy, Üstün, Nizar, Adrien, Lazslo…avec qui j’ai partagé cette dernière année de thèse si agréable. Je souhaite remercier toutes les personnes, qui d’une façon ou une autre m’ont épaulée : soit au sein du laboratoire de génétique que celui du Loria … grâce à leur gentillesse, leur disponibilité et leur compétence, ils m’ont enrichie pour mener à bien ce fabuleux projet. Merci à mes parents de m’avoir toujours poussé à réaliser ce que je souhaitais faire. D’avoir été là, toujours à mes cotés. Merci à mes frères Okan et Ozcan. Promis, à l’avenir je serai moins stressée et plus disponible. Merci à ma sœur Sevgi. Tu tombes toujours à pic … merci Et merci à mon porte bonheur. Quelle patience tu as… 4°¨• §•≥ ° © ≤•≥ Table des matières Liste des figures...................................................................................................................................................7 Liste des tableaux ...............................................................................................................................................9 Abréviations.......................................................................................................................................................11 Préambule...........................................................................................................................................................16 Introduction 1. Retard mental ..........................................................................................................................................19 1.1. Définition...........................................................................................................................................19 1.2. Prévalence des RM.........................................................................................................................20 1.3. Etiologie des RM.............................................................................................................................20 2. Retards mentaux liés au chromosome X......................................................................................23 2.1. Prévalence des RMLX...................................................................................................................23 2.2. Nosologie ...........................................................................................................................................24 2.3. Etiologie .............................................................................................................................................25 2.4. Physiopathologie des RMLX......................................................................................................30 2.4.1. RMLX et synapse ...................................................................................................................30 2.4.2. RMLX, régulation de la transcription et remodelage de la chromatine.........33 2.4.3. RMLX et possibilités thérapeutiques............................................................................34 3. Le Syndrome d’Aicardi.........................................................................................................................34 3.1. Historique..........................................................................................................................................34 3.2. Spectre clinique ..............................................................................................................................35 3.2.1. Les anomalies neurologiques ..........................................................................................35 3.2.2. Les anomalies oculaires .....................................................................................................36 3.2.3. Les anomalies extra neurologiques...............................................................................37 3.2.4. Pronostic et histoire naturelle.........................................................................................38 3.2.5. Proposition de critères pour le diagnostic clinique du syndrome d’Aicardi..... ................................................................................................................................................
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name mature T-cell proliferation 1 Gene Symbol MTCP1 Organism Human Gene Summary This gene was identified by involvement in some t(X;14) translocations associated with mature T-cell proliferations. This region has a complex gene structure with a common promoter and 5' exon spliced to two different sets of 3' exons that encode two different proteins. This gene represents the upstream 13 kDa protein that is a member of the TCL1 family. This protein may be involved in leukemogenesis. Gene Aliases P13MTCP1, p8MTCP1 RefSeq Accession No. NC_000023.10, NG_005114.1, NT_167198.1 UniGene ID Not Available Ensembl Gene ID ENSG00000214827 Entrez Gene ID 4515 Assay Information Unique Assay ID qHsaCED0048630 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000369476, ENST00000362018, ENST00000596212, ENST00000597096 Amplicon Context Sequence TCCCCTGACCATTAAATGATGCTGTATCTGCCACAAGCGAGAGTTGTTATCCATG TAGCGCTCCTCCGGGTAGAGTTGCCACATGAGAGGTAGCTGGGAGGT Amplicon Length (bp) 72 Chromosome Location X:154293804-154293986 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 106 R2 0.9994 cDNA Cq 24.34 cDNA Tm (Celsius) 82 gDNA Cq 25.37 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report MTCP1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard
    [Show full text]
  • University of California, San Diego
    UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs of this journey. iv EPIGRAPH It is foolish to tear one's hair in grief, as though sorrow would be made less by baldness. ~Cicero v TABLE OF CONTENTS Signature Page .............................................................................................................. iii Dedication ....................................................................................................................
