US 20150284724A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0284724 A1 COLLARD et al. (43) Pub. Date: Oct. 8, 2015

(54) TREATMENT OF (SIRT) RELATED (60) Provisional application No. 61/330,427, filed on May DISEASES BY INHIBITION OF NATURAL 3, 2010, provisional application No. 61/415,891, filed ANTISENSE TRANSCRIPT TO A SIRTUN on Nov. 22, 2010, provisional application No. 61/412, (SIRT) 066, filed on Nov. 10, 2010, provisional application No. 61/409,136, filed on Nov. 2, 2010. (71) Applicant: CuRNA, Inc., Miami, FL (US) Publication Classification (72) Inventors: Joseph COLLARD, Delray Beach, FL (US): Olga Khorkova Sherman, (51) Int. Cl. Tequesta, FL (US); Carlos Coito, West CI2N IS/II3 (2006.01) Palm Beach, FL (US); Belinda De Leon, (52) U.S. Cl. San Francisco, CA (US) CPC ...... CI2N 15/1137 (2013.01); C12N 2310/11 (2013.01) (21) Appl. No.: 14/741,164 (57) ABSTRACT (22) Filed: Jun. 16, 2015 The present invention relates to antisense oligonucleotide that modulate the expression of and/or function of a Sirtuin Related U.S. ApplicationO O Data RidSIRT), in particular,p a Sirtuin by Rs. targeting E. inventionnatural antisense also ria poly o (62) Division of application No. 13/695,801, filed on Nov. the identification of these antisense oligonucleotides and their 2, 2012, now Pat. No. 9,089,588, filed as application use in treating diseases and disorders associated with the No. PCT/US2011/021052 on Jan. 13, 2011. expression of (SIRT)s. Patent Application Publication Oct. 8, 2015 Sheet 1 of 14 US 2015/0284724 A1

F}, i

Foid tiererica in SiRi expression after treatnerit with siris to Sas

c.

: 3 3 38 s s 3. S. a S 6 8 S s s: 3 $ 3. 3. S 3 in

FC

Fesix difference in sistas expressics after treatment with risis. As it sittas

sirt:S stasis stas 7 Patent Application Publication Oct. 8, 2015 Sheet 2 of 14 US 2015/0284724 A1

FORE

fascichsage is SRii in NA copyriter cigared to inactive gastroi S.S. iss.

a r, E. & c 8. w .

S S. S. : : S S. S. & S

FRS,

fed cišerences in SERS3 expy stribef extirpassex to costs at s38. -,

CF33S.S. R& sit: 8x2-i-Sika £f &S sit 2-2 six 28& 2-g- a 3-Rsraethy: : NAS is:ytrix

8.85 {R-073: Ri888 R&G R-86s. R.3863 Patent Application Publication Oct. 8, 2015 Sheet 3 of 14 US 2015/0284724 A1

FORES

*aid difference in SRT1 copy narrater copared its to stre:

P:3,

FSS: E S3R S-3 RS &E RHS sirt 232 SA;

FORS is

Fair silifferees it SRS rRNA agy is nies Enjaared to antic 3.

s

..S.

.

3.8.

8.

33-33 Patent Application Publication Oct. 8, 2015 Sheet 4 of 14 US 2015/0284724 A1

F.R.

$oid difference in SRf 38A togy auxixe afief treatsyer twis &liga assist SSSR as cared to contra:

FSS SiR'S

FORS 8

six difference is fia &ay reber ergaret Ra cates:

SPS, SER: Patent Application Publication Oct. 8, 2015 Sheet 5 of 14 US 2015/0284724 A1

F; ;

*oid difference it trii copy is earnga red to contro st: R&:8: S$8

,

i

ERE

* if:eese is is NA gy & E::paredits kit

S8.

S. g s& r K w es s s s: & Patent Application Publication Oct. 8, 2015 Sheet 6 of 14 US 2015/0284724 A1

GRE

Foix difference in RNA copy it corp3.res to centra E.8 :S ; P: . P: SES . i.

& .2 s

w

3,3 3:3S & 8 88.

s s as r r wr e ck : : .

RE

Feist difference it rRNA copy nutrier &cipated to controi Sii

Pa,3 s s:

e8 r ss s r r r s r 8. s e s Patent Application Publication Oct. 8, 2015 Sheet 7 of 14 US 2015/0284724 A1

GRE 3

Foid difference in rRNA copy is cargaret to cartrai

C?8-949 CR-3 (3R,3398 (C38.895

GRE :

Saša diffence in 388 copy is catgage to carts a . .

r. S3S 3:

& s :s s 3.: E. s s E. S. s & R n Patent Application Publication Oct. 8, 2015 Sheet 8 of 14 US 2015/0284724 A1

G RES

Faiti charge in rary Accrgy if consisteritis entre:

SSR

i FERE 6

raid charge cars pared to tetroi

Patent Application Publication Oct. 8, 2015 Sheet 9 of 14 US 2015/0284724 A1

FEG RE

Fox: diffee-tie in 188s cog furtier co: 3:3 to cotti:

FRE 8

sis iss'ssE. E 1-, &SSS3

S’s & Patent Application Publication Oct. 8, 2015 Sheet 10 of 14 US 2015/0284724 A1

RE

is: 888&ss is sis

GRE 20

Sets: riffssc; ii. 888 is is arris's to ris: $8.

... .333

S$33.

SERS Patent Application Publication Oct. 8, 2015 Sheet 11 of 14 US 2015/0284724 A1

EE

SS:

RE 13

Se:cess eS-8.2.xy S is

is 3,83S

w S.

FORE 23

Fate sixsness is 88.5 tasy & sateix.88 to exers: R 8', six& SSS

$538.

3.SSS: Patent Application Publication Oct. 8, 2015 Sheet 12 of 14 US 2015/0284724 A1

GRE

Ficifere's: its RNA tepsy is taxas a circa

. S. 8 0.4

-88s -88 B-ESS RSS RS-8S R-SS

RES

exici differe see in 8NA copy icoparsi to crite: & SS

3.

S.S. S

E838. 3. SS. 35. Patent Application Publication Oct. 8, 2015 Sheet 13 of 14 US 2015/0284724 A1

GRE 6

Foid iii.feretes in nin.A copy # exparse to tertrai

iS$82,

RE

said tieressee irs RN& copy crispated to entras

3:SSS

S.

$$$$$. Šs SSS Patent Application Publication Oct. 8, 2015 Sheet 14 of 14 US 2015/0284724 A1

GRES

fixis sifs:’sses is issSNF, issy is : Yiyskies 3& Six: x}

FORE 2

Scies &ifiesses r &&.8, copy: star: ix cists sis

w

83.33. E.E., US 2015/0284724 A1 Oct. 8, 2015

TREATMENT OF SIRTUIN (SIRT) RELATED 0006. In another embodiment, an oligonucleotide targets a DISEASES BY INHIBITION OF NATURAL natural antisense sequence of a Sirtuin (SIRT) polynucle ANTISENSE TRANSCRIPT TO A SIRTUN otide, for example, nucleotides set forth in SEQID NO: 9 to (SIRT) 23, 141 to 143, and any variants, alleles, homology, mutants, derivatives, fragments and complementary sequences FIELD OF THE INVENTION thereto. Examples of antisense oligonucleotides useful in practicing the methods of the present invention are set forth as 0001. The present application claims the priority of U.S. SEQID NOS: 24 to 127. provisional patent application No. 61/330,427 filed May 3, 0007 Another embodiment provides a method of modu 2010, U.S. provisional patent application No. 61/409,136 lating function and/or expression of a Sirtuin (SIRT) poly filed Nov 2, 2010, U.S. provisional patent application No. nucleotide in patient cells or tissues in Vivo or in vitro com 61/412,066 filed Nov. 10, 2010 and U.S. provisional patent prising contacting said cells or tissues with an antisense application No. 61/415,891 filed Nov. 22, 2010. oligonucleotide 5 to 30 nucleotides in length wherein said 0002 Embodiments of the invention comprise oligonucle oligonucleotide has at least 50% sequence identity to a otides modulating expression and/or function of a Sirtuin reverse complement of an antisense of the Sirtuin (SIRT) (SIRT) and associated molecules. polynucleotide; thereby modulating function and/or expres sion of the Sirtuin (SIRT) polynucleotide in patient cells or BACKGROUND tissues is vivo or in vitro. 0008 Another embodiment provides a method of modu 0003 DNA-RNA and RNA-RNA hybridization are lating function and/or expression of a Sirtuin (SIRT) poly important to many aspects of nucleic acid function including nucleotide in patient cells or tissues in Vivo or in vitro com DNA replication, transcription, and translation. Hybridiza prising contacting said cells or tissues with an antisense tion is also central to a variety of technologies that either oligonucleotide 5 to 30 nucleotides in length wherein said detect a particular nucleic acid or alter its expression. Anti oligonucleotide has at least 50% sequence identity to an anti sense nucleotides, for example, disrupt by sense oligonucleotide to a Sirtuin (SIRT) antisense poly hybridizing to target RNA, thereby interfering with RNA nucleotide; thereby modulating function and/or expression of splicing, transcription, translation, and replication. Antisense the Sirtuin (SIRT) polynucleotide in patient cells or tissues in DNA has the added feature that DNA-RNA hybrids serve as vivo or in vitro. a substrate for digestion by ribonuclease H, an activity that is 0009. In one embodiment, a composition comprises one or present in most cell types. Antisense molecules can be deliv more antisense oligonucleotides which bind to sense and/or ered into cells, as is the case for oligodeoxynucleotides antisense Sirtuin (SIRT) polynucleotides. (ODNs), or they can be expressed from endogenous genes as 0010. In another embodiment, the oligonucleotides com RNA molecules. The FDA recently approved an antisense prise one or more modified or substituted nucleotides. drug, VITRAVENETM (for treatment of cytomegalovirus 0011. In another embodiment, the oligonucleotides com retinitis), reflecting that antisense has therapeutic utility. prise one or more modified bonds. 0012. In yet another embodiment, the modified nucle SUMMARY otides comprise modified bases comprising phosphorothio 0004. In one embodiment, the invention provides methods ate, methylphosphonate, peptide nucleic acids, 2'-O-methyl, for inhibiting the action of a natural antisense transcript by flouro- or carbon, methylene or other locked nucleic acid using antisense oligonucleotide(s) targeted to any region of (LNA) molecules. Preferably, the modified nucleotides are the natural antisense transcript resulting in up-regulation of locked nucleic acid molecules, including C-L-LNA. 0013. In another embodiment, the oligonucleotides are the corresponding sense gene. It is also contemplated herein administered to a patient Subcutaneously, intramuscularly, that inhibition of the natural antisense transcript can be intravenously or intraperitoneally. achieved by siRNA, ribozymes and small molecules, which 0014. In another embodiment, the oligonucleotides are are considered to be within the scope of the present invention. administered in a pharmaceutical composition. A treatment 0005 One embodiment provides a method of modulating regimen comprises administering the antisense compounds at function and/or expression of a Sirtuin (SIRT) polynucleotide in patient cells or tissues in vivo or in vitro comprising con least once to patient; however, this treatment can be modified tacting said cells or tissues with an antisense oligonucleotide to include multiple doses over a period of time. The treatment 5 to 30 nucleotides in length wherein said oligonucleotide has can be combined with one or more other types of therapies. at least 50% sequence identity to a reverse complement of a 0015. In another embodiment, the oligonucleotides are polynucleotide comprising 5 to 30 consecutive nucleotides encapsulated in a liposome or attached to a carrier molecule within nucleotides 1 to 1028 of SEQID NO:9 or nucleotides (e.g. , TAT peptide). 1 to 429 of SEQID NO: 10, or nucleotides 1 to 508 of SEQID 0016 Other aspects are described infra. NO: 11 or nucleotides 1 to 593 of SEQID NO: 12, 1 to 373 of BRIEF DESCRIPTION OF THE DRAWINGS SEQID NO: 13, 1 to 1713 of SEQID NO: 14, 1 to 660 of SEQ ID NO: 15, 1 to 589 of SEQID NO: 16, 1 to 726 of SEQID (0017 FIGS. 1 and 2 show Real time PCR results of experi NO: 17, 1 to 320 of SEQID NO: 18, 1 to 616 of SEQID NO: ments in which HepG2 cells were treated with oligonucle 19, 1 to 492 of SEQID NO: 20, 1 to 428 of SEQID NO: 21, otides designed to target SIRT antisense CV396200. The 1 to 4041 of SEQID NO: 22 or 1 to 705 of SEQID NO: 23 or results show that the levels of the SIRT1 mRNA in HepG2 1 to 2714 of SEQID NO: 141 or 1 to 1757 of SEQID NO: 142 cells were significantly increased 48 h after treatment with or 1 to 3647 of SEQID NO: 143, thereby modulating function one of the siRNAs designed to sirtas (sirtas 5, P=0.01). In and/or expression of the Sirtuin (SIRT) polynucleotide in the same samples the levels of sirtas RNA were significantly patient cells or tissues in vivo or in vitro. decreased after treatment with sirtas 5, but unchanged after US 2015/0284724 A1 Oct. 8, 2015

