Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S1 of S87 Supplementary Materials: The Draft Genome Sequence of the Yersinia entomophaga Entomopathogenic Type Strain MH96T
Mark R. H. Hurst, Amy Beattie, Eric Altermann, Roger M. Moraga, Lincoln A. Harper, Joanne Calder and Aurelie Laugraud
Table S1. Yersinia entomophaga unique regions 1 and 2. For graphic depiction refer to Figure 2 of the associated manuscript.
Yersinia entomophaga unique region 1.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (Over the Indicated Range of Amino Acid Residues) in Relation Accession Number (Amino Acid Residues) to Target Sequence. Protein Domain branched-chain amino acid ABC transporter substrate-binding protein [Yersinia nurmii] Length: 423 WP_049597723.1 95/97(423) 1–423 PL78_03820 (423) Aliphatic amidase expression-regulating protein [Beauveria bassiana D1-5] Length: 648 gbKGQ13304.1 92/95(420) 226–645 urea ABC transporter permease [Yersinia nurmii] Length: 524 WP_049597583.1 92/94(524) 1–524 PL78_03825 (524) MULTISPECIES: urea ABC transporter permease [Enterobacteriaceae] Length: 524 WP_048332627.1 73/81(507) 1–524 amino acid ABC transporter permease [Yersinia nurmii] Length: 357 WP_049597584.1 96/96(357) 1–357 PL78_03830 (357) amino acid ABC transporter permease [Buttiauxella agrestis] Length: 357 WP_034495296.1 88/93(357) 1–357
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S2 of S87
urea ABC transporter ATP-binding protein [Yersinia nurmii] Length: 265 WP_049597585.1 96/97(265)1–265 PL78_03835 (265) urea ABC transporter ATP-binding protein [Cedecea neteri] Length: 265 WP_038472477.1 89/94(265) 1–265 urea ABC transporter ATP-binding protein [Yersinia nurmii] Length: 232 WP_049597586.1 98/99(232) 1–232 PL78_03840 (232) urea ABC transporter ATP-binding protein [Buttiauxella agrestis] Length: 232 WP_034455625.1 86/93(232) 1–232 LuxR family transcriptional regulator [Yersinia nurmii] Length: 247 WP_049597724.1 98/99(247) 1–247 PL78_03845 (261) LuxR family transcriptional regulator [Yersinia ruckeri] Length: 247 WP_004719049.1 80/89(246) 1–247 acyl-homoserine-lactone synthase [Yersinia nurmii] Length: 216 WP_049597587.1 99/100(216)1–216 PL78_03850 (216) acyl-homoserine-lactone synthase [Yersinia ruckeri] Length: 216 WP_038245616.1 87/92(216) 1–216 membrane protein [Yersinia nurmii] Length: 231 WP_049597588.1 96/98(231) 1–231 PL78_03855 (237) hypothetical protein [Yersinia intermedia] Length: 237 WP_050077576.1 72/87(236) 1–236
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S3 of S87
hypothetical membrane protein [Azoarcus sp. BH72] Length: 149 embCAL95245.1 51/72(86) 68–149 PL78_03860 (238) hypothetical protein [Photorhabdus luminescens] Length: 207 WP_052739685.1 31/49(209)13–207 hydrolase [Mesorhizobium loti] Length: 259 WP_027033575.1 59/78(32)226–257 PL78_03862 (81) carbon monoxide dehydrogenase form II large subunit [uncultured bacterium] Length: 315 gbAAW66018.1 37/53(52) 14–65 ERF family protein [uncultured Mediterranean phage uvMED] Length: 201 dbjBAR33765.1 33/50(55) 41–94 PL78_03865 (100) PREDICTED: sarcoma antigen 1-like, partial [Callithrix jacchus] Length: 276 XP_008989763.1 33/54(46) 169–213 glycosyl transferase [Yersinia nurmii] Length: 336 WP_049597589.1 95/96(336) 1–336 PL78_03870 (336) glycosyl transferase [Yersinia pseudotuberculosis] Length: 326 WP_012303433.1 70/83(325) 1–336 dipeptidyl carboxypeptidase II [Yersinia nurmii] Length: 723 WP_049597590.1 95/97(723) 1–723 PL78_03875 (723) Dipeptidyl carboxypeptidase Dcp [Yersinia ruckeri] Length: 729 embCEK27267.1 82/89(726) 1–726
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S4 of S87
hypothetical protein [Yersinia nurmii] Length: 519 WP_049597591.1 97/97(519) 1–519 PL78_03880 (519) hypothetical protein [Brenneria goodwinii] Length: 534 WP_048636529.1 62/79(516)1–516 malate permease [Yersinia nurmii] Length: 453 WP_049597592.1 99/99(519) 1–453 PL78_03885 (453) malate permease [Yersinia ruckeri] Length: 453 WP_045844043.1 92/96(452) 1–452 transcriptional regulator [Yersinia nurmii] Length: 239 WP_049597593.1 99/99(239)1–239 PL78_03890 (239) transcriptional regulator [Yersinia ruckeri] Length: 239 WP_038242277.1 93/96(239) 1–239 histidine kinase [Yersinia nurmii] Length: 543 WP_049597594.1 97/98(543) 1–543 PL78_03895 (543) histidine kinase [Yersinia ruckeri] Length: 543 WP_042524781.1 87/94(543) 1–543 2-oxoglutarate translocator [Yersinia nurmii] Length: 470 WP_049597595.1 99/98(470) 1–470 PL78_03900 (470) 2-oxoglutarate translocator [Yersinia ruckeri] Length: 470 WP_038275783.1 91/95(470)1–470
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S5 of S87
iron reductase [Yersinia aldovae] Length: 254 WP_042546885.1 94/96(254) 1–254 PL78_03905 (254) iron reductase [Yersinia nurmii] Length: 254 WP_049597596.1 94/98(254) 1–254 cytochrome C biogenesis protein CcmH [Yersinia aldovae] Length: 519 WP_042546884.1 96/97(519) 1–519 PL78_03910(519) cytochrome C biogenesis protein CcmH [Yersinia nurmii] Length: 519 WP_049597597.1 96/97(519) 1–519 putative siderophore biosynthetic enzyme [Yersinia aldovae] Length: 434 embCNL58692.1 97/98(434) 1–434 PL78_03915 (434) putative siderophore biosynthetic enzyme [Yersinia nurmii] Length: 434 embCNE39394.1 95/96(434) 1–434 siderophore biosynthesis protein [Yersinia aldovae] Length: 198 WP_049596217.1 95/97(197) 1–197 PL78_03920 (190) siderophore biosynthesis protein [Yersinia aldovae] Length: 198 WP_042546883.1 95/97(197) 1–197 siderophore biosynthesis protein IucA [Yersinia aldovae] Length: 611 WP_042839931.1 96/97(611) 1–611 PL78_03925 (612) siderophore biosynthesis protein IucA [Yersinia aldovae] Length: 611 WP_042546882.1 96/97(611) 1–611
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S6 of S87
putative iron-siderophore transport system %2CATP-binding component [Yersinia aldovae] Length: 287 embCNL53775.1 94/95(287) 1–287 PL78_03930 (287) putative iron-siderophore transport system %2CATP-binding component [Yersinia aldovae] Length: 287 embCNL58815.1 94/95(287) 1–287 iron ABC transporter permease [Yersinia aldovae] Length: 346 WP_049689070.1 97/97(216) 31–346 PL78_03935 (346) iron ABC transporter permease [Yersinia nurmii] Length: 346 WP_049597600.1 96/98(206) 41–346 iron ABC transporter permease [Yersinia nurmii] Length: 339 WP_049597601.1 94/95(339) 1–339 PL78_03940 (339) iron ABC transporter permease [Yersinia aldovae] Length: 339 WP_042839929.1 95/96(336) 1–339 periplasmic binding family protein [Yersinia aldovae 670-83] Length: 37 gbAJJ64399.1 96/97(376)1–376 PL78_03945 (341) iron-siderophore ABC transporter substrate-binding protein [Yersinia aldovae] Length: 362 WP_042546879.1 97/98(362)1–362 TonB-dependent receptor [Yersinia aldovae] Length: 749 WP_042839927.1 96/97(749) 1–749 PL78_03950 (749) TonB-dependent receptor [Yersinia aldovae] Length: 749 WP_042546878.1 96/97(749) 1–749
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S7 of S87
IucA/IucC family protein [Yersinia aldovae] Length: 609 WP_049596218.1 97/97(609) 1–609 PL78_03955 (609) siderophore biosynthesis protein IucA [Yersinia aldovae] Length: 609 WP_042546877.1 96/97(609) 1–609 serine 3-dehydrogenase [Yersinia intermedia] Length: 479 WP_050086263.1 86/93(478) 1–479 PL78_03960 (478) serine 3-dehydrogenase [Yersinia nurmii] Length: 478 WP_049597605.1 96/97(478 )1–478 serine 3-dehydrogenase [Yersinia nurmii] Length: 481 WP_049597606.1 96/97(464) 18–481 PL78_03965 (464) serine 3-dehydrogenase [Yersinia intermedia] Length: 485 WP_005182588.1 80/87(464)1–485 metalloprotease [Yersinia nurmii] Length: 482 embCNE39855.1 93/95(482) 1–482 PL78_03970 (482) serine 3-dehydrogenase [Yersinia ruckeri] Length: 477 WP_042524782.1 55/67(442) 40–477 PL78_03975 (77) No similarity ‐ Proteinase inhibitor precursor [Yersinia nurmii] Length: 138 embCNE39896.1 97/100(109) 30–138 PL78_03980 (109) alkaline proteinase inhibitor [Yersinia intermedia] Length: 138 WP_050086261.1 78/87(109) 30–138
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S8 of S87
peptidase [Yersinia nurmii] Length: 580 WP_049597607.1 98/99(580) 1–580 PL78_03985 (580) peptidase [Yersinia intermedia] Length: 580 WP_050312322.1 91/94(580) 1–580 hemolysin D [Yersinia nurmii] Length: 443 WP_049597608.1 98/99(443) 1–443 PL78_03990 (434) hemolysin D [Yersinia intermedia] Length: 443 WP_050312323.1 87/93(443) 1–443 pfam00529 peptidase [Yersinia nurmii] Length: 447 WP_049597609.1 99/99(447) 1–447 PL78_03995 (440) peptidase [Yersinia intermedia] Length: 447 WP_050086258.1 91/96(447) 1–447 cytochrome B561 [Yersinia nurmii] Length: 205 WP_049597610.1 96/96 (2025) 1–205 PL78_04000 (195) cytochrome B561 [Yersinia ruckeri] Length: 206 WP_042524786.1 84/90(205) 2–206
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S9 of S87
hypothetical protein [Yersinia nurmii] Length: 262 putative sulfite oxidase subunit YedY [Yersinia nurmii] WP_049597611.1 Sequence ID: emb|CNE40096.1| PL78_04005 (262) Length: 262 Number of Matches: 97/98(262) 1–262 hypothetical protein [Yersinia ruckeri] Length: 262 WP_042524787.1 90/94(262) 1–262 pentapeptide MXKDX repeat protein [Yersinia nurmii] Length: 123 embCNE40130.1 89/90(123) 1–123 PL78_04010 (112) hypothetical protein [Yersinia ruckeri] Length: 112 WP_042524788.1 77/90(112) 1–112 multidrug DMT transporter permease [Yersinia nurmii] Length: 300 WP_049597612.1 96/98(300) 1–300 PL78_04015 (300) membrane protein [Yersinia ruckeri] Length: 300 WP_004720598.1 87/93(289) AraC family transcriptional regulator [Yersinia nurmii] Length: 292 WP_049597613.1 99/99(292) 1–292 PL78_04020 (292) AraC family transcriptional regulator [Yersinia ruckeri] Length: 292 WP_004720600.1 90/94(292) 1–292
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S10 of S87
Yersinia entomophaga unique region 2
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number (amino acid resides) to Target Sequence. Protein Domain tRNA (guanine-N7)-methyltransferase [Yersinia nurmii] Length: 239 WP_049599599.1 99/100(239) 1–239 PL78_09500 (239) tRNA (Guanine-N(7)-)-methyltransferase [Yersinia ruckeri ATCC 29473] Length: 252 gbEEP99613.1 94/96(239) 14–252 A/G-specific adenine glycosylase [Yersinia nurmii] Length: 366 WP_049599597.1 98/98(366) 1–366 PL78_09505 (366) A/G-specific adenine glycosylase [Yersinia ruckeri] Length: 366 WP_045844287.1 93/96(366) 1–366 oxidative damage protection protein [Yersinia nurmii] Length: 90 WP_049599595.1 99/98(90) 1–90 PL78_09510 (90) Fe(2+)-trafficking protein [Yersinia massiliensis] Length: 90 WP_019211664.1 97/98(90) 1–90 murein transglycosylase [Yersinia nurmii] Length: 358 WP_049599592.1 99/99(358) 1–358 PL78_09515 (358) murein transglycosylase [Yersinia ruckeri] Length: 358 WP_004719291.1 99/99(358) 1–358
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S11 of S87
permease [Yersinia nurmii] Length: 249 WP_049599589.1 PL78_09520 (249) 94/95(249) 1–249 Permease Sulfite exporter TauE/SafE [Yersinia bercovieri] Length: 249 embCNF01781.1 85/93(247) 1–247 ornithine decarboxylase [Yersinia nurmii] Length: 720 WP_049599586.1 97/98(719) 1–719 PL78_09525 (720) ornithine decarboxylase [Yersinia pekkanenii] Length: 720 WP_049615402.1 86/93(719) 1–719 PL78_09550 tRNAphe fimbrial protein [Yersinia nurmii] Length: 176 WP_049597733.1 PL78_09535 (176) 98/98(176) 1–176 Fimbrial protein fimbrial protein [Yersinia intermedia] Length: 176 WP_050076821.1 91/96(176) 1–176 putative fimbrial chaperone [Yersinia frederikseniir] Length: 243 embCFR11699.1 PL78_09540 (243) 89/95(243) 1–243 Fimbrial chaperone fimbrial chaperone protein [Yersinia nurmii] Length: 242 WP_049597734.1 98/97(242) 1–243 fimbrial protein [Yersinia nurmii] Length: 887 WP_049597735.1 PL78_09545 (887) 95/97(887) 1–887 Fimbrial protein fimbrial usher protein [Yersinia frederikseniir] Length: 887 WP_004710087.1 88/95(888) 1–887
