Page 1 of 56 Diabetes
1 Orally active osteoanabolic agent 6 C β D glucopyranosyl (2S, 3S) (+) 5,7, 3',4'
2 tetrahydroxydihydroflavonol binds to adiponectin receptors, with a preference for AdipoR1,
3 induces adiponectin associated signaling and improves metabolic health in a rodent model of
4 diabetes.
5 Running title: GTDF is an orally active adiponectin mimetic
6 Abhishek Kumar Singh1,#, Amit Arvind Joharapurkar2,#, Mohd. Parvez Khan3, Jay Sharan Mishra1,
7 Nidhi Singh1, Manisha Yadav1, Zakir Hossain4, Kainat Khan3, Sudhir Kumar5, Nirav Anilkumar
8 Dhanesha2, Devendra Pratap Mishra5, Rakesh Maurya5, Sharad Sharma6, Mukul Rameshchandra
9 Jain2, Arun Kumar Trivedi1, Madan Madhav Godbole7, Jiaur Rahaman Gayen4 , Naibedya
10 Chattopadhyay2 and Sabyasachi Sanyal1,*
11
12 Authors’ affiliations:
13 1Biochemistry Division, CSIR Central Drug Research Institute, 10 Janakipuram Extn, Sitapur Road, Lucknow
14 226031, UP, India. 2Zydus Research Center, Sarkhej Bavla NH#8A, Moraiya, Ahmedabad 382210, Gujarat,
15 India. 3Division of Endocrinology, CSIR Central Drug Research Institute, 10 Janakipuram Extn, Sitapur Road,
16 Lucknow 226031, UP, India. 4Division of Phramacokinetics, CSIR Central Drug Research Institute, 10
17 Janakipuram Extn, Sitapur Road, Lucknow 226031, UP, India. 5Division of Medicinal and Process Chemistry,
18 CSIR Central Drug Research Institute, 10 Janakipuram Extn, Sitapur Road, Lucknow 226031, UP, India.
19 6Division of Toxicology, CSIR Central Drug Research Institute, 10 Janakipuram Extn, Sitapur Road, Lucknow
20 226031, UP, India. 7Department of Molecular Medicine, Sanjay Gandhi Postgraduate Institute of Medical
21 Sciences, Lucknow 226014, UP, India.
22 # These authors contributed equally
23 *Address correspondence to Sabyasachi sanyal, e mail: [email protected], Biochemistry Division,
24 CSIR Central Drug Research Institute, 10 Janakipuram Extn, Sitapur Road, Lucknow 226031, UP,
25 India ; Tel: (+91) 9792366322; Fax: (+91) (522) 2771941
26 Word Count 5412
27 Number of Figures 7
1
Diabetes Publish Ahead of Print, published online May 21, 2014 Diabetes Page 2 of 56
1 ABSTRACT
2 Adiponectin is an adipocytokine that signals through plasma membrane bound adiponectin
3 receptors (AdipoR) 1 and 2. Plasma adiponectin depletion is associated with type 2
4 diabetes, obesity and cardiovascular diseases. Adiponectin therapy however, is yet
5 unavailable owing to its large size, complex multimerization and functional differences of the
6 multimers. We report discovery and characterization of 6 C β D glucopyranosyl (2S, 3S)
7 (+) 5,7, 3',4' tetrahydroxydihydroflavonol (GTDF) as an orally active adiponectin mimetic.
8 GTDF interacted with both AdipoRs, with a preference for AdipoR1. It induced adiponectin
9 associated signaling and enhanced glucose uptake and fatty acid oxidation in vitro, which
10 were augmented or abolished by AdipoR1 overexpression or silencing respectively. GTDF
11 improved metabolic health, characterized by elevated glucose clearance, β cell survival,
12 reduced steatohepatitis, browning of white adipose tissue and improved lipid profile in an
13 AdipoR1 expressing but not an AdipoR1 depleted strain of diabetic mice. The discovery of
14 GTDF as an adiponectin mimetic provides a promising therapeutic tool for the treatment of
15 metabolic diseases.
16
17
18
19
20
21
22
23
24
25 2
Page 3 of 56 Diabetes
1 The anti inflammatory adipocytokine adiponectin (1; 2) signals through adiponectin
2 receptors (AdipoR) 1 and 2 (3). T cadherin, a cadherin family member that lacks
3 transmembrane and cytoplasmic domains also binds adiponectin, and is proposed to affect its
4 bioavailability (4). Plasma adiponectin depletion is associated with type 2 diabetes, obesity
5 and cardiovascular diseases (5 7). Adiponectin administration or overexpression ameliorates
6 insulin resistance, metabolic syndrome and atherosclerosis in animals (3; 8 12) and enhances
7 pancreatic β cell survival (13). These evidences make AdipoRs important therapeutic targets
8 for metabolic diseases.
9 Structurally, adiponectin belongs to the complement 1q family (1; 14; 15).
10 Adipoenctin monomer is a 30 kDa protein consisting of an N terminal collagenous and a C
11 terminal globular domains (1). Mammalian plasma adiponectin is present in several
12 multimeric forms; low molecular weight dimer or trimers, medium molecular weight
13 hexamers or high molecular weight (HMW) dodecamers and 18 mers (10; 16 18). The
14 globular domain of adiponectin (gAd) can form trimers and was initially shown to exist as a
15 proteolytic cleavage product in human plasma (10), although subsequent studies failed to
16 detect it in circulation, its ability to modulate AdipoRs is undisputed. All these forms display
17 different levels of physiological activity and the HMW complex is considered the most
18 clinically relevant form (10; 16 18). The HMW full length adiponectin and gAd
19 preferentially signal through AdipoR2 and AdipoR1 respectively (3). Given the
20 multimerization related complexities of adiponectin structure and function, it appears that
21 small molecule AdipoR ligands may provide the only viable therapeutic option against
22 diseases associated with defects in adiponectin expression or action.
23 We have previously identified GTDF, a novel natural analog of the dietary flavonoid
24 quercetin, as a potent orally bioavailable osteoanabolic compound that induced proliferation,
25 differentiation and mineralization of cultured primary osteoblasts at a nanomolar 3
Diabetes Page 4 of 56
1 concentration that was 1000 fold less than effective concentration of quercetin or queretin O
2 glucoside, and restored trabecular bones of osteopenic rats on a par with parathyroid hormone
3 (19). While studying its mechanism of action, we found that GTDF induced rapid AMP–
4 dependent protein kinase (AMPK), AKT and p38 phosphorylation and elevated PGC 1α
5 expression in osteoblasts. GTDF also deacetylated tumor suppressor P53 via indirect
6 activation of NAD dependent deacetylase Sirtuin1 (sirt1) [(20), and manuscript in
7 preparation, SS and NC)]. Literature search revealed that adiponectin elicits similar cellular
8 signaling (1; 3; 11). Interestingly, the quercetin group of compounds display functional
9 properties similar to adiponectin, such as AMPK activation, glucose uptake enhancement,
10 induction of fatty acid oxidation related genes and amelioration of diabetes and insulin
11 resistance in vivo (21 23). We thus asked if GTDF, quercetin or other naturally occurring
12 quercetin analogs could be adiponectin mimetics. Here we report detailed characterization of
13 GTDF as an adiponectin mimetic that improves metabolic health in a rodent model of
14 diabetes.
15
16 RESEARCH DESIGN AND METHODS
17 Materials and kits: All cell culture reagents were from Invitrogen, Life Technologies
18 (Carlsbad, CA). Fine chemicals were from Sigma Aldrich (St. Louis, MO) unless otherwise
19 indicated. Epoxy agarose beads conjugated with GTDF were constructed at Shantani Biotech
20 (Pune, India). Globular adiponectin (gAd) was purchased from Enzo Life Sciences
21 (Farmingdale, NY) and ATGen Global (Gyeonggi do, South Korea) and compared; gAd
22 from both sources showed identical activity; gAd from ATGen Global was used in this study.
23 GW7647 was from Sigma Aldrich, full length human AdipoR1 and AdipoR2 mammalian
24 expression constructs were from Open Biosystems (Huntsville, AL). 125I gAd was from
25 Phoenix Pharmaceuticals (Burlingame, CA), 125I (20 MBq) used for radiolabeling GTDF was 4
Page 5 of 56 Diabetes
1 from BARC (Mumbai, India). Glycogen assay kit was from Sigma Aldrich (St. Louis,
2 Missouri). Serum concentrations of triglycerides, nonesterified free fatty acids (NEFA),
3 HDL, LDL,VLDL, total cholesterol, beta hydroxybutyrate, and creatinine were determined
4 using kits purchased from Pointe Scientific (Canton, MI, USA).Circulating glucagon, insulin,
5 C peptide, leptin, adiponectin, ghrelin, corticosterone and markers of inflammation (MCP 1,
6 TNF α, and IL 6) were estimated using enzyme linked immunosorbent assay (ELISA) assay
7 kits (R&D Systems, Minneapolis, MN). Serum concentrations of sodium and potassium were
8 measured using a Cobas c system (Roche Diagnostics; Indianapolis, IN). TUNEL assay kit
9 was from Roche Applied Science (Indianapolis, IN). Plasma membrane extraction kit was
10 from Biovision (Milpitas, CA).
11 Cell culture and induction of differentiation
12 HEK 293, CHO, C2C12 and 3T3L 1 cell lines were cultured as reported (24). Mouse stromal
13 vascular fraction (SVF) was prepared from epididymal fat pad by collagenase digestion.
14 Human SVFs were prepared from human lipoaspirates (subcutaneous), collected following
15 approval of Institutional Ethical Committee. Cells were differentiated in presence of GTDF
16 or vehicle for 10d (3T3L 1 and mouse SVF) or 21d (human SVF), using standard procedure,
17 and then analyzed by QPCR, immunoblotting or microscopy.
18 Iodination and purification of 125I-GTDF
19 GTDF was radio labeled as previously described for quercetin1 with minor modifications.
20 Briefly, 10 l of 125I (20 MBq; BARC, Mumbai, India) was added to 100 g GTDF in 5%
21 acetic acid/methanol, then chloramine T (4 g in MilliQ H2O) was added, and the mixture
22 was allowed to react at room temperature (240C) for 5 min. The reaction was terminated by
23 adding 60 l sodium metabisulphite (4mg/ml in MilliQ H2O).The reaction mixture was dried
24 by passing nitrogen and was dissolved into methanol (100 l). Reverse phase TLC (RP 18
5
Diabetes Page 6 of 56
1 F254s, Merck, 8cm in length) was used to purify 125I GTDF from free iodine and unlabeled
2 compound using methanol water (40% 60%) as mobile phase. Following run, the TLC plate
3 was cut into pieces of 0.5mm each and the distribution of radioactivity along the plate was
4 measured in a gamma Counter. TLC of the blank reaction suggested the location of free 125I
5 in the TLC plate. The RF value of the labeled compound was determined by gamma
6 counting. The area showing maximum activity at distance of 40 to 60 mm was eluted from
7 the TLC plate, and was washed with methanol, centrifuged, decanted and dried under N2.
8 Overexpression and silencing experiments
9 Plasmid transfections were performed with Lipofectamine LTX (Life Technologies
10 Carlsbad, CA) reagent according to manufacturer’s protocols. For C2C12 transfections,
11 C2C12 myoblasts were trypsinized and transfected. The cells were then grown till 60 70%
12 confluence. They were then differentiated and assessed as required. For RNA interference,
13 siRNAs (siAdipoR1; L 063377 01 0010and siC; siRNA against luciferase GL3 duplex D
14 001400 01 50) were purchased from Thermo Scientific (Pittsburgh, PA). Cells were
15 transfected with 0.1µM of each siRNA using DharmaFECT 1 transfection reagent (Thermo
16 Scientific). 72 h after transfection cells were treated and were analyzed as required.
17 QPCR, Western blotting, co-immunoprecipitation
18 These studies were performed as previously described (24). List of primer sequences for
19 qPCR has been provided in supplementary table 5. Anti PGC 1α (ST1202; Millipore,
20 Billerica, MA) was used at 1:2000 dilution and anti CD36 (18836 1 AP; Proteintech
21 (Chicago, IL) was used at 1:1000 dilution. Anti UCP 1 (ab10983) UCP3 (ab3477) and
22 PPARα (ab8934); Abcam (Cambridge, MA) were used at 1:1000 dilutions. Phospho AMPK
23 (Thr172), AMPK, phospho p38(Thr 180/ Tyr 182), p38, phospho ACC, ACC, Glut4, P53,
24 Acetyl P53 (Lys 382), C/EBPβ, and β actin antibodies were from Cell Signalling
6
Page 7 of 56 Diabetes
1 Technology (Beverly, MA) and were used at 1:1000 except β actin which was used at
2 1:3000 dilution. Antibodies against AdipoR1 (sc 46748), AdipoR2 (sc 46755) and N
3 cadherin (sc 1502) were from Santacruz Biotechnology (Dallas, TX) and used at 1:1000
4 dilutions. For immunohistochemistry, insulin antibody (Cell Signalling Technology; Beverly,
5 MA) was used at a dilution of 1:200, phycoerythrin tagged Ki 67 antibody (BD
6 Biosciences;San Diego, CA) was used at a dilution of 1:100 and anti UCP 1 (ab10983) was
7 used at a dilution of 1:250.