treatment with Sirtas 6 and sirtas 7, which also had no mRNA are significantly increased at HepG2 cells 48 h after effect on the SIRT1 mRNA levels (FIG. 2).sirtas 5, sirtas 6 treatment with two of the oligos designed to SIRT1 antisense and sirtas 7 correspond to SEQ ID NOs: 47, 48 and 49 AW169958. Bars denoted as CUR-1381, CUR-1382, CUR respectively. 1383 and CUR-1384 correspond to samples treated with SEQ 0018 FIG. 3 shows results for the oligonucleotide walk ID NOS: 66 to 69 respectively. across the SIRT antisense. Real time PCR results show that (0027 FIG. 13 is a graph of real time PCR results showing the levels of the SIRT1 mRNA in HepG2 cells are signifi the fold change+standard deviation, in SIRT1 mRNA after cantly increased 48 h after treatment with three of the anti treatment of 3T3 cells with phosphorothioate oligonucle sense oligonucleotides desired to sirtas (CUR-0292, CUR otides introduced using Lipofectamine 2000, as compared to 0307 and CUR-0308). CUR-0292 to CUR-0309 correspond control. Real time PCR results show that the levels of SIRT1 to SEQID NOs: 24 to 41 respectively. mRNA are significantly increased in 3T3 cells 48 h after 0019 FIGS. 4 and 5 show results for PS, LNA and 2'O Me treatment with three of the oligonucleotides designed to Modified oligonucleotides in HepG2 (FIG. 4) and Vero76 SIRT1 mouse antisense AK044604. Bars denoted as CUR (FIG. 5) cells. Real time PCR results show that the levels of 0949, CUR-0842, CUR-1098 and CUR-1099 correspond to the SIRT1 mRNA in HepG2 cells are significantly increased samples treated with SEQID NOS: 76, 70, 80 and 81 respec 48 h after treatment with PS, LNA, 2'O Me and 2'O Me tively. mixmer designed antisense oligonucleotides to SIRT1 anti 0028 FIG. 14 is a graph of real time PCR results showing sense. Levels of SIRT1 mRNA in Vero cells also increased 48 the fold change+standard deviation its SIRT1 mRNA after hours after treatment with PS and LNA modified antisense treatment: of 3T3 cells with phosphorothioate oligonucle oligonucleotides to SIRT1 antisense. Bars denoted as CUR otides introduced using Lipofectamine 2000, as compared to 0245, CUR-0736, CUR 0688, CUR-0740 and CUR-0664 control. Real time PCR results show that the levels of SIRT1 correspond to SEQID NOs: 42 to 46 respectively. mRNA are significantly increased in 3T3 cells 48 h after 0020 FIG. 6 shows PCR results of Monkey Biopsies. treatment with five of the oligonucleotides designed to SIRT1 Real time PCR results show an increase in SIRT1 mRNA mouse antisense AK044604. Bars denoted as CUR-0948 to levels in fat biopsies from monkeys dosed with CUR-963, an CUR-0951, CUR-0846, and CUR-0844 correspond to oligonucleotide designed to SIRT1 antisense CV396200.1. samples treated with SEQ ID NOS: 75 to 78, 74 and 72 CUR-963 corresponds to SEQID NO: 43. respectively. 0021 FIG. 7 shows PCR results of primary monkey liver (0029 FIG. 15 is a graph of real time PCR results showing hepatocytes. Real time PCR results show an increase in the fold change+standard deviation in SIRT1 mRNA after SIRT1 mRNA levels after treatment with an oligonucleotide treatment of 3T3 cells with phosphorothioate oligonucle against SIRT1 antisense. Bar denoted as CUR-0245 corre otides introduced using Lipofectamine 2000, as compared to sponds to SEQID NO: 42. control. Real time PCR results show that the levels of SIRT1 0022 FIG. 8 shows results for oligonucleotides designed mRNA are significantly increased in HepG2 cells 48 h after to SIRT antisense CV396.200. Real Time PCR results show treatment with two of the oligonucleotides designed to SIRT1 that levels of SIRT1 mRNA in HepG2 cells are significantly mouse antisense AK044604. Bars denoted as CUR-0842, increased following treatment with one of the oligonucle CUR-0844, and CUR-0845 correspond to samples treated otides designed to SIRT1 antisense CV396200. The bars with SEQID NOS: 70, 72 and 73 respectively. denoted as CUR-1230 to CUR-1233 correspond to SEQ ID 0030 FIG. 16 is a graph of real time PCR results showing NOS: 50 to 53. the fold change--standard deviation in SIRT1 mRNA after 0023 FIG. 9 shows results for oligonucleotides designed treatment of 3T3 cells with phosphorothioate oligonucle to SIRT antisense CV428275. Real Time PCR results show otides introduced using Lipofectamine 2000, as compared to that levels of SIRT1 mRNA in HepG2 cells are significantly control. Real time PCR results show that the levels of SIRT1 increased following treatment with two of the oligonucle mRNA are significantly increased in HepG2 cells 48 h after otides designed to SIRT1 antisense CV428275. The bars treatment with two of the oligonucleotides designed to SIRT1 denoted as CUR-1302, CUR-1304, CUR-1303 and CUR mouse antisense AK044604. Bars denoted as CUR-0843 and 1305 correspond to SEQID NOs: 54 to 57. CUR-0846 correspond to samples treated with SEQID NOS: 0024 FIG. 10 shows Real time PCR results. The results 71 and 74 respectively. show that a significant increase in SIRT1 mRNA levels in 0031 FIG. 17 is a graph of real time PCR results showing HepG2 cells 48 hours after treatment with one of the oligo the fold change--standard deviation in Sirtuin3 mRNA after nucleotides designed to SIRT antisense BE717453. The bars treatment of HepG2 cells with phosphorothioate oligonucle denoted as CUR-1264 to CUR-1266 correspond to SEQ ID otides introduced using Lipofectamine 2000, as compared to NOs: 58 to 60 respectively. control. RT PCR results show that sirt3 levels in HepG2 cells 0025 FIG. 11 shows Real time PCR results. The results are increased 48 hours after treatment with phosphorothioate show that show that the levels of the SIRT1 mRNA in HepG2 antisense oligonucleotides designed to sirt3 antisense cells are significantly increased 48 h after treatment with Hs.683117. Bars denoted as CUR-0551, CUR-1552, CUR three of the oligonucleotides designed to SIRT1 antisense 1555, CUR-1556, CUR-1553, CUR-1554, CUR-1545, CUR AV718812. The bars denoted as CUR-1294, CUR-1297, 1546, CUR-1548, CUR-1549, CUR-1550 and CUR-1547, CUR-1295, CUR-1296 and CUR-1298 correspond to SEQ correspond to samples treated with SEQ ID NOS: 82 to 93 ID NOs: 61 to 65 respectively. respectively. 0026 FIG. 12 is a graph of real time PCR results showing 0032 FIG. 18 is a graph of real time PCR results showing the fold change+standard deviation in SIRT1 mRNA after the fold change--standard deviation in Sirtuin3 mRNA after treatment of HepG2 cells with phosphorothioate oligonucle treatment of HepG2 cells with phosphorothioate oligonucle otides introduced using Lipofectamine 2000, as compared to otides introduced using Lipofectamine 2000, as compared to control. Real time PCR results show that the levels of SIRT1 control. RT PCR results show that sirt3 levels in HepG2 cells US 2015/0284724 A1 Oct. 8, 2015

are increased 48 hours after treatment with phosphorothioate 0040 FIG. 26 is a graph of real time PCR results showing antisense oligonucleotides designed to sirt3 antisense the fold change--standard deviation in SIRT6 mRNA after BQ024738 and BE164357. Bars denoted as CUR-1869, treatment of DBS-FCL-1 cells with phosphorothioate oligo CUR-1871 and CUR-1873 to CUR-1878 correspond to nucleotides introduced using Lipofectamine 2000, as com samples treated with SEQID NOS: 94,95, 96 and 98.99, 100, pared to control. Real time PCR results show that the levels of 101 and 102 respectively. SIRT6 mRNA in DBS-FCL-1 cells are significantly 0033 FIG. 19 is a graph of real time PCR results showing increased 48 h after treatment with two of the oligos designed the fold change+standard deviation in SIRT3 mRNA after to SIRT6 antisense bf772662 and one oligo designed to the treatment of Hek293 cells with phosphorothioate and siRNA sequence at accession number NM 133475. Bars denoted as oligonucleotides introduced using Lipofectamine 2000, as CUR-0876, CUR-0878, CUR-0875 and CUR-0874, corre compared to control. Bars denoted as CUR-1883 and CUR spond to samples treated with SEQ ID NOS: 119, 121, 118 1884 correspond to samples treated with SEQID NOS: 126 and 117 respectively. and 127 respectively. 0041 FIG. 27 is a graph of real time PCR results showing 0034 FIG. 20 is a graph of real time PCR results showing the fold change--standard deviation in SIRT7 mRNA after the fold change+standard deviation in SIRT3 mRNA after treatment of Vero76 cells with phosphorothioate oligonucle treatment of Vero76 cells with phosphorothioate and siRNA otides introduced using Lipofectamine 2000, as compared to oligonucleotides introduced using Lipofectamine 2000, as control. Bars denoted as CUR-1824 and CUR-1825 corre compared to control. Bars denoted as CUR-1883 CUR-1884 spond to samples treated with SEQ ID NOS: 122 and 123 CUR-1873, CUR-1875, CUR-1878 and CUR-1546 corre respectively. spond to samples treated with SEQID NOS: 126, 12796,98, 0042 FIG. 28 is a graph of real time PCR results showing 100, and 92 respectively the fold change--standard deviation in SIRT7 mRNA after treatment of SR-N-AS cells with phosphorothioate oligo 0035 FIG. 21 is a graph of real time PCR results showing nucleotides introduced using Lipofectamine 2000, as com the fold change+standard deviation in SIRT4 mRNA after pared to control. Bars denoted as CUR-1824 and CUR-1825 treatment of HUVEC cells with phosphorothioate oligo correspond to samples treated with SEQ ID NOS: 124 and nucleotides introduced using Lipofectamine 2000, as com 125 respectively. pared to control. Bars denoted as CUR-1832 and CUR-1835 0043 FIG. 29 is a graph of real time PCR results showing correspond to samples treated with SEQ ID NOS: 105 and the fold change--standard deviation in SIRT7 mRNA after 107 respectively. treatment of HepG2 cells with phosphorothioate oligonucle 0036 FIG.22 is a graph of real time PCR results showing otides introduced using Lipofectamine 2000, as compared to the fold change+standard deviation in SIRT4 mRNA after control. Bars denoted as CUR-1824 and CUR-1825 corre treatment of HepG2 cells with phosphorothioate oligonucle spond to samples treated with SEQ ID NOS: 122 and 123 otides introduced using Lipofectamine 2000, as compared to respectively. control. Bars denoted as CUR-1833 and CUR-1835 corre spond to samples treated with SEQ ID NOS: 104 to 107 SEQUENCE LISTING DESCRIPTION respectively. 0044 SEQID NO: 1: Homo sapiens sirtuin (silent mating 0037 FIG. 23 is a graph of real time PCR results showing type information regulation 2 homolog) 1 (S. cerevisiae) the fold change+standard deviation in SIRT5 mRNA after (SIRT1), mRNA (NCBI Accession Number: NM 012238.4) treatment of HepG2 cells with phosphorothioate oligonucle 0045 SEQID NO: 133: Homo sapiens sirtuin 1 (SIRT1), otides introduced using Lipofectamine 2000, as compared to transcript variant 2, mRNA (NCBI Accession Number: control. Bars denoted as CUR-1828, CUR-1829, CUR-1831 NM 001142498.1) and CUR-1830 correspond to samples treated with SEQ ID 0046 SEQID NO: 2: Mus musoulus sirtuin 1 (silent mat NOS: 108, 109, 111 and 110 respectively. ing type information regulation 2, homolog) 1 (S. cerevisiae) 0038 FIG. 24 is a graph of real time PCR results showing (SIRT1) mRNA (NCBI Accession Number:NM the fold change+standard deviation in SIRT6 mRNA after 001159589) treatment of HepG2 cells with phosphorothioate oligonucle 0047 SEQ ID NO:3: Homo sapiens sirtuin 2 (SIRT2), otides introduced using Lipofectamine 2000, as compared to transcript variant 1, mRNA (NCBI Accession No.: control. Real time PCR results show that the levels of SIRT6 NM 012237.3). mRNA in HepG2 cells are significantly increased 48 h after 0048 SEQID NO: 134. Homo sapiens sirtuin 2 (SIRT2), treatment with one of the oligos designed to the SIRT6 anti transcript variant 2, mRNA (NCBI Accession Number: sense sequence at accession number NM 133475. Bars NM 030593.2) denoted as CUR-0873, CUR-0869 to CUR-0871, CUR-0874 0049 SEQID NO: 135. Homo sapiens sirtuin 2 (SIRT2), and CUR-0872, correspond to samples treated with SEQID transcript variant 3, mRNA (NCBI Accession Number: NOS: 116, 112, 113, 114, 117 and 115 respectively. NM 001193286.1) 0039 FIG.25 is a graph of real time PCR results showing 0050 SEQID NO: 136. Homo sapiens sirtuin 2 (SIRT2), the fold change+standard deviation in SIRT6 mRNA after transcript variant 4, non-coding RNA (NCBI Accession treatment of HepG2 cells with phosphorothioate oligonucle Number: NR 134146.1) otides introduced using Lipofectamine 2000, as compared to 0051 SEQID NO: 4: Homo sapiens sirtuin (silent mating control. Real time PCR results show that the levels of SIRT6 type information regulation 2 homolog) 3 (S. cerevisiae) mRNA in HepG2 cells are significantly increased 48 h after (SIRT3). transcript variant 1, mRNA (NCBI Accession No.: treatment with one of the oligo designed to SIRT6 antisense NM 012239.5). bf772662. Bars denoted as CUR-0878, CUR-0876, CUR 0052 SEQID NO: 137: Homo sapiens sirtuin 3 (SIRT3), 0877 and CUR-0875, correspond to samples treated with transcript variant 2, mRNA (NCBI Accession Number: SEQ ID NOS: 121, 119, 120, and 118 respectively. NM 001017524.2) US 2015/0284724 A1 Oct. 8, 2015