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S12 of S87
putative fimbrial usher protein StbD [Yersinia nurmii] Length: 455 embCNE45478.1 PL78_09550 (424) 96/98(455)1–455 Fimbrial usher protein StbD fimbrial family protein [Yersinia frederikseniir ATCC 33641] Length: 455 gbKGA46118.1 89/94(455) 1–455 molecular chaperone [Yersinia nurmii] Length: 255 WP_049597737.1 PL78_09555 (243) 95/97(243) 13–255 Chaperone molecular chaperone [Yersinia frederikseniir] Length: 255 WP_032911350.1 81/90(242) 14–255 nicotinamidase [Salmonella enterica] PL78_09560 (255) Length: 225 WP_050178696.1 92/95(225) 1–225 hypothetical protein [Massilia niastensis] Length: 302 WP_020656025.1 PL78_09565 (303) 74/85(301) 1–301 LysR LysR family transcriptional regulator [Aeromonas aquatica] Length: 306 WP_033130787.1 70/82(301) 1–301 potassium transporter KefC [Yersinia nurmii] Length: 619 WP_049597738.1 PL78_09570 (619) 98/98(619) 1–619 Transporters potassium transporter KefC [Citrobacter amalonaticus] Length: 620 WP_046475364.1 86/91(619) 1–619 potassium transporter KefF [Yersinia nurmii] Length: 176 WP_049597739.1 PL78_09575 (176) 96/97(176) 1–176 Transporters MULTISPECIES: potassium transporter [Enterobacteriaceae] Length: 176 WP_003018878.1 88/94(176) 1–176
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S13 of S87
hypothetical protein [Yersinia nurmii] Length: 129 WP_049597740.1 96/99(129) 1–129 PL78_09575 (127) hypothetical protein [Yersinia aldovae] Length: 129 WP_042546198.1 73/89(129) 1–129 hypothetical protein [Yersinia nurmii] Length: 129 WP_049597740.1 96/99(127) 3–129 hypothetical protein [Yersinia aldovae] PL78_09580 (127) Length: 129 WP_042546198.1 72/89(127) 2–129 hypothetical protein [Photorhabdus luminescens] Length: 123 WP_011148526.1 50/64(119) 1–119 hypothetical protein [Yersinia nurmii] Length: 96 WP_049597741.1 78/85(91) 1–91 PL78_09585 (96) hypothetical protein [Yersinia intermedia] Length: 112 WP_050074814.1 52/67(87) 1–87 hypothetical protein [Yersinia intermedia] Length: 136 WP_032905692.1 PL78_09590 (137) 79/88(137) 1–136 PirA Uncharacterised protein [Yersinia nurmii] Length: 137 embCNE45801.1 95/97(137) 1–137
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S14 of S87
hypothetical protein [Yersinia nurmii] Length: 416 WP_049597742.1 93/96(416) 1–416 hypothetical protein [Yersinia intermedia] PL78_09595 (416) Length: 416 WP_050086266.1 PirB 86/94(416) 1–416 toxin PirB [Photorhabdus luminescens] Length: 419 WP_046395117.1 47/66(396) 17–412 thermolabile hemolysin [Yersinia intermedia] Length: 426 WP_050086267.1 82/91(426) 1–426 PL78_09600 (426) thermolabile hemolysin [Yersinia nurmii] Lipase Length: 426 WP_049597743.1 95/97(426) 1–426 pfam00657: Lipase_GDSL iron ABC transporter [Erwinia toletana] PL78_09605 (255) Length: 255 WP_026111923.1 Iron transporter 77/86(255) 1–255 iron-dicitrate transporter subunit FecD [Rahnella aquatilis] Length: 320 WP_047607211.1 PL78_09610 (320) 82/90(320) 1–320 Iron transporter Fe3+ dicitrate ABC transporter permease [Rahnella aquatilis] Length: 320 WP_014341819.1 82/90(320) 1–320 iron ABC transporter [Rahnella aquatilis] PL78_09615 (333) Length: 334 WP_014341818.1 Iron transporter 85/91(333) 1–334 iron siderophore-binding protein [Rahnella aquatilis] PL78_09620 (302) Length: 301 WP_014341817.1 80/88(289) 13–301 transporter [Erwinia toletana] PL78_09625 (785) Length: 786 WP_017802701.1 Iron transporter 83/91(784) 3–786
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S15 of S87
iron dicitrate transport regulator FecR [Erwinia toletana] Length: 309 WP_051050855.1 PL78_09630 (321) 69/82(309) 1–309 Iron transporter iron dicitrate transport regulator FecR [Rahnella aquatilis] Length: 323 WP_047610250.1 68/81(323) 1–323 RNA polymerase sigma factor [Rahnella aquatilis] PL78_09635 (175) Length: 172 WP_014341814.1 81/88(171) 1–171 MULTISPECIES: protein RclC [Escherichia] PL78_09645 (193) Length: 197 WP_001355150.1 84/90(186) 1–186 pyridine nucleotide-disulfide oxidoreductase [Escherichia coli] PL78_09650 (441) Length: 441 WP_038340583.1 73/85(441) 1–441 AraC family transcriptional regulator [Ewingella americana] PL78_09655 (288) Length: 284 WP_034790889.1 61/74(282) 1–282 glycine/betaine ABC transporter [Yersinia nurmii] Length: 500 WP_049597746.1 100/100(500) 1–500 PL78_09660(500) glycine/betaine ABC transporter [Yersinia frederikseniir] Length: 500 WP_050108470.1 94/98(500) 1–500 6-O-methylguanine DNA methyltransferase [Yersinia nurmii] Length: 350 WP_049597747.1 93/95(349) 1–349 PL78_09665 (350) hypothetical protein [Serratia marcescens] Length: 351 WP_021504722.1 67/79(343) 11–351
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S16 of S87
DNA-3-methyladenine glycosidase [Yersinia nurmii] Length: 200 WP_049597748.1 95/97(200) 1–200 PL78_09670 (200) DNA-3-methyladenine glycosidase [Yersinia rohdei] Length: 202 WP_032817263.1 71/82(200) 1–200 peptide synthetase [Yersinia nurmii] Length: 501 WP_049597749.1 96/98(500) 1–500 PL78_09675 (501) peptide synthetase [Yersinia ruckeri] Length: 501 WP_042525915.1 76/83(500) 1–500 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase [Yersinia nurmii] Length: 248 WP_049598095.1 96/98(248) 1–248 PL78_09680 (248) 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase [Yersinia ruckeri] Length: 251 gbKFE37680.1 86/90(251) 1–251 isochorismatase [Yersinia nurmii] Length: 294 WP_049597750.1 97/97(294) 1–294 PL78_09685 (294) isochorismatase [Yersinia ruckeri] Length: 294 WP_042525917.1 85/91(294) 1–294 enterobactin synthase subunit E [Yersinia nurmii] Length: 543 WP_049597751.1 97/98(543) 1–543 PL78_09690 (543) enterobactin synthase subunit E [Yersinia ruckeri] Length: 544 WP_038244834.1 86/91(540) 1–540
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S17 of S87
menaquinone-specific isochorismate synthase [Yersinia nurmii] Length: 415 embCNE46363.1 96/97(415) 1–415 PL78_09695 (389) Enterobactin synthetase component C (Isochorismate synthase) [Yersinia ruckeri ATCC 29473] Length: 402 gbEEP98231.1 80/87(402) 1–402 iron ABC transporter substrate-binding protein [Yersinia nurmii] Length: 349 WP_049597752.1 95/96(346) 1–346 PL78_09700 (346) iron ABC transporter substrate-binding protein [Yersinia ruckeri] Length: 346 WP_038244836.1 77/86(346) 1–346 POT family transporter [Yersinia nurmii] Length: 425 WP_049597753.1 97/98(422) 1–425 PL78_09705 (425) POT family transporter [Yersinia ruckeri] Length: 422 WP_038244838.1 91/96(422) 1–422 iron-enterobactin transporter membrane protein [Yersinia nurmii] Length: 351 embCNE46474.1 PL78_09710 (312) 97/98(351) 1–351 Iron transporter Ferric enterobactin transport protein [Yersinia ruckeri ATCC 29473] Length: 351 gbEEP98234.1 87/94(351) 1–351 iron ABC transporter permease [Yersinia nurmii] Length: 347 WP_049597754.1 PL78_09715 (347) 97/97(347) 1–347 Iron transporter iron-enterobactin transporter permease [Yersinia enterocolitica] Length: 347 WP_019079081.1 81/89(347) 1–347
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S18 of S87
iron-dicitrate transporter ATP-binding subunit [Yersinia nurmii] Length: 276 WP_049597755.1 PL78_09720 (276) 97/98(276) 1–276 Iron transporter iron-dicitrate transporter ATP-binding subunit [Yersinia ruckeri] Length: 275 WP_045844292.1 86/94(271) 1–271 hypothetical protein [Yersinia nurmii] PL78_09725 (219) Length: 219 WP_049597756.1 85/90(219) 1–219 chromophore lyase [Yersinia nurmii] Length: 2399 WP_049597757.1 high molecular weight siderophore biosynthesis protein [Yersinia nurmii] emb|CNE46596.1| PL78_09730 (2399) Length: 2399 chromophore lyase 96/97(2399) 1–2399 chromophore lyase [Yersinia ruckeri] Length: 2386 WP_038244849.1 72/83(2400) 1–2384 Uncharacterized protein conserved in bacteria [Yersinia nurmii] embCNE46635.1 97/98(74) 16–89 antibiotic synthesis protein MbtH [Yersinia ruckeri] Length: 74 WP_038244851.1 PL78_09735 (73) 81/89(74) 1–74 antibiotic synthesis protein MbtH [Xenorhabdus cabanillasii] Length: 84 WP_051502373.1 56/67(73) 1–69 enterochelin esterase [Yersinia nurmii] Length: 435 WP_049597758.1 PL78_09740 (435) 95/97(435) 1–435 Enterochelin esterase enterochelin esterase [Yersinia ruckeri] Length: 439 WP_042525934.1 80/87(435) 1–435
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S19 of S87
ferrichrysobactin receptor [Yersinia nurmii] Length: 736 WP_049597759.1 PL78_09745 (736) 98/99(736) 1–736 Ferrichrysobactin receptor ferrichrysobactin receptor [Yersinia ruckeri] Length: 735 WP_004722010.1 88/94(736) 1–735 Uncharacterised protein [Yersinia nurmii] Length: 139 embCNE46726.1 95/97(119) 21–139 PL78_09750 (139) hypothetical protein [Yersinia mollaretii] Length: 136 WP_049646990.1 59/69(126)11–136 hypothetical protein [Yersinia nurmii] Length: 112 WP_049597761.1 88/91(112) 1–112 PL78_09755 (112) putative efflux system protein [Yersinia enterocolitica] Length: 129 embCFQ35865.1 55/69(92) 38–128 heavy metal RND transporter [Yersinia nurmii] Length: 426 WP_049597762.1 PL78_09760 (426) 93/95(424) 1–424 Transporter heavy metal RND transporter [Yersinia intermedia] Length: 432 WP_050077138.1 75/84(432) 1–432 cobalt transporter [Yersinia nurmii] Length: 503 WP_049597763.1 PL78_09765 (503) 92/94(503) 1–503 Transporter cobalt transporter [Yersinia frederikseniir] Length: 509 WP_050300177.1 71/83(509) 1–509
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S20 of S87
cation transporter [Yersinia nurmii] Length: 1040 WP_049597764.1 PL78_09770 (1040) 97/98(1040) 1–1040 Transporter putative cation efflux system protein [Yersinia kristensenii] Length: 1043 embCFR25599.1 92/96(1039) 1–1039 shikimate dehydrogenase [Yersinia nurmii] Length: 272 WP_049597765.1 97/98(272)1–272 PL78_09775 (272) shikimate dehydrogenase [Yersinia ruckeri] Length: 272 WP_038244855.1 88/94(271) 1–271 biopolymer transporter ExbD [Yersinia nurmii] Length: 141 WP_049597766.1 PL78_09780 (141) 99/100(141) 1–141 Transporter biopolymer transporter ExbD [Yersinia ruckeri] Length: 141 WP_004720996.1 91/96(141) 1–141 MotA/TolQ/ExbB proton channel family protein [Yersinia nurmii] Length: 339 embCNE47005.1 97/97(341) 1–339 PL78_09785 (238) tonB-system energizer ExbB [Yersinia ruckeri] Length: 339 gbAJI95450.1 85/90(342) 1–339 cystathionine beta-lyase [Yersinia nurmii] Length: 398 WP_049597767.1 97/98(398) 1–398 PL78_09790 (402) cystathionine beta-lyase [Yersinia ruckeri] Length: 398 gbAJI94061.1 Rang88/95(394) 1–394
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S21 of S87
membrane protein [Yersinia nurmii] Length: 220 WP_049597768.1 99/100(220) 1–220 PL78_09795 (220) membrane protein [Yersinia ruckeri] Length: 220 WP_004721003.1 92/95(220) 1–220 AraC family transcriptional regulator [Yersinia nurmii] Length: 297 WP_049598101.1 96/96(297) 1–297 PL78_09800 (297) AraC family transcriptional regulator [Yersinia ruckeri] Length: 299 WP_038244888.1 89/94(297) 1–297
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S22 of S87
Table S2. Yersinia entomophaga Rhs associated regions 2–5. For graphic depiction refer to Figure 3 of the associated manuscript.