8 Glucose-uptake
9 Fully differentiated C2C12 myotubes on 24 well plates were treated with vehicle (0.1%
10 DMSO) or 0.01 µM GTDF for 24h, following which the cells were serum starved for 3h. The
11 cells were then washed three times in warm (370 C) HEPES buffer solution ( HBS; 140 mM
12 sodium chloride, 20 mM HEPES, 5 mM potassium chloride, 2.5 mM magnesium sulfate, 1
13 mM calcium chloride, pH 7.4) and then were treated with warm HBS or 0.1µM insulin (in
14 HBS) for 20 min. Subsequently cells were washed 3X in warm HBS and were then
15 incubated in 250µl transport solution (HBS containing with 1µCi 3H deoxyglucose (Perkin
16 Elmer) and 10µM unlabeled 2 deoxyglucose (Sigma Aldrich) per well for 5 min. Then the
17 transport solution was aspirated and the cells were washed 3X with ice cold stop solution
18 (0.9% NaCl and 25mM dextrose). Subsequently the cells were lysed in 100µl 0.5N NaOH
19 and 5µl lysate was used for determination of protein concentration (by Bichinconic acid
20 assay: Sigma Aldrich), and rest of the lysate were used to measure cellular radioactivity in a
21 beta counter (Beckman Coulter, New Delhi, India).
22 Fatty acid oxidation
23 C2C12 myotubes plated in 12 well plates were treated with vehicle (0.1% DMSO) or 0.01µM
24 GTDF for 2h, 24h or 120h. Following treatment, the cells were washed 3X in warm HBS and
25 were then incubated with medium containing 0.75 mM palmitate (conjugated to 2% fatty acid 7
Diabetes Page 8 of 56
1 free BSA)/14C palmitate at 2 µCi/ml) for 2h. Following this incubation period, 1 ml of the
2 culture medium was removed and transferred to a sealable tube, the cap of which housed a
3 Whatman (GF/B) filter paper disc that had been presoaked with 1M potassium hydroxide.
14 4 CO2 trapped in the media were then released by acidification of media using 60% (vol/vol)
5 perchloric acid and gently agitating the tubes at 37°C for 2 h. Radioactivity that had become
6 adsorbed onto the filter discs were then be quantified by liquid scintillation counting in a
7 beta counter (Beckman Coulter).
8
9 Animal Experiments
10 Animal studies were approved by Institutional Animal Ethics Committee (IAEC) of Zydus
11 Research Centre, Ahmedabad. This facility is accredited to AALAC. Mice were individually
12 housed at 21◦C, in 12 h light:12 h dark cycles. All animals had access to normal chow diet
13 and water ad libitum. 12 week old male BL6 (25 30g), db/db or BKS db/db (45 50g) were
14 divided into different treatment groups randomly (db/db; n=8/group and BKS db/db;
15 n=6/group). Vehicle groups received 1% Carboxymethylcellulose and the other groups
16 received GTDF or pioglitazone (10mg/kg), once a day, by oral gavage for 30 days. Feed
17 intake and body weight were measured every day. Blood was obtained from tail snips and
18 glucose levels were measured using a glucometer. Glucose tolerance tests were performed on
19 day 29 after overnight fasting. Pyruvate tolerance test was performed on Day 31, after an
20 overnight fast. On day 32, the animals were fasted for six hours and sacrificed. Plasma and
21 tissues were collected and stored at 80oC until further analysis. Hepatic glycogen was
22 estimated using a glycogen assay kit. IPGTT, IPPTT, estimation of circulating biomarkers,
23 histology and immunohistochemistry were performed using standard procedures.
24 EDL muscle culture and treatment
8
Page 9 of 56 Diabetes
1 EDL muscle strips along with tendons were dissected out from anesthetized mice and were
2 tied to stainless steel clutch pins by the tendons, without stretching. Muscles were
3 preincubated for 30 min at 37°C in oxygenated (95% O2/5% CO2) Krebs–Henseleit solution
4 (pH 7.4), then again for 30 min in the same medium with or without 2.5 g/ml gAd or 0.1µM
5 GTDF. The incubation media were gassed continuously with 95% O2/5% CO2 through
6 hypodermic needle. At the end of this incubation, tendons were removed, the muscles were
7 blotted on gauze pads and snap frozen in liquid N2 and were stored at −80°C until further
8 analysis.
9
10 Data analysis and Statistics
11 Results are expressed as mean ± SEM. All data were analyzed using GraphPad Prism 5.0
12 (GraphPad, San Diego, CA). Animal data involving more than two groups were analyzed
13 using two way ANOVA followed by Bonferroni post test or one way ANOVA followed by
14 Tukey’s multiple comparison test as appropriate. In vitro or in vivo data involving two
15 experimental groups were analyzed using two tailed unpaired Student’s t test or Mann
16 Whitney U test as appropriate.
17
18 RESULTS
19 GTDF binds to AdipoRs and mimics adiponectin-associated signaling events in vitro.
20 We assessed GTDF, quercetin and its natural analogs (chemical structures in Fig. 1)
21 in a “peroxisome proliferator activated receptor (PPAR) α ligand activitation assay”, a
22 previously reported functional assay for AdipoRs (3), in HEK293 cells that express
23 endogenous AdipoR1 (3). All the quercetin analogs tested enhanced PPARα activity in
24 presence of PPARα agonist GW7647 (Fig. 2A). GTDF maximally activated the reporter at
25 0.01µM, while dihydroquercetin (DHQ) an enantiomer of the aglycone form of GTDF and 9
Diabetes Page 10 of 56
1 quercetin 6 C β D glucopyranoside (QCG) did so at 0.1µM, and quercetin, quercetin 3 O β
2 D glucopyranoside (QOG) or quercetin 3 O α L rhamnopyranoside (QR) caused maximal
3 activation at 1µM (Fig. 2A). Amplitudes of activation of PPARα ligand activity by GTDF
4 and gAd were comparable (Fig. 2B). GTDF did not activate PPARα in absence of GW7647,
5 indicating that it was not a PPARα agonist per se (Fig. 2C).
6 To assess if GTDF and AdipoRs could physically interact, we immobilized GTDF on
7 agarose beads and performed a pull down assay with purified plasma membrane from C2C12
8 myotubes that expressed both AdipoR1 and R2 (3). GTDF beads but not control beads
9 successfully pulled down AdipoR1 and R2, and free GTDF or QCG competed with this
10 binding (Fig. 2D). Cold GTDF competed with 125I adiponectin for binding to C2C12 cells in
11 a radioligand binding assay (Fig. 2E). Radioligand saturation assays with 125I labeled GTDF
12 (Fig. 2F) or 125I gAd (Supplementary Figure 2) revealed that both these ligands bound to
13 AdipoR deficient chinese hamster ovary (CHO) cells (25) transfected with AdipoR1 or R2
14 but not empty expression plasmids (Fig. 2G) (GTDF: Kd and BMAX; 4.90nM and
15 1410fmol/mg of protein for AdipoR1 and 326 nM and 3950 fmol/mg of protein for AdipoR2;
16 gAd: Kd and BMAX 0.25 g/ml and 130ng/mg for AdipoR1 and 0.526 g/ml and 200ng/mg for
17 AdipoR2). Thus GTDF displayed about 70 fold more affinity towards AdipoR1 over
18 AdipoR2.
19 Consistent with adiponectin associated rapid signaling events (1; 26) GTDF induced
20 AMPK, acetyl coA carboxylase (ACC), and p38 phosphorylation in C2C12 myotubes (Fig.
21 2H). While p38 phosphorylation was rapid and sustained, AMPK and ACC phosphorylation
22 peaked at 1 and 10 min respectively, and returned to the basal level at 60 min (Fig. 2H). A
23 similar pattern of AMPK and ACC phosphorylation by adiponectin has been reported earlier
24 (11).
10
Page 11 of 56 Diabetes
1 Apart from adiponectin glutamate receptors also activate AMPK and p38 (27), and we
2 therefore assessed if GTDF could modulate these two receptors, however, GTDF failed to
3 bind to or activate/repress any of the ionotropic or metabotropic glutamate receptors (mGlu),
4 while quercetin strongly activated mGlu2 and inhibited mGlu 4, 6 and 8 (Supplementary
5 Tables S1 and S2). To also assess if these signaling events were mediated through one or
6 more G protein coupled receptors (GPCR), GPCR modulation by GTDF was assessed and it
7 failed to activate or repress any of the 158 GPCRs tested (Supplementary Tables S3 and S4).
8 Consistent with its activation of adiponectin associated signaling, GTDF enhanced
9 mRNA and protein levels of factors associated with fatty acid transport [CD36 and fatty acid
10 binding protein 3 (FABP3)], oxidation [(carnityl palmitoyl transferase 1 b; CPT1B), long
11 chain fatty acyl CoA synthetase (FACS), acetyl CoA oxidase (ACOX1), PPARα and
12 PPARδ)], mitochondrial biogenesis (PPARγ coactivator 1α; PGC 1α), mitochondrial
13 uncoupling protein (UCP) 3, and glucose transporter 4 (Glut4), while lipoprotein lipase
14 (LPL) and PPARγ were unchanged (Fig. 2I and 2J). Adiponectin deacetylates and activates
15 PGC 1α via indirect activation of Sirt1 (26), and consistent with its indirect sirt1 activation
16 (20), GTDF too deacetylated PGC 1α in C2C12 myotubes (Fig. 2K). This PGC 1α induction
17 and activation led to increased mitochondrial DNA copy number (Fig. 2L). gAd enhances
18 basal glucose uptake (3; 11) and increases insulin sensitivity(28) in C2C12 myotubes, and in
19 consistence, GTDF too enhanced basal and insulin stimulated glucose uptake in these cells
20 (Fig. 2M). Further, GTDF also significantly enhanced basal and insulin dependent glucose
21 uptake in a C2C12 myotube model of palmitate induced insulin resistance (Fig. 2N). Similar
22 to rapid enhancement of fatty acid oxidation by adiponectin (3; 11; 29), GTDF significantly
23 enhanced 14C palmitate oxidation in C2C12 myotubes within 2h, which increased further
24 over time (Fig. 2O).
25 11
Diabetes Page 12 of 56
1 Overexpression or silencing of AdipoR1 augments or mitigates GTDF functions in vitro.
2 GTDF significantly enhanced insulin stimulated glucose uptake in CHO/HIRc cells
3 [CHO cells expressing ectopic human insulin receptor (30)] transfected with AdipoR1 but not
4 empty plasmid (Fig. 3A). Consistent with the binding studies AdipoR1 but not AdipoR2
5 overexpression in C2C12 myotubes significantly enhanced GTDF stimulated AMPK, ACC
6 and p38 phosphorylation (Fig. 3B). Small interfering RNA (siRNA) for AdipoR1
7 (siAdipoR1) but not control siRNA against luciferase (siC) abolished GTDF induced AMPK,
8 ACC and p38 phosphorylation, without affecting AdipoR2 expression. Further, GTDF
9 stimulated glucose uptake and fatty acid oxidation were abolished by siAdipoR1 (Fig. 3C-
10 3E), while insulin stimulated glucose uptake was unaltered (Fig. 3D). Together with Fig 1
11 and supplementary tables 1 4, these results demonstrate that GTDF action indeed is
12 AdipoR1 specific.
13
14 BKS.Cg-Dock7m +/+ Leprdb/db/J (BKS-db/db) mice have severely depleted plasma
15 membrane-associated AdipoR1 compared to B6.BKS(D)-Leprdb/db/J (db/db) mice.
16 A relevant animal model to test AdipoR specificity of GTDF would have been
17 AdipoR1/R2 knockout mice subjected to diet induced obesity. However, our inability to
18 obtain the knockout mice led us to search for an alternate model. Since chronic high level of
19 plasma insulin causes an AdipoR depletion mediated adiponectin resistance (31), we
20 systematically investigated AdipoR expression in major adiponectin target organs, across
21 different age groups in two different strains of leptin receptor deficient obese and diabetic
22 mice; db/db (in C57BL/6J background) and BKS db/db (in BLKS/J background), and wild
23 type healthy C57BL/6J (BL6).
24 Comparison of 12 week old male BL6, db/db and BKS db/db mice revealed that both
25 diabetic mice had lower AdipoR mRNAs in skeletal muscle, liver and eWAT compared to 12
Page 13 of 56 Diabetes
1 the healthy BL6 mice, however, between the diabetic strains only modest differences were
2 observed (Fig. 4A).
3 Examination of total and plasma membrane (PM) associated AdipoR protein levels
4 however, revealed striking differences between the two diabetic strains. While BKS db/db
5 displayed >80% decrease in total and PM associated and therefore functional AdipoR1
6 expression in skeletal muscle, BL6 and db/db did not show significant difference (Fig. 4B).