0053 SEQ ID NO: 5: Homo sapiens sirtuin 4 (SIRT4), orders and/or concurrently with other acts or events. Further mRNA (NCBI Accession No.: NM 012240). more, not all illustrated acts or events are required to imple 0054 SEQID NO: 138: Homo sapiens sirtuin 5 (SIRT5), ment a methodology in accordance with the present inven transcript variant 2, mRNA (NCBI Accession Number: tion. NM 031244.2) 0063 All genes, gene names, and gene products disclosed 0.055 SEQID NO: 139: Homo sapiens sirtuin 5 (SIRT5), herein are intended to correspond to homologs from any transcript variant 3, mRNA (NCBI Accession Number: species for which the compositions and methods disclosed NM 001 193267.1) herein are applicable. Thus, the terms include, but are not 0056 SEQ ID NO: 6: Homo sapiens sirtuin 5 (SIRT5), limited to genes and gene products from humans and mice. It transcript variant 1, mRNA (NCBI Accession No.: is understood that when a gene or gene product from a par NM 012241). ticular species is disclosed, this disclosure is intended to be 0057 SEQ ID NO: 7: Homo sapiens sirtuin 6 (SIRT6), exemplary only, and is not to be interpreted as a limitation transcript variant 1, mRNA (NCBI Accession No.: unless the context in which it appears clearly indicates. Thus, NM 016539). for example, for the genes disclosed herein, which in some 0058 SEQID NO: 140: Homo sapiens sirtuin 6 (SIRT6), embodiments relate to mammalian nucleic acid and amino transcript variant 2, mRNA (NCBI Accession Number: acid sequences are intended to encompass homologous and/ NM 001 193285.1) or orthologous genes and gene products from other animals 0059 SEQ ID NO: 8: Homo sapiens sirtuin 7 (SIRT7), including, but not limited to other mammals, fish, amphib mRNA (NCBI Accession No.: NM 016538). Natural Anti ians, reptiles, and birds. In embodiments, the genes or nucleic sense Sequences-SEQID NO: 9: Expanded natural antisense acid sequences are human. sequence (CV396200-expanded): SEQ ID NO: 10: Natural 0064. The accession numbers named herein identify pub Antisense sequence (CV428275); SEQID NO: 11: Natural licly available sequences in the National Institutes of Health Antisense Sequence (BE717453) SEQ ID NO: 12: Natural database, GenBank (see Nucleic Acids Research, 2008 Jan, Antisense Sequence (AV718812); SEQ ID NO: 13: Natural 36 Database issue: D25-30), unless otherwise indicated. All SIRT1 antisense sequence (AW169958): SEQ ID NO: 14: sequences referenced by accession number are incorporated Mouse Natural SIRT1 mouse antisense sequence herein by reference. (AKO44604): SEQ ID NO: 15: Natural SIRT3 antisense sequence (Hs.683.117); SEQID NO: 16: Natural SIRT3 anti Definitions sense sequence (DA645474) SEQID NO: 17: Natural SIRT3 0065. The terminology used herein is for the purpose of antisense sequence (BQ024738); SEQ ID NO: 18: Natural describing particular embodiments only and is not intended to SIRT3 antisense sequence (BE164357); Natural SIRT3 anti be limiting of the invention. As used herein, the singular sense sequence (RIC8A) SEQ ID NO: 141, Natural SIRT3 forms “a”, “an and “the are intended to include the plural antisense sequence (PMSD13) SEQ ID NO: 142, Natural forms as well, unless the context clearly indicates otherwise. SIRT3 antisense sequence (DA246502) SEQ ID NO: 143, Furthermore, to the extent that the terms “including, SEQ ID NO: 19: Natural SIRT4 antisense sequence “includes”, “having”, “has”, “with', or variants thereofare (AA156947); SEQ ID NO: 20: Natural SIRT5 antisense used in either the detailed description and/or the claims, such sequence (Hs.671550); SEQID NO: 21: Natural SIRT6 anti terms are intended to be inclusive in a manner similar to the sense sequence (BF772662); SEQID NO: 22: Natural SIRT6 term "comprising.” antisense sequence (ANKRD24); SEQ ID NO. 23; Natural 0066. The term “about' or “approximately” means within SIRT7 antisense sequence (Hs.671550) Antisense oligo an acceptable error range for the particular value as deter nucleotides-SEQID NOS: 24 to 127.* indicates phosphothio mined by one of ordinary skill in the art, which will depend in ate bond,+ indicates LNA and mindicates 2"OMe, rindicates part on how the value is measured or determined, i.e., the RNA limitations of the measurement system. For example, “about 0060 SEQ ID NO: 128 to 130-SEQ ID NO: 128 corre can mean within 1 or more than 1 Standard deviation, per the spond to the exon 4 of the SIRT1 natural antisense practice in the art. Alternatively, “about can mean a range of CV396200, SEQID NO: 129, 130 and 131 correspond to the up to 20%, preferably up to 10%, more preferably up to 5%, forward primer sequence, reverse primer sequence and the and more preferably still up to 1% of a given value. Alterna reporter sequence respectively. SEQID NO: 132 corresponds tively, particularly with respect to biological systems or pro to CUR 962, * indicates phosphothioate bond and + indicates cesses, the term can mean within an order of magnitude, LNA. preferably within 5-fold, and more preferably within 2-fold, 0061 SEQ ID NO: 144 and 145 correspond to reverse of a value. Where particular values are described in the appli complement of the antisense oligonucleotide SEQID NOS: cation and claims, unless otherwise slated the term “about 126 and 127 respectively. meaning within an acceptable error range for the particular value should be assumed. DETAILED DESCRIPTION 0067. As used herein, the term “mRNA' means the pres 0062 Several aspects of the invention are described below ently known mRNA transcript(s) of a targeted gene, and any with reference to example applications for illustration. It further transcripts which may be elucidated. should be understood that numerous specific details, relation 0068. By “antisense oligonucleotides’ or “antisense com ships, and methods are set forth to provide a full understand pound is meant an RNA or DNA molecule that binds to ing of the invention. One having ordinary skill in the relevant another RNA or DNA (target RNA, DNA). For example, if it art, however, will readily recognize that the invention can be is an RNA oligonucleotide it binds to another RNA target by practiced without one or more of the specific details or with means of RNA-RNA interactions and alters the activity of the other methods. The present invention is not limited by the target RNA. An antisense oligonucleotide can upregulate or ordering of acts or events, as Some acts may occur in different downregulate expression and/or function of a particular poly US 2015/0284724 A1 Oct. 8, 2015

nucleotide. The definition is meant to include any foreign SIR2L1, SIR2-like protein 1, are considered the same in the RNA or DNA molecule which is useful from a therapeutic, literature and are used interchangeably in the present appli diagnostic, or other viewpoint. Such molecules include, for cation. example, antisense RNA or DNA molecules, interference 0074 As used herein, the words Sirtuin2, Sirtuin-2, RNA (RNAi), micro RNA, decoy RNA molecules, siRNA, SIRT2, SIR2L and SIR2L2, are considered same in the lit enzymatic RNA, therapeutic editing RNA and agonist and erature and used interchangeably in the present application. antagonist RNA, antisense oligomeric compounds, antisense 0075. As used herein, the words Sirtuin 3, Sirtuin3, Sir oligonucleotides, external guide sequence (EGS) oligonucle tuin-3, SIRT3, SIRT3, hSIRT3, NAD-dependent deacetylase otides, alternate splicers, primers, probes, and other oligo sirtuin-3, mitochondrial, SIR2L3, SIR2-like protein 3 are meric compounds that hybridize to at least a portion of the used interchangeably in the present application. target nucleic acid. As such, these compounds may be intro 0076. As used herein, the words Sirtuin-4, SIRT4, duced in the form of single-stranded, double-stranded, par MGC130046, MGC130047, MGC57437, NAD-dependent tially single-stranded, or circular oligomeric compounds. ADP-ribosyltransferase sirtuin-4, SIR2L4, SIR2-like protein 0069. In the context of this invention, the term "oligo 4, are considered same in the literature and used interchange nucleotide' refers to an oligomer or polymer of ribonucleic ably in the present application. acid (RNA) or deoxyribonucleic acid (DNA) or mimetics 0077. As used herein, the words Sirtuin 5, SIRT5, thereof. The term "oligonucleotide', also includes linear or FLJ36950, NAD-dependent deacetylase sirtuin-5, SIR2L5, circular oligomers of natural and/or modified monomers or SIR2-like protein 5, are considered same in the literature and linkages, including deoxyribonucleosides, ribonucleosides, used interchangeably in the present application. Substituted and alpha-anomeric forms thereof, peptide 0078. As used herein, the words Sirtuin 6, Sirtuiné, Sir nucleic acids (PNA), locked nucleic acids (LNA), phospho tuin-6, SIRT6, SIRT6, NAD-dependent deacetylase sirtuin rothioate, methylphosphonate, and the like. Oligonucleotides 6, SIR2L6, SIR2-like protein 6 are considered the same in the are capable of specifically binding to a target polynucleotide literature and are used interchangeably in the present appli by way of a regular pattern of monomer-to-monomer inter cation. actions, such as Watson-Crick type of base pairing, Hoðgs 0079. As used herein, the words Sirtuin 7, SIRT7, teen or reverse Hoogsteen types of base pairing, or the like. MGC126840, MGC126842, NAD-dependent deacetylase 0070 The oligonucleotide may be “chimeric', that is, sirtuin-7. SIR2L7, SIR2-like protein 7, are considered same composed of different regions. In the context of this invention in the literature and used interchangeably in the present appli "chimeric' compounds are oligonucleotides, which contain cation. two or more chemical regions, for example, DNA region(s), 0080. As used herein, the term "oligonucleotide specific RNA region(s), PNA region(s) etc. Each chemical region is for or "oligonucleotide which targets’ refers to an oligo made up of at least one monomer unit, i.e., a nucleotide in the nucleotide having a sequence (i) capable of forming a stable case of an oligonucleotides compound. These oligonucle complex with a portion of the targeted gene, or (ii) capable of otides typically comprise at least one region wherein the forming a stable duplex with a portion of a mRNA transcript oligonucleotide is modified in order to exhibit one or more of the targeted gene. Stability of the complexes and duplexes desired properties. The desired properties of the oligonucle can be determined by theoretical calculations and/or in vitro otide include, but are not limited, for example, to increased assays. Exemplary assays for determining stability of hybrid resistance to nuclease degradation, increased cellular uptake, ization complexes and duplexes are described in the and/or increased binding affinity for the target nucleic acid. Examples below. Different regions of the oligonucleotide may therefore have I0081. As used herein, the term “target nucleic acid different properties. The chimeric oligonucleotides of the encompasses DNA, RNA (comprising premRNA and present invention can be formed as mixed structures of two or mRNA) transcribed from such DNA, and also cDNA derived more oligonucleotides, modified oligonucleotides, oligo from Such RNA, coding, noncoding sequences, sense or anti nucleosides and/or oligonucleotide analogs as described sense polynucleotides. The specific hybridization of an oli above. gomeric compound with its target nucleic acid interferes with 0071. The oligonucleotide can be composed of regions the normal function of the nucleic acid. This modulation of that can be linked in “register that is, when the monomers are function of a target nucleic acid by compounds, which spe linked consecutively, as in native DNA, or linked via spacers. cifically hybridize to it, is generally referred to as “antisense”. The spacers are intended to constitute a covalent “bridge' The functions of DNA to be interfered include, for example, between the regions and have in cases a length not exceeding replication and transcription. The functions of RNA to be about 100 carbon atoms. The spacers may carry different interfered, include all vital functions such as, for example, functionalities, for example, having positive or negative translocation of the RNA to the site of protein translation, charge, carry special nucleic acid binding properties (inter translation of protein from the RNA, splicing of the RNA to calators, groove binders, toxins, fluorophors etc.), being lipo yield one or more mRNA species, and catalytic activity which philic, inducing special secondary structures like, for may be engaged in or facilitated by the RNA. The overall example, alanine containing peptides that induce alpha-heli effect of such interference with target nucleic acid function is CS modulation of the expression of an encoded product or oli 0072. As used herein “Sirtuins (SIRT)s are inclusive of gonucleotides. all family members, mutants, alleles, fragments, species, cod I0082 RNA interference “RNAi is mediated by double ing and noncooding sequences, sense and antisense poly stranded RNA (dsRNA) molecules that have sequence-spe nucleotide Strands, etc. cific homology to their “target nucleic acid sequences. In 0073. As used herein, the words Sirtuin 1, SIRT1, sirtuin, certain embodiments of the present invention, the mediators silent mating type information regulation 2 homolog 1, are 5-25 nucleotide “small interfering RNA duplexes (siR hSIR2, hSIRT1, NAD-dependent deacetylase sirtuin-1, NAs). The siRNAs are derived from the processing of dsRNA US 2015/0284724 A1 Oct. 8, 2015 by an RNase known as Dicer, siRNA duplex products ylphosphomates, phosphoroselenoate, phosphoramidate, and are recruited into a multi-protein siRNA complex termed the like, as more fully described below. RISC (RNA Induced Silencing Complex). Without wishing I0087. The term “nucleotide' covers naturally incurring to be bound by any particular theory, a RISC is then believed nucleotides as well as non-naturally occurring nucleotides. It to be guided to a target nucleic acid (suitably mRNA), where should be clear to the person skilled in the art that various the siRNA duplex interacts in a sequence-specific way to nucleotides which previously have been considered “non mediate cleavage in a catalytic fashion. Small interfering naturally occurring have Subsequently been found in nature. RNAs that can be used in accordance with the present inven Thus, “nucleotides’ includes not only the known purine and tion cast be synthesized and used according to procedures that pyrimidine heterocycles-containing molecules, but also het are well known in the art and that will be familiar to the erocyclic analogues and tautomers thereof. Illustrative ordinarily skilled artisan. Small interfering RNAs for use in examples of other types of nucleotides are molecules contain the methods of the present invention suitably comprise ing adenine, guanine, thymine, cytosine, uracil, purine, Xan between about 1 to about 50 nucleotides (nt). In examples of thine, diaminopurine, 8-oxo-N6-methyladenine, 7-deaZax non limiting embodiments, siRNAS can comprise about 5 to anthine, 7-deazaguanine, N4.N4-ethanocytosin, N6.N6 about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)- about 15 to about 25 nt, or about 20-25 nucleotides. alkynylcytosine, 5-flourouracil, 5-bromouracil, pseudoisocy 0083. Selection of appropriate oligonucleotides is facili tosine, 2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, tated by using computer programs that automatically align isoguanin, inosine and the “non-naturally occurring nucle nucleic acid sequences and indicate regions of identity or otides described in U.S. Pat. No. 5,432,272. The term “nucle homology. Such programs are used to compare nucleic acid otide' is intended to cover every and all of these examples as sequences obtained, for example, by searching databases well as analogues and tautomers thereof. Especially interest Such as GenBank or by sequencing PCR products. Compari ing nucleotides are those containing adenine, guanine, thym Son of nucleic acid sequences from a range of species allows ine, cytosine, and uracil, which are considered as the naturally the selection of nucleic acid sequences that display an appro occurring nucleotides in relation to therapeutic and diagnos priate degree of identity between species. In the case of genes tic application in humans. Nucleotides include the natural that have not been sequenced. Southern blots are performed to 2'-deoxy and 2'-hydroxyl Sugars, e.g., as described in Korn allow a determination of the degree of identity between genes berg and Baker, DNA Replication, 2nd Ed. (Freeman, San in target species and other species. By performing Southern Francisco, 1992) as well as their analogs. blots at varying degrees of stringency, as is well known in the I0088 “Analogs” in reference to nucleotides includes syn art, it is possible to obtain an approximate measure of identity. thetic nucleotides having modified base moieties and/or These procedures allow the selection of oligonucleotides that modified Sugar moieties. Such analogs include synthetic exhibit a high degree of complementarity to target nucleic nucleotides designed to enhance binding properties, e.g., acid sequences in a subject to be controlled and a lower degree duplex or triplex stability, specificity, or the like. of complementarity to corresponding nucleic acid sequences I0089. As used herein, “hybridization” means the pairing in other species. One skilled in the art will realize that there is of Substantially complementary strands of oligomeric com considerable latitude in selecting appropriate regions of pounds. One mechanism of pairing involves hydrogen bond genes for use in the present invention. ing, which may be Watson-Crick, Hoogsteen or reversed I0084. By “enzymatic RNA meantan RNA molecule with Hoögsteen hydrogen bonding, between complementary enzymatic activity. Enzymatic nucleic acids (ribozymes) act nucleoside or nucleotide bases (nucleotides) of the strands of by first binding to a target RNA. Such binding occurs through oligomeric compounds. For example, adenine and thymine the target binding portion of an enzymatic nucleic acid which are complementary nucleotides which pair through the for is held in close proximity to an enzymatic portion of the mation of hydrogen bonds. Hybridization can occur under molecule that acts to cleave the target RNA. Thus, the enzy varying circumstances. matic nucleic acid first recognizes and then binds a target 0090. An antisense compound is “specifically hybridiz RNA through base pairing, and once bound to the correct site, able' when binding of the compound to the target nucleic acid acts enzymatically to cut the target RNA. interferes with the normal function of the target nucleic acid to cause a modulation of function and/or activity, and there is I0085. By “decoy RNA is meant an RNA molecule that a sufficient degree of complementarity to avoid non-specific mimics the natural binding domain for a ligand. The decoy binding of the antisense compound to non-target nucleic acid RNA therefore competes with natural binding target for the sequences under conditions in which specific binding is binding of a specific ligand. For example, it has been shown desired, i.e., under physiological conditions in the case of in that over-expression of HIV trans-activation response (TAR) Vivo assays or therapeutic treatment, and under conditions in RNA can act as a “decoy’ and efficiently binds HIV tat which assays are performed in the case of in vitro assays. protein, thereby preventing it from binding to TAR sequences 0091. As used herein, the phrase “stringent hybridization encoded in the HIV RNA. This is meant to be a specific conditions” or “stringent conditions' refers to conditions example. Those in the art will recognize that this is but one under which a compound of the invention will hybridize to its example, and other embodiments can be readily generated target sequence, but to a minimal number of other sequences. using techniques generally known in the art. Stringent conditions are sequence-dependent and will be dif I0086. As used herein, the term “monomers’ typically indi ferent in different circumstances and in the context of this cates monomers linked by phosphodiester bonds or analogs invention, “stringent conditions’ under which oligomeric thereof to form oligonucleotides ranging in size from a few compounds hybridize to a target sequence are determined by monomeric units, e.g., from about 3-4, to about several hun the nature and composition of the oligomeric compounds and dreds of monomeric units. Analogs of phosphodiester link the assays in which they are being investigated. In general, ages include: phosphorothioate, phosphorodithioate, meth stringent hybridization conditions comprise low concentra US 2015/0284724 A1 Oct. 8, 2015