Yersinia entomophaga Rhs associated region 2.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (over the Indicated Range of Amino acid Residues) in Relation Accession Number (Amino Acid Resides) to Target Sequence. Protein Domain ferritin [Yersinia nurmii] Length: 171 WP_049600522.1 PL78_18705(171) 99/99(171) 1–171 Ferritin ferritin [Yersinia ruckeri] Length: 171 WP_004721727.1 97/97(171) 1–171 hypothetical protein [Yersinia nurmii] Length: 128 WP_049600525.1 98/100(128) 1–128 PL78_18710(128) hypothetical protein [Yersinia ruckeri] Length: 128 WP_038243346.1 94/99(128) 1–128 copper resistance protein CopD [Yersinia nurmii] Length: 294 WP_049600528.1 PL78_18715 (294) 96/97(294) 1–294 CopD copper resistance protein CopD [Yersinia ruckeri] Length: 294 WP_045844133.1 80/87(294) 1–94 hypothetical protein [Yersinia nurmii] Length: 113 WP_049600531.1 97/98(113) 1–113 PL78_18720 (113) hypothetical protein [Yersinia mollaretii] Length: 113 WP_004875990.1 81/90(113) 1–113
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S23 of S87
integrase [Yersinia enterocolitica] PL78_18725 (263) Length: 369 WP_050876385.1 97/98(263) 107–369 MULTISPECIES: transposase [Yersinia] PL78_18730 (100) Length: 100 WP_042526049.1 100/100(100) 1–100 IS911 orfB [Shigella flexneri 2a str. 2457T] PL78_18735 (56) Length: 52 gbAAP16190.1 82/90(51) 1–51 Putative transposase [Yersinia enterocolitica] PL78_18740 (68) Length: 138 embCFB70873.1 93/95(68) 71–138 hypothetical protein [Yersinia ruckeri] PL78_18745(155) Length: 542 WP_038246006.1 99/98(253) 1–153 MULTISPECIES: hypothetical protein [Serratia] PL78_18750 (220) Length: 261 WP_025122879.1 60/78(218) 44–260 hypothetical protein [Yersinia aldovae] PL78_18755(91) Length: 105 WP_042546108.1 49/69(89) 17–105 hypothetical protein [Yersinia pekkanenii] Length: 221 WP_049615575.1 PL78_18760 (207) 77/86(195) 12–206 LopT cysteine protease [Photorhabdus luminescens] Length: 323 WP_058589369.1 24/40(181) 131–297 hypothetical protein [Yersinia nurmii] Length: 105 WP_049600537.1 92/96(104) 1–105 PL78_18765 (105) hypothetical protein [Yersinia aldovae] Length: 105 WP_042546108.1 59/71(104) 1–105
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S24 of S87
hypothetical protein [Yersinia aldovae] PL78_18770 (95) Length: 268 WP_042546107.1 61/74(94) 44–136 transposase [Yersinia rohdei] PL78_18775 (120) Length: 197 embCNF45791.1 46/53(167) 1–167 rhsa toxin protein [Yersinia nurmii] Length: 963 embCNE97220.1 PL78_18780 (965) 87/90(965) 1–963 RhsA insecticidal toxin complex protein TccC3 [Vibrio parahaemolyticus] (tc_PAI_042) Length: 971 gbAHZ10944.1 76/83(971) 1–971 hypothetical protein [Photorhabdus luminescens] Length: 462 WP_049582883.1 45/64(457) 6–460 PL78_18785 (458) hypothetical protein [Yersinia nurmii] Length: 458 WP_049600554.1 94/96(458) 1–458 inhibitor of vertebrate lysozyme precursor [Salmonella enterica subsp. VII] Length: 155 embCAX67957.1 PL78_18790 (150) 69/84(150) 6–155 Ivy Probable inhibitor of vertebrate lysozyme [Erwinia tasmaniensis Et1/99] Length: 154 embCAO95555.1 62/76(150) 7–154 lyseE threonine transporter [Raoultella terrigena] PL78_18795(205) Length: 205 WP_045857255.1 LyseE 84/91(205) 1–205 acetyltransferase [Yersinia ruckeri] PL78_18800(182) Length: 182 WP_038244025.1 92/98(182) 1–182
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S25 of S87
Yersinia entomophaga Rhs associated region 3.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number (Amino Acid Residues) to Target Sequence. Protein Domain transposase [Yersinia ruckeri] PL78_00880 (249) Length: 249 WP_042527218.1 99/100 (249) 1–249 transposase [Yersinia enterocolitica] PL78_00885 (88) Length: 96 WP_011815814.1 100/100(88) 9–96 IS1329 transposase B [Yersinia enterocolitica] PL78_00890 (252) Length: 280 embCRX47735.1 89/93(207) 1–207 hypothetical protein KOXM_28035 [Klebsiella oxytoca M5al] Length 116 gbEKP24881.1 87/93(187) 1–187 MULTISPECIES: membrane protein [Enterobacteriaceae] PL78_00895 (187) Length: 187 WP_024358370.1 87/93(87) 1–187 hypothetical protein [Serratia sp. Leaf51] Length: 187 WP_056771403.1 94/97(187) 1–187 major exported protein [Yersinia nurmii] Length: 172 WP_049602039.1 PL78_00900 (172) 100/100(172) 1–172 Hcp hypothetical protein [Photorhabdus temperata] Length: 172 WP_021323277.1 95/97(172) 1–172
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S26 of S87
type VI secretion protein [Yersinia nurmii] Length: 165 PL78_00905 (165) WP_049602042.1 99/99(165) 1–165 “type VI secretion protein” type VI secretion protein [Yersinia nurmii] Length: 493 WP_049602045.1 PL78_00910 (493) 100/100(493) 1–493 ImpC MULTISPECIES: type VI secretion protein [Yersinia pseudotuberculosis complex] Length: 493 WP_025381701.1 93/96(493) 1–493 lysozyme [Yersinia nurmii] Length: 146 WP_049602048.1 PL78_00915 (146) 98/98(146) 1–146 Lys MULTISPECIES: lysozyme [Serratia] Length: 146 WP_025123010.1 70/84(145) 1–146 type VI secretion protein [Yersinia nurmii] Length: 602 WP_049602051.1 PL78_00920 (602) 99/99(602) 1–602 ImpG type VI secretion protein [Yersinia pekkanenii] Length: 606 WP_049612770.1 80/89(606) 1–602 type VI secretion protein [Yersinia nurmii] Length: 347 WP_049602054.1 100/100(335) 1–347 PL78_00925(347) type VI secretion protein [Yersinia pseudotuberculosis] Length: 362 WP_050136839.1 80/90(335) 1–347 phosphopeptide-binding protein [Yersinia nurmii] Length: 436 WP_049602058.1 99/99(436) 1–436 PL78_00930 (436) MULTISPECIES: phosphopeptide-binding protein [Yersinia pseudotuberculosis complex] Length: 438 WP_033852633.1 67/79(439) 1–436
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S27 of S87
type VI secretion protein [Yersinia nurmii] Length: 180 WP_049602061.1 98/99(180) 1–180 PL78_00935 (180) type VI secretion protein [Xenorhabdus khoisanae] Length: 184 WP_047964021.1 66/80(184) 1–180 type VI secretion protein [Yersinia nurmii] Length: 448 WP_049602062.1 PL78_00940 (448) 99/99(448) 1–444 ImpJ type VI secretion protein [Yersinia aldovae] Length: 448 WP_049689231.1 83/91(448) 1–444 membrane protein [Yersinia nurmii] Length: 255 WP_049602063.1 PL78_00945 (255) 97/98(255) 1–255 MotB chemotaxis protein MotB [Photorhabdus asymbiotica] Length: 256 WP_012776473.1 79/88(256) 1–256 Clp protease ClpV [Yersinia nurmii] Length: 866 WP_049602066.1 PL78_00950 (866) 98/99(866) 1–866 ClpV MULTISPECIES: Clp protease ClpV [Yersinia pseudotuberculosis complex] Length: 867 WP_025381694.1 78/88(867) 1–866 Fis family transcriptional regulator [Yersinia nurmii] Length: 266 WP_049602068.1 PL78_00955 (266) 96/98(266) 1–266 Fis Fis family transcriptional regulator [Yersinia aldovae] Length: 265 WP_042546926.1 71/83(266) 1–265
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S28 of S87
type VI secretion protein [Yersinia nurmii] Length: 218 WP_049602071.1 96/96(218) 1–218 PL78_00960 (218) type VI secretion protein [Yersinia aldovae] Length: 219 WP_042546925.1 63/73(192) 30–219 membrane protein [Yersinia nurmii] Length: 467 WP_049602074.1 PL78_00965 (470) 96/96(467) 1–467 ImpA MULTISPECIES: membrane protein [Serratia] Length: 462 WP_025123019.1 60/73(471)1–467 type VI secretion protein IcmF [Yersinia nurmii] Length: 1183 WP_049602076.1 98/98(1183) 1–1183 PL78_00970 (1183) lipoprotein [Yersinia pseudotuberculosis] IcmF Length: 1177 embCFV32787.1 Orf3 73/85(1176) 2–177 type VI secretion protein IcmF [Photorhabdus luminescens] Length: 1181 WP_011144748.1 66/80(1168) 16–1181 membrane protein [Yersinia nurmii] Length: 441 WP_049602079.1 97/98(441) 1–441 membrane protein [Yersinia aldovae] PL78_00975 (441) Length: 442 WP_049634662.1 ImpA 58/73(443) 1–441 hypothetical protein [Photorhabdus luminescens] Length: 459 WP_011148302.1 34/51(466) 1–454
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S29 of S87
type VI secretion protein Vgr [Yersinia nurmii] Length: 756 WP_049602081.1 96/96(770) 1 to 756 type VI secretion protein Vgr [Serratia fonticola] PL78_00980 (770) Length: 743 WP_037413087.1 VgR 72/80(705) 52–743 unnamed protein product [Photorhabdus luminescens subsp. laumondii TTO1] Length: 704 embCAE12757.1 39/57(612) 3–604 hypothetical protein [Yersinia nurmii] Length: 139 WP_049602084.1 PL78_00985 (139) 98/98(138) 1–138 Orf5 hypothetical protein [Photorhabdus luminescens] Length: 139 WP_049584104.1 64/79(139) 1–139 YD repeat-/RHS repeat-containing protein [Yersinia nurmii] Length: 1451 embCNF22828.1 PL78_00990 (1444) 99/99(1320) 1–1320 Rhs type IV secretion protein Rhs [Photorhabdus asymbiotica] Length: 1451 WP_012777142.1 59/72(1345) 1–1320 hypothetical protein [Yersinia nurmii] Length: 123 WP_049602103.1 98/99(123) 1–123 PL78_00995 (123) hypothetical protein [Leminorella grimontii] Spt4 Length: 123 WP_027272928.1 100/100(13) 1–123 COG2093: Spt4
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S30 of S87
MULTISPECIES: hypothetical protein [Yersinia pseudotuberculosis complex] Length: 117 WP_025381673.1 85/93(117) 1–117 Uncharacterised protein [Yersinia similis] PL78_01000 (117) Length: 117 WP_054878057.1 85/92(117) 1–117 hypothetical protein [Photorhabdus luminescens] Length: 115 WP_011147332.1 66/84(117) 1–115 type IV secretion protein Rhs [Pectobacterium carotovorum] Length: 1424 WP_039503594.1 83/89(144) 1280–1423 PL78_01005 (145) hypothetical protein SK41_01880 [Enterobacter aerogenes] Length: 255 gbKLV93059.1 79/86(145) 111–254 hypothetical protein [Pectobacterium wasabiae] Length: 145 WP_025919449.1 61/64(142) 1–141 PL78_01010 (147) hypothetical protein [Enterobacter cloacae] Length: 141 WP_047174021.1 60/78(132) 10–140 hypothetical protein [Yersinia nurmii] Length: 67 WP_049602119.1 100/100(67) 1–67 PL78_01015 (67) hypothetical protein [Morganella morganii] Length: 284 WP_052927290.1 75/95(67) 218–284 hypothetical protein [Lonsdalea quercina] PL78_01025 (159) Length: 159 WP_036150158.1 94/96(159) 1–149 type IV secretion protein Rhs [Pantoea ananatis] PL78_01030 (97) Length: 1395 WP_028723925.1 TIGR03696: Rhs_assc_core 72/83(99) 1260–1358
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S31 of S87
hypothetical protein [Yersinia nurmii] Length: 82 WP_049602116.1 98/100(82) 1–82 hypothetical protein [Pantoea sp. BL1] PL78_01035 (82) Length: 82 WP_045834389.1 59/81(82) 1–82 hypothetical protein [Type-F symbiont of Plautia stali] Length: 82 WP_058958422.1 59/82(82) 1–82 hypothetical protein [Yersinia nurmii] Length: 127 WP_053215256.1 97/98(122) 6–127 hypothetical protein [Serratia fonticola] Length: 138 WP_051363166.1 PL78_01040 (139) 98/99(138) 1–138 AHH hypothetical protein ECA4293 [Pectobacterium atrosepticum SCRI1043] pfam14412 Length: 150 embCAG77190.1 74/83(139) 12–150 type IV secretion protein Rhs [Serratia fonticola] Length: 1487 WP_046808161.1 99/99(139) 1349–1487 hypothetical protein [Serratia fonticola] Length: 173 P_046808162.1 99/99(173) 1–173 hypothetical protein [Yersinia nurmii] PL78_01045 (173) Length: 173 WP_049596802.1 95/97(173) 1–173 hypothetical protein [Photorhabdus luminescens] Length: 177 WP_036812017.1 34/57(173) 5–174 membrane protein [Yersinia nurmii] Length: 321 WP_049596801.1 98/99(284) 38–321 PL78_01050 (321) putative membrane protein [Yersinia intermedia] Length: 284 gbAJJ19515.1 83/93(284) 1–284
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S32 of S87