7 In liver, PM AdipoR1 but not AdipoR2 was strongly depleted (≥80%) in BKS db/db but not
8 in db/db, while compared to BL6 total AdipoR1 and R2 proteins were diminished in both. In
9 WAT, both diabetic strains displayed >90% reduction in total AdipoR1 protein compared to
10 BL6, while AdipoR2 protein was not detected (Fig. 4B). AdipoR2 could not be detected in
11 PM fraction of skeletal muscle (Fig. 4B) and we failed to generate enough PM extract from
12 WAT for immunoblotting. Together, compared to db/db and BL6, BKS db/db displayed
13 severely depleted total and PM AdipoR1 protein in skeletal muscle and liver at 12 weeks of
14 age. Consistent with this observation, gAd and GTDF failed to induce AMPK
15 phosphorylation in extensor digitorium longinus (EDL) muscles of BKS db/db, while it did
16 so in EDL muscles from both BL6 and db/db mice (Fig. 4C). Thus, based on above evidences
17 we selected 12 week old male db/db mice as adiponectin sensitive, and age and sex matched
18 BKS db/db as adiponectin resistant models for the in vivo pharmacological studies.
19
20 GTDF fails to improve diabetic phenotype in BKS-db/db mice.
21 Over a 30d treatment period, GTDF did not alter feed intake or body weight in BKS
22 db/db (Fig. 5A), while PPARγ agonist pioglitazone (Pio) significantly enhanced body weight
23 6d onwards without altering feed intake (Fig. 5B). GTDF failed to alter non fasting blood
24 glucose, fasting blood glucose and glucose clearance, while Pio significantly improved these
13
Diabetes Page 14 of 56
1 parameters (Fig. 5Cand 5D). GTDF failed to alter plasma glycated haemoglobin (HbA1c)
2 and insulin (Fig. 5E and 5F). GTDF was ineffective in improving the fasting lipid profile in
3 these mice, while pio modestly but significantly reduced plasma TG and VLDL (Fig. 5G).
4 These results indicate that GTDF is ineffective in BKS db/db mice that display severely
5 depleted AdipoR1 protein in skeletal muscle and liver. That pio improved glycemic
6 parameters in these mice further indicates that GTDF did not function through the PPARγ
7 pathway.
8
9 GTDF ameliorates diabetic phenotype in AdipoR1-expressing db/db mice.
10 In contrast to its inefficacy in BKS db/db (Fig. 5), GTDF was remarkably effective in
11 AdipoR1 expressing db/db mice. It reduced feed intake in db/db but not BL6 (Fig. 6A),
12 which could be correlated with a robust reduction in serum ghrelin (Fig. 6N). GTDF treated
13 db/db mice displayed reducing trend in body weight, which however was not statistically
14 significant (Fig. 6B) and showed significantly reduced adipose tissue weight (Supplementary
15 Figure 3). GTDF remarkably reduced nonfasting blood glucose in db/db mice on the 7th day
16 of treatment (Fig. 6C). Reduction in feed intake could not be responsible for the GTDF
17 induced reduction in nonfasting glucose level in db/db, as the feed intake was significantly
18 different only after 16d of treatment, while nonfasting blood glucose was drastically reduced
19 at the 7th day and did not fall any further.
20 GTDF modestly yet significantly reduced fasting blood glucose in db/db but not in
21 BL6 (Fig. 6D), which was associated with modestly reduced hepatic gluconeogenesis as
22 revealed by a pyruvate tolerance test (PTT) (Fig. 6E). GTDF treatment prevented increase in
23 HbA1c in db/db, which increased in the vehicle treated db/db during the treatment period
24 (Fig. 6F). In intraperitoneal glucose tolerance tests (IPGTT), GTDF treated db/db mice
14
Page 15 of 56 Diabetes
1 showed remarkably improved glucose clearance (Fig. 6G), however, both fasting insulin as
2 well as insulin levels during glucose challenge was higher in these mice over vehicle treated
3 controls, while they were unchanged in BL6 mice (Fig. 6G-6I). The enhanced insulin level
4 was associated with increase in pancreatic C peptide (Fig. 6J), indicating that insulin
5 production was higher in GTDF treated db/db mice. However, hypokalemia, generally
6 associated with higher insulin, was not observed (Fig. 6K).
7 Pancreatic histomorphometry revealed that in vehicle treated db/db mice, islet number
8 was diminished in comparison to BL6, and GTDF significantly increased it in the former but
9 not later (Fig. 6Land 6M). Furthermore, about 30% of the β cell population in the islets of
10 vehicle treated db/db mice were apoptotic as determined by TUNEL staining whilst GTDF
11 markedly attenuated the number of apoptotic β cells (Fig. 6L and 6M). The increased islet
12 number in GTDF treated db/db pancreas was not due to cellular proliferation as the islets
13 from these mice did not stain for the proliferation marker Ki 67 (Fig. 6l), indicating that
14 GTDF might protect beta cells from gluco and lipotoxicity induced apoptosis. Serum
15 glucagon level was unchanged (Fig. 6N).
16 Consistent with anti inflammatory properties of adiponectin, GTDF treatment in
17 db/db mice significantly lowered serum tumor necrosis factor alpha (TNFα), and interleukin
18 6 (IL6) showed a reducing trend, whilst monocyte / macrophage chemoattractant protein 1
19 (MCP 1) was unchanged (Fig. 6N). While serum adiponectin showed an increasing trend
20 upon GTDF treatment (p=0.082), leptin level was greatly diminished (Fig. 6N). We also
21 found a robust fall in serum corticosterone (Fig. 6N), indicating that GTDF might be cardio
22 protective. Analysis of serum lipid profile revealed significant reductions in total cholesterol,
23 triglyceride (TG), very low density lipoprotein (VLDL), non esterified fatty acids (NEFA)
24 and ketone bodies (β OH butyrate) which supports an enhanced fatty acid oxidation rate,
25 while it significantly enhanced high density lipoprotein (HDL) level (Fig. 6N), reiterating its 15
Diabetes Page 16 of 56
1 cardioprotective promise. Low–density lipoprotein (LDL) and creatinine levels were
2 unchanged (Fig. 6N). In light of the lipid profile data, we examined the hepatic histology, and
3 sections from GTDF treated db/db mice displayed no vacuolation and lipid accumulation,
4 while the vehicle treated db/db exhibited robust lipid accumulation (Fig. 6O). Hepatic
5 glycogen level was unchanged (Fig. 6P). Together, Fig. 5 and 6 indicated that GTDF stalls
6 diabetes progression in AdipoR expressing db/db mice and improves their overall metabolic
7 health, while it is ineffective in AdipoR1 depleted BKS db/db.
8 GTDF induces browning of white adipose tissue, evidence of involvements of direct and
9 indirect pathways.
10 GTDF induced and activated PGC 1α in myocytes and PGC 1α is reported to induce
11 FNDC5, a myokine that drives browning of myf 5 negative white adipocytes (32). GTDF
12 indeed enhanced FNDC5 expression in C2C12 myotubes and increased its secretion in
13 culture medium (Fig. 7A) indicating that it might induce FNDC5 in circulation and thereby
14 promote browning of WAT. Histological analysis of epididymal WAT (eWAT) from GTDF
15 treated db/db mice revealed robust fat mobilization characterized by reduction in adipocyte
16 size (Fig. 7B) and these eWATs stained strongly for the brown adipose marker UCP 1 (Fig.
17 7C), indicating that GTDF indeed induced a browning “like” phenomenon.
18 Adipocyte specific transgenic overexpression of adiponectin is reported to mobilize
19 WAT, enhance UCPs and decrease TNFα and leptin level in this tissue (33), indicating that
20 adiponectin may also promote a FNDC5 independent browning of WAT through a direct
21 action on adipocytes. Differentiation of 3T3L 1 cells in presence of GTDF from day 0 or day
22 2 of differentiation reduced oil droplet accumulation in these cells and significantly reduced
23 triglyceride content (Fig. 7D and 7E). Differentiation of 3T3L 1, mouse (epididymal) or
24 human SVFs in presence of GTDF enhanced expressions of UCP 1, UCP 2, PGC 1α, brown
25 adipose determination factor PRDM16, brown fat enriched protein CIDEA and adiponectin 16
Page 17 of 56 Diabetes
1 (Fig. 7F-7H). PRDM16 and ccaat/enhancer protein beta (C/EBPβ) transcriptional complex
2 has been implicated in conversion of myf 5 positive myoblasts into BAT (34), and GTDF
3 also induced the expression of c/EBPβ in 3T3L 1, mouse and human SVF (Fig. 7H),
4 indicating that this complex may play an important role in the browning phenomenon
5 observed here. Consistent with elevated browning markers, GTDF increased mitochondrial
6 DNA content in mouse SVFs (Fig. 7I). Notably; GTDF did not activate β adrenergic
7 receptors (Supplementary Tables 3 and 4 and Fig. 7J).
8
9
10 DISCUSSION
11 Following comprehensive molecular characterizations, we have identified GTDF as
12 an orally active, small molecule adiponectin mimic that improves metabolic parameters in a
13 preclinical disease setting and holds therapeutic promise in metabolic diseases caused by
14 adiponectin deficiency.
15 GTDF interacted with AdipoRs and displayed a 70 fold higher affinity for AdipoR1
16 over R2. It induced adiponectin associated rapid signaling, gene expressions and functional
17 events in C2C12 myotubes which were respectively augmented or abolished by AdipoR1
18 overexpression or silencing.
19 Our inability to procure AdipoR knock out mice inspired us to explore alternate
20 model systems and led to the identification of 12 week old male BKS db/db mice as
21 AdipoR1 deficient, while age and sex matched db/db mice were found to be AdipoR1 intact.
22 Intriguingly, these differences were not apparent at the mRNA level but were pronounced in
23 the protein level, especially at the level of PM associated and hence functional form of
24 AdipoR1 protein. These findings indicate that apart from transcriptional regulation by insulin
25 and Foxo1 (31), AdipoR1 expression and function may also be regulated by post 17
Diabetes Page 18 of 56
1 transcriptional or translational events. Interestingly, a recent report characterized a
2 developmentally regulated alternate splice variant of AdipoR1 in human subjects that was
3 strongly enhanced during skeletal muscle differentiation and was decreased in diabetic
4 patients, and the protein level of AdipoR1 accurately represented these changes but not total
5 mRNA levels that accounted for all AdipoR1 splice variants(35). Our data gains further
6 support from another recent report, which describes that microRNA 221 and the RNA
7 binding protein polypyrimidine tract binding protein regulate AdipoR1 protein expression
8 and are induced in genetic and diet induced mice models of obesity (36).
9 Consistent with AdipoR1 deficiency, BKS db/db mice were refractory to GTDF,
10 while metabolism in db/db mice was remarkably improved. Interestingly, GTDF reduced
11 feed intake in db/db mice from 16 day onwards. Effect of adiponectin on feed intake is
12 controversial and all three possible outcomes have been reported (37 39). While the reason
13 for these differences is unclear, strain of mice, mode of administration and the administered
14 form of adiponectin appear to be responsible. It however, is important to note that we
15 delivered GTDF by oral route, in contrast to systemic delivery or transgene based
16 overexpression of adiponectin, and thus GTDF may impact satiety related hormones from
17 gut. In agreement with this notion, plasma ghrelin level was greatly reduced in GTDF treated
18 db/db mice. Ghrelin is chiefly produced by P/D1 cells lining the fundus of stomach and given
19 the current lack of information regarding expression of AdipoRs in these cells it’s presently
20 unclear if GTDF mediated downregulation of ghrelin level is achieved through AdipoRs in
21 these cells. However, since GTDF did not alter feed intake in adiponectin insensitive BKS
22 db/db, it seems probable that these cells may express one or more AdipoRs which may act as
23 sensors for diet derived putative AdipoR ligands.
24 In addition to alteration in feed intake, GTDF remarkably reduced nonfasting blood
25 glucose that was significant from day 7 onwards and did not fall thereafter. GTDF also stalled 18
Page 19 of 56 Diabetes
1 the increase in HbA1c that was observed in vehicle treated db/db mice. Reduction in feed
2 intake could not account for these changes as earlier reports have demonstrated that caloric
3 restriction fails to not only decrease nonfasting blood glucose or HbA1c in db/db mice with
4 manifested diabetes (40 42) but also fails to prevent onset of hyperglycemia in db/db mice
5 pair fed for 5 weeks since weaning (43). That GTDF decreased feed intake in db/db only but
6 not in BL6 and BKS db/db, clearly indicates that toxicity was not involved. It’s further
7 supported by our earlier study where, GTDF not only normalized feed intake in high dose
8 dexamethasone treated wistar rats, it also prevented dexamethsone induced mortality (20).
9 While the effect of GTDF on nonfasting blood glucose and glucose clearance were
10 robust, it caused significant but modest decrease in fasting blood glucose and hepatic
11 gluconeogenesis. Since GTDF showed a preference for AdipoR1, and R2 is the principal
12 AdipoR in liver, it appears that GTDF mediated reduction of blood glucose might be
13 principally achieved by skeletal muscle’s AdipoR1 mediated glucose disposal, which is
14 supported by the fact that fasting hepatic glycogen was unaltered upon GTDF treatment.
15 However, a robust reduction in ketone bodies in GTDF treated db/db mice indicates that in
16 these animals the liver may efficiently oxidize them.