tions (<0.15 M) of salts with inorganic cations such as Na++ hybridize to the target sequence at equilibrium. Typically, or K++ (i.e., low ionic strength), temperature higher than 20° stringent conditions will be those in which the salt concen C.-25° C. below the Tm of the oligomeric compound: target tration is at least about 0.01 to 1.0 MNaion concentration (or sequence complex, and the presence of denaturants such as other salts) at pH 7.0 to 8.3 and the temperature is at least formamide, dimethylformamide, dimethyl sulfoxide, or the about 30° C. for short oligonucleotides (e.g., 10 to 50 nucle detergent sodium dodecyl sulfate (SDS). For example, the otide). Stringent conditions may also be achieved with the hybridization rate decreases 1.1% for each 1% formamide. addition of destabilizing agents such as formamide. An example of a high Stringency hybridization condition is 0.095 As used herein, “modulation” means either an 0.1x sodium chloride-sodium citrate buffer (SSC)/0.1% increase (stimulation) or a decrease (inhibition) in the expres (w/v) SDS at 60° C. for 30 minutes. Sion of a gene. 0092 “Complementary, as used herein, refers to the capacity for precise pairing between two nucleotides on one 0096. The term “variant, when used in the context of a or two oligomeric Strands. For example, if a nucleobase at a polynucleotide sequence, may encompass a polynucleotide certain position of an antisense compound is capable of sequence related to a wildtype gene. This definition may also hydrogen bonding with a nucleobase at a certain position of a include, for example, “allelic,” “splice.” “species,” or “poly target nucleic acid, said target nucleic acid being a DNA, morphic' variants. A splice variant may have significant iden RNA, or oligonucleotide molecule, then the position of tity to a reference molecule, but will generally have a greater hydrogen bonding between the oligonucleotide and the target or lesser number of polynucleotides due to alternate splicing nucleic acid is considered to be a complementary position. of exons during mRNA processing. The corresponding The oligomeric compound and the further DNA, RNA, or polypeptide may possess additional functional domains oran oligonucleotide molecule are complementary to each other absence of domains. Species variants are polynucleotide when a Sufficient number of complementary positions in each sequences that vary from one species to another. Of particular molecule are occupied by nucleotides which can hydrogen utility in the invention are variants of wildtype gene products. bond with each other. Thus, “specifically hybridizable' and Variants may result from at least one mutation in the nucleic “complementary are terms which are used to indicate a acid sequence and may result in altered mRNAS or in Sufficient degree of precise pairing or complementarity overa polypeptides whose structure or function may or may not be sufficient number of nucleotides such that stable and specific altered. Any given natural or recombinant gene may have binding occurs between the oligomeric compound and a tar none, one, or many allelic forms. Common mutational get nucleic acid. changes that give rise to variants are generally ascribed to 0093. It is understood in the art that the sequence of an natural deletions, additions, or substitutions of nucleotides. oligomeric compound need not be 100% complementary to Each of these types of changes may occur alone, or in com that of its target nucleic acid to be specifically hybridizable. bination with the others, one or more times in a given Moreover, an oligonucleotide may hybridize over one or Sequence. more segments such that intervening or adjacent segments are 0097. The resulting polypeptides generally will have sig not involved in the hybridization event (e.g., a loop structure, nificantamino acid identity relative to each other. A polymor mismatch or hairpin structure). The oligomeric compounds of phic variant is a variation in the polynucleotide sequence of a the present invention comprise at least about 70%, or at least particular gene between individuals of a given species. Poly about 75%, or at least about 80%, or at least about 85%, or at morphic variants also may encompass 'single nucleotide least about 90%, or at least about 95%, or at least about 99% polymorphisms” (SNPs.) or single base mutations in which sequence complementarity to a target region within the target the polynucleotide sequence varies by one base. The presence nucleic acid sequence to which they are targeted. For of SNPs may be indicative of, for example, a certain popula example, an antisense compound in which 18 of 20 nucle tion with a propensity for a disease state, that is Susceptibility otides of the antisense compound tire complementary to a Versus resistance. target region, and would therefore specifically hybridize, 0098. Derivative polynucleotides include nucleic acids would represent 90 percent complementarity. In this Subjected to chemical modification, for example, replace example, the remaining noncomplementary nucleotides may ment of hydrogen by an alkyl, acyl, or amino group. Deriva be clustered or interspersed with complementary nucleotides tives, e.g. derivative oligonucleotides, may comprise non and need not be contiguous to each other or to complementary naturally-occurring portions, such as altered Sugar moieties nucleotides. AS Such, an antisense compound which is 18 orinter-Sugar linkages. Exemplary among these are phospho nucleotides in length having 4 (four) noncomplementary rothioate and other Sulfur containing species which are nucleotides which are flanked by two regions of complete known in the art. Derivative nucleic acids may also contain complementarity with the target nucleic acid would have labels, including radionucleotides, , fluorescent 77.8% overall complementarity with the target nucleic acid agents, chemiluminescent agents, chromogenic agents, Sub and would thus fall within the scope of the present invention. strates, cofactors, inhibitors, magnetic particles, and the like. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely (0099. A "derivative” polypeptide or peptide is one that is using BLAST programs (basic local alignment search tools) modified, for example, by glycosylation, pegylation, phos and PowerBLAST programs known in the art. Percent phorylation, Sulfation, reduction/alkylation, acylation, homology, sequence identity or complemenlarity, can be chemical coupling, or mild formalin treatment. A derivative determined by, for example, the Gap program. may also be modified to contain a detectable label, either 0094. As used herein, the term “Thermal Melting Point directly or indirectly, including, but not limited to, a radio (Tm) refers to the temperature, under defined ionic strength, isotope, fluorescent, and enzyme label. pH, and nucleic acid concentration, at which 50% of the 0100. As used herein, the term “animal' or “patient' is oligonucleotides complementary to the target sequence meant to include, for example, humans, sheep, elks, deer, US 2015/0284724 A1 Oct. 8, 2015

mule deer, minks, mammals, monkeys, horses, cattle, pigs, not limited to, headache, stupor and coma, dementia, seizure, goats, dogs, cats, rats, mice, birds, chicken, reptiles, fish, sleep disorders, trauma, infections, neoplasms, neuroopthal insects and arachnids. mology, movement disorders, demyelinatiag diseases, spinal 0101 "Mammal’ covers warm blooded mammals that are cord disorders, and disorders of peripheral nerves, muscle typically under medical care (e.g., humans and domesticated and neuromuscular junctions. Addiction and mental illness, animals). Examples include feline, canine, equine, bovine, include, but are not limited to, bipolar disorder and schizo and human, as well as just human. phrenia, are also included in the definition of neurological 0102 “Treating or “treatment covers the treatment of a disorder. The following is a list of several neurological disor disease-state in a mammal, and includes: (a) preventing the ders, symptoms, signs and syndromes that can be treated disease-state from occurring in a mammal, in particular, when using compositions and methods according to the present Such mammal is predisposed to the disease-state but has not invention: acquired epileptiform aphasia; acute disseminated yet been diagnosed as having it; (b) inhibiting the disease encephalomyelitis; adrenoleukodystrophy; age-related state, e.g., arresting it development; and/or (c) relieving the macular degeneration; agenesis of the corpus calloSum; agno disease-state, e.g., causing regression of the disease state until sia; Aicardi syndrome; Alexander disease; Alpers disease; a desired endpoint is reached. Treating also includes the ame alternating hemiplegia; Vascular dementia; amyotrophic lat lioration of a symptom of a disease (e.g., lessen the pain or eral Sclerosis; anencephaly; Angelman syndrome; angioma discomfort), wherein Such amelioration may or may not be tosis; anoxia; aphasia; apraxia; arachnoid cysts, arachnoidi directly affecting the disease (e.g., cause, transmission, tis; Anronl-Chiari malformation; arteriovenous expression, etc). malformation; Asperger syndrome; ataxia telegiectasia; 0103) As used herein, " refers to all types of cancer attention deficit hyperactivity disorder, autism; autonomic or neoplasm or malignant tumors found in mammals, includ dysfunction; back pain; Batten disease; Behcet’s disease; ing, but not limited to: leukemias, lymphomas, melanomas, Bell’s palsy, benign essential blepharospasm; benign focal; carcinomas and sarcomas. The cancer manifests itself as a amyotrophy; benign intracranial ; Binswanger's "tumor or tissue comprising malignant cells of the cancer. disease; blepharospasm; Bloch Sulzberger syndrome; bra Examples of tumors include Sarcomas and carcinomas Such chial plexus injury; brain abscess; brain injury; brain tumors as, but not limited to: fibrosarcoma, myxosarcoma, liposar (including glioblastoma multiforme); spinal tumor, Brown coma, chondrosarcoma, osteogenic sarcoma, chordoma, Sequard syndrome; Canavan disease; carpal tunnel Syn angiosarcoma, endotheliosarcoma, lymphangiosarcoma, drome; causalgia; central pain syndrome; central pontine lymphangioendotheliosarcoma, Synovioma, mesothelioma, myelinolysis; cephalic disorder; cerebral ; cerebral Ewings tumor, leiomyosarcoma, rhabdomyosarcoma, colon ; cerebral atrophy; cerebral gigantism; cere carcinoma, pancreatic cancer, breast cancer, ovarian cancer, bral palsy; Charcot-Marie-Toot disease; chemotherapy-in prostate cancer, squamous cell carcinoma, basal cell carci duced neuropathy and neuropathic pain; Chiari malforma noma, adenocarcinoma, Sweat gland carcinoma, sebaceous tion; chorea; chronic inflammatory demyelinating gland carcinoma, papillary carcinoma, papillary adenocarci polyneuropathy; chronic pain; chronic regional pain Syn nomas, cystadenocarcinoma, medullary carcinoma, bron drome; Coffin Lowry syndrome; coma, including persistent chogenic carcinoma, renal cell carcinoma, hepatoma, bile Vegetative state; congenital facial diplegia; corticobasal duct carcinoma, choriocarcinoma, seminoma, embryonal degeneration; cranial ; craniosynostosis; Creutzfeldt carcinoma, Wilms tumor, cervical cancer, testicular tumor, Jakob disease; cumulative trauma disorders; Cushing's Syn lung carcinoma, Small cell lung carcinoma, bladder carci drome; cytomegalic inclusion body disease; cytomegalovirus noma, epithelial carcinoma, glioma, astrocytoma, medullo infection; dancing eyes-dancing feet syndrome; Dandy blastoma, craniopharyngioma, ependymoma, pinealoma, Walker syndrome; Dawson disease; De Morsier's syndrome: hemangioblastoma, acoustic neuroma, oligodendroglioma, Dejerine-Klumke palsy, dementia; dermatomyositis; dia meningioma, melanoma, neuroblastoma, and retinoblas betic neuropathy; diffuse Sclerosis; dysautonomia; dys toma. Additional which can be treated by the dis graphia; dyslexia; dystonias; early infantile epileptic closed composition according to the invention include but not encephalopathy; empty sella syndrome; encephalitis; limited to, for example. Hodgkin’s Disease, Non-Hodgkin’s encephaloceles; encephalotrigeminal ; epi Lymphoma, multiple myeloma, neuroblastoma, breast can lepsy; Erb's palsy; essential tremor; Fabry's disease; Fahr's cer, ovarian cancer, lung cancer, rhabdomyosarcoma, pri syndrome; fainting; familial spastic paralysis; febrile sei mary thrombocytosis, primary macroglobulinemia, Small Zures; fisher syndrome; Friedreich's ataxia; fronto-temporal cell lung tumors, primary brain tumors, stomach cancer, dementia and other “tauopathies'; Gaucher's disease; Gerst colon cancer, malignant pancreatic insulanoma, malignant mann's syndrome; giant cell arteritis; giant cell inclusion carcinoid, urinary bladder cancer, premalignant skin lesions, disease; globoid cell leukodystrophy: Guillain-Barre syn testicular cancer, lymphomas, thyroid cancer, neuroblastoma, drome; HTLV-1-associated myelopathy; Hallervorden-Spate esophageal cancer, genitourinary tract cancer, malignant disease; head injury; headache; hemifacial spasm; hereditary hypercalcemia, cervical cancer, endometrial cancer, adrenal spastic paraplegia; heredopathia atactic a polyneoritiformis; cortical cancer, and prostate cancer. herpes Zosteroticus; herpes Zoster; Hirayama syndrome; HIV 0104 “Neurological disease or disorder refers to any dis associated dementia and neuropathy (also neurological mani ease or disorder of the nervous system and/or visual system, festations of AIDS); holoprosencephaly: Huntington's dis “Neurological disease or disorder include disease or disor ease and other polyglutamine repeat diseases; hydranenceph ders that involve the central nervous system (brain, brainstem aly; hydrocephalus; hypercortisolism; hypoxia; immune and cerebellum), the peripheral nervous system (including mediated encephalomyelitis; inclusion body myositis; cranial nerves), and the autonomic nervous system (parts of incontinentia pigment; infantile phytanic acid storage dis which are located in both central and peripheral nervous ease; infantile refsum disease; infantile spasms; inflamma system). Examples of neurological disorders include but are tory myopathy; intracranial cyst; intracranial hypertension; US 2015/0284724 A1 Oct. 8, 2015