Yersinia entomophaga Rhs associated region 4.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number (Amino Acid Residues) to Target Sequence. Protein Domain ketodeoxygluconokinase [Yersinia nurmii] Length: 317 WP_049597328.1 95/96(317) 1–317 PL78_11955 (317) ketodeoxygluconokinase [Yersinia ruckeri] Length: 317 WP_049689687.1 86/92(315) 1–315 peptidase [Yersinia nurmii] Length: 515 WP_049597329.1 96/97(515) 1–515 PL78_11960 (515) peptidase [Yersinia ruckeri] Length: 496 WP_042526849.1 90/94(490) 1–490 C4-dicarboxylate transporter [Yersinia nurmii] Length: 430 WP_049597330.1 99/99(430) 1–430 PL78_11965 (430) C4-dicarboxylate ABC transporter [Yersinia ruckeri] Length: 430 WP_004723244.1 97/98(430) 1–430 biofilm formation regulator HmsP [Yersinia nurmii] Length: 666 embCNE26472.1 98/99(655) 12–666 PL78_11970 (655) biofilm formation regulator HmsP [Yersinia ruckeri] Length: 655 WP_038242966.1 81/90(655) 1–655
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S33 of S87
cellulose synthase [Yersinia ruckeri] Length: 1160 WP_042526844.1 PL78_11975 (1159) 86/92(1160) 1–1160 CelC cellulose synthase [Yersinia ruckeri] Length: 1160 WP_038242904.1 86/92(1160) 1–1160 endoglucanase [Yersinia nurmii] Length: 377 WP_049597332.1 PL78_11980 (377) 97/97(377) 1–377 CelD endoglucanase [Yersinia ruckeri] Length: 376 WP_004723238.1 86/91(377) 1–376 cellulose synthase [Yersinia nurmii] Length: 770 WP_049597464.1 PL78_11985 (770) 96/97(770) 1–770 CelB cellulose synthase [Yersinia ruckeri] Length: 770 WP_042528353.1 90/94(770) 1–770 cellulose synthase [Yersinia nurmii] Length: 875 WP_049597333.1 PL78_11990 (875) 98/98(875) 1–875 CelA cellulose synthase [Yersinia ruckeri] Length: 875 WP_038276495.1 91/95(875) 1–875 cell division protein [Yersinia nurmii] Length: 243 WP_049597334.1 PL78_11995 (243) 95/98(243) 1–243 CelT cell division protein [Yersinia ruckeri] Length: 245 WP_038276497.1 79/87(245) 1–245
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S34 of S87
hypothetical protein [Yersinia nurmii] Length: 63 WP_049597335.1 PL78_12000 (63) 90/92(63) 1–63 CelS hypothetical protein [Yersinia ruckeri] Length: 63 WP_038242910.1 90/95(63) 1–63 cellulose biosynthesis protein BcsE [Yersinia ruckeri] PL78_12005 (518) Length: 518 WP_042526838.1 CelP 84/92(518) 1–518 WP_042526824.1 WP_042526824.1 membrane protein [Yersinia ruckeri] WP_042526824.1 Length: 546 WP_042526834.1 84/91(553) 1–546 dipeptide transporter ATP-binding subunit [Yersinia nurmii] Length: 341 embCNE26976.1 98/98(334) 8–334 PL78_12020 (334) dipeptide transporter ATP-binding subunit [Yersinia enterocolitica] Length: 341 embCFQ43661.1 98/98(333) 8–340 peptide ABC transporter ATP-binding protein [Yersinia nurmii] Length: 326 WP_049597338.1 99/100(1–326) 1–326 PL78_12025 (326) peptide ABC transporter ATP-binding protein [Yersinia ruckeri] Length: 326 WP_042526832.1 98/98(326) 1–326 peptide transporter [Yersinia nurmii] Length: 300 WP_049597339.1 99/100(300) 1–300 PL78_12030 (300) peptide ABC transporter [Yersinia ruckeri] Length: 300 WP_004718359.1 98/99(300) 1–300
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S35 of S87
hypothetical protein [Yersinia nurmii] Length: 339 WP_049597340.1 99/99(339) 1–339 PL78_12035 (339) hypothetical protein [Yersinia ruckeri] Length: 339 WP_038242913.1 99/99(33) 1–339 peptide ABC transporter substrate-binding protein [Yersinia nurmii] Length: 536 WP_049597341.1 99/99(536) 1–536 PL78_12040 (536) peptide ABC transporter substrate-binding protein [Yersinia ruckeri] Length: 536 WP_004718354.1 97/98(536) 1–536 MFS transporter [Yersinia nurmii] Length: 443 WP_049597342.1 99/100(443) 1–443 PL78_12050 (443) hypothetical protein [Yersinia ruckeri] Length: 445 WP_004718352.1 97/98(443) 1–443 PL78_12045 tRNA-Pro MFS transporter [Yersinia nurmii] Length: 443 WP_049597342.1 99/100(443) 1–443 PL78_12050 (443) hypothetical protein [Yersinia ruckeri] Length: 445 WP_004718352.1 97/98(443) 1–443 histidine kinase [Yersinia nurmii] Length: 509 WP_049597343.1 99/99(509) 1–509 PL78_12055 (509) histidine kinase [Yersinia ruckeri] Length: 509 WP_038242914.1 91/95(509) 1–509
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S36 of S87
DNA-binding response regulator [Yersinia nurmii] Length: 196 WP_049597344.1 99/99(196) 1–196 PL78_12060 (196) DNA-binding response regulator [Yersinia ruckeri] Length: 196 WP_038242915.1 95/98(196) 1–196 phosphoethanolamine transferase [Yersinia nurmii] Length: 563 WP_049597345.1 98/99(563) 1–563 PL78_12065 (563) phosphoethanolamine transferase [Yersinia ruckeri] Length: 563 WP_042528351.1 91/95(561) 1–561 organic hydroperoxide resistance protein [Yersinia nurmii] Length: 141 WP_049597346.1 98/98(141) 1–141 PL78_12070 (141) MULTISPECIES: organic hydroperoxide resistance protein [Yersinia] Length: 141 WP_038637498.1 95/91(1410) 1–141 homoprotocatechuate degradative operon repressor [Yersinia nurmii] Length: 144 embCNE27397.1 95/97(144) 1–144 PL78_12075 (149) Transcriptional regulator, MarR family [Yersinia frederikseniir ATCC 33641] Length: 144 gbEEQ15729.1 85/93(143) 1–143 membrane protein [Yersinia nurmii] Length: 487 WP_049597348.1 98/99(487) 1–487 PL78_12080 (487) membrane protein [Yersinia ruckeri] Length: 487 WP_038242916.1 93/96(487) 1–497
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S37 of S87
membrane protein [Yersinia nurmii] Length: 175 WP_049597349.1 97/97(175) 1–175 PL78_12085 (175) membrane protein [Yersinia ruckeri] Length WP_004718344.1 84/90(172) 1–172 proline-specific permease [Yersinia nurmii] Length: 464 WP_049597350.1 PL78_12090 (464 99/100 1–464 proline-specific permease [Yersinia ruckeri] Length: 464 WP_042526824.1 95/97(463) 1–463 histidine ammonia-lyase [Yersinia nurmii] Length: 511 WP_049597351.1 PL78_12095 (511) 98/98(511) 1–511 histidine ammonia-lyase [Yersinia ruckeri] Length: 511 WP_038276502.1 95/97(510) 1–510 urocanate hydratase [Yersinia nurmii] Length: 563 WP_049597352.1 PL78_12100 (563) 99/99(562) 1–562 Uhyd urocanate hydratase [Yersinia ruckeri] Length: 563 WP_038242919.1 98/99(563) 1–563 hypothetical protein [Yersinia nurmii] Length: 592 WP_049597353.1 PL78_12105 (592) 90/94(592) 1–592 IcmF type VI secretion protein IcmF [Pantoea sp. MBLJ3] Length: 1145 WP_039659128.1 32/50(560) 409–950
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S38 of S87
hypothetical protein [Yersinia nurmii] Length: 207 WP_049597354.1 PL78_12110 (205) 90/96(196) 6–201 VasF hypothetical protein [Yersinia mollaretii] Length: 207 WP_032813416.1 39/60(207) 1–198 hypothetical protein [Serratia fonticola] Length: 176 WP_037411404.1 86/91(175) 1–175 hypothetical protein [Xenorhabdus cabanillasii] PL78_12115 (176) Length: 164 WP_038263077.1 40–58(172) 1–162 hypothetical protein [Photorhabdus luminescens] Length: 164 WP_040154291.1 38/58(170) 1–160 hypothetical protein [Yersinia pseudotuberculosis] PL78_12120 (131) Length: 131 WP_0503212031 88/94(131) 1–131 type IV secretion protein Rhs [Yersinia similis] PL78_12125(138) Length: 457 gbAHK18882.1 T4SS 92/96(132) 326–457 type III secretion system effector protein, partial [Xanthomonas campestris pv. musacearum NCPPB 4379] locus, KWO_0111025 gbKFA09649.1 PL78_12130(204) Length: 82 T3SS 37/46(52) 18–69 hypothetical protein [Photorhabdus luminescens] Length: 201 WP_049584090.1 46/56(203) 4–201
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S39 of S87
RHS/YD repeat-containing protein [Yersinia nurmii] Length: 1395 embCND85328.1 PL78_12135 (1400) 95/96(1257) 1–1297 Rhs RHS/YD repeat-containing protein wapA_1 [Yersinia pseudotuberculosis] Length: 1406 embCNB75225.1 86/90(1297) 1–1297 hypothetical protein [Yersinia nurmii] Length: 144 WP_049596388.1 97/98(144) 1–144 hypothetical protein [Serratia fonticola] PL78_12140 (144) Length: 144 WP_021181280.1 84/88(144) 1–144 hypothetical protein [Photorhabdus luminescens] Length: 141 WP_049583043.1 53/71(135) 6–140 integrase core domain protein [Yersinia ruckeri] Length: 264 gbAJI95622.1 99/99(249) 16–264 PL78_12145 (249) IS1400 transposase B [Yersinia enterocolitica subsp. enterocolitica WA-314] Length: 249 gbEKA28335.1 97/98(249) 1–249 transposase [Yersinia enterocolitica] Length: 96 WP_011815814.1 100/100(88) 9–96 PL78_12150 (89) transposase [Citrobacter youngae ATCC 29220] Length: 95 gbEFE06341.1 100/100(88) 8–95
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S40 of S87
aldehyde dehydrogenase [Yersinia enterocolitica] PL78_12155 (110) Length: 110 WP_050130145.1 91/94(110) 1–110 hypothetical protein [Yersinia massiliensis] Length: 141 WP_049607925.1 99/98(141) 1–141 PL78_12160 (141) hypothetical protein [Photorhabdus luminescens] Length: 141 WP_049583905.1 48/78(141) 1–141 helicase [Yersinia massiliensis] PL78_12165 (619) Length: 619 WP_049607923.1 99/99(619) 1–619
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S41 of S87
Yersinia entomophaga Rhs associated region 5.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number (Amino Acid Residues) to Target Sequence. Protein Domain LysR family transcriptional regulator [Yersinia nurmii] Length: 306 WP_049602006.1 PL78_15035(306) 97/98(306) 1–306 LysR LysR family transcriptional regulator [Yersinia ruckeri] Length: 306 WP_004721488.1 94/96(306) 1–306 hypothetical protein [Yersinia nurmii] Length: 293 WP_049602009.1 57/68(89) 186–274 PL78_15040 (115) hypothetical protein [Yersinia frederikseniir] Length: 291 WP_050083633.1 37/58(114) 161–274 hypothetical protein [Chromobacterium violaceum] Length: 89 WP_011135095.1 47/67(86) 1–86 PL78_15045 (93) hypothetical protein [Photorhabdus luminescens] Length: 81 WP_036775687.1 45/64(77) 1–77 hypothetical protein [Chromobacterium violaceum] PL78_15050 (265) Length: 265 WP_011135094.1 39/59(268) 1–264 3-oxoacyl-ACP synthase [Chromobacterium violaceum] PL78_15055 (416) Length: 416 WP_045050403.1 3-o-ACP 76/83(416) 1–416
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S42 of S87
unnamed protein product [Photorhabdus luminescens subsp. laumondii TTO1] PL78_15060 (321) Length: 340 embCAE14514.1 28/21(351) 9–329 hypothetical protein [Photorhabdus luminescens] Length: 186 WP_049581660.1 32/52(170) 14–179 PL78_15065 (181) PREDICTED: xaa-Pro dipeptidase isoform X1 [Xenopus (Silurana) tropicalis] Length: 554 XP_012816407.1 25/42(146) 121–265 type IV secretion protein Rhs [Pseudomonas fluorescens] PL78_15070 (1584) Length: 1577 WP_034134568.1 Rhs 40/58(1449) 1–1433 hypothetical protein [Yersinia intermedia] Length: 160 WP_050074372.1 PL78_15075 (160) 58/76(159) 1–159 NusG NusG-type transcription antiterminator [Serratia entomophila] Length: 160 WP_010895762.1 53/73(159) 1–159 CMY/LAT/MOX/ACT/MIR/FOX family class C beta-lactamase [Yersinia ruckeri] PL78_15080 (214) Length: 381 WP_004721718.1 AmpC 96/97(212) 1–212 ISEhe3 transposase A [Yersinia ruckeri ATCC 29473] PL78_15085 (92) Length: 94 gbEEP97487.1 95/96(92) 3–94 transposase [Yersinia pekkanenii] PL78_15090 (283) Length: 283 WP_049615490.1 99/99(283) 1–283 MULTISPECIES: hypothetical protein [Enterobacteriaceae] PL78_15095 (283) Length: 283 WP_048990909.1 100/100(283) 1–283
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S43 of S87
hypothetical protein [Escherichia coli] Length: 68 WP_001071601.1 100/100(68)1–68 PL78_15100 (68) DNA binding protein [Plautia stali symbiont] Length: 70 dbjBAN95392.1 99/100(68) 3–70 hypothetical protein [Escherichia coli] PL78_15105 (169) Length: 169 WP_001610849.1 96/97(133) 1–133 MULTISPECIES: hypothetical protein [Enterobacteriaceae] PL78_15110 (189) Length: 189 WP_001610847.1 97/98(189) 1–189 hypothetical protein E1470_c27270 [Escherichia coli ECC-1470] Length: 92 gbAJG09638.1 100//100(90) 3–92 PL78_15115 (90) His-Xaa-Ser system protein HxsD [Photorhabdus luminescens] Length: 90 WP_058588807.1 96/98(90)1–90 His-Xaa-Ser system radical SAM maturase HxsB [Escherichia coli] PL78_15120 (462) Length: 462 WP_023567064.1 99/100(462) 1–462
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S44 of S87
Table S3. Yersinia entomophaga Type II and III associated regions. For graphic depiction refer to Figure 4 of the associated manuscript.