17 BKS db/db display much severe hyperglycemia than db/db and are susceptible to
18 terminal diabetes characterized by pancreatic β cell degranulation and death, while db/db
19 mice are protected from terminal diabetes due to the unique proliferation capacity of their β
20 cells (44). Thus, in older db/db mice hyperglycemia is corrected through a higher plasma
21 insulin level, although these mice remain severely dyslipidemic (44). In our experimental set
22 up, consistent with a lower plasma insulin (which although was still much higher than healthy
23 BL6) than db/db, the BKS db/db mice indeed exhibited higher fasting and nonfasting blood
24 glucose. However, β cell proliferation was yet not apparent in db/db as evidenced by lack of
25 Ki67 staining; indicating that during the experimental period the db/db β cells did not yet go 19
Diabetes Page 20 of 56
1 on a proliferative drive. Further, about 30% of β cells from db/db mice were apoptotic and
2 GTDF strongly mitigated this apoptosis without increasing proliferation, indicating that
3 GTDF may protect these cells from gluco and lipotoxic stresses and a similar finding has
4 been reported for adiponectin (45).
5 Despite higher plasma insulin, GTDF treated db/db mice were not hypokalemic and
6 displayed a remarkably improved lipid profile evidenced by decreased serum total
7 cholesterol, TG, VLDL and NEFA and increased HDL, which together with a marked decline
8 in plasma corticosterone in these mice, indicates that GTDF may have cardioprotective
9 properties. NEFA are breakdown products of TG that are released from adipocytes following
10 lipolysis and are important in diabetic pathogenesis (46). The marked decline in plasma
11 NEFA suggests that in GTDF treated db/db mice NEFA were either utilized with robust
12 efficiency in liver and skeletal muscle, or adipose TG were efficiently oxidized in situ, or a
13 combination of both. These postulates could be corroborated by the facts that livers of
14 GTDF treated db/db were free from vacuolation and oil droplets which were
15 characteristically present in vehicle treated db/db mice, and eWAT depot in GTDF treated
16 db/db mice showed robust mobilization and increased UCP 1 expression. Since both db/db
17 and BKS db/db displayed depleted AdipoR1 protein in eWAT, it is possible that GTDF
18 caused browning of eWAT through an indirect mechanism involving previously described
19 PGC 1α induced myokine; FNDC5/irisin (32). Consistent with PGC 1α induction and
20 activation, GTDF induced FNDC5 expression in C2C12 myotubes and its release in culture
21 medium. In addition, GTDF was also capable of directly inducing brown adipose markers
22 and increasing mitochondrial content in 3T3L 1, mouse and human SVFs differentiated in its
23 presence, indicating that GTDF may protect against energy imbalance related metabolic
24 diseases. However, further studies including GTDF’s effect on energy expenditure is needed
25 to fully understand and realize its potential. 20
Page 21 of 56 Diabetes
1 While this manuscript was under review, Okada Iwabu et al reported identification and
2 characterization of a small molecule AdipoR agonist; Adiporon (47). While Adiporon is 2 (4
3 Benzoylphenoxy) N [1 (phenylmethyl) 4 piperidinyl]acetamide, GTDF is a flavone c
4 glucoside and these compounds do not share any structural homology. Functionally, adiporon
5 showed comparable affinity to both AdipoR1 and R2 and acted through both these receptors
6 to bring about physiological improvements in diabetic mice, while GTDF showed a stronger
7 affinity for AdipoR1 and given its modest effects on hepatic gluconeogenesis, appears to act
8 mainly via AdipoR1. Incidentally, another recent report identified DHQ (also known as
9 taxifoliol) as one of 9 small molecule AdipoR agonists from a library of 10,000 compounds
10 by a fluorescent polarization based screen, however, the in vivo efficacy of DHQ is yet to be
11 elucidated (48). DHQ is an enantiomer of the aglycone form of GTDF and was active in our
12 PPARα ligand activation as well, albeit at a 10 fold higher concentration than GTDF. In
13 contrast to GTDF, DHQ displays a stronger affinity for AdipoR2 (48) and thus studies with
14 DHQ alone or in combination with GTDF will be needed to further explore their therapeutic
15 potential in metabolic diseases.
16 In conclusion, discovery of GTDF as a small molecule adiponectin mimetic, that
17 remarkably improves metabolic health in diabetic mice provides a promising therapeutic tool
18 for treatment of adiponectin deficiency associated metabolic diseases. However, given the
19 lack of AdipoR knock out animal models in this study, it remains to be confirmed if all the
20 beneficial metabolic effects of GTDF were indeed routed through AdipoRs alone.
21
22 ACKNOWLEDGEMENTS
23 This work was supported by CSIR grant BSC0201 to SS and NC. AKS was supported by
24 fellowship from CSIR. MY, MPK were supported by ICMR fellowships, JSM, NS, JH were
25 supported by fellowships from UGC, KK was supported by DBT fellowship. 21
Diabetes Page 22 of 56
1
2 AKS, MPK, JSM, NS, MY, KK, DPM, RM, ShS, AKT, JRG, NC and SS have a pending
3 patent pertaining to some of the works in this manuscript. AAJ, NAD, MRJ are employees of
4 Zydus Research Center the research and development arm of Cadila Health Care limited,
5 Ahmedabad, India. This study was in no way sponsored or funded by an industry.
6
7 Part of the work was presented as an abstract in the “International Symposium on Molecular
8 Signaling” held at Visva Bharati University, Santiniketan, India from February 18 21, 2013.
9
10 SS conceived the study. AKS, AAJ, JRG, MMG, NC and SS designed experiments. AKS,
11 AAJ, JSM, MPK, NS, MY, KK, JH, SK, NAD, DPM and MMG performed experiments.
12 MRJ, RM, AKT, MMG, NC, JRG and SS supervised experiments. ShS provided materials
13 and contributed to discussion. AKT, JRG, contributed to discussion. All authors analyzed
14 data. SS and NC contributed to discussion, wrote, edited and reviewed the manuscript. SS is
15 the guarantor of this work and, as such, had full access to all the data in the study and takes
16 responsibility for the integrity of the data and the accuracy of the data analysis.
17
18 Authors acknowledge Sophisticated Analytical Instrument Facility in CSIR CDRI for help
19 with confocal microscopy. The authors acknowledge Prem N Yadav, Ph.D. (Division of
20 Pharmacology, CSIR, CDRI) for help with designing of the radioligand binding assays and
21 Durga Prasad Mishra, Ph.D. (Division of Endocrinology, CSIR CDRI) for sharing antibodies.
22
23 REFERENCES
24 1. Kadowaki T, Yamauchi T: Adiponectin and adiponectin receptors. Endocr Rev 2005;26:439 451 25 2. Robinson K, Prins J, Venkatesh B: Clinical review: adiponectin biology and its role in 26 inflammation and critical illness. Crit Care 2011;15:221
22
Page 23 of 56 Diabetes
1 3. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara 2 K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, 3 Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T: 4 Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003;423:762 5 769 6 4. Hug C, Wang J, Ahmad NS, Bogan JS, Tsao TS, Lodish HF: T cadherin is a receptor for hexameric 7 and high molecular weight forms of Acrp30/adiponectin. Proceedings of the National Academy of 8 Sciences of the United States of America 2004;101:10308 10313 9 5. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, Iwahashi H, Kuriyama H, 10 Ouchi N, Maeda K, Nishida M, Kihara S, Sakai N, Nakajima T, Hasegawa K, Muraguchi M, Ohmoto 11 Y, Nakamura T, Yamashita S, Hanafusa T, Matsuzawa Y: Plasma concentrations of a novel, adipose 12 specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol 13 2000;20:1595 1599 14 6. Li S, Shin HJ, Ding EL, van Dam RM: Adiponectin levels and risk of type 2 diabetes: a systematic 15 review and meta analysis. Jama 2009;302:179 188 16 7. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, Tataranni PA: 17 Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and 18 hyperinsulinemia. J Clin Endocrinol Metab 2001;86:1930 1935 19 8. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE: The adipocyte secreted protein Acrp30 20 enhances hepatic insulin action. Nature medicine 2001;7:947 953 21 9. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, 22 Tsuboyama Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, 23 Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, Kadowaki T: The 24 fat derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and 25 obesity. Nature medicine 2001;7:941 946 26 10. Fruebis J, Tsao TS, Javorschi S, Ebbets Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF: 27 Proteolytic cleavage product of 30 kDa adipocyte complement related protein increases fatty acid 28 oxidation in muscle and causes weight loss in mice. Proceedings of the National Academy of Sciences 29 of the United States of America 2001;98:2005 2010 30 11. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, 31 Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, 32 Kadowaki T: Adiponectin stimulates glucose utilization and fatty acid oxidation by activating AMP 33 activated protein kinase. Nature medicine 2002;8:1288 1295 34 12. Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, Uchida S, Ito Y, Takakuwa K, 35 Matsui J, Takata M, Eto K, Terauchi Y, Komeda K, Tsunoda M, Murakami K, Ohnishi Y, Naitoh T, 36 Yamamura K, Ueyama Y, Froguel P, Kimura S, Nagai R, Kadowaki T: Globular adiponectin 37 protected ob/ob mice from diabetes and ApoE deficient mice from atherosclerosis. The Journal of 38 biological chemistry 2003;278:2461 2468 39 13. Holland WL, Miller RA, Wang ZV, Sun K, Barth BM, Bui HH, Davis KE, Bikman BT, Halberg 40 N, Rutkowski JM, Wade MR, Tenorio VM, Kuo MS, Brozinick JT, Zhang BB, Birnbaum MJ, 41 Summers SA, Scherer PE: Receptor mediated activation of ceramidase activity initiates the 42 pleiotropic actions of adiponectin. Nature medicine 2011;17:55 63 43 14. Hu E, Liang P, Spiegelman BM: AdipoQ is a novel adipose specific gene dysregulated in obesity. 44 The Journal of biological chemistry 1996;271:10697 10703 45 15. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF: A novel serum protein similar to 46 C1q, produced exclusively in adipocytes. The Journal of biological chemistry 1995;270:26746 26749 47 16. Shapiro L, Scherer PE: The crystal structure of a complement 1q family protein suggests an 48 evolutionary link to tumor necrosis factor. Curr Biol 1998;8:335 338 49 17. Tsao TS, Murrey HE, Hug C, Lee DH, Lodish HF: Oligomerization state dependent activation of 50 NF kappa B signaling pathway by adipocyte complement related protein of 30 kDa (Acrp30). The 51 Journal of biological chemistry 2002;277:29359 29362 52 18. Tsao TS, Tomas E, Murrey HE, Hug C, Lee DH, Ruderman NB, Heuser JE, Lodish HF: Role of 53 disulfide bonds in Acrp30/adiponectin structure and signaling specificity. Different oligomers activate 54 different signal transduction pathways. The Journal of biological chemistry 2003;278:50810 50817 23
Diabetes Page 24 of 56