    [Show full text]
  • Structural Studies of the Complex Between Akt-In and the Akt2-PH Domain Suggest That the Peptide Acts As an Allosteric Inhibitor of the Akt Kinase
    The Open Spectroscopy Journal, 2009, 3, 65-76 65 Open Access Structural Studies of the Complex Between Akt-in and the Akt2-PH Domain Suggest that the Peptide Acts as an Allosteric Inhibitor of the Akt Kinase Virginie Ropars1,2,3, Philippe Barthe1,2,3, Chi-Shien Wang4, Wenlung Chen4, Der-Lii M. Tzou4,5, Anne Descours6, Loïc Martin6, Masayuki Noguchi7, Daniel Auguin1,2,3,,¶ and Christian Roumestand*,1,2,3 1CNRS UMR 5048, Centre de Biochimie Structurale, Montpellier, France 2INSERM U554, Montpellier, France 3Université Montpellier I et II, Montpellier, France 4Department of Applied Chemistry, National Chiayi University, Chiayi 60004, Taiwan, ROC 5Institute of Chemistry, Academia Sinica, Nankang, Taipei 11529, Taiwan, ROC 6CEA, iBiTecs, Service d’Ingénierie Moléculaire des Protéines, 91191 Gif sur Yvette, France 7Division of Cancer Biology, Institute for Genetic Medicine, Hokkaido University, N15 W7, Kita-ku, Sapporo 060-0815, Japan Abstract: Serine/threonine kinase Akt plays a central role in the regulation of cell survival and proliferation. Hence, the search for Akt specific inhibitors constitutes an attractive strategy for anticancer therapy. We have previously demonstrated that the proto-oncogene TCL1 coactivates Akt upon binding to its Plekstrin Homology Domain, and we proposed a model for the structure of the complex TCL1:Akt2-PHD. This model led to the rational design of Akt-in, a peptide inhibitor spanning the A ß-strand of human TCL1 that binds Akt2 PH domain and inhibits the kinase activation. In the present report, we used NMR spectroscopy to determine the 3D structure of the peptide free in solution and bound to Akt2-PHD.
    [Show full text]
  • Coupling of Spliceosome Complexity to Intron Diversity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coupling of spliceosome complexity to intron diversity Jade Sales-Lee1, Daniela S. Perry1, Bradley A. Bowser2, Jolene K. Diedrich3, Beiduo Rao1, Irene Beusch1, John R. Yates III3, Scott W. Roy4,6, and Hiten D. Madhani1,6,7 1Dept. of Biochemistry and Biophysics University of California – San Francisco San Francisco, CA 94158 2Dept. of Molecular and Cellular Biology University of California - Merced Merced, CA 95343 3Department of Molecular Medicine The Scripps Research Institute, La Jolla, CA 92037 4Dept. of Biology San Francisco State University San Francisco, CA 94132 5Chan-Zuckerberg Biohub San Francisco, CA 94158 6Corresponding authors: [email protected], [email protected] 7Lead Contact 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.19.436190; this version posted March 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. SUMMARY We determined that over 40 spliceosomal proteins are conserved between many fungal species and humans but were lost during the evolution of S. cerevisiae, an intron-poor yeast with unusually rigid splicing signals. We analyzed null mutations in a subset of these factors, most of which had not been investigated previously, in the intron-rich yeast Cryptococcus neoformans.