Yersinia entomophaga T3SSYE1.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number (Amino Acid Resides) to Target Sequence. Protein Domain hypothetical protein SLIQ_15070 [Serratia liquefaciens FK01] Length: 209 dbjGAK27997.1 PL78_18070 (296) 33/55(202) 5–206 LuxR hypothetical protein [Yersinia nurmii] Length: 296 WP_049596354.1 85/91(296) 1–296 hypothetical protein [Yersinia nurmii] Length: 2359 WP_049596353.1 92/94(2337) 1–2336 hypothetical protein [Hafnia alvei] Length: 2332 WP_051874183.1 PL78_18075 (2347) 44/61(2355) 1–2319 Intimim invasin [Xenorhabdus bovienii] Length: 2217 WP_012988596.1 43/60(1607) 16–1595 invasin [Sodalis praecaptivus] Length: 934 WP_025423285.1 46/53(900) 17–905 hypothetical protein [Yersinia nurmii] Length: 151 WP_049596352.1 79/86(151) 1–151 PL78_18080 (151) alpha-N-arabinofuranosidase [Cellvibrio japonicus] Length: 375 WP_012488648.1 27/47(100) 93–176
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S45 of S87
hypothetical protein [Yersinia frederikseniir] Length: 345 WP_050318901.1 33/51(129) 210–316 PL78_18085 (241) hypothetical protein [Yersinia nurmii] Length: 241 WP_049596351.1 75/87(160) 82–241 DUF218 domain [Yersinia nurmii] Length: 455 embCND83898.1 93/95(455) 1–455 PL78_18090 (371) hypothetical protein [Pseudomonas sp. UW4] Length: 435 WP_015095362.1 54/70(391) 44–433 invasion protein IagB [Yersinia nurmii] Length: 143 WP_049596806.1 PL78_18095 (139) 97/98(143) 1–143 IaGB invasion protein IagB [Serratia fonticola] Length: 146 WP_046808476.1 64/80(136) 4–139 PL78_18100 (69) NA hypothetical protein [Serratia fonticola] Length: 263 WP_024486144.1 PL78_18105 (193) 45/62(264) 1–263) InvF hypothetical protein [Yersinia nurmii] WP_049596350.1 Length: 255
96/98(255) 1–255 type III secretion system outer membrane pore InvG [Serratia fonticola] Length: 564 WP_024486143.1 PL78_18110 (549) 72/84(564) 1–563 InvG type III secretion system protein [Yersinia nurmii] Length: 562 embCND83797.1 99/99(562) 1–562 1–562
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S46 of S87
hypothetical protein [Yersinia nurmii] Length: 381 WP_049596349.1 PL78_18115 (367) 96/97(380) 1–380 InvE hypothetical protein [Serratia fonticola] Length: 381 WP_024486142.1 64/80(332) 35–366 type III secretion system protein InvA [Yersinia nurmii] Length: 682 WP_049596348.1 PL78_18120 (681) 98/98(682) 1–682 InvA type III secretion system protein InvA [Serratia fonticola] Length: 685 WP_024486141.1 76/88(685) 1–685 hypothetical protein [Serratia fonticola] Length: 134 WP_024486140.1 PL78_18125 (133) 59/81(133) 2–134 SpaK hypothetical protein [Yersinia nurmii] Length: 133 WP_049596347.1 97/100(133) 1–133 ATP synthase [Serratia fonticola] Length: 430 WP_024486139.1 PL78_18130 (430) 81/88(430) 1–430 InvC ATP synthase [Yersinia nurmii] ATP synthase Length: 430 WP_049596346.1 97/98(430) 1–430 hypothetical protein [Serratia fonticola] Length: 151 WP_037413054.1 PL78_18135 (151) 44/66(151) 1–151 SpaM hypothetical protein [Yersinia nurmii] Length: 151 WP_049596345.1 92/94(151) 1–151
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S47 of S87
hypothetical protein [Serratia fonticola] Length: 328 WP_024486137.1 PL78_18140 (358) 39/55(84) 254–328 SpaN hypothetical protein [Yersinia nurmii] Length: 358 WP_049596344.1 87/91(358) 1–358 hypothetical protein [Serratia fonticola] Length: 286 WP_037413052.1 PL78_18145 (317) 51/68(289) 1–286 SpaO hypothetical protein [Yersinia nurmii] Length: 317 WP_049596343.1 91/96(317) 1–317 type III secretion system protein [Yersinia nurmii] PL78_18150(219) Length: 219 WP_049596342.1 FilP 99/100(219)1–219 type III secretion system protein SpaQ [Yersinia nurmii] Length: 84 WP_049596341.1 PL78_18155(84) 100/100(84) 1–84 SpaQ surface presentation of antigens protein SpaQ [Cedecea davisae] Length: 85 WP_016537922.1 83/93(83) 1–83 hypothetical protein [Serratia fonticola] Length: 254 WP_024486133.1 PL78_18160 (254) 76/85(253) 1–253 SpaR type III secretion apparatus SpaR [Yersinia nurmii] Length: 254 WP_049596340.1 97/99(254) 1–254 type III secretion system protein SpaS [Serratia fonticola] Length: 355 WP_046808151.1 PL78_18165 (350) 72/88(346) 1–346 SpaS type III secretion system protein SpaS [Yersinia nurmii] Length: 350 WP_049596339.1 97/98(350) 1–350
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S48 of S87
chaperone protein SicA [Yersinia nurmii] Length: 164 WP_049596338.1 PL78_18170 (164) 98/100(164) 1–164 SicA chaperone protein SicA [Serratia fonticola] Length: 158 WP_037412608.1 71/90(151) 1–151 hypothetical protein [Yersinia nurmii] Length: 630 WP_049596337.1 PL78_18175 (630) 95/98(630) 1–630 SipB hypothetical protein [Serratia fonticola] Length: 609 WP_046808152.1 47/67(604) 12–605 hypothetical protein [Yersinia nurmii] Length: 400 WP_049596336.1 PL78_18180 (400) 96/97(399)1–399 SipC hypothetical protein [Serratia fonticola] Length: 364 WP_024485265.1 33/51(281) 47–323 cell invasion protein SipD, partial [Chromobacterium violaceum] Length: 283 WP_045050982.1 PL78_18185 (408) 47/66(212)74–281 SipD hypothetical protein [Yersinia nurmii] Length: 407 WP_049596335.1 89/92(409) 1–407 hypothetical protein [Yersinia nurmii] Length: 805 WP_049596334.1 PL78_18190 (752) 86/91(444) 1–443 SipA hypothetical protein [Serratia fonticola] Length: 733 WP_024485266.1 28/48(194) 60–247
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S49 of S87
hypothetical protein [Yersinia nurmii] Length: 77 WP_049596333.1 92/97(77) 1–77 PL78_18195(85) acyl carrier protein [Candidatus Regiella insecticola] Length: 91 WP_039908335.1 43/69(75) 2–76 type III secretion system needle complex protein PrgH [Yersinia nurmii] Length: 402 embCND83112.1 PL78_18205 (402) 96/98(402) 1–402 PrgH hypothetical protein [Serratia fonticola] Length: 401 WP_046808154.1 46/66(401) 2–401 type III secretion system needle complex protein PrgI [Yersinia nurmii] Length: 87 WP_049596331.1 PL78_18210 (87) 92/95(87) 1–87 PrgI type III secretion apparatus needle protein [Cedecea davisae DSM 4568] Length: 90 gbEPF14983.1 76/81(76) 15–90 hypothetical protein [Yersinia nurmii] Length: 100 WP_049596330.1 PL78_18215 (100) 97/98(100)1–100 PrgJ hypothetical protein [Serratia fonticola] Length: 97 WP_024485270.1 53/80(96) 2–97 pathogenicity island 1 effector protein [Yersinia nurmii] Length: 244 WP_049596329.1 PL78_18220(244) 98/98(244) 1–244 PrgK type III secretion apparatus lipoprotein [Serratia fonticola] Length: 235 WP_024485271.1 66/83(229) 2–230 hypothetical protein [Yersinia nurmii] Length: 190 WP_049596328.1 PL78_18225 (190) 94/97(190)1–190 OrgA hypothetical protein [Serratia fonticola] Length: 199 WP_024485272.1 46/63(182) 15–196
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S50 of S87
hypothetical protein [Yersinia nurmii] Length: 233 WP_049596327.1 PL78_18230 (233) 95/98(233) 1–233 OrgB hypothetical protein [Serratia fonticola] Length: 230 WP_024485273.1 42/65(149) 1–226 hypothetical protein [Yersinia nurmii] Length: 70 97/99(58) 1–70 WP_049596326.1 Sequence ID: emb|CND82903.1| PL78_18235 (73) Length: 70 81/90(70) 1–70 hypothetical protein [Serratia fonticola] Length: 71 WP_024485274.1 48/68(58) 14–71 Uncharacterised protein [Yersinia nurmii] Length: 196 embCND82874.1 91/94(196) 1–196 PL78_18240 (197) hypothetical protein [Serratia fonticola] Length: 197 WP_024485275.1 44/61(201) 1–196 oxidoreductase [Yersinia nurmii] Length: 438 WP_049596324.1 97/98(438) 1–438 PL78_18245 (438) oxidoreductase [Serratia fonticola] Length: 438 WP_046808249.1 80/90(438) 1–438 agmatine deiminase [Yersinia nurmii] Length: 367 WP_049596323.1 91/95(367) 1–367 PL78_18250 (367) agmatine deiminase [Marinomonas mediterranea] Length: 367 WP_013660875.1 67/78(366) 1–365
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S51 of S87
Yersinia entomophaga T3SSYE2.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus % Identity/% similarity (over the Indicated Range of Amino Acid Residues) in Relation to Accession Number (Amino Acid Residues) Target Sequence. Protein Domain DNA mismatch repair protein MutS [Yersinia nurmii] PL78_14480 (851) Length: 851 WP_049601201.1 99/99(851) 1–851 membrane protein [Yersinia nurmii] Length: 147 embCNF08019.1 90/93(147) 1–147 PL78_14490 (147) hypothetical protein BD65_2656 [Yersinia ruckeri] Length: 149 gbAJI94952.1 63/75(149) 1–149 lytic transglycosylase [Yersinia nurmii] Length: 159 WP_049601195.1 81/91(159) 1–159 PL78_14495 (120) lytic transglycosylase [Yersinia ruckeri] Length: 158 WP_038244579.1 61/77(145) 11–155 helicase [Halomonas sp. TG39a] Length: 907 WP_035576868.1 31/47(122) 82–199 PL78_14500 (117) Uncharacterised protein [Yersinia nurmii] Length: 138 embCNF07957.1 73/83(138) 1–138 invasion protein OrgB [Yersinia nurmii] Length: 224 embCNF07929.1 PL78_14505 (224) 82/90(224) 1–224 OrgB hypothetical protein [Yersinia ruckeri] Length: 222 WP_042527542.1 40/60(213) 10–222
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S52 of S87
hypothetical protein [Yersinia nurmii] Length: 181 WP_049601187.1 84/91(160) 21–180 PL78_14510 (181) hypothetical protein [Yersinia ruckeri] Length: 176 WP_038251258.1 44/67(158) 17–174 type III secretion protein [Yersinia nurmii] Length: 247 WP_049601185.1 PL78_14515 (248) 91/94(247) 1–247 Prgk type III secretion protein [Yersinia ruckeri] Length: 252 WP_042527545.1 69/80(247) 1–243 hypothetical protein [Yersinia ruckeri] Length: 100 WP_042527547.1 PL78_14520 (101) 44/61(101) 1–100 PrgJ hypothetical protein [Yersinia nurmii] Length: 101 WP_049601183.1 94/97(101) 1–101 hypothetical protein [Yersinia nurmii] Length: 99 WP_049601181.1 PL78_14525 (100) 36/51(97) 1–99 PrgI hypothetical protein [Yersinia ruckeri] Length: 104 WP_042527549.1 36/51(97) 8–103 type III secretion system needle complex protein PrgH [Yersinia nurmii] Length: 422 embCNF07697.1 PL78_14530 (422) 85/92(422) 1–422 PrgH hypothetical protein [Yersinia ruckeri] Length: 395 WP_042527551.1 39/59(411) 3–395
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S53 of S87