1 19. Sharan K, Mishra JS, Swarnkar G, Siddiqui JA, Khan K, Kumari R, Rawat P, Maurya R, Sanyal 2 S, Chattopadhyay N: A novel quercetin analogue from a medicinal plant promotes peak bone mass 3 achievement and bone healing after injury and exerts an anabolic effect on osteoporotic bone: the role 4 of aryl hydrocarbon receptor as a mediator of osteogenic action. J Bone Miner Res 2011;26:2096 5 2111 6 20. Khan MP, Mishra JS, Sharan K, Yadav M, Singh AK, Srivastava A, Kumar S, Bhaduaria S, 7 Maurya R, Sanyal S, Chattopadhyay N: A novel flavonoid C glucoside from Ulmus wallichiana 8 preserves bone mineral density, microarchitecture and biomechanical properties in the presence of 9 glucocorticoid by promoting osteoblast survival: A comparative study with human parathyroid 10 hormone. Phytomedicine : international journal of phytotherapy and phytopharmacology 2013; 11 21. Nieman DC, Williams AS, Shanely RA, Jin F, McAnulty SR, Triplett NT, Austin MD, Henson 12 DA: Quercetin's influence on exercise performance and muscle mitochondrial biogenesis. Med Sci 13 Sports Exerc 42:338 345 14 22. Jeong SM, Kang MJ, Choi HN, Kim JH, Kim JI: Quercetin ameliorates hyperglycemia and 15 dyslipidemia and improves antioxidant status in type 2 diabetic db/db mice. Nutr Res Pract 16 2012;6:201 207 17 23. Nieman DC, Williams AS, Shanely RA, Jin F, McAnulty SR, Triplett NT, Austin MD, Henson 18 DA: Quercetin's influence on exercise performance and muscle mitochondrial biogenesis. Medicine 19 and science in sports and exercise 2010;42:338 345 20 24. Dwivedi SK, Singh N, Kumari R, Mishra JS, Tripathi S, Banerjee P, Shah P, Kukshal V, Tyagi 21 AM, Gaikwad AN, Chaturvedi RK, Mishra DP, Trivedi AK, Sanyal S, Chattopadhyay N, 22 Ramachandran R, Siddiqi MI, Bandyopadhyay A, Arora A, Lundasen T, Anakk SP, Moore DD, 23 Sanyal S: Bile acid receptor agonist GW4064 regulates PPARgamma coactivator 1alpha expression 24 through estrogen receptor related receptor alpha. Molecular endocrinology 2011;25:922 932 25 25. Neumeier M, Weigert J, Schaffler A, Weiss T, Kirchner S, Laberer S, Scholmerich J, Buechler C: 26 Regulation of adiponectin receptor 1 in human hepatocytes by agonists of nuclear receptors. Biochem 27 Biophys Res Commun 2005;334:924 929 28 26. Iwabu M, Yamauchi T, Okada Iwabu M, Sato K, Nakagawa T, Funata M, Yamaguchi M, Namiki 29 S, Nakayama R, Tabata M, Ogata H, Kubota N, Takamoto I, Hayashi YK, Yamauchi N, Waki H, 30 Fukayama M, Nishino I, Tokuyama K, Ueki K, Oike Y, Ishii S, Hirose K, Shimizu T, Touhara K, 31 Kadowaki T: Adiponectin and AdipoR1 regulate PGC 1alpha and mitochondria by Ca(2+) and 32 AMPK/SIRT1. Nature 2010;464:1313 1319 33 27. Kim JH, Lee JO, Lee SK, Moon JW, You GY, Kim SJ, Park SH, Park JM, Lim SY, Suh PG, Uhm 34 KO, Song MS, Kim HS: The glutamate agonist homocysteine sulfinic acid stimulates glucose uptake 35 through the calcium dependent AMPK p38 MAPK protein kinase C zeta pathway in skeletal muscle 36 cells. The Journal of biological chemistry 2011;286:7567 7576 37 28. Wang C, Mao X, Wang L, Liu M, Wetzel MD, Guan KL, Dong LQ, Liu F: Adiponectin sensitizes 38 insulin signaling by reducing p70 S6 kinase mediated serine phosphorylation of IRS 1. The Journal of 39 biological chemistry 2007;282:7991 7996 40 29. Yoon MJ, Lee GY, Chung JJ, Ahn YH, Hong SH, Kim JB: Adiponectin increases fatty acid 41 oxidation in skeletal muscle cells by sequential activation of AMP activated protein kinase, p38 42 mitogen activated protein kinase, and peroxisome proliferator activated receptor alpha. Diabetes 43 2006;55:2562 2570 44 30. Wilden PA, Backer JM, Kahn CR, Cahill DA, Schroeder GJ, White MF: The insulin receptor with 45 phenylalanine replacing tyrosine 1146 provides evidence for separate signals regulating cellular 46 metabolism and growth. Proceedings of the National Academy of Sciences of the United States of 47 America 1990;87:3358 3362 48 31. Tsuchida A, Yamauchi T, Ito Y, Hada Y, Maki T, Takekawa S, Kamon J, Kobayashi M, Suzuki 49 R, Hara K, Kubota N, Terauchi Y, Froguel P, Nakae J, Kasuga M, Accili D, Tobe K, Ueki K, Nagai 50 R, Kadowaki T: Insulin/Foxo1 pathway regulates expression levels of adiponectin receptors and 51 adiponectin sensitivity. The Journal of biological chemistry 2004;279:30817 30822 52 32. Bostrom P, Wu J, Jedrychowski MP, Korde A, Ye L, Lo JC, Rasbach KA, Bostrom EA, Choi JH, 53 Long JZ, Kajimura S, Zingaretti MC, Vind BF, Tu H, Cinti S, Hojlund K, Gygi SP, Spiegelman BM:
24
Page 25 of 56 Diabetes
1 A PGC1 alpha dependent myokine that drives brown fat like development of white fat and 2 thermogenesis. Nature 2012;481:463 468 3 33. Bauche IB, El Mkadem SA, Pottier AM, Senou M, Many MC, Rezsohazy R, Penicaud L, Maeda 4 N, Funahashi T, Brichard SM: Overexpression of adiponectin targeted to adipose tissue in transgenic 5 mice: impaired adipocyte differentiation. Endocrinology 2007;148:1539 1549 6 34. Kajimura S, Seale P, Kubota K, Lunsford E, Frangioni JV, Gygi SP, Spiegelman BM: Initiation of 7 myoblast to brown fat switch by a PRDM16 C/EBP beta transcriptional complex. Nature 8 2009;460:1154 1158 9 35. Ashwal R, Hemi R, Tirosh A, Gordin R, Yissachar E, Cohen Dayag A, Rosenberg A, Karasik A, 10 Bluher M, Kanety H: Differential expression of novel adiponectin receptor 1 transcripts in skeletal 11 muscle of subjects with normal glucose tolerance and type 2 diabetes. Diabetes 2011;60:936 946 12 36. Lustig Y, Barhod E, Ashwal Fluss R, Gordin R, Shomron N, Baruch Umansky K, Hemi R, 13 Karasik A, Kanety H: RNA binding protein PTB and microRNA 221 co regulate AdipoR1 translation 14 and adiponectin signaling. Diabetes 2013; 15 37. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, Eto K, Yamashita T, Kamon 16 J, Satoh H, Yano W, Froguel P, Nagai R, Kimura S, Kadowaki T, Noda T: Disruption of adiponectin 17 causes insulin resistance and neointimal formation. The Journal of biological chemistry 18 2002;277:25863 25866 19 38. Qi Y, Takahashi N, Hileman SM, Patel HR, Berg AH, Pajvani UB, Scherer PE, Ahima RS: 20 Adiponectin acts in the brain to decrease body weight. Nature medicine 2004;10:524 529 21 39. Shklyaev S, Aslanidi G, Tennant M, Prima V, Kohlbrenner E, Kroutov V, Campbell Thompson 22 M, Crawford J, Shek EW, Scarpace PJ, Zolotukhin S: Sustained peripheral expression of transgene 23 adiponectin offsets the development of diet induced obesity in rats. Proceedings of the National 24 Academy of Sciences of the United States of America 2003;100:14217 14222 25 40. Tonra JR, Ono M, Liu X, Garcia K, Jackson C, Yancopoulos GD, Wiegand SJ, Wong V: Brain 26 derived neurotrophic factor improves blood glucose control and alleviates fasting hyperglycemia in 27 C57BLKS Lepr(db)/lepr(db) mice. Diabetes 1999;48:588 594 28 41. Chen D, Liao J, Li N, Zhou C, Liu Q, Wang G, Zhang R, Zhang S, Lin L, Chen K, Xie X, Nan F, 29 Young AA, Wang MW: A nonpeptidic agonist of glucagon like peptide 1 receptors with efficacy in 30 diabetic db/db mice. Proceedings of the National Academy of Sciences of the United States of 31 America 2007;104:943 948 32 42. Sleeman MW, Garcia K, Liu R, Murray JD, Malinova L, Moncrieffe M, Yancopoulos GD, 33 Wiegand SJ: Ciliary neurotrophic factor improves diabetic parameters and hepatic steatosis and 34 increases basal metabolic rate in db/db mice. Proceedings of the National Academy of Sciences of the 35 United States of America 2003;100:14297 14302 36 43. Bates SH, Kulkarni RN, Seifert M, Myers MG, Jr.: Roles for leptin receptor/STAT3 dependent 37 and independent signals in the regulation of glucose homeostasis. Cell Metab 2005;1:169 178 38 44. Davis RC, Castellani LW, Hosseini M, Ben Zeev O, Mao HZ, Weinstein MM, Jung DY, Jun JY, 39 Kim JK, Lusis AJ, Peterfy M: Early hepatic insulin resistance precedes the onset of diabetes in obese 40 C57BLKS db/db mice. Diabetes 2010;59:1616 1625 41 45. Wijesekara N, Krishnamurthy M, Bhattacharjee A, Suhail A, Sweeney G, Wheeler MB: 42 Adiponectin induced ERK and Akt phosphorylation protects against pancreatic beta cell apoptosis 43 and increases insulin gene expression and secretion. The Journal of biological chemistry 44 2010;285:33623 33631 45 46. Karpe F, Dickmann JR, Frayn KN: Fatty acids, obesity, and insulin resistance: time for a 46 reevaluation. Diabetes 2011;60:2441 2449 47 47. Okada Iwabu M, Yamauchi T, Iwabu M, Honma T, Hamagami K, Matsuda K, Yamaguchi M, 48 Tanabe H, Kimura Someya T, Shirouzu M, Ogata H, Tokuyama K, Ueki K, Nagano T, Tanaka A, 49 Yokoyama S, Kadowaki T: A small molecule AdipoR agonist for type 2 diabetes and short life in 50 obesity. Nature 2013;503:493 499 51 48. Sun Y, Zang Z, Zhong L, Wu M, Su Q, Gao X, Zan W, Lin D, Zhao Y, Zhang Z: Identification of 52 adiponectin receptor agonist utilizing a fluorescence polarization based high throughput assay. PloS 53 one 2013;8:e63354
25
Diabetes Page 26 of 56
1 49. Sharan K, Swarnkar G, Siddiqui JA, Kumar A, Rawat P, Kumar M, Nagar GK, Manickavasagam 2 L, Singh SP, Mishra G, Wahajuddin, Jain GK, Maurya R, Chattopadhyay N: A novel flavonoid, 6 C 3 beta d glucopyranosyl (2S,3S) (+) 3',4',5,7 tetrahydroxyflavanone, isolated from Ulmus wallichiana 4 Planchon mitigates ovariectomy induced osteoporosis in rats. Menopause 2010;17:577 586 5 50. Siddiqui JA, Sharan K, Swarnkar G, Rawat P, Kumar M, Manickavasagam L, Maurya R, Pierroz 6 D, Chattopadhyay N: Quercetin 6 C beta D glucopyranoside isolated from Ulmus wallichiana 7 planchon is more potent than quercetin in inhibiting osteoclastogenesis and mitigating ovariectomy 8 induced bone loss in rats. Menopause 2011;18:198 207 9 51. Siddiqui JA, Swarnkar G, Sharan K, Chakravarti B, Gautam AK, Rawat P, Kumar M, Gupta V, 10 Manickavasagam L, Dwivedi AK, Maurya R, Chattopadhyay N: A naturally occurring rare analog of 11 quercetin promotes peak bone mass achievement and exerts anabolic effect on osteoporotic bone. 12 Osteoporos Int 2011;22:3013 3027 13 52. Kumar M, Rawat P, Dixit P, Mishra D, Gautam AK, Pandey R, Singh D, Chattopadhyay N, 14 Maurya R: Anti osteoporotic constituents from Indian medicinal plants. Phytomedicine : international 15 journal of phytotherapy and phytopharmacology 2010;17:993 999 16 53. Hosseinimehr SJ, Tolmachev V, Stenerlow B: 125I labeled quercetin as a novel DNA targeted 17 radiotracer. Cancer biotherapy & radiopharmaceuticals 2011;26:469 475
18
19 20 FIGURE LEGENDS 21 22 Fig. 1. Chemical structures of quercetin and its natural analogs.
23 (A) Quercetin (B) (2R, 3R) dihydroquercetin (C) 6 C β D glucopyranosyl (2S, 3S) (+)
24 5,7, 3',4' tetrahydroxydihydroflavonol (GTDF). (D) Quercetin 6 C β D glucopyranoside
25 (QCG). (E) Quercetin 3 O β D glucopyranoside (QOG). (F) Quercetin 3 O α L
26 rhamnopyranoside (QR). GTDF, QCG and DHQ were isolated from the stem bark of Ulmus
27 wallichiana Planchon (19; 49 51). QR was prepared from stems of Cissus quadrangularis
28 (52). Quercetin and QOG were procured from Sigma Aldrich (St. Louis, MO). Purity of
29 GTDF, DHQ, QCG and QR were > 98%; quercetin was > 95% and QOG was >90%.
30
31 Fig. 2. GTDF is an AdipoR agonist that elicits adiponectin-associated signaling and
32 functional events
33 (A-C) PPARα ligand activation assay in HEK 293 cells transfected with Gal4 UAS Luc and
34 Gal4 PPARα. 24h after transfection cells were treated as indicated, luciferase activities were
35 normalized with GFP fluorescence obtained from cotransfected eGFPC1 plasmid; used as a
26
Page 27 of 56 Diabetes
1 transfection control. (A) Data is plotted as activity of compounds in presence of PPARα
2 agonist GW7647 at its effective concentration 10 (EC10: 0.001µM) over luciferase activity
3 obtained in presence of GW7647 alone. (B) Comparison of GTDF with gAd (0.1µg/ml). (C)
4 GTDF activity in absence of GW7647. (D) GTDF was immobilized on epoxy agarose beads
5 and GTDF beads or mock treated control beads were incubated with 50µg plasma membrane
6 extracts from C2C12 myotubes in presence or absence of 100 fold molar excess of GTDF or QCG,
7 following washes the complexes were resolved by SDS PAGE and were analyzed by immunoblotting
8 (see Supplementary Figure 1 for antibody validation data; anti AdipoR1 also detected AdipoR2 in
9 agreement with the supplier information). (E) Competition radioligand binding assay. C2C12
10 myotubes in 12 well plates were incubated with 2µl of 10µCi/ml mouse 125I gAd with or
11 without cold GTDF in PBS supplemented with 0.1% BSA for 12h, following which cells
12 were washed and lysed. A portion of the lysate was used for protein estimation and rest was
13 quantitated in a gamma counter. Nonspecific binding was determined with a 200 fold excess
14 of cold gAd. Specific binding was calculated by subtracting nonspecific binding from the
15 total binding. The count per minute (CPM) was normalized with protein concentration and
16 plotted as % binding compared to wells without cold GTDF. (F) 125I GTDF was prepared by
17 chloramine T method as described elsewhere (53) and research design and methods, and
18 purified by thin layer chromatography (TLC). A representative reverse phase TLC result
19 showing blank reaction (upper panel) and 125I GTDF (lower panel) is shown. 125I did not
20 move in the TLC with mobile phase methanol water (40% 60%). (G) CHO cells transfected
21 with AdipoR1, AdipoR2 or empty expression plasmids in 12 well plates were incubated with
22 increasing concentrations of 125I GTDF (specific activity 178.2 Ci/ mmol) for 2h at 40C (at 2h
23 the binding equilibrium was established). The cells were then washed and processed as in 2F.