Joubert syndrome; Keams-Sayre syndrome; Kennedy disease verse myelitis; traumatic brain injury; tremor, trigeminal neu Kinsbourne syndrome; Klippel Feil syndrome; Krabbe dis ralgia; tropical spastic paraparesis; tuberous Sclerosis; Vascu ease; Kugelberg-Welander disease; kuru; Lafora disease; lar dementia (multi-infarct dementia); including Lambert-Eaton myasthenic syndrome; Landau-Kleffner Syn temporal arteritis; Von Hippel-Lindau disease; Wallenberg's drome; lateral medullary (Wallenberg) syndrome; learning syndrome; Werdnig-Hoffman disease; West syndrome; whip disabilities; Leigh's disease; Lennox-Gustaut Syndrome; lash; Williams syndrome; Wildon's disease; and Zellweger Lesch-Nyhan syndrome; leukodystrophy; Lewy body syndrome. dementia; Lissencephaly; locked-in syndrome; Lou Gehrig's 0105 "Metabolic disease' refers to a wide range of dis disease (i.e., motor neuron disease or amyotrophic lateral eases and disorders of the endocrine system including, for Sclerosis); lumbar disc disease; Lyme disease-neurological example, insulin resistance, diabetes, obesity, impaired glu sequelae; Machado-Joseph disease; macrencephaly: mega cose tolerance, high blood cholesterol, hyperglycemia, dys lencephaly: Melkersson-Rosenthal syndrome: Menieres dis lipidemia and hyperlipidemia. ease; meningitis; Menkes disease; metachromatic leukodys 010.6 An “” refers to systemic inflammatory trophy; microcephaly; migraine; Miller Fisher syndrome; conditions and conditions associated locally with migration mini-strokes; mitochondrial myopathies; Mobius syndrome; and attraction of monocytes, leukocytes and/or neutrophils. monomelic amyotrophy; motor neuron disease; Moyamoya Examples of inflammation include, but are not limited to, disease; mucopolysaccharidoses; milti-infarct dementia; Inflammation resulting from infection with pathogenic multifocal motor neuropathy; multiple Sclerosis and other organisms (including grant-positive bacteria, gram-negative demyelinating disorders; multiple system atrophy with pos bacteria, viruses, fungi, and parasites such as protozoa and tural ; p muscular dystrophy; myasthenia gravis; helminths), transplant rejection (including rejection of Solid myelinoclastic diffuse Sclerosis; myoclonic encephalopathy organs such as kidney, liver, heart, lung or cornea, as well as of infants; myoclonus; myopathy; myotonia congenital; nar rejection of bone marrow transplants including graft-Versus colepsy; neurofibromatosis; neuroleptic malignant Syn host disease (GVHD)), or from localized chronic or acute drome; neurological manifestations of AIDS; neurological autoimmune or allergic reactions. Autoimmune diseases sequelae of lupus; neuromyotonia; neuronal ceroid lipofus include acute glomerulonephritis; rheumatoid or reactive cinosis; neuronal migration disorders; Niemann-Pick dis arthritis; chronic glomerulonephritis; inflammatory bowel ease; O'Sullivan-McLeod syndrome; occipital neuralgia; diseases Such as Crohn's disease, ulcerative colitis and necro occult spinal dysraphism sequence; Ohtahara syndrome; tizing enterocolitis; granulocyte transfusion associated Syn olivopontocerebellar atrophy; opsoclonus myoclonus; optic dromes; inflammatory dermatoses such as contact dermatitis, neuritis; ; overuse syndrome; pares atopic dermatitis, psoriasis; systemic lupus erythematosus thesia; Neurodegenerative disease or disorder (Parkinson's (SLE), autoimmune thyroiditis, multiple Sclerosis, and some disease, Huntington's disease, Alzheimer's disease, amyo forms of diabetes, or any other autoimmune state where trophic lateral Sclerosis (ALS), dementia, multiple Sclerosis attack by the Subjects own immune system results in patho and other diseases and disorders associated with neuronal cell logic tissue destruction. Allergic reactions include allergic death); paramyotonia congenital; paraneoplastic diseases; asthma, chronic bronchitis, acute and delayed hypersensitiv paroxysmal attacks; Parry Romberg syndrome; Pelizaeus ity. Systemic inflammatory disease states include inflamma Merzbacher disease; periodic paralyses; peripheral neuropa tion associated with trauma, burns, reperfusion following thy; painful neuropathy and neuropathic pain; persistent Veg ischemic events (e.g. thrombotic events in heart, brain, intes etative state; pervasive developmental disorders; photic tines or peripheral vasculature, including myocardial infarc Sneeze reflex; phytanic acid storage disease; Pick's disease; tion and stroke), sepsis, ARDS or multiple organ dysfunction pinched nerve; pituitary tumors; polymyositis; porencephaly: syndrome. Inflammatory cell recruitment also occurs in post-polio syndrome; posterpetic neuralgia; postinfectious aterosclerotic plaques. Inflammation includes, but is not lim encephalomyelitis; postural hypotension; Prader-Willi syn ited to, Non-Hodgkin’s lymphoma, Wegener's granulomato drome; primary lateral Sclerosis; prion diseases; progressive sis, Hashimoto's thyroiditis, hepatocellular carcinoma, thy hemifacial atrophy; progressive multifocalcukoencephal mus atrophy, chronic pancreatitis, rheumatoid arthritis, opathy; progressive Sclerosing poliodystrophy; progressive reactive lymphoid hyperplasia, osteoarthritis, ulcerative coli Supranuclearpalsy, pseudotumor cerebri; Ramsay-Hunt Syn tis, papillary carcinoma, Crohn's disease, ulcerative colitis, drome (types I and II); Rasmussen's encephalitis; reflex sym acute cholecystitis, chronic cholecystitis, cirrhosis, chronic pathetic dystrophy syndrome; Refsum disease; repetitive sialadenitis, peritonitis, acute pancreatitis, chronic pancreati motion disorders; repetitive stress injuries; restless legs Syn tis, chronic Gastritis, adenomyosis, endometriosis, acute cer drome; retrovirus-associated myelopathy: Rett syndrome; viciitis, chronic cerviciitis, lymphoid hyperplasia, multiple Reye's syndrome: Saint Vitus dance: Sandhoff disease: Sclerosis, hypertrophy secondary to idiopathic thrombocy Schilder's disease; Schizencephaly; Septo-optic dysplasia; topenic purpura, primary IgA nephropathy, systemic lupus shaken baby syndrome; shingles; Shy-Drager syndrome; erythematosus, psoriasis, pulmonary emphysema, chronic Sjogren's syndrome; sleep apnea; Soto's syndrome; spastic pyelonephritis, and chronic cystitis. ity; spina bifida; spinal cord injury; spinal cord tumors; spinal 0107. A or disorder includes muscular atrophy; Stiff-Person syndrome; stroke: Sturge those disorders that can either cause ischemia or are caused by Weber syndrome; Subacute Sclerosing panencephalitis; Sub reperfusion of the heart. Examples include, but are not limited cortical arteriosclerotic, encephalopathy; Sydenham chorea; to, , coronary disease, granulomatous Syncope; Syringomyelia; tardive dyskinesia; Tay-Sachs dis myocarditis, chronic myocarditis (non-granulomatous), pri ease; temporal arteritis; tethered spinal cord syndrome; mary hypertrophic cardiomyopathy, peripheral artery disease Thomsen disease; thoracic outlet syndrome; Tic Douloureux; (PAD), stroke, angina pectoris, myocardial infarction, cardio Todd's paralysis; Tourette syndrome; transient ischemic vascular tissue damage caused by cardiac arrest, cardiovas attack; transmissible spongiform encephalopathies; trans cular tissue damage caused by cardiac bypass, cardiogenic US 2015/0284724 A1 Oct. 8, 2015