hypothetical protein [Yersinia ruckeri] Length: 264 WP_052470857.1 PL78_14535 (150) 42/57(143) 14–156 AraC hypothetical protein [Yersinia nurmii] Length: 261 WP_049601175.1 83/89(131) 7–137 type III secretion system protein [Yersinia nurmii] Length: 567 WP_049601173.1 PL78_14540 (567) 95/97(567) 1–567 InvG type III secretion system protein [Yersinia ruckeri] Ysac Length: 570 WP_042527553.1 74/86(565) 5–569 hypothetical protein [Yersinia nurmii] Length: 366 WP_049601168.1 PL78_14545 (366) 90/95(366) 1–366 InvE hypothetical protein [Yersinia ruckeri] Ysaw Length: 368 WP_038244567.1 67/82(357) 1–357 type III secretion system protein InvA [Yersinia ruckeri] Length: 689 WP_045844472.1 PL78_14550 (691) 80/88(689) 1–689 InvA type III secretion system protein InvA [Yersinia nurmii] Length: 689 WP_049601166.1 95/97(689) 1–689 type III secretion system protein [Yersinia nurmii] Length: 135 WP_049601164.1 PL78_14555 (140) 91/95(135) 1–135 InvB type III secretion system protein [Yersinia ruckeri] Ysak Length: 135 WP_042527558.1 66/78(134) 1–134
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S54 of S87
ATP synthase SpaL [Yersinia nurmii] Length: 399 embCNF07457.1 PL78_14560 (430) 92/96(399) 1–399 SpaL ATP synthase [Yersinia nurmii] InvC Length: 430 WP_049601162.1 92/96(430) 1–430 hypothetical protein [Yersinia nurmii] Length: 153 WP_049601160.1 82/90(153) 1–153 PL78_14565 (153) hypothetical protein [Yersinia ruckeri] Length: 159 WP_038244563.1 49/70(152) 1–152 hypothetical protein [Yersinia ruckeri] Length: 411 WP_042527563.1 53/73(75) 335–409 PL78_14570 (365) hypothetical protein [Yersinia nurmii] Length: 365 WP_049601159.1 75/82(365) 1–365 hypothetical protein [Yersinia nurmii] Length: 310 WP_049601155.1 PL78_14575 (310) 84/92(310) 1–310 SpoA hypothetical protein [Yersinia ruckeri] Ysaq Length: 308 WP_038244561.1 51/67(310) 1–308 type III secretion system protein [Yersinia nurmii] Length: 218 WP_049601152.1 PL78_14580 (218) 96/98(218) 1–218 Spap type III secretion system protein [Yersinia ruckeri] YsaR Length: 218 WP_042527567.1 83/92(218) 1–218
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S55 of S87
type III secretion apparatus protein [Yersinia nurmii] Length: 87 WP_049601148.1 PL78_14585 (87) 94/97(87) 1–87 Spaq hypothetical protein [Yersinia ruckeri] Length: 87 WP_004722103.1 88/97(86) 1–86 type III secretion system protein [Yersinia nurmii] Length: 264 WP_049601145.1 PL78_14590 (264) 94/96(264) 1–264 SpaR type III secretion system protein [Yersinia ruckeri] YscT Length: 264 WP_042527569.1 79/90(264) 1–264 type III secretion system protein [Yersinia ruckeri] Length: 386 WP_042527571.1 PL78_14595 (376) 76/89(377) 1–374 SpaS type III secretion system protein [Yersinia nurmii] Length: 376 WP_049601142.1 94/98(376) 1–376 type III secretion protein [Yersinia ruckeri] Length: 170 gbKFE37947.1 PL78_14600 (170) 84/91(167) 1–167 SicA type III secretion protein [Yersinia nurmii] Length: 170 WP_049601141.1 96/97(170) 1–170 hypothetical protein [Yersinia nurmii] Length: 643 WP_049601136.1 PL78_14605 (643) 89/93(643) 1–643 SipB hypothetical protein [Yersinia ruckeri] Ysp1 Length: 659 WP_042527573.1 43/64(676) 1–643
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S56 of S87
hypothetical protein [Yersinia nurmii] Length: 410 WP_049601135.1 PL78_14610 (410) 84/91(410) 1–410 SipC hypothetical protein [Yersinia ruckeri] Yspc Length: 503 WP_038275434.1 30/54(337) 179–503 hypothetical protein [Yersinia nurmii] Length: 341 WP_049601131.1 PL78_14615 (682) 86/92(341) 1–341 SipD hypothetical protein [Yersinia ruckeri] Length: 365 WP_038275436.1 44/64(226) 143–365 acyl carrier protein [Yersinia nurmii] Length: 91 embCNF06932.1 84/90(92) 1–89 PL78_14620 (93) hypothetical protein [Yersinia ruckeri] Length: 94 WP_052470858.1 55/75(73) 19–91 secretion protein [Yersinia nurmii] Length: 128 WP_049601130.1 93/95(128) 1–128 PL78_14625 (128) secretion protein [Yersinia mollaretii] Length: 128 WP_004874038.1 54/72(128) 1–128 fumarate hydratase [Yersinia ruckeri] Length: 547 WP_004722663.1 98/98(547) 1–547 PL78_14630 (547) fumarate hydratase [Yersinia nurmii] Length: 547 WP_049601127.1 99/99(547) 1–547
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S57 of S87
Yersinia entomophaga general secretion pathway protein T2SS.
Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number to Target Sequence. Protein Domain transcriptional regulator [Yersinia nurmii] Length: 222 WP_049599794.1 PL78_08915 (222) 93/95(222) 1–222 LysR hypothetical protein [Yersinia ruckeri] Length: 222 WP_042525802.1 59/76(222) 1–222 transposase [Yersinia enterocolitica] Length: 180 WP_050927038.1 74/75(97) 22–118 PL78_08920 (98) transposase [Serratia sp. Leaf51] Length: 180 WP_056779158.1 74/75(96) 22–117 transposase [Pluralibacter gergoviae] Length: 88 WP_048282832.1 82/88(60) 1–60 PL78_08925 (65) transposase [Yersinia enterocolitica] Length: 88 WP_050927036.1 82/88(60) 1–60 general secretion pathway protein K [Yersinia nurmii] Length: 259 embCNE84927.1 PL78_08930 (280) 78/87(256) 1–256 GspK hypothetical protein [Yersinia ruckeri] Length: 321 WP_038276190.1 33/52(315) 5–317
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S58 of S87
type II secretion system protein GspJ [Yersinia nurmii] Length: 213 WP_049599786.1 PL78_08935 (204) 87/94(204) 10–213 GspJ general secretion pathway protein J [Serratia marcescens FGI94] Length: 202 gbAGB84035.1 34/56(198) 11–200 type II secretion system protein GspI [Yersinia nurmii] Length: 127 WP_049599784.1 PL78_08940 (127) 82/87(127) 1–127 GspI general secretion pathway protein I [Aeromonas diversa CDC 2478–85] Length: 119 gbENY71267.1 32/61(108) 2–104 hypothetical protein [Yersinia nurmii] Length: 183 WP_049599781.1 81/90(182) 1–182 PL78_08945 (185) hypothetical protein [Yersinia ruckeri] Length: 192 WP_038241044.1 29/48(173) 6–171 type II secretion system protein GspG [Yersinia nurmii] Length: 150 WP_049599778.1 PL78_08950 (102) 93/96(150) 1–150 GspI type II secretion system protein GspG [Yersinia ruckeri] Length: 149 WP_038241042.1 76/85(143) 1–143 hypothetical protein [Yersinia nurmii] Length: 399 WP_049599774.1 93/97(399) 1–399 PL78_08955 (399) hypothetical protein [Yersinia ruckeri] Length: 395 WP_042525816.1 50/71(397) 1–393
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S59 of S87
type II secretion system protein GspE [Yersinia nurmii] Length: 502 WP_049599771.1 PL78_08960 (495) 96/98(495) 8–502 GspE type II secretion system protein E [Yersinia ruckeri ATCC 29473] Length: 491 gbKGA50644.1 71/85(491) 1–491 general secretion pathway protein GspD [Yersinia nurmii] Length: 680 WP_053215274.1 PL78_08965 (651) 94/96(645) 29–673 GspD type II secretion system protein GspD [Yersinia ruckeri] Length: 650 WP_038241119.1 68/83(633) 21–650 hypothetical protein [Yersinia nurmii] Length: 189 WP_049599768.1 PL78_08970 (187) 79/90(188) 1–188 GspC General secretion pathway protein C [Yersinia ruckeri ATCC 29473] Length: 188 gbEEP93904.1 32/50(186) hypothetical protein [Yersinia nurmii] Length: 139 WP_049599767.1 100/100(139) 1–139 PL78_08975 (139) hypothetical protein yruck0001_4150 [Yersinia ruckeri ATCC 29473] Length: 157 gbEEP99541.1 194/97(139) 19–157 PL78_08980 (94) No significant similarity PL78_08985
tRNA–Gly
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S60 of S87
Table S4. Yersinia entomophaga accessory virulence determinants: Repeats in Toxin cluster, CdtAB, VIP2, adenylate cyclase, chitinase and chitin binding protein associated regions and putative hemolysins. For graphic depiction refer to Figure 5 of the associated manuscript.
Yersinia entomophaga Repeats in Toxin associated cluster. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number to Target Sequence. Protein Domain transcriptional regulator [Yersinia nurmii] Length: 216 WP_049597066.1 99/100(216) 1–216 PL78_16895 (216) transcriptional regulator [Yersinia ruckeri] Length: 216 WP_042525316.1 99/100(216) 1–216 tRNA(5–methylaminomethyl–2–thiouridylate) methyltransferase [Yersinia nurmii] Length: 907 WP_049597067.1 96/98(907) 1–907 PL78_16900 (907) tRNA(5–methylaminomethyl–2–thiouridylate) methyltransferase [Yersinia ruckeri] Length: 907 WP_042525315.1 85/91(907) 1–907 MFS transporter [Yersinia nurmii] Length: 384 WP_049597068.1 PL78_16905 (384) 98/99(384)1–384 MFS transporter MFS transporter [Yersinia ruckeri] Length: 384 WP_042528242.1 90/95(384) 1–384 autotransporter adhesin [Yersinia nurmii] Length: 4660 WP_049597069.1 PL78_16910 (4660) 93/95(4661) 1–4659 RTX adhesin [Yersinia enterocolitica] Length: 4221 WP_050915363.1 58/72(4103) 179–4220 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S61 of S87
outer membrane channel protein [Yersinia nurmii] Length: 461 embCNE14355.1 98/99(461) 1–461 PL78_16915 (461) MULTISPECIES: type I secretion system outer membrane protein [Yersinia] Length: 461 WP_050142178.1 85/91(463) 1–461 putative toxin transport protein [Yersinia nurmii] Length: 713 embCNE14391.1 PL78_16920 (713) 97/98(713) 1–713 T1SS (CyaE) putative toxin transport protein [Yersinia massiliensis] Length: 760 embCNH58774.1 87/92(712) 51–760 secretion protein HlyD [Yersinia nurmii] Length: 389 WP_049597070.1 PL78_16925 (389) 99/99(389) 1–289 HlyD secretion protein HlyD [Yersinia frederikseniir] Length: 389 WP_050140418.1 88/95(389) 1–389 membrane protein [Yersinia nurmii] Length: 370 WP_049597071.1 97/98(370)1–370 PL78_16930 (370) membrane protein [Yersinia ruckeri] Length: 376 WP_038251489.1 90/94(376)1–376 GNAT family acetyltransferase [Yersinia nurmii] Length: 183 WP_049597072.1 97/98(183) 1–183 PL78_16945 (183) GNAT family acetyltransferase [Yersinia ruckeri] Length: 178 WP_042525312.1 81/88(178) 1–178
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S62 of S87
beta–lactam binding protein AmpH [Yersinia nurmii] Length: 376 embCNE14590.1 99/98(367)10–376 PL78_16950 (376) beta–lactam–binding protein [Yersinia ruckeri] Length: 381 WP_042525310.1 91/94(367)15–381 hypothetical protein yinte0001_11730 [Yersinia intermedia ATCC 29909] Length: 512 gbEEQ17977.1 87/91(485) 5–489 PL78_16955 (475) MULTISPECIES: MFS transporter [Yersinia] Length: 508 WP_032907368.1 87/91(485) 1–485 MBL fold hydrolase [Yersinia nurmii] Length: 330 WP_045844204.1 94/96(330) 1–330 PL78_16960 (330) MBL fold metallo–hydrolase [Yersinia ruckeri] Length: 330 WP_049597075.1 83/89(330) 1–330 hypothetical protein [Yersinia nurmii] Length: 325 WP_050475862.1 98/98(325) 1–325 PL78_16965 (325) hypothetical protein [Herbaspirillum rhizosphaerae] Length: 326 WP_049597076.1 71/82(324) 1–324