24 (H) Immunoblot analysis in C2C12 myotubes treated with or without GTDF for indicated
25 times. Densitometric analysis of three independent blots using Image J software is given in
27
Diabetes Page 28 of 56
1 the right panel. (I) Quantitative polymerase chain reaction (QPCR) based determination of
2 gene expression in C2C12 myotubeswas performed on a LightCycler 480 (Roche
3 Diagnostics, Mannheim, Germany) using SYBR green chemistry (oligonucleotide sequences
4 in Supplementary Table 5) data were analyzed by CT method using β actin as
5 normalization control. (J) Immunoblotting in C2C12 myotubes treated with GTDF. (K) Co
6 immunoprecipitation followed by immuno detection of acetylated PGC 1α. Whole cell
7 extract from C2C12 myotubes were precleared with protein A sepharose and IgG isotype and
8 were incubated with PGC 1α antibody (2µg/reaction) for 3h. Complexes were resolved on
9 8% SDS PAGE and were probed with Ac Lys antibody. (L) Mitochondrial DNA content
10 determination by QPCR in C2C12 myotubes treated for 48h with GTDF. (M) Glucose uptake
11 in C2C12 myotubes. C2C12 myotubes in 24 well plates were treated with vehicle or GTDF
12 for 24h. Cells were then washed and treated with 0.1µM insulin for 20 min and glucose
13 uptake was quantified as described in research design and methods. (N) C2C12 myotubes
14 were rendered insulin resistant by incubation in 500µM palmitate for 24h (control groups
15 received 4% BSA). GTDF group received 0.01µM GTDF for 12h. Glucose uptake studies
16 were performed as described in figure 2M. (O) Fatty acid oxidation in C2C12 myotubes.
17 C2C12 myotubes in 12 well plates were treated with vehicle (0h) or GTDF for 2h, 24h or
18 120h. Following incubation, fatty acid oxidation was assessed as described in research design
19 and methods. Data are mean ± SEM of 3 (A-C, E, G-I,, K, M-O), or 6 independent
20 experiments (L). All images are representatives of 3 independent experiments. GTDF
21 concentration in all experiments was 0.01µM or as indicated. V; Vehicle. *p<0.05, **p<0.01,
22 ***p<0.001.
23
24 Fig. 3. Overexpression or knockdown of AdipoR1 enhances or mitigates GTDF action
25 respectively 28
Page 29 of 56 Diabetes
1 (A) Immunoblot analysis of C2C12 myotubes transfected with vector or AdipoRs. (B)
2 Immunoblot analysis of C2C12 myotubes transfected with luciferase siRNA (siC) or siRNAs
3 against AdipoR1. (C) Glucose uptake in C2C12 myotubes transfected with indicated siRNAs.
4 Data are mean ± SEM of 4 independent experiments. (D) Fatty acid oxidation in C2C12
5 myotubes transfected with indicated siRNAs. Data are mean ± SEM of 3 independent
6 experiments. In all graphs Images are representative of 3 independent experiments. GTDF
7 concentration in all experiments was 0.01µM. Note: anti AdipoR1 also detects AdipoR2.
8 *p<0.05, **p<0.01, ***p<0.001.
9
10 Fig. 4. Comparison of mRNA and protein expression of AdipoRs and evaluation of
11 adiponectin sensitivity in BL6, db/db or BKS- db/db mice.
12 12 week old male mice (n=3/group) were assessed for (A) AdipoR mRNA expression and
13 (B) total or PM associated AdipoR protein levels in skeletal muscle (quadriceps), liver or
14 eWAT. Bar graphs represent densitometric analysis. β actin and N cadherin were used as
15 loading controls. Note: anti AdipoR1 also detects AdipoR2.(C). EDL muscles excised from
16 12 week old BL6, db/db or BKS db/db mice were treated with 2.5 g/ml gAd or vehicle for
17 30 min as described in research designs and methods. Total protein was then isolated and
18 analyzed for pAMPK and AMPK expression. *p<0.05, **p<0.01, ***p<0.001 in comparison
19 to BL6. ##p<0.01compared to db/db.
20
21 Fig. 5. GTDF but not pioglitazone fails to improve metabolic health in BKS-db/db
22 12 week old male db/db mice (n=6/group) were fed vehicle, 10mg/kg GTDF or Pio for 30
23 days. (A) Feed intake. (B) Body weight. (C) Nonfasting blood glucose was analyzed using a
24 glucometer capable of measuring 20 900 mg/dl glucose in whole blood (Gluco Dr.
25 Supersensor (Gyeonggi do, South Korea). (D) IPGTT; Glucose was intraperitoneally 29
Diabetes Page 30 of 56
1 administered in mice (1g/kg body weight) and at indicated time points blood was collected
2 from tail snips and blood glucose was measured by a glucometer. Inset represents area under
3 the curve (AUC). (E) Glycated haemoglobin level; vehicle vs GTDF 9.9±0.4% vs 9.3 ± 0.3%
4 (84.33 ± 4.29 vs 78.17±2.96 fmol/mol) (F) Fasting insulin was estimated by ELISA (G)
5 Fasting serum lipid profile.. *p<0.05, **p<0.01, ***p<0.001.
6
7 Fig. 6. GTDF improves metabolic parameters in db/db mice
8 12 week old db/db or BL6 mice were fed vehicle or 10mg/kg GTDF for 30 days; n=8/group.
9 (A) Feed intake. (B) Body weight. (C) Nonfasting blood glucose. (D) Fasting blood glucose.
10 (E) PTT; Mice were intraperitoneally administered sodium pyruvate (1g/kg body weight) and
11 blood collected from tail snips were analyzed by a glucometer. Inset represents AUC. (F)
12 Glycated haemoglobin level; graph represents mean ± SEM. HbA1c was comparable between
13 vehicle and GTDF group on 0d; Mean±SD; 8.7±1.03% vs 8.72 ±1.17% (72.0±11.1 vs
14 72±12.8fmol/mol) but was significantly lowered in GTDF treated group after 30d V vs
15 GTDF; 10.53±0.54% vs 9±0.93% (91±5.9 vs 75±10.2 fmol/mol) (G) IPGTT, inset represents
16 AUC. (H) Insulin level during IPGTT; Blood collected from tail snips at indicated time
17 points during GTT was used for insulin measurement by ELISA. Inset, represents AUC. (I)
18 Fasting insulin. (J) Serum pancreatic C peptide level (K) Serum Na+ and K+ levels. (L)
19 Microscopic images from immunostaining of pancreas sections by anti insulin antibody; top
20 two panels; diaminobenzidine (DAB) staining (light microscopy; Leica DMI6000 B), third
21 and fourth panels from above; confocal microscopy (Carl Zeiss LSM 510 Meta).
22 Immunofluorescence for insulin (green), DAPI (blue) and TUNEL (red), or insulin, DAPI
23 and Ki 67 (red); by confocal microscopy are shown. (M) Histomorphometry of pancreatic
24 islets was performed using Image –Pro plus (6.1) software (MediaCybernetics), where two
25 investigators separately evaluated 10 random sections probed with insulin antibody from 4 30
Page 31 of 56 Diabetes
1 mice per group, blinded to experimental design. (N) Fasting serum levels of circulating
2 glucagon, leptin, adiponectin, ghrelin, corticosterone and markers of inflammation (MCP 1,
3 TNF α, and IL 6) as determined by ELISA. (O) Microscopic images from hematoxylin and
4 eosin (H&E) stained or oil red O stained liver sections. Top panel magnification 10X, bar
5 200µm. Middle and bottom panel magnification 40X, bar 50 µm. (P) Hepatic glycogen
6 content. n=8 for all experiments unless otherwise indicated. *p<0.05, **p<0.01, ***p<0.001.
7
8 Fig. 7. GTDF induces browning in adipocytes
9 (A) Immunodetection of FNDC5 in C2C12 myotubes or culture medium (CM) of C2C12
10 myotubes treated with GTDF. (B) H&E staining of eWAT of db/db mice used in Fig. 6. (C)
11 Immunofluorescent staining of the same eWAT by anti UCP 1 antibody, visualized by
12 confocal microscopy. Bottom panel shows images in bright field. (B and C) Each image is
13 representative of 10 random sections from 3 mice per group. (D) Oil red O staining of 3T3L
14 1 adipocytes differentiated with or without GTDF, where GTDF was added on day 0 or day 2
15 of differentiation (10d or 8d respectively). (E) Extracted oil red O from stained cells
16 quantified by spectrophotometry at 490nm. Data are mean ± SEM of 3 independent
17 experiments. (F and G) QPCR analysis of gene expression in 3T3L 1 (F) or mouse SVFs (G)
18 differentiated with or without GTDF. (H) 3T3L 1, mouse SVF or human SVF were
19 differentiated with or without GTDF using standard protocol and as indicated in 7D, and
20 analyzed by immunoblotting. (I) Mitochondrial DNA content determination by QPCR in
21 mouse SVF differentiated in presence of GTDF. (J) GTDF does not modulate the activity of
22 β adrenergic receptors. HEK 293 cells in 24 well plates were transfected with 200 ng cyclic
23 AMP response element driven luciferase reporter (CRE Luc), 200 ng mammalian expression
24 plasmids for β ADR 1, 2 or 3 and 100 ng eGFPC1. 24 h post transfection, cells were
25 treated for 6 h with indicated ligands, lysed and GFP and luciferase activity were 31
Diabetes Page 32 of 56
1 determined using a microplate fluorimeter (Fluostar Omega; BMG Labtech) and a microplate
2 luminometer (GloMax; Promega). The luciferase values were normalized with GFP and
3 plotted as fold luciferase activity over vehicle treated controls. Data are mean ± SEM of 3
4 independent experiments in all graphs. Images are representative of 3 independent
5 experiments. GM; Growth medium (DMEM with 4.5mg/ml glucose, 4.0mM glutamine, 1
6 mM sodium pyruvate, 10% FBS and 1X antibiotic antimycotic solution) DM; Differentiation
7 medium (GM supplemented with 1.5µg/ml insulin, 0.5mM IBMX, 1.0µM dexamethasone
8 and 1µM rosiglitazone), INS; Insulin medium GM plus 1.5µg/ml insulin). For human SVFs
9 after DM and INS medium cells were cultured for 21d, at which matured adipocyte
10 phenotypes were observed. Cells were given fresh medium containing vehicle or 0.01µM
11 GTDF every day during the differentiation. *p<0.05, **p<0.01, ***p<0.005.
12 Supplementary information includes supplementary Figures 1 3 and supplementary tables
13 1 5.
32
Page 33 of 56 Diabetes
Chemical structures of quercetin and its natural analogs.
Diabetes Page 34 of 56
GTDF is an AdipoR agonist that elicits adiponectin-associated signaling and functional events
Page 35 of 56 Diabetes
Overexpression or knockdown of AdipoR1 enhances or mitigates GTDF action respectively
Diabetes Page 36 of 56
Comparison of mRNA and protein expression of AdipoRs and evaluation of adiponectin sensitivity in BL6, db/db or BKS- db/db mice.
Page 37 of 56 Diabetes
GTDF but not pioglitazone fails to improve metabolic health in BKS-db/db 218x266mm (600 x 600 DPI)
Diabetes Page 38 of 56
GTDF improves metabolic parameters in db/db mice 193x208mm (600 x 600 DPI)
Page 39 of 56 Diabetes
GTDF induces browning in adipocytes
Diabetes Page 40 of 56
SUPPLEMENTARY DATA
Supplementary Figure 1. Validation of AdipoR1 and R2 antibodies. 50 g protein extracts from CHO cells transfected with empty plasmid or AdipoR1 and R2 mammalian expression plasmids or C2C12 cells (that express endogenous AdipoRs) were analyzed by immunoblotting with indicated antibodies. AdipoR1 antibody showed some cross reactivity with over expressed AdipoR2, which was expected as this antibody was raised against a peptide from the C terminus of AdipoR1 that shares amino acid similarity with AdipoR2. Image representative of 3 independent experiments.
Page 41 of 56 Diabetes
Supplementary Figure 2. Saturation binding of 125I gAd to CHO cells transfected with AdipoR1, AdipoR2 or vector only. CHO cells transfected with AdipoR1, R2 or empty expression vector were incubated with increasing concentrations of 125I gAd in PBS supplemented with 0.1% BSA for 2h, following which cells were washed and lysed. A portion of the lysate was used for protein estimation and rest was quantitated in a gamma counter. Nonspecific binding for each concentration was determined using 200 fold excess of cold gAd. Specific binding was calculated by subtracting nonspecific binding from the total binding. The count per minute (CPM) was normalized with protein concentration and plotted.