shock, and related conditions that would be known by those of PF02146 and in INTERPRO as INTERPRO description (en ordinary skill in the art or which involve dysfunction of or try IPRO03000). A description of the Pfam database can be tissue damage to the heart or vasculature, especially, but not found in "The PfamProtein Families Database' Bateman Aet limited to, tissue damage related to Sirtuin3 activation. CVS al. (2002) Nucleic Acids Research 30(1):276-280 and Son diseases include, but are not limited to, atherosclerosis, hammer et al. (1997) Proteins 28(3):405-420 and a detailed granulomatous myocarditis, myocardial infarction, myocar description of HMMs can be found, for example, in Gribskov dial fibrosis secondary to valvular heart disease, myocardial et al. (1990) Meth. Enzymol. 183:146-159; Gribskov et al. fibrosis without infarction, primary hypertrophic cardiomy (1987) Proc. Natl. Acad. Sci. USA 84:4355-4358; Kroghet opathy, and chronic myocarditis (non-granulomatous). al. (1994) J. Mol. Biol. 235:1501-1531; and Stultz et al. (1993) Protein Sci. 2:305-314. Polynucleotide and Oligonucleotide Compositions 0118. Among the mitochondrial sirtuins, SIRT3 possesses and Molecules the most robust deacetylase activity. Indeed, significantly higher levels of mitochondrial protein were Targets detected in the livers of SIRT3-null mice, compared to those 0108. In one embodiment, the targets comprise nucleic of SIRT4 or SIRT5 knockout animals. However, little is acid sequences of a Sirtuin (SIRT), including without limita known about the physiological role of SIRT3 despite the fact tion sense and/or antisense noncoding and/or coding that a number of SIRT3 substrates and co-precipitating pro sequences associated with a Sirtuin (SIRT). teins have been identified: acetyl-CoA synthetase 2, Ku70, 0109. In one embodiment, the targets comprise nucleic FOXO3a, subunit 9 of mitochondrial Complex I (NDUFA9), acid sequences of SIRT1, including without limitation sense glutamate dehydrogenase and isocitrate dehydrogenase 2. and/or antisense noncoding and/or coding sequences associ 0119 SIRT3 is a major mitochondrial deacetylase. Mito ated with SIRT1 gene. chondrial proteins show hyperacetylation in SIRT3 knockout 0110. In one embodiment, the targets comprise nucleic mice, but not in SIRT4 or SIRT5 knockout mice. Acetyl-CoA acid sequences of SIRT2, including without limitation sense synthetase 2 (AceCS2), a mitochondrial enzyme that converts and/or antisense noncoding and/or coding sequences associ acetate into acetyl-CoA, was the first mitochondrial substrate ated with SIRT2 gene. of SIRT3 identified. Deacetylation of AccCS2 at lysine 642 0111. In one embodiment, she targets comprise nucleic by SIRT3 activates acetyl-CoA synthetase activity, providing acid sequences of SIRT3, including without limitation sense increased acetyl-CoA to feed into the tricarboxylic acid cycle. and/or antisense noncoding and/or coding sequences associ Glutamate dehydrogenase (GDH), another mitochondrial ated with SIRT3 gene. protein involved in energy production, is deacetylated by 0112. In one embodiment, the targets comprise nucleic SIRT3, GDH can also be ADP-ribosylated by SIRT4 in turn to acid sequences of SIRT4, including without limitation sense decrease its enzyme activity. This indicates that SIRT3 could and/or antisense noncoding and/or coding sequences associ play an important role in cell metabolism. SIRT3 has also ated with SIRT4 gene. been shown to be involved in selective apoptosis pathways 0113. In one embodiment, the targets comprise nucleic and cell growth control SIRT3 and SIRT4, but not SIRT5, acid sequences of SIRT5, including without limitation sense have been implicated in the NAD+ salvage pathway that and/or antisense noncoding and/or coding sequences associ regulates the NAD+ level relating to cell survival. In addition, ated with SIRT5 gene. variability in the hSIRT3 gene has been linked to human 0114. In one embodiment, the targets comprise nucleic longevity. acid sequences of SIRT6, including without limitation sense 0.120. The Silent Information Regulator-2 gene (Sir2) and/or antisense noncoding and/or coding sequences associ encodes an NAD-dependent that links ated with SIRT6 gene. regulation of , genomic stability, and life span in S. 0115. In one embodiment, the targets comprise nucleic cerevisae. By promoting chromatin silencing, Sir2 inhibits acid sequences of SIRT7, including without limitation sense transcription at several genetic loci and represses recombina and/or antisense noncoding and/or coding sequences associ tion at ribosomal DNA (rDNA) repeats. Yeast with mutations ated with SIRT7 gene. in Sir2 have increased genomic instability in the context of 0116 “SIRT1 protein” refers to a member of the sir2 fam rDNA recombination, which in turn shortens replicative life ily of sirtuin deacetylases. In one embodiment, a SIRT1 pro span—a marker of reproductive aging in this organism. Con tein includes yeast Sir2 (GenBankAccession No. P53685), C. versely, extracopies of Sir2 that suppress rDNA recombina elegans Sir-2.1 (GenBank Accession No. NP sub-501912), tion increase replicative life span. These effects of Sir2 Sug human SIRT1. (GenBank Accession No. NM. Sub-012238 gest paradigms in which genes that promote genome and NPsnb.-036370 (or AF083106)) stabilization through chromatin modulation may be impor 0117 SIRT1 “Sirtuins' are proteins that include a SIR2 tant contributors to regulation organismal life span, aging, domain, a domain defined as amino acids sequences that are and age-related pathology. scored as hits in the Plant family “SIR2'-PF02146 (attached 0121 Consistent with a conserved role for Sir2 factors in to the Appendix). This family is referenced in the INTERPRO life span regulation, increased activity of Sir2 proteins in the database as INTERPRO description (entry IPRO03000). To multicellular organisms C. elegans and D. melanogaster also identify the presence of a “SIR2 domain in a protein increases life span. However, these Sir2 factors may operate sequence, and make the determination that a polypeptide or through mechanisms that are independent of genome stabili protein of interest has a particular profile, the amino acid Zation, and their physiologic molecular Substrates are still sequence of the protein can be searched against the Pfam unclear. In mammals, there are seven Sir2 family members, database of HMMs (e.g., the Pfam database, release 9) using SIRT1-SIRT7. The SIRTs have been of great interest as can the default parameters (http://www.sanger.ac.uk/Software/ didate regulate of mammalian life span and aging-related Pfam/HMM search). The SIR2 domain is indexed in Pfamas processes. In this context, several mammalian SIRTs have US 2015/0284724 A1 Oct. 8, 2015 functions that impact on aging-associated molecular path tion factors, that regulate cellular oxidative and genotoxic ways and disease. However, initial studies of mammalian stresses. SIRT6 is involved in important functions in preserv SIRTs linked these enzymes to biochemical targets and cel ing cells from genomic instability and progeroid phenotype. lular functions that are distinct from those of S. cerevisiae Moreover, SIRT6 is the only sirtuin to exhibit a robust auto Sir2. ADP-ribosyltransferase activity. SIRT7 is the only sirtuin 0122 Sirtuins are homologues of the yeast transcriptional localized in nucleoli. It was shown to exhibit no deacetylase repressor Sir2p and are conserved from bacteria to humans. or ADP-ribosyltansferase activity when tested on acetylated Human SIRT4 is localized to the mitochondria. SIRT4 is a histones and various acetylated components of the RNA Pol I matrix protein and becomes cleaved at amino acid 28 after machinery. Concerning the nucleolar function of SIRT7. Ford import into mitochondria. Mass spectrometry analysis of pro et al. proposed that SIRT7 could be a positive regulator of teins that coimmunoprecipitate with SIRT4 identified insulin rDNA transcription via its association with RNA Pol I. Its degrading enzyme and the ADP/ATP carrier proteins, ANT2 overexpression enhances rNA transcription, whereas its and ANT3. SIRT4 exhibits no histone deacetylase activity but inhibition reduces rDNA transcription. Interestingly, expres functions as an efficient ADP-ribosyltransferase on histones sion of SIRT7 is positively correlated with cell growth: SIRT7 and bovine serum albumin. SIRT4 is expressed in islets of is abundant in metabolically active tissues such as liver, Langerhans and colocalizes with insulin-expressing B cells. spleen and tests. To date, there are no data concerning the cell Depletion of SIRT4 from insulin-producing INS-1E cells cycle regulation of SIRT7 and its fate during mitosis when results in increased insulin secretion in response to glucose. rDNA transcription is repressed. 0123 Sirtuin (silent mating type information regulation 2 0.126 In some embodiments, antisense oligonucleotides homology) 5 (S. cerevisae), also known as SIRT5 is a protein are used to prevent or treat diseases or disorders associated which in humans in encoded by the SIRT5 gene and in other with Sirtuin (SIRT) family members. Exemplary Sirtuin species by the SirtS gene. This gene encodes a member of the (SIRT) mediated diseases and disorders which can be treated sirtuin family of proteins, homologs to the yeast Sir2 protein. with cell/tissues regenerated from stem cells obtained using Members of the sirtuin family are characterized by a sirtuin the antisense compounds comprise: a disease or disorder core domain and grouped into four classes. The functions of associated with abnormal function and/or expression of Sir human sirtuins have not yet been determined; however, yeast tuin, cancer (e.g., breast cancer, colorectal cancer, CCL, sirtuin proteins are known to regulate epigenetic gene silenc CML, prostate cancer), a neurodegenerative disease or disor ing and Suppress recombination of rDNA. Studies suggest der (e.g., Alzheimer's Disease (AD), Huntington's disease, that the human sirtuins may function as intracellular regula Parkinson’s disease, Amyotrophic Lateral Sclerosis (ALS), tory proteins with mono-ADP-ribosyltransferase activity. Multiple Sclerosis, and disorders caused by polyglutamine The protein encoded by this gene is included in class III of the aggregation), a beta-amyloid disease or disorder (e.g., a dis sirtuin family. Alternative splicing of this gene results in two order characterized by .beta.-amyloid accumulation Such as transcript variants. Alzheimer's disease), skeletal muscle disease (e.g., Duchene 0.124. The generation of mice deficient for the mammalian muscular dystrophy, skeletal muscle atrophy, Becker's dys SIRT6 gene revealed a potential role for SIRT6 in linking trophy, or myotonic dystrophy); a metabolic disease or dis regulation of life span, chromatin, and genomic stability. In order (e.g., insulin resistance, diabetes, type 2 diabetes, obe this context, SIRT6 deficiency in mice leads to dramatically sity, impaired glucose tolerance, metabolic syndrome, adult shortened life span and acute degenerative phenotypes that onset diabetes, diabetic nephropathy, hyperglycemia, overlap with pathologies of premature aging. Moreover, diabetic nephropathy, Hypercholesterolemia, dyslipidemia SIRT6 cells have genomic instability and hyperlipidemia and an age-related metabolic disease etc.), a DNA damage hypersensitivity. In biochemical fractionation disease or disorder associated with impaired insulin regula assays, SIRT6 protein associates preferentially with a chro tion, neuropathy (e.g., sensory neuropathy, autonomic neur matin-enriched cellular fraction. Together, these observations opathy, motor neuropathy, retinopathy), a disease or disorder Suggested that SIRT6 might couple chromatin regulation with associated with a ketogenic condition, a disease or disorder DNA repair. However, a physiologic role for SIRT6 in such a associated with impaired energy homeostasis, a disease or process has not yet been demonstrated. disorder associated with impaired Acetyl-CoA synthetase 2 0.125 Mammalian sirtuins (SIRT1-7), homologs of the activity, a disease or disorder associated with metabolic yeast Sir2, have recently been proposed to be involved in the homeostasis, a lipid metabolism disease or disorder, a disease control of critical metabolic pathways as well as apoptosis, or disorder associated with impaired thermogenesis, a disease stress responses, DNA repair, cell cycle, genomic stability or disorder associated with impaired regulation of cell divi and gene expression. Sirtuins, also designated class III his Sion, a disease or disorder associated with mitochondrial tone deacetylases, are protein deacetylases/ADP ribosyl dysfunction, neuropathy (e.g., sensory neuropathy, auto transferases. These enzymes are highly conserved from nomic neuropathy, motor neuropathy, retinopathy), fibrosis, prokaryotes to eukaryotes. They all share a conserved NAD inflammatory cardiomyopathy, heart hypertrophy, Ichronic dependent catalytic core domain, and exhibit variable N-ter inflammation, atherosclerosis, arthritis, dementia, osteoporo minal and C-terminal extensions that contribute to their sis, and a cardiovascular disease or disorder, a hepatic disease unique Subcellular localization and may also regulate their or disorder (e.g., due to alcohol abuse or hepatitis, fatty liver catalytic activity. The subcellular distribution, substrate disease etc.), age-related macular degeneration, bone disease specificity and cellular function of sirtuins are quite diverse. (e.g., osteoporosis), a blood disease (e.g., a leukemia), bone SIRT2 is a predominantly cytoplasmic protein, SIRT3-5 are resorption, age-related macular degeneration, AIDS related mitochondrial and SIRT7, -6 and -7 are localized in the dementia, ALS, Bell's Palsy, atherosclerosis, a cardiac dis nucleus. SIRT7, the most closely related to yeast Sir2 and the ease or disorder (e.g., cardiac dysrhymias, chronic congestive best characterized sirtuin, possesses a large number of Sub heart failure, ischemic stroke, coronary artery disease and strates, including p53, Ku70, NF-kB and forkhead transcrip cardiomyopathy), chronically degenerative disease (e.g., car US 2015/0284724 A1 Oct. 8, 2015

diac muscle disease), chronic renal failure, type 2 diabetes, syndrome (OMS); optic neuritis; Ord’s thyroiditis; osteoar ulceration, cataract, presbiopia, glomerulonephritis, Guillan thritis; pemphigus; pernicious anaemia; polyarteritis nodosa; Barre Syndrome, hemorrhagic stroke, rheumatoid arthritis, polymyositis; postoperative or traumatic inflammation; pri inflammatory bowel disease, SLE, Crohn's disease, osteoar mary biliary cirrhosis; primary myoxedema, psoriasis; pso thritis, osteoporosis. Chronic Obstructive Pulmonary Disease riatic arthritis; rheumatic fever, rheumatoid arthritis; Reiter's (COPD), pneumonia, skin aging, a skin disease or disorder, syndrome: Scleroderma; Sjogren's syndrome; stroke-is urinary incontinence, a disease or disorder associated with chemia; systemic lupus erythematosus (SLE); systemic onset mitochondrial dysfunction (e.g., mitochondrial myopathy, juvenile idiopathic arthritis; Takayasu's arteritis; temporal encephalopathy, Leber's disease, Leigh encephalopathia, arteritis; vitiligo; warm autoimmune hemolytic anemia; and Pearson's disease, lactic acidosis, mitochondrial encephal Wegener's granulomatosis. opathy, lactic acidosis and stroke like symptoms (MELAS) I0128. In another embodiment, the antisense oligonucle etc.), liver degeneration, skeletal muscle degeneration, a mus otides modulate the normal expression and/or normal func cular disease or disorder, inflammation, a disease or disorder tion of a Sirtuin (SIRT) in patients suffering from or at risk of associated with ectopic lipid storage, a disease or disorder developing diseases or disorders associated with Sirtuin associated with oxidative stress, a disease or disorder associ (SIRT). ated with cellular stress, a disease or disorder associated with I0129. In embodiments of the present invention, therapeu neuronal cell death, aging or other condition characterized by tic and/or cosmetic regimes and related tailored treatments unwanted cell loss, degenerative syndrome, a disease or dis are provided to subjects requiring skin treatments or at risk of order associated with ammonia detoxification, aging, a dis developing conditions for which they would require skin ease or disorder associated with dysfunction, a dis treatments. Diagnosis can be made, e.g., based on the Sub ease or disorder associated with impaired chromatin jects SIRT status. A patient's SIRT expression levels in a regulation, a disease or disorder associated with premature given tissue such as skin can be determined by methods , a disease or disorder associated with known to those of skill in the art and described elsewhere impared SIRT mediated DNA repair and a condition charac herein, e.g., by analyzing tissue using PCR or antibody-based terized by unwanted cell loss. detection methods. 0127 Sirtuins have been reported to regulate TNF-alpha 0.130. A preferred embodiment of the present invention activity, as described in, e.g., U.S. Pat. App. Pub. No. 2010/ provides a composition for skin treatment and/or a cosmetic 0.137345, "Prophylactic and therapeutic use of sirtuin inhibi application comprising SIRT antisense oligonucleotides, tors in TNF-alpha mediated pathologies, incorporated herein e.g., to upregulate expression of SIRT in the skin. Examples by reference in its entirety. In embodiments antisense oligo of antisense oligonucleotides are set forth as SEQID NOS: 24 nucleotides of the present invention are used to modulate to 127. U.S. Pat. No. 7,544.497, “Compositions for manipu Sirtuins, e.g., SIRT6, to treat TNP-alpha-mediated disorders lating the lifespan and stress response of cells and organisms.” or diseases. TNF-alpha-mediated disorders or diseases incorporated herein by reference, describes potential cos include, e.g., ankylosing spondylitis, atherosclerosis, inflam metic use for agents that modulate Sirtuin activity by reduc matory bowel disease (IBD) including Crohn's disease and ing the K of the Sirtuin protein for its substrate. In embodi ulcerative colitis, psoriasis, psoriatic arthritis, or rheumatoid ments, cells are treated in vivo with the oligonucleotides of arthritis, cachexia, Gram-negative sepsis, endotoxin-induced the present invention, to increase cell lifespan or prevent shock, septic shock syndrome, systemic inflammatory apoptosis. For example, skin can be protected from aging, response syndrome (SIRS) or multiple organ dysfunction e.g., developing wrinkles, by treating skin, e.g., epithelial syndrome (MODS); and/or graft versus host pathologies, cells, as described herein. In an exemplary embodiment, skin including graft versus host disease (GVHD) and rejection of is contacted with a pharmaceutical or cosmetic composition transplanted Xenogenic or allogeneic tissues or organs; and/or comprising a SIRT antisense compound as described herein. acute or chronic infectious or parasitic processes, including Exemplary skin afflictions or skin conditions include disor viral, bacterial or fungal, infections and protozoan or meta ders or diseases associated with or caused by inflammation, Zoan parasite infections, preferably cerebral malaria or men Sun damage or natural aging. For example, the compositions ingococcal meningitis; and/or allergic disorders, including find utility in the prevention or treatment of contact dermatitis allergic rhinitis, allergic conjunctivitis, asthma, eczema, urti (including irritant contact dermatitis and allergic contact der caria, contact dermatitis, systemicallergic response (anaphy matitis), atopic dermatitis (also known as allergic eczema), laxis) and anaphylactic shock, allergic rhinitis or asthma, actinic keratosis, keratinization disorders (including acute disseminated encephalomyelitis (ADEM); Addison's eczema), epidermolysis bullosa diseases (including penfi disease; ankylosing spondylitis; antiphospholipid antibody gus), exfoliative dermatitis, seborrheic dermatitis, erythemas syndrome (APS); aplastic anemia; atherosclerosis; autoim (including erythema multiforme and erythema nodosum), mune gastritis; autoimmune hepatitis; autoimmune thromb damage caused by the Sun or other light Sources, discoid lupus ocytopenia; Behcet’s disease; coeliac disease; dermatomyo erythematosus, dermatomyositis, skin cancer and the effects sitis; diabetes mellitus type I: diabetes mellitus type II; of natural aging. familial Mediterranean fever, familial cold-induced autoin I0131 Sirtuin has been reported to interfere with dihy flammatory syndrome; Goodpasture’s syndrome; gout: drotestosterone-induced androgen receptor signaling. (See, pseudogout: Graves' disease; Guillain-Barre Syndrome e.g., Fu, et al., 2006, "Hormonal Control of Androgen Recep (GBS); Hashimoto's disease; hereditary periodic fevers; idio tor Function through SIRT1. Molecular and Cellular Biol pathic thrombocytopenic purpura; inflammatory bowel dis ogy 26(21): 8122-8135, incorporated herein by reference.) In ease (IBD) including Crohn's disease and ulcerative colitis; embodiments of the present invention, a composition com ischemia-; Kawasaki's disease; mixed con prising SIRT antisense oligonucleotides, e.g., to upregulate nective tissue disease; Muckle-Wells syndrome; multiple expression of SIRT in the scalp and inhibit androgen receptor Sclerosis (MS); myasthenia gravis; opSoclonus myoclonus signaling, thereby preventing androgenetic alopecia (hair US 2015/0284724 A1 Oct. 8, 2015