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S63 of S87
Yersinia entomophaga putative virulence cluster CdtAB. Closest BlastP orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over The Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain hypothetical protein [Yersinia nurmii] Length: 241 WP_049600373.1 96/97(241) 1–241 PL78_18410 hypothetical protein [Serratia fonticola] Length: 249 WP_059200486.1 46/63(241) 12–249 D–alanine––D–alanine ligase [Yersinia nurmii] Length: 371 WP_049600376.1 98/99(371) 1–367 PL78_18415 (371) D–alanine––D–alanine ligase [Yersinia ruckeri] Length: 368 WP_038276041.1 92/97(367) 1–367 yheo–like PAS domain [Yersinia nurmii] Length: 220 embCNE94733.1 95/97(220) 1–220 PL78_18420 (211) yheo–like PAS domain [Yersinia frederikseniir] Length: 230 embCNK81303.1 6/92(217) 12–228 serine dehydratase [Yersinia nurmii] Length: 323 WP_049600379.1 97/98(323) 1–323 PL78_18425 (323) serine dehydratase [Yersinia intermedia] Length: 322 WP_050077290.1 79/88(321) 1–321
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S64 of S87
alpha/beta hydrolase [Yersinia nurmii] Length: 293 WP_049600386.1 95/96(293) 1–293 PL78_18430 (293) alpha/beta hydrolase [Serratia marcescens] Length: 294 WP_033635162.1 63/77(294) 1–294 pfam00561; COG1075 acid–resistance protein [Yersinia nurmii] Length: 108 WP_049600389.1 95/98(108) 1–108 PL78_18435 (108) acid–resistance protein [Yersinia rohdei] Length: 110 WP_032816440.1 76/86(110) 1–110 hypothetical protein [Yersinia nurmii] Length: 190 WP_049600392.1 83/90(189) 1–189 PL78_18440 (190) hypothetical protein [Yersinia ruckeri] CdtA Length: 191 WP_052470825.1 59/74(182) 10–189 pfam03498: CDtoxinA cytolethal distending toxin subunit B [Yersinia ruckeri] Length: 298 embCNB14664.1 PL78_18445 (296) 64/78(294)1–294 CdtB hypothetical protein [Yersinia nurmii] Length: 296 WP_049600395.1 91/96(296) 1–296 hypothetical protein [Yersinia nurmii] Length: 466 WP_049600397.1 94/97(466) 1–466 PL78_18450 (466) hypothetical protein [Yersinia ruckeri] Length: 463 WP_049689405.1 73/85(466) 1–463 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S65 of S87
kinase [Yersinia nurmii] Length: 282 WP_049600400.1 99/99(282) 1–282 PL78_18455 (282) serine/threonine protein kinase [Yersinia ruckeri] Length: 282 WP_004721381.1 93/96(282) 1–282
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S66 of S87
Yersinia entomophaga putative VIP2 associated region. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation Accession Number to Target Sequence. Protein Domain transcriptional regulator [Yersinia nurmii] Length: 293 WP_049596942.1 96/96(293) 1–293 PL78_16130 (293) transcriptional regulator [Yersinia ruckeri] Length: 287 WP_042525447.1 86/92(287) 1–287 Na(+)–translocating NADH–quinone reductase subunit E [Yersinia nurmii] Length: 158 WP_049596943.1 99/99(158) 1–158 PL78_16135 (158) a+–translocating NADH–quinone reductase subunit E [Yersinia ruckeri] Length: 158 WP_004717931.1 91/93(158) 1–158 glucokinase [Yersinia nurmii] Length: 321 WP_049596944.1 96/97(321) 1–321 PL78_16140 (321) glucokinase [Yersinia ruckeri] Length: 321 WP_042525445.1 90/94(321) 1–321 hypothetical protein [Yersinia enterocolitica] Length: 400 WP_005175826.1 50–67(403) 1–400 PL78_16145 (402) NAD:arginine ADP–ribosyltransferase [Yersinia enterocolitica] VIPA Length: 402 embCRY18359.1 50/66(399) 9–402 (pfam01129) Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S67 of S87
membrane protein [Yersinia nurmii] Length: 414 WP_049596945.1 98/99(414) 1–414 PL78_16150 (414) membrane protein [Yersinia ruckeri] Length 415 WP_004717929.1 92/95(415) 1–415
Yersinia entomophaga putative virulence cluster adenylate cyclase associated region. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation to Accession number Target Sequence. Protein Domain serine/threonine dehydratase [Yersinia nurmii] Length: 330 WP_049599166.1 99/100(330) 1–330 PL78_08385 (330) serine/threonine dehydratase [Yersinia aldovae] ength: 330 WP_004699735.1 94/97(330) 1–330 PL78_08390 (61) Nil similarity toxin protein [Yersinia nurmii] Length: 402 embCNE75600.1 89/95(350)52–401 adenylate cyclase [Serratia sp. Leaf50] Length: 369 WP_055772549.1 56/76(356) 13–402 PL78_08395 (351) adenylate cyclase–1 [Candidatus Hamiltonella defensa] Length: 437 WP_015873608.1 55/74(345) 77–415 calmodulin–sensitive adenylate cyclase [Bacillus anthracis] Length: 800 WP_000197748.1 35/52(201) 306–503 pfam03497 Anthrax_toxA Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S68 of S87
peptidase M16 [Yersinia nurmii] Length: 931 WP_049599163.1 94/96(931)1–931 PL78_08400 (931) peptidase M16 [Yersinia enterocolitica] Length: 927 WP_050157122.1 77/87(931) 1–927
Yersinia entomophaga chitinase. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Accession % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Relation to Target Residues) Number Sequence. Protein Domain glutathione–disulfide reductase [Yersinia nurmii] Length: 450 WP_049597320.1 99/99(450) 1–450 PL78_11905 (450) glutathione–disulfide reductase [Yersinia intermedia] Length: 450 WP_050073664.1 97/98(450) 1–450 glycosyl hydrolase family protein [Yersinia nurmii] Length: 352 embCNE26027.1 98/98(352)1–352 PL78_11910 (351) chitinase [Paenibacillus dauci] Length: 414 WP_052714100.1 60/77(341) 13–351 cystathionine beta–lyase [Yersinia nurmii] Length: 396 WP_049597321.1 97/98(396) 1–396 PL78_11915 (396) cystathionine beta–lyase [Yersinia ruckeri] Length: 396 WP_038242896.1 96/98(396) 1–396
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S69 of S87
Yersinia entomophaga chitin binding fimbrial cluster, Chi–Fim. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range Of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain outer membrane lipoprotein Blc [Yersinia nurmii] Length: 176 embCNE76662.1 98/99(176) 1–176 PL78_08260 (176) membrane protein [Yersinia ruckeri] Length: 180 WP_042528366.1 89/96(174) 1–174 multidrug transporter [Yersinia nurmii] WP_049599231.1 99/100(104) 1–104 PL78_08265 (104) multidrug transporter [Yersinia ruckeri] WP_038241885.1 95/99(104) 1–104 fimbrial protein [Yersinia nurmii] Length: 174 WP_049599227.1 99/99(174) 1–174 PL78_08270 (174) fimbrial protein [Yersinia ruckeri] Length: 174 WP_042527048.1 89/95(174) 1–174 pilus assembly protein [Yersinia nurmii] Length: 805 WP_049599224.1 99/99(660) 128–787 PL78_08275 (660) pilus assembly protein [Yersinia ruckeri] Length: 803 WP_052470850.1 85/92(659) 126–784
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S70 of S87
fimbrial protein [Yersinia nurmii] Length: 244 Legth: 244 WP_049599223.1 97/97(244) 1–244 PL78_08280(244) fimbrial protein [Yersinia ruckeri] Length: 244 WP_042527047.1 81/89(244) 1–244 hypothetical protein [Yersinia nurmii] Length: 330 WP_049599220.1 PL78_08285 (330) 97/98(330) 1–330 pfam00419 fimbrial family protein [Yersinia ruckeri] Length: 330 gbAJI95306.1 88/93(330) 1–330 helix–turn–helix transcriptional regulator [Yersinia ruckeri] PL78_08290 (203) WP_038241888.1 97/98(202) 1–202 chitin–binding protein [Yersinia ruckeri] PL78_08295 (197) Length: 197 WP_052470849.1 89/93(196) 1–196 elongation factor P [Yersinia ruckeri] Length: 188 WP_004722438.1 100/100(160) 1–160 PL78_08300 (160) elongation factor P [Yersinia nurmii] Length: 188 WP_049599212.1 99/99(160) 1–160
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S71 of S87
Yersinia entomophaga putative chitin binding fimbrial cluster, Chi–SrfAB. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation To Target Sequence. Protein Domain Vat family streptogramin A O–acetyltransferase [Yersinia nurmii] Length: 216 WP_049598340.1 95/96(216) 1–216 PL78_05305 (216) streptogramin A acetyl transferase [Enterobacter sp. 638] Length: 216 gbABP59079.1 74/90(210) 1–216 chitin–binding protein [Yersinia nurmii] Length: 216 WP_049598342.1 93/95(216)–1–216 PL78_05310 (216) chitin–binding protein [Yersinia intermedia] Length: 216 WP_005183097.1 71/78(215)–1–215 virulence factor [Yersinia nurmii] Length: 444 embCNE60077.1 PL78_05315 (464) 91/92(451)1–444 SrfA virulence effector protein [Yersinia ruckeri] Length: 442 WP_004717438.1 65/71(471)1–442 virulence factor SrfB [Yersinia nurmii] Length: 994 WP_049598346.1 PL78_05320 (994) 98/98(994) 1–994 SrfB virulence factor SrfB [Yersinia ruckeri] Length 994 WP_038242595.1 87/93(994) 1–994
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S72 of S87
virulence factor [Yersinia nurmii] Length: 816 WP_049598348.1 94/96(433) 1–433 PL78_10835 (460) virulence factor [Yersinia ruckeri] virulence factor Length: 816 WP_038275949.1 72/83(433) 1–433 pfam10139: Virul_Fac putative bacterial virulence factor hypothetical protein [Yersinia nurmii] Length 189 WP_049598349.1 96/97(189) 1–189 serine hydrolase family protein [Yersinia ruckeri] PL78_05330 (189) Length: 186 gbAJI94666.1 78/87(185) 1–185 hypothetical protein [Xenorhabdus doucetiae] Length: 185 WP_045973197.1 87/73(186) 1–185 Uncharacterized distant relative of cell wall–associated hydrolases [Yersinia nurmii] Length: 196 embCNE60215.1 PL78_05335 (195) 98/98(195) 2–196 hypothetical protein MU9_2339 [Morganella morganii subsp. morganii KT] gbAGG31384.1 63/79(188) 9–196
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S73 of S87
Yersinia entomophaga putative hemolysin’s. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain hemolysin [Yersinia nurmii] Length: 1625 WP_049597670.1 96/97(1625)1–1625 hemolysin [Yersinia ruckeri] PL78_04365 (1624) Length: 1630 WP_045844326.1 57/93 (1630)1–1628 hemolysin [Serratia proteamaculans] Length: 1615 WP_012147176.1 57/71(1646) 1–1615 hemolysin [Yersinia nurmii] Length: 1645 WP_049598079.1 95/97(1645)1–1645 hemolysin [Yersinia ruckeri] PL78_11060 (1645) Length: 1630 WP_004719456.1 70/82(1637)1–1627 hemolysin [Serratia liquefaciens] Length: 1615 WP_046372512.1 53/69(1–1615) 1–1615 hemolysin III family protein [Yersinia nurmii] Length: 221 WP_049600002.1 98/100(221) 1–221 PL78_09050(221) hemolysin III [Yersinia intermedia] Length: 237 embCQJ63471.1 83/89(237) 1–237
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S74 of S87
Table S5. Yersinia entomophaga cell adhesins, fimbriae, Lipopolysaccharide and cellulose encoding clusters. For graphic depiction refer to Figure 7 of the associated manuscript.