Diabetes Page 42 of 56
Supplementary Figure 3. GTDF lowers adipose tissue weight in db/db mice. Indicated fat pads from 6 mice in each group were dissected and weighted using an analytical balance (Mettler, Toledo, Osaka, Japan).
Page 43 of 56 Diabetes
Supplementary Table 1: GTDF does not bind to ionotropic glutamate receptors. Wistar rat cerebral cortex (for AMPA receptor, and NMDA receptor agonist, glycine, phencyclidine and polyamine sites), Wistar rat whole brain (minus cerebellum, for Kainate receptor) or whole Wistar rat brain (for non selective glutamate binding) were incubated with indicated radioligands in absence or presence of indicated doses of GTDF. % inhibition of radioligand binding was calculated using standard formula. Threshold inhibition was set at 50% for consideration of inhibition.
GTDF Receptor, % Radi Specific Kd of Nonspec Incubat Incubati Concentra assay inhibition oliga binding radiolig ific ion on time, tion ( M) of specific nd activity and competit buffer temperat radioligand of or ure binding radiolig and
AMPA 1.0 mM 50 mM L Tris 5.0 Glutami HCl, nM 90% KD1= c acid pH 7.4, 10 3 [3H] 200 AMP 0.018 mM A M KSCN 1 15 KD2 = 0.1 7 0.99 90min, M 4°C Kainate 5.0 1.0 mM 50 mM 60 nM 80% KD = L Tris minutes, 10 7 [3H] Glutami HCl, 4°C AMP 0.012 c acid pH 7.4 A M 1 2 0.1 1 NMDA, 2.0 1.0 mM 50 mM 20 Agonism nM L Tris minutes, [3H] 70% KD = Glutami HCl, 4°C 10 3 CGP c acid pH 7.4 3965 0.019 3 M 1 7 0.1 6 NMDA, 0.33 50 mM 30 Glycine nM HEPES minutes, [3H] 85% KD = 10.0 M , pH 4°C 10 7 7.7 MDL 105,5 0.006 MDL 19 M 105,519 Diabetes Page 44 of 56
1 3 0.1 3
NMDA, 1.0 M 45 Phencycli Dizocilp minutes, dine 4.0 ine (+) 25°C nM MK [3H] 94% KD = 801) 10 2 0.0084 TCP M 10 mM Tris 1 5 HCl, 0.1 2 pH 7.4 NMDA, 2.0 50 mM 2 hours, Polyamin nM Tris 4°C e [3H] 80% KD = HCl, 10 4 pH 7.4 Ifenp 0.026 rodil M 10.0 M 1 8 Ifenprod 0.1 3 il Glutamate 50 mM 30 , Non 3.75 Tris minutes, selective nM HCl, 37°C [3H] 90% KD = pH 7.4, 10 17 L 2.5 mM Gluta CaCl2 mic 0.29 acid M 50.0 M L 1 13 Glutami 0.1 14 c acid
Page 45 of 56 Diabetes
Supplementary Table 2. GTDF does not activate or repress metabotropic glutamate receptors at its active dose but quercetin activates mGlu2, and suppresses mGlu4, 6 and 8 activity. Modulation of metabotropic glutamate receptor activities by GTDF or quercetin at their pharmacologically active concentrations was assessed. mGlu1, 3, 5 activities were assessed by an aequorin assay, mGlu2 and 7 activities were assessed by cAMP assay, mGlu4, 6 and 8 were assessed by GTPγS binding. PAM; positive allosteric modulator. Threshold activation or repression was set at 50%. % activation or repression beyond the threshold is in red.
Assay mode Conc Co Compound ( M) Agonist Antagonist PAM Addition % % % % activation inhibition activation activation Receptor: mGlu1 GTDF 1 0.15 8.98 0.951 2.09 0.1 0.35 1.6 0.791 0.87 Quercetin 1000 0.049 16.41 2.02 3.38 100 0.37 8.911 6.97 23.58 Receptor: mGlu2 GTDF 1 10.64 19.62 17.95 0.1 7.76 9.56 8.59 Quercetin 1000 2.17 18.32 12.65 100 117.85* 7.6 284.27* Receptor: mGlu3 GTDF 1 2.38 5.06 3.55 6.39 0.1 0.78 12.26 3.52 3.94 Quercetin 1000 0.36 6.58 18.96 0.061 100 4.75 11.32 5.068 24.67 Receptor: mGlu4 GTDF 1 5.04 4.44 4.14 0.1 1.63 6.16 5.87 Quercetin 1000 23.15 86.97 33.79 100 7.75 31.65 14.11 Receptor: mGlu5 GTDF 1 0.4 1.15 3.35 2.61 0.1 0.04 3.35 5.14 3.69 Quercetin 1000 0.11 14.66 0.74 0.64 100 0.07 30.92 8.72 3.55 Diabetes Page 46 of 56
Receptor: mGlu6 GTDF 1 2.24 0.04 15.39 0.1 6.65 4.91 4.82 Quercetin 1000 136.684 201.61 141.74 100 20.7469 58.63 39.7 Receptor: mGlu7 GTDF 1 16.46 11.21 8.68 0.1 19.05 0.22 0.836 Quercetin 1000 18.96 13.68 10.19 100 23.22 4.71 8.94 Receptor: mGlu8 GTDF 1 1.15 15.33 10.26 0.1 4.24 1.28 4.6 Quercetin 1000 72.89 159.53 64.26 100 14.3 58.17 10.91
Page 47 of 56 Diabetes
Supplementary Table 3. GTDF is not a GPCR agonist. GTDF at its pharmacologically active dose (0.1 M) or high dose (10 M) was assessed for its ability to modulate GPCR signalling using pathhunter β arrestin assay for the indicated GPCRs. Threshold for consideration as an activator was set at 50%.
GTDF GTDF Assay % % GPCR ID Conc Conc Mode Activity Activity ( M) ( M) ADCYAP1R1 Agonist 0.1 2% 10 2% ADORA3 Agonist 0.1 7% 10 9% ADRA1B Agonist 0.1 1% 10 2% ADRA2A Agonist 0.1 3% 10 1% ADRA2B Agonist 0.1 5% 10 3% ADRA2C Agonist 0.1 2% 10 1% ADRB1 Agonist 0.1 1% 10 1% ADRB2 Agonist 0.1 0% 10 1% AGTR1 Agonist 0.1 3% 10 2% AGTRL1 Agonist 0.1 1% 10 2% AVPR1A Agonist 0.1 5% 10 4% AVPR1B Agonist 0.1 2% 10 1% AVPR2 Agonist 0.1 2% 10 4% BDKRB1 Agonist 0.1 5% 10 0% BDKRB2 Agonist 0.1 3% 10 3% BRS3 Agonist 0.1 6% 10 2% C5AR1 Agonist 0.1 2% 10 2% C5LR2 Agonist 0.1 1% 10 14% CALCR Agonist 0.1 1% 10 11% CALCR + RAMP2 Agonist 0.1 7% 10 4% CALCR + RAMP3 Agonist 0.1 6% 10 25% CALCRL + RAMP1 Agonist 0.1 4% 10 1% CALCRL + RAMP2 Agonist 0.1 4% 10 1% CALCRL + RAMP3 Agonist 0.1 3% 10 1% CCKAR Agonist 0.1 2% 10 1% CCKBR Agonist 0.1 5% 10 4% CCR10 Agonist 0.1 3% 10 3% CCR2 Agonist 0.1 2% 10 2% CCR3 Agonist 0.1 5% 10 4% CCR4 Agonist 0.1 5% 10 1% CCR5 Agonist 0.1 4% 10 1% CCR6 Agonist 0.1 2% 10 3% CCR7 Agonist 0.1 8% 10 5% Diabetes Page 48 of 56
CCR8 Agonist 0.1 0% 10 3% CCR9 Agonist 0.1 5% 10 5% CHRM1 Agonist 0.1 4% 10 5% CHRM2 Agonist 0.1 3% 10 1% CHRM3 Agonist 0.1 5% 10 2% CHRM4 Agonist 0.1 6% 10 4% CHRM5 Agonist 0.1 7% 10 29% CMKLR1 Agonist 0.1 2% 10 4% CMKOR1 Agonist 0.1 8% 10 2% CNR1 Agonist 0.1 0% 10 2% CNR2 Agonist 0.1 0% 10 4% CRHR1 Agonist 0.1 2% 10 1% CRHR2 Agonist 0.1 3% 10 1% CRTH2 Agonist 0.1 3% 10 5% CX3CR1 Agonist 0.1 2% 10 0% CXCR1 Agonist 0.1 10% 10 1% CXCR2 Agonist 0.1 2% 10 2% CXCR3 Agonist 0.1 3% 10 3% CXCR4 Agonist 0.1 7% 10 9% CXCR5 Agonist 0.1 8% 10 6% CXCR6 Agonist 0.1 2% 10 3% DRD1 Agonist 0.1 6% 10 3% DRD2L Agonist 0.1 4% 10 2% DRD2S Agonist 0.1 5% 10 3% DRD3 Agonist 0.1 7% 10 14% DRD4 Agonist 0.1 2% 10 2% DRD5 Agonist 0.1 4% 10 2% EDG1 Agonist 0.1 3% 10 5% EDG2 Agonist 0.1 1% 10 2% EDG3 Agonist 0.1 4% 10 5% EDG4 Agonist 0.1 2% 10 1% EDG5 Agonist 0.1 2% 10 7% EDG6 Agonist 0.1 2% 10 12% EDG7 Agonist 0.1 4% 10 2% EDG8 Agonist 0.1 0% 10 1% EDNRA Agonist 0.1 7% 10 3% EDNRB Agonist 0.1 3% 10 3% F2R Agonist 0.1 9% 10 2% F2RL1 Agonist 0.1 1% 10 1% F2RL3 Agonist 0.1 3% 10 1% FPR1 Agonist 0.1 10% 10 4% FPRL1 Agonist 0.1 2% 10 1% Page 49 of 56 Diabetes
FSHR Agonist 0.1 6% 10 11% GALR1 Agonist 0.1 4% 10 1% GALR2 Agonist 0.1 5% 10 6% GCGR Agonist 0.1 3% 10 1% GHSR1A Agonist 0.1 0% 10 2% GIPR Agonist 0.1 3% 10 13% GLP1R Agonist 0.1 1% 10 1% GLP2R Agonist 0.1 1% 10 2% GPR1 Agonist 0.1 4% 10 3% GPR109A Agonist 0.1 11% 10 4% GPR119 Agonist 0.1 4% 10 4% GPR120 Agonist 0.1 1% 10 7% GPR35 Agonist 0.1 4% 10 3% GPR92 Agonist 0.1 7% 10 6% GRPR Agonist 0.1 1% 10 2% HCRTR1 Agonist 0.1 3% 10 1% HCRTR2 Agonist 0.1 3% 10 1% HRH1 Agonist 0.1 0% 10 1% HRH2 Agonist 0.1 2% 10 1% HRH3 Agonist 0.1 14% 10 6% HTR1A Agonist 0.1 2% 10 2% HTR1B Agonist 0.1 4% 10 4% HTR1E Agonist 0.1 7% 10 1% HTR1F Agonist 0.1 3% 10 2% HTR2A Agonist 0.1 3% 10 11% HTR2C Agonist 0.1 3% 10 1% HTR5A Agonist 0.1 1% 10 13% KISS1R Agonist 0.1 3% 10 4% LHCGR Agonist 0.1 1% 10 8% LTB4R Agonist 0.1 3% 10 3% MC1R Agonist 0.1 1% 10 1% MC3R Agonist 0.1 7% 10 10% MC4R Agonist 0.1 4% 10 12% MC5R Agonist 0.1 8% 10 5% MCHR1 Agonist 0.1 1% 10 5% MCHR2 Agonist 0.1 3% 10 2% MLNR Agonist 0.1 3% 10 4% MRGPRX2 Agonist 0.1 6% 10 2% MTNR1A Agonist 0.1 0% 10 4% MTNR1B Agonist 0.1 9% 10 3% NMU1R Agonist 0.1 5% 10 12% NPBWR1 Agonist 0.1 2% 10 6% Diabetes Page 50 of 56
NPBWR2 Agonist 0.1 4% 10 3% NPFFR1 Agonist 0.1 1% 10 2% NPSR1 Agonist 0.1 2% 10 4% NPY1R Agonist 0.1 4% 10 3% NPY2R Agonist 0.1 2% 10 1% NTSR1 Agonist 0.1 7% 10 9% OPRD1 Agonist 0.1 1% 10 3% OPRK1 Agonist 0.1 0% 10 5% OPRL1 Agonist 0.1 0% 10 14% OPRM1 Agonist 0.1 5% 10 5% OXTR Agonist 0.1 3% 10 3% P2RY11 Agonist 0.1 3% 10 2% P2RY12 Agonist 0.1 4% 10 5% P2RY2 Agonist 0.1 2% 10 3% P2RY4 Agonist 0.1 13% 10 10% P2RY6 Agonist 0.1 1% 10 0% PPYR1 (NPY4) Agonist 0.1 0% 10 2% PRLHR Agonist 0.1 7% 10 3% PROKR1 Agonist 0.1 7% 10 1% PROKR2 Agonist 0.1 3% 10 1% PTAFR Agonist 0.1 16% 10 3% PTGER2 Agonist 0.1 0% 10 4% PTGER3 Agonist 0.1 3% 10 3% PTGER4 Agonist 0.1 15% 10 9% PTGIR Agonist 0.1 6% 10 7% PTHR1 Agonist 0.1 3% 10 1% PTHR2 Agonist 0.1 3% 10 1% RXFP3 Agonist 0.1 2% 10 4% SCTR Agonist 0.1 3% 10 1% SSTR2 Agonist 0.1 2% 10 1% SSTR3 Agonist 0.1 0% 10 4% SSTR5 Agonist 0.1 0% 10 6% TACR1 Agonist 0.1 13% 10 20% TACR2 Agonist 0.1 11% 10 4% TACR3 Agonist 0.1 2% 10 1% TBXA2R Agonist 0.1 0% 10 3% TRHR Agonist 0.1 2% 10 2% TSHR Agonist 0.1 1% 10 2% UTR2 Agonist 0.1 1% 10 4% VIPR1 Agonist 0.1 2% 10 2% VIPR2 Agonist 0.1 1% 10 0%
Page 51 of 56 Diabetes
Supplementary Table 4. GTDF is not a GPCR antagonist or inhibitor. GTDF at its pharmacologically active dose (0.1 M) or high dose (10 M) was assessed for its ability to antagonize or inhibit GPCR signaling in presence of EC80 concentrations of cognate agonists of the indicated GPCRs, using pathhunter β arrestin assay. Threshold inhibition for consideration as an antagonist or inhibitor was set at 50%.