loss). In embodiments, a patient Suffering from alopecia is or semisolid emulsions, either oil-in-water or water-in-oil. administered either a topical or systemic formulation. In an Cream bases are water-washable, and contain an oil phase, an embodiment, an antisense oligonucleotide described herein is emulsifier and an aqueous phase. The oil phase is generally incorporated into a topical formulation containing a topical comprised of petrolatum and a fatty alcohol Such as cetyl or carrier that is generally Suited to topical drug administration Stearyl alcohol; the aqueous phase usually, although not nec and comprising any Such material known in the art. The essarily, exceeds the oil phase in Volume, and generally con topical carrier may be selected so as to provide the composi tains a humectant. The emulsifier in a cream formulation as tion in the desired form, e.g., as an ointment, lotion, cream, explained in Remington's, Supra, is generally a nonionic, microemulsion, gel, oil, Solution, or the like, and may be anionic, cationic or amphoteric Surfactant. comprised of a material of either naturally occurring or Syn 0.135 Antisense oligonucleotides of the invention may be thetic origin. It is preferable that the selected carrier not incorporated into microemulsions, which generally are ther adversely affect the active agent or other components of the modynamically stable, isotropically clear dispersions of two topical formulation. Examples of suitable topical carriers for immiscible liquids, such as oil and water, Stabilized by an use herein include water, alcohols and other nontoxic organic interfacial film of surfactant molecules (Encyclopedia of Solvents, glycerin, mineral oil, silicone, petroleum jelly, lano Pharmaceutical Technology (New York: Marcel Dekker, lin, fatty acids, vegetable oils, parabens, waxes, and the like. 1992), volume 9). For the preparation of microemulsions, Formulations may be colorless, odorless ointments, lotions, Surfactant (emulsifier), co-surfactant (co-emulsifier), an oil creams, microemulsions and gels. phase and a water phase are necessary. Suitable surfactants 0132 Antisense oligonucleotides of the invention may be include any Surfactants that are useful in the preparation of incorporated into ointments, which generally are semisolid emulsions, e.g., emulsifiers that are typically used in the preparations which are typically based on petrolatum or other preparation of creams. The co-surfactant (or “co-emulsifier) petroleum derivatives. The specific ointment base to be used, is generally selected from the group of polyglycerol deriva as will be appreciated by those skilled in the art, is one that tives, glycerol derivatives and fatty alcohols. Preferred emul will provide for optimum drug delivery, and, preferably, will sifier/co-emulsifier combinations are generally although not provide for other desired characteristics as well e.g., emol necessarily selected from the group consisting of glyceryl liency or the like. As with other carriers or vehicles, an oint monostearate and polyoxyethylene Stearate; polyethylene ment base should be inert, stable, nonirritating and nonsen glycol and ethylene glycol palmitostearate; and caprilic and sitizing. As explained in Remington’s Pharmaceutical capric triglycerides and oleoyl macrogolglycerides. The Sciences (Mack Pub. Co.), ointment bases may be grouped water phase includes not only water but also, typically, buff into four classes: oleaginous bases; emulsifiable bases; emul ers, glucose, propylene glycol, polyethylene glycols, prefer sion bases; and water-soluble bases. Oleaginous ointment ably lower molecular weight polyethylene glycols (e.g., PEG bases include, for example, vegetable oils, obtained from 300 and PEG 400), and/or glycerol, and the like, while the oil animals, and semisolid hydrocarbons obtained from petro phase will generally comprise, for example, fatty acid esters, leum. Emulsifiable ointment bases, also known as absorbent modified vegetable oils, silicone oils, mixtures of mono- di ointment bases, contain little or no water and include, for and triglycerides, mono and di-esters of PEG (e.g., oleoyl example, hydroxyStearin Sulfate, anhydrous lanolin and macrogol glycerides), etc. hydrophilic petrolatum. Emulsion ointment bases are either 0.136 Antisense oligonucleotides of the invention may be water-in-oil (W/O) emulsions or oil-in-water (O/W) emul incorporated into gel formulations, which generally are semi sions, and include, for example, cetyl alcohol, glyceryl Solid systems consisting of either Suspensions made up of monostearate, lanolin and Stearic acid. Exemplary water Small inorganic particles (two-phase systems) or large soluble ointment bases are prepared from polyethylene gly organic molecules distributed Substantially uniformly cols (PEGs) of varying molecular weight (see, e.g., Reming throughout a carrier liquid (single phase gels). Single phase tons, Supra). gels can be made, for example, by combining the active agent, 0.133 Antisense oligonucleotides of the invention may be a carrier liquid and a suitable gelling agent Such as tragacanth incorporated into lotions, which generally are preparations to (at 2 to 5%), sodium alginate (at 2-10%), gelatin (at 2-15%), be applied to the skin surface without friction, and are typi methylcellulose (at 3-5%), sodium carboxymethylcellulose cally liquid or semiliquid preparations in which solid par (at 2-5%), carbomer (at 0.3-5%) or polyvinyl alcohol (at ticles, including the active agent, are present in a water or 10-20%) together and mixing until a characteristic semisolid alcohol base. Lotions are usually suspensions of Solids, and product is produced. Other Suitable gelling agents, include may comprise a liquid oily emulsion of the oil-in-water type. methylhydroxycellulose, polyoxyethylene-polyoxypropy Lotions are preferred formulations for treating large body lene, hydroxyethylcellulose and gelatin. Although gels com areas, because of the case of applying a more fluid composi monly employ aqueous carrier liquid, alcohols and oils can be tion. It is generally necessary that the insoluble matter in a used as the carrier liquid as well. lotion be finely divided. Lotions will typically contain sus 0.137 Various additives, known to those skilled in the art, pending agents to produce better dispersions as well as com may be included in formulations, e.g., topical formulations. pounds useful for localizing and holding the active agent in Examples of additives include, but are not limited to, solubi contact with the skin, e.g., methylcellulose, sodium car lizers, skin permeation enhancers, opacifiers, preservatives boxymethylcellulose, or the like. An exemplary lotion formu (e.g., anti-oxidants), gelling agents, buffering agents, Surfac lation for use in conjunction with the present method contains tants (particularly nonionic and amphoteric Surfactants), propylene glycol mixed with a hydrophilic petrolatum such as emulsifiers, emollients, thickening agents, stabilizers, that which may be obtained under the trademark Aquaphor(R) humectants, colorants, fragrance, and the like. Inclusion of from Beiersdorf, Inc. (Norwalk, Conn.). solubilizers and/or skin permeation enhancers is particularly 0134) Antisense oligonucleotides of the invention may be preferred, along with emulsifiers, emollients and preserva incorporated into creams, which generally are viscous liquid tives. An optimum topical formulation comprises approxi US 2015/0284724 A1 Oct. 8, 2015 mately: 2 wt.% to 60 wt.%, preferably 2 wt.% to 50 wt.% (SIRT) polynucleotides alone but extends to any of the iso solubilizer and/or skin permeation enhancer; 2 wt.% to 50 wt. forms, receptors, homologs, non-coding regions and the like %, preferably 2 wt.% to 20 wt.%, emulsifiers; 2 wt.% to 20 of a Sirtuin (SIRT). wt.% emollient; and 0.01 to 0.2 wt.% preservative, with the 0144. In another embodiment, an oligonucleotide targets a active agent and carrier (e.g., water) making of the remainder natural antisense sequence (natural antisense to the coding of the formulation. and non-coding regions) of a Sirtuin (SIRT) targets, includ 0138 A skin permeation enhancer serves to facilitate pas ing, without limitation, variants, alleles, homology mutants, sage of therapeutic levels of active agent to pass through a derivatives, fragments and complementary sequences reasonably sized area of unbroken skin. Suitable enhancers thereto. Preferably the oligonucleotide is an antisense RNA are well known in the art and include, for example: lower or DNA molecule. alkanols such as methanol ethanol and 2-propanol; alkyl 0145. In another embodiment, the oligomeric compounds methyl sulfoxides such as dimethylsulfoxide (DMSO), of the present invention also include variants in which a decylmethylsulfoxide (C. sub.10 MSO) and tetradecylmethyl different base is present at one or more of the nucleotide sulfboxide:pyrrolidones such as 2-pyrrolidone, N-methyl-2- positions in the compound. For example, if the first nucleotide pyrrolidone and N-(-hydroxyethyl)pyrrolidone; urea; N.N- is an adenine, variants may be produced which contain thy diethyl-m-toluamide: C. sub.2-C. Sub.6 alkanediols; miscella midine, guanosine, cytidine or other natural or unnatural neous solvents such as dimethyl formamide (DMF), N.N- nucleotides at this position. This may be done at any of the dimethylactamide (DNA) and tetrahydrofurfuryl alcohol: positions of the antisense compound. and the 1-substituted azacycloheptan-2-ones, particularly 0146 In some embodiments, homology, sequence identity 1-n-dodecylcyclazacycloheptan-2-one (laurocapram; avail or complementarity, between the antisense compound and able under the trademark AZone(R) from Whitby Research target is from about 50% to about 60%. In some embodi Incorporated, Richmond, Va.). ments, homology, sequence identity or complementarity, is 0139 Examples of solubilizers include, but are not limited from about 60% to about 70%. In some embodiments, homol to, the following: hydrophilic ethers such as diethylene glycol ogy, sequence identity or complementarity, is from about monoethyl ether (ethoxydiglycol, available commercially as 70% to about 80%. In some embodiments, homology, Transcutol R) and diethylene glycol monoethyl ether oleate sequence identity or complementarity, is from about 80% to (available commercially as SoficutolR); polyethylene castor about 90%. In some embodiments, homology, sequence iden oil derivatives such as polyoxy 35 castor oil, polyoxy 40 tity or complementarity, is about 90%, about 92%, about hydrogenated castor oil, etc.; polyethylene glycol, particu 94%, about 95%, about 96%, about 97%, about 98%, about larly lower molecular weight polyethylene glycols such as 99% or about 100%. PEG 300 and PEG 400, and polyethylene glycol derivatives 0147 An antisense compound is specifically hybridizable such as PEG-8 caprylic/capric glycerides (available commer when binding of the compound to the target nucleic acid cially as Labrasol(R); alkyl methylsulfoxides such as DMSO; interferes with the normal function of the target nucleic acid pyrrolidones Such as 2-pyrrolidone and N-methyl-2-pyrroli to cause a loss of activity, and there is a Sufficient degree of done; and DMA. Many solubilizers can also act as absorption complementarity to avoid non-specific binding of the anti enhancers. A single solubilizer may be incorporated into the sense compound to non-target nucleic acid sequences under formulation, or a mixture of solubilizers may be incorporated conditions in which specific binding is desired. Such condi therein. tions include, i.e., physiological conditions in the case of in 0140) Suitable emulsifiers and co-emulsifiers include, Vivo assays or therapeutic treatment, and conditions in which without limitation, those emulsifiers and co-emulsifiers assays are performed in the case of in vitro assays. described with respect to microemulsion formulations. Emol 0.148. An antisense compound, whether DNA, RNA, chi lients include, for example, propylene glycol, glycerol, iso meric, substituted etc., is specifically hybridizable when bind propyl myristate, polypropylene glycol-2 (PPG-2) myristyl ing of the compound to the target DNA or RNA molecule ether propionate, and the like. interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a Sufficient degree of 0141. Other active agents may also be included in formu complementarity to avoid non-specific binding of the anti lations, e.g., other anti-inflammatory agents, analgesics, anti sense compound to non-target sequences under conditions in microbial agents, antifungal agents, antibiotics, vitamins, which specific binding is desired, i.e., under physiological antioxidants, and Sunblock agents commonly found in Sun conditions in the case of in vivo assays or therapeutic treat screen formulations including, but not limited to, anthra ment, and in the case of in vitro assays, under conditions in nilates, benzophenones (particularly benzophenone-3), cam which the assays are performed. phor derivatives, cinnamates (e.g., octyl methoxycinnamate), 0149. In another embodiment, targeting of a Sirtuin dibenzoyl methanes (e.g., butyl methoxydibenzoyl methane), (SIRT) including without limitation, antisense sequences p-aminobenzoic acid (PABA) and derivatives thereof, and which are identified and expanded, using for example, PCR, salicylates (e.g., octyl salicylate). hybridization etc., one or more of the sequences set forth as 0142. In one embodiment, the oligonucleotides are spe SEQ ID NO:9 to 23, 141 to 143, and the like, modulate the cific for polynucleotides of a Sirtuin (SIRT), which includes, expression or function of a Sirtuin (SIRT). in one embodi without limitation noncoding regions. The Sirtuin (SIRT) ment, expression or function is up-regulated as compared to a targets comprise variants of a Sirtuin (SIRT); mutants of a control. In another embodiment, expression or function is Sirtuin (SIRT), including SNPs; noncoding sequences of a down-regulated as compared to a control. Sirtuin (SIRT); alleles, fragments and the like. Preferably the 0150. In another embodiment, oligonucleotides comprise oligonucleotide is an antisense RNA molecule. nucleic acid sequences set forth, as SEQ ID NOS: 24 to 127 0143. In accordance with embodiments of the invention, including antisense sequences which are identified and the target nucleic acid molecule is not limited to Sirtuin expanded, using for example, PCR, hybridization, etc. These US 2015/0284724 A1 Oct. 8, 2015