Yersinia entomophaga fimbrial associated region. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain fumarate reductase [Yersinia nurmii] Length: 118 WP_049599234.1 PL78_08255 (118) 99/100(118) 1–118 fumarate reductase subunit D [Yersinia ruckeri] WP_004722457.1 97/100(118) 1–118 outer membrane lipoprotein Blc [Yersinia nurmii] Length: 176 embCNE76662.1 98/99(176) 1–176 PL78_08260 (176) membrane protein [Yersinia ruckeri] Length: 180 WP_042528366.1 89/96(174) 1–174 multidrug transporter [Yersinia nurmii] Length: 104 WP_049599231.1 99/100(104) 1–104 PL78_08265 (104) multidrug transporter [Yersinia ruckeri] Length: 104 WP_038241885.1 95/99(104) 1–104 fimbrial protein [Yersinia nurmii] Length: 174 WP_049599227.1 99/99(174) 1–174 PL78_08270 (174) fimbrial protein [Yersinia ruckeri] Length: 174 WP_042527048.1 90/95(174) 1–174 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S75 of S87
pilus assembly protein [Yersinia nurmii] Length: 805 WP_049599224.1 PL78_08275 (678) 98/99(678) 128–805 FimD/PapC pilus assembly protein [Yersinia ruckeri] Length: 803 WP_052470850.1 84/91(678) 126–803 fimbrial protein [Yersinia nurmii] Length: 244 WP_049599223.1 PL78_08280 (244) 97/97(244) 1–244 PapD fimbrial protein [Yersinia ruckeri] Length: 244 WP_042527047.1 81/89(244) 1–244 hypothetical protein [Yersinia nurmii] Length: 330 WP_049599220.1 97/98(330) 1–330 PL78_08285 (330) fimbrial family protein [Yersinia ruckeri] Length: 330 gbAJI95306.1 88/93(330) 1–330 helix–turn–helix transcriptional regulator [Yersinia nurmii] Length: 199 WP_049599217.1 77/86(202)1–198 PL78_08290 (203) helix–turn–helix transcriptional regulator [Yersinia ruckeri] Length: 203 WP_038241888.1 97/98(202) 1–202 chitin–binding protein [Yersinia ruckeri] PL78_08295 (197) Length: 197 WP_052470849.1 89/93(196) 1–196 elongation factor P [Yersinia nurmii] Length: 188 WP_049599212.1 99/100(188) 1–188 PL78_08300 (188) elongation factor P [Yersinia ruckeri] Length: 188 WP_004722438.1 99/99(188) 1–188 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S76 of S87
lysine 2,3–aminomutase [Yersinia nurmii] Length: 342 WP_049599209.1 99/99(342) 1–342 PL78_0805 (342) EF–P beta–lysylation protein EpmB [Yersinia ruckeri] Length: 342 WP_042527045.1 93/95(341) 1–341
Yersinia entomophaga fimbrial associated island FAIYE96. Closest BlastP Orthologue [Species] Length: Amino acid Length of Orthologue Locus (Amino Acid Residues) % identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain tRNA–Asn PL78_17260 aagcaaaaaacccgactaagtttccttaatcgggcttctctaatatggctcctctgactggactcgaaccagtgacatacggatt tRNA–Asn aacagtccgccgttctaccgactgaactacagaggaatcgtgtgaacggggcg Raffinose permease [Yersinia rohdei] Length: 430 WP_004716742.1 92/95(422) 9–430 PL78_17265 (425) galactoside permease [Serratia sp. Leaf51] Length: 428 WP_056775892.1 73/86(406) 7–412 alpha–galactosidase [Yersinia rohdei] Length: 707 WP_049616652.1 80/89(708) 1–707 PL78_17270 (708) alpha–galactosidase [Serratia fonticola] Length: 708 WP_024483295.1 75/85(708) 1–708
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S77 of S87
transcriptional regulator [Yersinia rohdei] Length: 336 WP_004716744.1 75/82(333) 1–333 transcriptional regulator [Sodalis praecaptivus] PL78_17275 (336) Length: 336 WP_025421693.1 Reg 64/75(331) 1–329 transcriptional regulator [Serratia fonticola] Length: 335 WP_024527340.1 63/76(326) 1–324 molecular chaperone [Yersinia nurmii] Length: 236 WP_049597187.1 PL78_17280 (236) 93/97(236) 1–236 Chap molecular chaperone [Yersinia frederikseniir] Length: 250 WP_050141295.1 62/74(239) 7–244 putative fimbrial usher protein StbD [Yersinia nurmii] Length: 440 embCNE17004.1 PL78_17285 (421) 98/98(421) 20–440 StbD hypothetical protein [Yersinia enterocolitica] Length: 444 WP_019082823.1 81/90(416) 29–444 fimbrial protein [Yersinia nurmii] Length: 858 WP_049597131.1 PL78_17290 (856) 96/98(858) 1–858 Fim fimbrial protein [Yersinia enterocolitica] Length: 874 WP_050160997.1 65/77(876) 1–874 pilus assembly protein [Yersinia nurmii] Length: 244 WP_049597132.1 PL78_17295 (244) 96/96(244) 1–244 PapD pilus assembly protein [Yersinia mollaretii] Length: 243 WP_049648727.1 73/82(244) 1–243 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S78 of S87
fimbrial protein [Yersinia nurmii] Length: 176 WP_049597133.1 PL78_17300 (176) 98/98(176) 1–176 Fim fimbrial protein [Yersinia pekkanenii] Length: 176 WP_049613690.1 76/88(176) 1–176 histidine kinase [Yersinia nurmii] Length: 1207 WP_049613690.1 95/97(1207) 1–1207 PL78_17305 (1207) putative virulence sensor protein [Yersinia intermedia] Length: 1288 embCRY76056.1 68/81(1234) 22–1273 putative two–component response regulator [Yersinia nurmii] Length: 209 embCNE17197.1 PL78_17310 (209) 98/99(209) 1–209 LuxR DNA–binding response regulator [Yersinia intermedia] Length: 210 WP_050075308.1 93/96(208) 3–210 hypothetical protein [Yersinia nurmii] PL78_17315 (59) Length: 59 WP_049597134.1 91/93(58) 1–58 tRNA–Asn PL78_17320 aagcaaaaaacccgactaagtttccttaatcgggcttctctaatatggctcctctgactggactcgaaccagtgacatacggatt tRNA–Asn aacagtccgccgttctaccgactgaactacagaggaatcgtgtgaacggggcg
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S79 of S87
Yersinia entomophaga lipopolysaccharide cluster. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain CDP–6–deoxy–delta–3,4–glucoseen reductase [Yersinia nurmii] Length: 327 WP_049598615.1 PL78_00680 (327) 97/99(327) 1–327 DdhD CDP–6–deoxy–delta–3,4–glucoseen reductase [Yersinia similis] Length: 329 WP_054878293.1 83/94(329) 1–329 cytidylyltransferase [Yersinia nurmii] Length: 257 WP_049598616.1 PL78_00685 (257) 100/100(257) 1–257 DdhA glucose–1–phosphate cytidylyltransferase [Yersinia ruckeri] Length: 257 WP_038275604.1 99/99(257) 1–257 C CDP–glucose 4%2C6–dehydratase [Yersinia nurmii] Length: 357N embCNE67016.1 PL78_00690 (299) 99/99(357) 1–357 DdhB CDP–glucose 4,6–dehydratase [Yersinia pseudotuberculosis IP 31758] Length: 391 gbABS48236.1 90/94(357)35–391 lipopolysaccharide biosynthesis protein RfbH [Yersinia nurmii] Length: 437 WP_049598618.1 PL78_00695 (437) 99/100(437) 1–437 DdhC CDP–4–keto–6–deoxy–D–glucose–3–dehydrase [Yersinia pseudotuberculosis] Length: 437 gbADI59424.1 97/98(437) 1–437 paratose synthase [Yersinia enterocolitica] PL78_00700 (283) Length: 285 WP_057647476.1 Prt 70/84(283) 1–283 Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S80 of S87
CDP–paratose 2–epimerase [Yersinia mollaretii] PL78_00705 (338) Length: 338 ref_049608459.1 84/92(338)1–338 CDP–paratose 2–epimerase [Yersinia mollaretii] PL78_00710 (438) Length: 338 WP_049608459.1 Wzx 84/92(338) 1–338 hypothetical protein [Yersinia nurmii] Length: 336 WP_049598623.1 PL78_00715 (333) 77/90(333) 4–336 WbcC putative glycosyltransferase [Yersinia pseudotuberculosis] Length: 339 embCNK90709.1 59/75(331) 4–334 PL78_00720 (417) histidine kinase [Yersinia pseudotuberculosis] Wzy Length: 406 WP_050103368.1 O antigen 51/70(404) 1–404 mannosyltransferase [Yersinia nurmii] Length: 337 WP_049598627.1 PL78_00725 (337) Range 1: 1 to 337 WbyK 0/337(0%) RfaB mannosyltransferase [Yersinia pseudotuberculosis] Length: 337 WP_012304490.1 78/88(337)1–337 GDP–mannose 4,6–dehydratase [Yersinia nurmii] Length: 373 WP_049598628.1 PL78_00730 (373) 100/100(373) 1–373 Gmd GDP–mannose 4,6–dehydratase [Yersinia pseudotuberculosis] Length: 373 P_011191888.1 96/98(373) 1–373
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S81 of S87
GDP–L–fucose synthetase [Yersinia nurmii] Length: 323 embCNE67246.1 PL78_00735 (321) 98/99(321) 3–323 Fcl GDP–fucose synthetase [Yersinia similis] Length: 321 WP_054878416.1 90/94(321) 1–321 GDP–mannose mannosyl hydrolase [Yersinia nurmii] Length: 154 WP_049598631.1 PL78_00740 (154) 97/97(154) 1–154 Gmm GDP–mannose mannosyl hydrolase [Photorhabdus temperata] Length: 154 WP_023043826.1 65/81(154) 1–154 mannose–1–phosphate guanyltransferase [Yersinia nurmii] Length: 468 WP_049598633.1 PL78_00745 (468) 99/98(468) 1–468 ManC mannose–1–phosphate guanyltransferase [Yersinia enterocolitica] Length: 468 WP_050142517.1 87/94(468)1–468 glycosyl transferase [Yersinia nurmii] Length: 247 WP_049598721.1 PL78_00750 (247) 98/98(247) 1–247 WbyL glycosyl transferase [Yersinia mollaretii] Length: 247 WP_004873391.1 76/88(247) 1–247 phosphomannomutase [Yersinia nurmii] Length: 456 WP_049598635.1 PL78_00755 (256) 99/99(455)1–456 ManB phosphomannomutase [Yersinia pseudotuberculosis] Length: 457 WP_050093032.1 85/91(455) 1–455
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S82 of S87
chain–length determining protein [Yersinia nurmii] Length: 384 WP_049598637.1 PL78_00760 (384) 96/98(384)1–384 Wzz chain–length determining protein [Yersinia ruckeri] Length: 384 WP_038275531.1 76/90(382)1–382 inosine/guanosine kinase [Yersinia nurmii] Length: 436 WP_049598639.1 99/99(436)1–436 PL78_00765 (436) inosine/guanosine kinase [Yersinia ruckeri] ength: 436 WP_038243753.1 96/98(436)1–436 cation:proton antiport protein [Yersinia nurmii] Length: 563 WP_049598641.1 99/100(563)1–563 PL78_00770 (563) cation:proton antiport protein [Yersinia intermedia] Length: 563 WP_042569300.1 94/97 (563) 1 to 563 fosmidomycin resistance protein [Yersinia nurmii] Sequence ID: Length: 404 WP_049598644.1 98/98(404)1–404 PL78_00775 (404) fosmidomycin resistance protein [Yersinia enterocolitica] Length: 410 WP_050155900.1 86/91(410)1–410 bifunctional UDP–sugar hydrolase/5'–nucleotidase [Yersinia nurmii] Length: 550 WP_049598646.1 PL78_00780 (550) 99/99(550)1–550 UshA bifunctional UDP–sugar hydrolase/5'–nucleotidase [Yersinia ruckeri] Length: 550 WP_038275532.1 97/98(550) 1–550
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S83 of S87
Table S6. Yersinia entomophaga countermeasures: ColicinV, Sod, and non–ribosomal peptide synthetase.
Yersinia entomophaga Colicin V. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain cell division protein DedD [Yersinia nurmii] Length: 246 WP_049597003.1 PL78_16520 (246) 95/96(245)1–246 Colicin V cell division protein DedD [Yersinia ruckeri] Length: 241 WP_038244265.1 80/86(247)1–241 colicin V production protein [Yersinia nurmii] Length: 169 WP_049597004.1 99/100(169)1–169 PL78_16525 (169) colicin V production protein [Yersinia frederikseniir] Length: 169 WP_050106079.1 98/99(169)1–169 amidophosphoribosyltransferase [Yersinia nurmii] Length: 505 WP_049597005.1 99/99(505)1–505 PL78_16530 (486) amidophosphoribosyltransferase [Yersinia ruckeri] Length: 505 WP_004717879.1 98/99(505)1–505
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S84 of S87
Yersinia entomophaga superoxide dismutase. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain superoxide dismutase [Yersinia nurmii] Length: 192 WP_049600140.1 PL78_05910 (192) 99/100(192)1–192 SodB superoxide dismutase [Yersinia ruckeri] Length: 192 WP_004717636.1 91/96(192) 1–192 superoxide dismutase [Yersinia nurmii] Length: 208 WP_049597374.1 PL78_12235 (208) 99/100(208)1–208 SodA Superoxide dismutase [Mn] [Yersinia ruckeri ATCC 29473] Length: 210 gb|EEQ00149.1 96/98(208)3–210 superoxide dismutase [Yersinia nurmii] Length: 174 WP_049601253.1 PL78_14360 (174) 95/95(174) 1–174 Sod superoxide dismutase [Yersinia enterocolitica] Length: 174 WP_046051564.1 81/89(174)1–174
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S85 of S87
Yersinia entomophaga non–ribosomal peptide synthetase. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain hydroxymethylpyrimidine/phosphomethylpyrimidine kinase [Yersinia nurmii] Length: 266 WP_049597164.1 97/98(266) 1–266 PL78_15600 (350) hydroxymethylpyrimidine/phosphomethylpyrimidine kinase [Yersinia ruckeri] Length: 266 WP_038241377.1 88/93(288) 1–266 hypothetical protein [Yersinia nurmii] Length: 288 WP_049596853.1 95/96(288) 1–288 PL78_15605 (288) hypothetical protein [Yersinia ruckeri] Length: 288 WP_004717978.1 80/88(288) 1–288 hypothetical protein [Yersinia nurmii] Length: 152 WP_049596854.1 PL78_15610 (152) 95/96(152) 1–152 Ivy Inhibitor of vertebrate lysozyme [Yersinia ruckeri ATCC 29473] gb|EEQ00208.1 Length: 153 84/92(152) 1–153 non–ribosomal peptide synthetase [Yersinia nurmii] Length: 3941 WP_049596855.1 PL78_15615 (3939) 94/96(3944) 1–3941 non–ribosomal peptide hypothetical protein [Serratia marcescens] synthetase Length: 4849 WP_060448349.1 40/57(3581) 2–3497
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S86 of S87
transposon DNA–invertase [Yersinia nurmii] Length: 189 WP_049596856.1 99/99(189) 1–189 DNA invertase [Methylophaga aminisulfidivorans] PL78_15620 (189) Length: 191 WP_007143928.1 74/87(187)1–187 DNA invertase [Methylophaga aminisulfidivorans] Length: 191 WP_007143928.1 74/87(187)1–187
Yersinia entomophaga non–ribosomal peptide synthetase. Closest BlastP Orthologue [Species] Length: Amino Acid Length of Orthologue Locus (Amino Acid Residues) % Identity/% Similarity (over the Indicated Range of Amino Acid Residues) in Accession Number Relation to Target Sequence. Protein Domain HutD family protein [Yersinia nurmii] Length: 191 WP_049597639.1 88/93(191)1–191 PL78_04160 (191) HutD family protein [Yersinia ruckeri] Length: 190 WP_042524807.1 72/82(187) 1–186 non–ribosomal peptide synthetase [Yersinia nurmii] Length: 1844 WP_049597640.1 PL78_04165 (1844) 92/95(1844)1–1844 non–ribosomal peptide pyochelin synthetase [Brevibacillus laterosporus] synthetase Length: 1838 WP_031412270.1 47/65(1838)8–1837
Toxins 2016, 8, 143; doi:10.3390/toxins8050143 S87 of S87
MULTISPECIES: transposase [Enterobacteriaceae] Length: 92 WP_012442396.1 97/98(92)1–92 PL78_04170 (78) transposase [Yersinia ruckeri] Length: 92 WP_038245923.1 95/96(92)1–92 transposase [Yersinia pekkanenii] Length: 283 WP_049615490.1 99/99(283) 1–283 PL78_04175 (283) integrase [Erwinia tasmaniensis] Length: 283 WP_012442397.1 99/99(283) 1–283