    [Show full text]
  • Environmental Influences on Endothelial Gene Expression
    ENDOTHELIAL CELL GENE EXPRESSION John Matthew Jeff Herbert Supervisors: Prof. Roy Bicknell and Dr. Victoria Heath PhD thesis University of Birmingham August 2012 University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT Tumour angiogenesis is a vital process in the pathology of tumour development and metastasis. Targeting markers of tumour endothelium provide a means of targeted destruction of a tumours oxygen and nutrient supply via destruction of tumour vasculature, which in turn ultimately leads to beneficial consequences to patients. Although current anti -angiogenic and vascular targeting strategies help patients, more potently in combination with chemo therapy, there is still a need for more tumour endothelial marker discoveries as current treatments have cardiovascular and other side effects. For the first time, the analyses of in-vivo biotinylation of an embryonic system is performed to obtain putative vascular targets. Also for the first time, deep sequencing is applied to freshly isolated tumour and normal endothelial cells from lung, colon and bladder tissues for the identification of pan-vascular-targets. Integration of the proteomic, deep sequencing, public cDNA libraries and microarrays, delivers 5,892 putative vascular targets to the science community.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • Ageing-Associated Changes in DNA Methylation in X and Y Chromosomes
    Kananen and Marttila Epigenetics & Chromatin (2021) 14:33 Epigenetics & Chromatin https://doi.org/10.1186/s13072-021-00407-6 RESEARCH Open Access Ageing-associated changes in DNA methylation in X and Y chromosomes Laura Kananen1,2,3,4* and Saara Marttila4,5* Abstract Background: Ageing displays clear sexual dimorphism, evident in both morbidity and mortality. Ageing is also asso- ciated with changes in DNA methylation, but very little focus has been on the sex chromosomes, potential biological contributors to the observed sexual dimorphism. Here, we sought to identify DNA methylation changes associated with ageing in the Y and X chromosomes, by utilizing datasets available in data repositories, comprising in total of 1240 males and 1191 females, aged 14–92 years. Results: In total, we identifed 46 age-associated CpG sites in the male Y, 1327 age-associated CpG sites in the male X, and 325 age-associated CpG sites in the female X. The X chromosomal age-associated CpGs showed signifcant overlap between females and males, with 122 CpGs identifed as age-associated in both sexes. Age-associated X chro- mosomal CpGs in both sexes were enriched in CpG islands and depleted from gene bodies and showed no strong trend towards hypermethylation nor hypomethylation. In contrast, the Y chromosomal age-associated CpGs were enriched in gene bodies, and showed a clear trend towards hypermethylation with age. Conclusions: Signifcant overlap in X chromosomal age-associated CpGs identifed in males and females and their shared features suggest that despite the uneven chromosomal dosage, diferences in ageing-associated DNA methylation changes in the X chromosome are unlikely to be a major contributor of sex dimorphism in ageing.
    [Show full text]
  • The Direction of Cross Affects Obesity After Puberty in Male but Not Female
    Kärst et al. BMC Genomics (2015) 16:904 DOI 10.1186/s12864-015-2164-2 RESEARCH ARTICLE Open Access The direction of cross affects obesity after puberty in male but not female offspring Stefan Kärst1†, Danny Arends1†, Sebastian Heise1†, Jan Trost1, Marie-Laure Yaspo2, Vyacheslav Amstislavskiy2, Thomas Risch2, Hans Lehrach2 and Gudrun A. Brockmann1* Abstract Background: We investigated parent-of-origin and allele-specific expression effects on obesity and hepatic gene expression in reciprocal crosses between the Berlin Fat Mouse Inbred line (BFMI) and C57Bl/6NCrl (B6N). Results: We found that F1-males with a BFMI mother developed 1.8 times more fat mass on a high fat diet at 10 weeks than F1-males of a BFMI father. The phenotype was detectable from six weeks on and was preserved after cross-fostering. RNA-seq data of liver provided evidence for higher biosynthesis and elongation of fatty acids (p = 0.00635) in obese male offspring of a BFMI mother versus lean offspring of a BFMI father. Furthermore, fatty acid degradation (p = 0.00198) and the peroxisome pathway were impaired (p = 0.00094). The circadian rhythm was affected as well (p = 0.00087). Among the highest up-regulated protein coding genes in obese males were Acot4 (1.82 fold, p = 0.022), Cyp4a10 (1.35 fold, p = 0.026) and Cyp4a14 (1.32 fold, p = 0.012), which hydroxylize fatty acids and which are known to be increased in liver steatosis. Obese males showed lower expression of the genetically imprinted and paternally expressed 3 (Peg3) gene (0.31 fold, p = 0.046) and higher expression of the androgen receptor (Ar) gene (2.38 fold, p = 0.068).
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]