GTDF % GTDF % Assay GPCR ID Conc Inhibiti Conc Inhibiti Mode ( M) on ( M) on ADCYAP1R1 Antagonist 0.1 3% 10 11% ADORA3 Antagonist 0.1 3% 10 6% ADRA1B Antagonist 0.1 3% 10 12% ADRA2A Antagonist 0.1 13% 10 12% ADRA2B Antagonist 0.1 1% 10 5% ADRA2C Antagonist 0.1 2% 10 5% ADRB1 Antagonist 0.1 13% 10 4% ADRB2 Antagonist 0.1 7% 10 10% AGTR1 Antagonist 0.1 14% 10 4% AGTRL1 Antagonist 0.1 20% 10 5% AVPR1A Antagonist 0.1 14% 10 13% AVPR1B Antagonist 0.1 15% 10 14% AVPR2 Antagonist 0.1 4% 10 1% BDKRB1 Antagonist 0.1 0% 10 3% BDKRB2 Antagonist 0.1 3% 10 2% BRS3 Antagonist 0.1 11% 10 4% C5AR1 Antagonist 0.1 3% 10 8% C5LR2 Antagonist 0.1 2% 10 12% CALCR Antagonist 0.1 4% 10 21% CALCR + RAMP2 Antagonist 0.1 10% 10 3% CALCR + RAMP3 Antagonist 0.1 5% 10 20% CALCRL + RAMP1 Antagonist 0.1 8% 10 1% CALCRL + RAMP2 Antagonist 0.1 6% 10 1% CALCRL + RAMP3 Antagonist 0.1 16% 10 0% CCKAR Antagonist 0.1 1% 10 11% CCKBR Antagonist 0.1 5% 10 13% CCR10 Antagonist 0.1 27% 10 6% CCR2 Antagonist 0.1 2% 10 4% CCR3 Antagonist 0.1 13% 10 1% Diabetes Page 52 of 56
CCR4 Antagonist 0.1 11% 10 1% CCR5 Antagonist 0.1 14% 10 1% CCR6 Antagonist 0.1 13% 10 6% CCR7 Antagonist 0.1 18% 10 7% CCR8 Antagonist 0.1 2% 10 25% CCR9 Antagonist 0.1 8% 10 17% CHRM1 Antagonist 0.1 18% 10 10% CHRM2 Antagonist 0.1 0% 10 8% CHRM3 Antagonist 0.1 1% 10 15% CHRM4 Antagonist 0.1 8% 10 28% CHRM5 Antagonist 0.1 7% 10 20% CMKLR1 Antagonist 0.1 0% 10 2% CMKOR1 Antagonist 0.1 1% 10 1% CNR1 Antagonist 0.1 1% 10 0% CNR2 Antagonist 0.1 2% 10 14% CRHR1 Antagonist 0.1 9% 10 0% CRHR2 Antagonist 0.1 7% 10 10% CRTH2 Antagonist 0.1 14% 10 13% CX3CR1 Antagonist 0.1 9% 10 4% CXCR1 Antagonist 0.1 9% 10 8% CXCR2 Antagonist 0.1 8% 10 1% CXCR3 Antagonist 0.1 14% 10 8% CXCR4 Antagonist 0.1 3% 10 13% CXCR5 Antagonist 0.1 16% 10 17% CXCR6 Antagonist 0.1 5% 10 6% DRD1 Antagonist 0.1 5% 10 21% DRD2L Antagonist 0.1 6% 10 3% DRD2S Antagonist 0.1 12% 10 12% DRD3 Antagonist 0.1 14% 10 0% DRD4 Antagonist 0.1 1% 10 1% DRD5 Antagonist 0.1 12% 10 11% EDG1 Antagonist 0.1 1% 10 17% EDG2 Antagonist 0.1 6% 10 8% EDG3 Antagonist 0.1 0% 10 6% EDG4 Antagonist 0.1 2% 10 10% EDG5 Antagonist 0.1 13% 10 4% EDG6 Antagonist 0.1 8% 10 11% EDG7 Antagonist 0.1 0% 10 1% EDG8 Antagonist 0.1 11% 10 28% EDNRA Antagonist 0.1 1% 10 16% EDNRB Antagonist 0.1 13% 10 10% F2R Antagonist 0.1 9% 10 3% Page 53 of 56 Diabetes
F2RL1 Antagonist 0.1 12% 10 0% F2RL3 Antagonist 0.1 3% 10 2% FPR1 Antagonist 0.1 5% 10 9% FPRL1 Antagonist 0.1 5% 10 4% FSHR Antagonist 0.1 7% 10 37% GALR1 Antagonist 0.1 11% 10 4% GALR2 Antagonist 0.1 19% 10 10% GCGR Antagonist 0.1 3% 10 14% GHSR1A Antagonist 0.1 3% 10 1% GIPR Antagonist 0.1 9% 10 23% GLP1R Antagonist 0.1 2% 10 1% GLP2R Antagonist 0.1 2% 10 2% GPR1 Antagonist 0.1 14% 10 8% GPR109A Antagonist 0.1 15% 10 9% GPR119 Antagonist 0.1 10% 10 25% GPR120 Antagonist 0.1 27% 10 3% GPR35 Antagonist 0.1 6% 10 9% GPR92 Antagonist 0.1 9% 10 10% GRPR Antagonist 0.1 19% 10 9% HCRTR1 Antagonist 0.1 9% 10 7% HCRTR2 Antagonist 0.1 15% 10 9% HRH1 Antagonist 0.1 7% 10 10% HRH2 Antagonist 0.1 6% 10 0% HRH3 Antagonist 0.1 1% 10 24% HTR1A Antagonist 0.1 3% 10 23% HTR1B Antagonist 0.1 1% 10 11% HTR1E Antagonist 0.1 0% 10 11% HTR1F Antagonist 0.1 1% 10 12% HTR2A Antagonist 0.1 3% 10 15% HTR2C Antagonist 0.1 12% 10 15% HTR5A Antagonist 0.1 19% 10 31% KISS1R Antagonist 0.1 7% 10 14% LHCGR Antagonist 0.1 8% 10 8% LTB4R Antagonist 0.1 6% 10 2% MC1R Antagonist 0.1 16% 10 12% MC3R Antagonist 0.1 3% 10 4% MC4R Antagonist 0.1 17% 10 20% MC5R Antagonist 0.1 9% 10 14% MCHR1 Antagonist 0.1 11% 10 20% MCHR2 Antagonist 0.1 3% 10 21% MLNR Antagonist 0.1 4% 10 6% MRGPRX2 Antagonist 0.1 1% 10 18% Diabetes Page 54 of 56
MTNR1A Antagonist 0.1 3% 10 25% MTNR1B Antagonist 0.1 25% 10 13% NMU1R Antagonist 0.1 21% 10 7% NPBWR1 Antagonist 0.1 9% 10 14% NPBWR2 Antagonist 0.1 8% 10 2% NPFFR1 Antagonist 0.1 5% 10 2% NPSR1 Antagonist 0.1 4% 10 17% NPY1R Antagonist 0.1 7% 10 16% NPY2R Antagonist 0.1 8% 10 4% NTSR1 Antagonist 0.1 5% 10 1% OPRD1 Antagonist 0.1 15% 10 9% OPRK1 Antagonist 0.1 0% 10 26% OPRL1 Antagonist 0.1 4% 10 34% OPRM1 Antagonist 0.1 4% 10 16% OXTR Antagonist 0.1 22% 10 8% P2RY11 Antagonist 0.1 11% 10 10% P2RY12 Antagonist 0.1 5% 10 7% P2RY2 Antagonist 0.1 2% 10 5% P2RY4 Antagonist 0.1 12% 10 10% P2RY6 Antagonist 0.1 0% 10 3% PPYR1 (NPY4) Antagonist 0.1 14% 10 15% PRLHR Antagonist 0.1 4% 10 6% PROKR1 Antagonist 0.1 8% 10 14% PROKR2 Antagonist 0.1 10% 10 4% PTAFR Antagonist 0.1 10% 10 16% PTGER2 Antagonist 0.1 2% 10 12% PTGER3 Antagonist 0.1 19% 10 6% PTGER4 Antagonist 0.1 22% 10 7% PTGIR Antagonist 0.1 3% 10 16% PTHR1 Antagonist 0.1 15% 10 0% PTHR2 Antagonist 0.1 5% 10 7% RXFP3 Antagonist 0.1 15% 10 21% SCTR Antagonist 0.1 13% 10 4% SSTR2 Antagonist 0.1 10% 10 7% SSTR3 Antagonist 0.1 16% 10 5% SSTR5 Antagonist 0.1 0% 10 2% TACR1 Antagonist 0.1 3% 10 10% TACR2 Antagonist 0.1 9% 10 12% TACR3 Antagonist 0.1 7% 10 3% TBXA2R Antagonist 0.1 22% 10 12% TRHR Antagonist 0.1 10% 10 11% TSHR Antagonist 0.1 19% 10 2% Page 55 of 56 Diabetes
UTR2 Antagonist 0.1 5% 10 13% VIPR1 Antagonist 0.1 3% 10 2% VIPR2 Antagonist 0.1 3% 10 1%
Diabetes Page 56 of 56
Supplementary Table 5. Oligonucleotide sequences. m; mouse. All sequences in 5' to 3' orientation.
Gene name Forward Reverse
mUCP 1 ACAGAAGGATTGCCGAAAC AGCTGATTTGCCTCTGAATG mUCP 2 GTTCCTCTGTCTCGTCTTGC GGCCTTGAAACCAACCA mUCP 3 TGACCTGCGCCCAGC CCCAGGCGTATCATGGCT mPPARα TCTTCACGATGCTGTCCTCCT GGAACTCGCCTGTGATAAAGC mPPARβ TCCAGAAGAAGAACCGCAACA GGATAGCGTTGTGCGACATG mPPARγ CAGGCCGAGAAGGAGAAGCT GGCTCGCAGATCAGCAGACT mPGC 1α AGCCGTGACCACTGACAACGAG CTGCATGGTTCTGAGTGCTAAG mCPT1B CTCCTTTCCTGGCTGAGGT GATCTGGAACTGGGGGATCT mLPL CCAATGGAGGCACTTTCCA TGGTCCACGTCTCCGAGTC mAdiponectin TGTTGGAATGACAGGAGCTGA CACACTGAACGCTGAGCGATAC mLeptin TCTCCGAGACCTCCTCCATCT TTCCAGGACGCCATCCAG mCD36 GGCCAAGCTATTGCGACAT CAGATCCGAACACAGCGTAGA mFABP3 CCCCTCAGCTCAGCACCAT CAGAAAAATCCCAACCCAAGAAT mFAS CGGAAACTTCAGGAAATGTCC TCAGAGACGTGTCACTCCTGG mFACS TCTAGGAGTGAAGGCCAACG GCAATATCTGAGGGCAGTGG mACOX1 GCCCAACTGTGACTTCCATC GCCAGGACTATCGCATGATT mPRDM16 ACAGGCAGGCTAAGAACCAG CGTGGAGAGGAGTGTCTTCAG mCIDEA AAACCATGACCGAAGTAGCC AGGCCAGTTGTGATGACTAAGAC mβ actin CCTCACCCTCCCAAAAGC GTGGACTCAGGGCATGGA
Mitochondrial DNA MT cox II GCCGACTAAATCAAGCAACA CAATGGGCATAAAGCTATGG Cyt B CATTTATTATCGCGGCCCTA TGTTGGGTTGTTTGATCCTG β Globin GAAGCAATTCTAGGGAGCAG GGAGCAGCGATTCTGAGTAGA