oligonucleotides can comprise one or more modified nucle within a target nucleic acid. “Sites, as used in the present otides, shorter or longer fragments, modified bonds and the invention, are defined as positions withina target nucleic acid. like. Examples of modified bonds or internucleotide linkages 0156. In one embodiment, the antisense oligonucleotides comprise phosphorothioate, phosphorodithioate or the like. bind to the natural antisense sequences of a Sirtuin (SIRT) and In another embodiment, the nucleotides comprise a phospho modulate the expression and/or function of a Sirtuin (SIRT) rus derivative. The phosphorus derivative (or modified phos (SEQID NO: 1 to 23 and 133 to 143). Examples of antisense phate group) which may be attached to the Sugar or Sugar sequences include SEQID NOS: 24 to 127. analog moiety in the modified oligonucleotides of the present 0157. In another embodiment, the antisense oligonucle invention may be a monophosphate, diphosphate, triphos otides bind to one or more segments of a Sirtuin (SIRT) phate, alkylphosphate, alkanephosphate, phosphorothioate polynucleotide and modulate the expression and/or function and the like. The preparation of the above-noted phosphate of a Sirtuin (SIRT). The segments comprise at least five analogs, and their incorporation into nucleotides, modified consecutive nucleotides of a Sirtuin (SIRT) sense or antisense nucleotides and oligonucleotides, per se, is also known and polynucleotides. need not be described here. 0158. In another embodiment, the antisense oligonucle 0151. The specificity and sensitivity of antisense is also otides are specific for natural antisense sequences of a Sirtuin harnessed by those of skill in the art for therapeutic uses. (SIRT) wherein binding of the oligonucleotides to the natural Antisense oligonucleotides have been employed as therapeu antisense sequences of a Sirtuin (SIRT) modulate expression tic moieties in the treatment of disease states in animals and and/or function of a Sirtuin (SIRT). man. Antisense oligonucleotides have been safely and effec 0159. In another embodiment, oligonucleotide com tively administered to humans and numerous clinical trials pounds comprise sequences set forth as SEQID NOS: 24 to are presently underway. It is thus established that oligonucle 127, antisense sequences which are identified and expanded, otides can be useful therapeutic modalities that can be con using for example, PCR, hybridization, etc. These oligo figured to be useful in treatment regimes for treatment of nucleotides can comprise one or more modified nucleotides, cells, tissues and animals, especially humans. shorter or longer fragments, modified bonds and the like. 0152. In embodiments of the present invention oligomeric Examples of modified bonds or internucleotide linkages com antisense compounds, particularly oligonucleotides, bind to prise phosphorothioate, phosphorodithioate or the like. In target nucleic acid molecules and modulate the expression another embodiment, the nucleotides comprise a phosphorus and/or function of molecules encoded by a target gene. The derivative. The phosphorus derivative (or modified phosphate functions of DNA to be interfered comprise, for example, group) which may be attached to the Sugar or Sugar analog replication and transcription. The functions of RNA to be moiety in the modified oligonucleotides of the present inven interfered comprise all vital functions such as, for example, tion may be a monophosphate, diphosphate, triphosphate, translocation of the RNA to the site of protein translation, alkylphosphate, alkanephosphate, phosphorothioate and the translation of protein from the RNA, splicing of the RNA to like. The preparation of the above-noted phosphate analogs, yield one or more mRNA species, and catalytic activity which and their incorporation into nucleotides, modified nucle may be engaged in or facilitated by the RNA. The functions otides and oligonucleotides, per se, is also known and need may be unregulated or inhibited depending on the functions not be described here. desired. (0160 Since, as is known in the art, the translation initia 0153. The antisense compounds, include, antisense oligo tion codon is typically 5'-AUG (in transcribed mRNA mol meric compounds, antisense oligonucleotides, external guide ecules; 5'-ATG in the corresponding DNA molecule), the sequence (EGS) oligonucleotides, alternate splicers, primers, translation initiation codon is also referred to as the AUG probes, and other oligomeric compounds that hybridize to at codon, the “start codon’ or the AUG start codon’. A minor least a portion of the target nucleic acid. As such, these com ity of genes has a translation initiation codon having the RNA pounds may be introduced in the form of single-stranded, sequence 5'-GUG, 5'-UUG or 5'-CUG.; and 5'-AUA, 5'-ACG double-stranded, partially single-stranded, or circular oligo and 5'-CUG have been shown to function in vivo. Thus, the meric compounds. terms “translation initiation codon’ and “start codon’ can 0154 Targeting an antisense compound to a particular encompass many codon sequences, even though the initiator nucleic acid molecule, in the context of this invention, can be amino acid in each instance is typically methionine (in a multistep process. The process usually begins with the eukaryotes) or formylmethionine (in prokaryotes). Eukary identification of a target nucleic acid whose function is to be otic and prokaryotic genes may have two or more alternative modulated. This target nucleic acid may be, for example, a start codons, any one of which may be preferentially utilized cellular gene (or mRNA transcribed from the gene) whose for translation initiation in a particular cell type or tissue, or expression is associated with a particular disorder or disease under a particular set of conditions. In the context of the state, or a nucleic acid molecule from an infectious agent. In invention, “start codon’ and “translation initiation codon’ the present invention, the target nucleic acid encodes a Sirtuin refer to the codon or codons that are used in vivo to initiate (SIRT). translation of an mRNA transcribed from a gene encoding a 0155 The targeting process usually also includes determi Sirtuin (SIRT), regardless of the sequence(s) of such codons. nation of at least one target region, segment, or site within the A translation termination codon (or 'stop codon”) of a gene target nucleic acid for the antisense interaction, to occur Such may have one of three sequences, i.e., 5'-UAA, 5'-UAG and that the desired effect, e.g., modulation of expression, will 5'-UGA (the corresponding DNA sequences are 5'-TAA, result. Within the context of the present invention, the term 5'-TAG and 5'-TGA, respectively). “region' is defined as a portion of the target nucleic acid 0.161 The terms “start codon region' and “translation ini having at least one identifiable structure, function, or charac tiation codon region” refer to a portion of such an mRNA or teristic. Within regions of target nucleic acids are segments. gene that, encompasses from about 25 to about 50 contiguous 'Segments' are defined as Smaller or Sub-portions of regions nucleotides in either direction (i.e., 5' or 3') from a translation US 2015/0284724 A1 Oct. 8, 2015

initiation codon. Similarly, the terms "stop codon region' and 0166 In another embodiment, the antisense oligonucle “translation termination codon region” refer to a portion of otides bind to coding and/or non-coding regions of a target Such an mRNA or gene that encompasses from about 25 to polynucleotide and modulate the expression and/or function about 50 contiguous nucleotides in either direction (i.e., 5' or of the target molecule. 3') from a translation termination codon. Consequently, the 0167. In another embodiment, the antisense oligonucle “start codon region’ (or “translation initiation codon region') otides bind to natural antisense polynucleotides and modulate and the 'stop codon region’ (or “translation termination the expression and/or function of the target molecule. codon region') are all regions that may be targeted effectively 0.168. In another embodiment, the antisense oligonucle with the antisense compounds of the present invention. otides bind to sense polynucleotides and modulate the expres 0162 The open reading frame (ORF) or “coding region.” sion and/or function of the target molecule. which is known in the art to refer to the region between the 0169. Alternative RNA transcripts can be produced from translation initiation codon and the translation termination the same genomic region of DNA. These alternative tran codon, is also a region which may be targeted effectively. Scripts are generally known as “variants'. More specifically, Within the context of the present invention, a targeted region “pre-mRNA variants' are transcripts produced from the same is the intragenic region encompassing the translation initia genomic DNA that differ from other transcripts produced tion or termination codon of the open reading frame (ORF) of from the same genomic DNA in either their start or stop a gene. position and contain both intronic and exonic sequence. 0170 Upon excision of one or more exon or intron 0163 Another target region includes the 5' untranslated regions, or portions thereof during splicing, pre-mRNA vari region (5' UTR), known in the art to refer to the portion of an ants produce smaller “mRNA variants”. Consequently, mRNA in the 5' direction from the translation initiation mRNA variants are processed pre-mRNA variants and each codon, and thus including nucleotides between the 5' cap site unique pre-mRNA variant must always produce a unique and the translation initiation codon of an mRNA (or corre mRNA variant as a result of splicing. These mRNA variants sponding nucleotides on the gene). Still another target region are also known as 'alternative splice variants. If no splicing includes the 3' untranslated region (3'UTR), known in the art of the pre-mRNA variant occurs then the pre-mRNA variant to refer to the portion of an mRNA in the 3' direction from the is identical to the mRNA variant. translation termination codon, and thus including nucleotides 0171 Variants can be produced through the use of alter between the translation termination codon and 3' end of an native signals to start or stop transcription. Pre-mRNAS and mRNA (or corresponding nucleotides on the gene). The 5' cap mRNAs can possess more than one start codon or stop codon. site of an mRNA comprises an N7-methylated guanosine Variants that originate from a pre-mRNA or mRNA that use residue joined to the 5'-most residue of the mRNA via a 5'-5' alternative start codons are known as “alternative start Vari triphosphate linkage. The 5' cap region of an mRNA is con ants of that pre-mRNA or mRNA. Those transcripts that use sidered to include the 5' cap structure itself as well as the first an alternative stop codon are known as 'alternative stop vari 50 nucleotides adjacent to the cap site. Another target region ants of that pre-mRNA or mRNA. One specific type of for this invention is the 5' cap region. alternative stop variant is the “polyA variant in which the 0164. Other target regions of SIRT1 comprise nucleotides multiple transcripts produced result from the alternative 65 to 85, and 221 to 253 of the antisense transcript selection of one of the “polyA stop signals' by the transcrip CV396200. In embodiments, methods of modulating a func tion machinery, thereby producing transcripts that terminate tion of and/or expression of a SIRT1 polynucleotide comprise at unique polyA sites. Within the context of the invention, the contacting cells or tissues with at least one antisense oligo types of variants described herein are also embodiments of nucleotide that targets one or more of these regions, in part or target nucleic acids. in whole. In certain embodiments, a combination of antisense 0172. The locations on the target nucleic acid to which the oligonucleotides that target one or more of these regions, and antisense compounds hybridize are defined as at least a one or more antisense transcripts that target other Sirtuins, are 5-nucleotide long portion of a target region to which an active used. In embodiments, multiple antisense oligonucleotides antisense compound is targeted. targeting different regions of a SIRT are used in combination, 0173 While the specific sequences of certain exemplary or multiple antisense oligonucleotides targeting one or more target segments are set forth herein, one of skill in the art will different Sirtuins are administered in combination. recognize that these serve to illustrate and describe particular 0.165 Although some eukaryotic mRNA transcripts are embodiments within the scope of the present invention. Addi directly translated, many contain one or more regions, known tional target segments are readily identifiable by one having as “introns,” which are excised from a transcript before it is ordinary skill in the art in view of this disclosure. translated. The remaining (and therefore translated) regions 0.174 Target segments 5-100 nucleotides in length com are known as “exons' and are spliced together to form a prising a stretch of at least five (5) consecutive nucleotides continuous mRNA sequence. In one embodiment, targeting selected from within the illustrative target segments are con splice sites, i.e., intron-exon junctions or exon-intron junc sidered to be suitable for targeting as well. tions, is particularly useful in situations where aberrant splic 0.175 Target segments can include DNA or RNA ing is implicated in disease, or where an overproduction of a sequences that comprise at least the 5 consecutive nucleotides particular splice product is implicated in disease. Anaberrant from the 5'-terminus of one of the illustrative target segments fusion junction due to rearrangement or deletion is another (the remaining nucleotides being a consecutive stretch of she embodiment of a target site. mRNA transcripts produced via same DNA or RNA beginning immediately upstream of the the process of splicing of two (or more) mRNAs from differ 5'-terminus of the target segment and continuing until the ent gene Sources are known as “fusion transcripts”. Introns DNA or RNA contains about 5 to about 100 nucleotides). can be effectively targeted using antisense compounds tar Similarly target segments are represented by DNA or RNA geted to, for example, DNA or pre-mRNA. sequences that comprise at least the 5 consecutive nucleotides US 2015/0284724 A1 Oct. 8, 2015

from the 3'-terminus of one of the illustrative target segments and that either category is capable of regulating the corre (the remaining nucleotides being a consecutive stretch of the sponding sense transcripts—either in a concordant or discon same DNA or RNA beginning immediately downstream of cordant manner. The strategies that are employed in identify the 3'-terminus of the target segment and continuing until the ing new oligonucleotides for use against a target can be based DNA or RNA contains about 5 to about 100 nucleotides). One on the knockdown of antisense RNA transcripts by antisense having skill in the art armed with the target segments illus oligonucleotides or any other means of modulating the trated herein will be able, without undue experimentation, to desired target. identify further target segments. 0181 Strategy 1: In the case of discordant regulation, 0176 Once one or more target regions, segments or sites knocking down the antisense transcript elevates the expres have been identified, antisense compounds are chosen which sion of the conventional (sense) gene. Should that latter gene are sufficiently complementary to the target, i.e., hybridize for a known or putative drug target, then knockdown sufficiently well and with sufficient specificity, to give the of its antisense counterpart could conceivably mimic the desired effect. action of a receptor agonist or an enzyme stimulant. 0177. In embodiments of the invention the oligonucle otides bind to an antisense Strand of a particular target. The 0182 Strategy 2: In the case of concordant regulation, one oligonucleotides are at least 5 nucleotides in length and can be could concomitantly knock down both antisense and sense synthesized so each oligonucleotide targets overlapping transcripts and thereby achieve Synergistic reduction of the sequences such that oligonucleotides are synthesized to cover conventional (sense) gene expression. If for example, at anti the entire length of the target polynucleotide. The targets also sense oligonucleotide is used to achieve knockdown, then this include coding as well as non coding regions. strategy can be used to apply one antisense oligonucleotide 0178. In one embodiment, specific nucleic acids are tar targeted to the sense transcript and another antisense oligo geted by antisense oligonucleotides. Targeting an antisense nucleotide to the corresponding antisense transcript, or a compound to a particular nucleic acid, is a multistep process. single energetically symmetric antisense oligonucleotide that The process usually begins with the identification of a nucleic simultaneously targets overlapping sense and antisense tran acid sequence whose function is to be modulated. This may Scripts. be, for example, a cellular gene (or mRNA transcribed from 0183. According to the present invention, antisense com the gene) whose expression is associated with a particular pounds include antisense oligonucleotides, ribozymes, exter disorder or disease state, or a non coding polynucleotide Such nal guide sequence (EGS) oligonucleotides, siRNA com as for example, non coding RNA (mRNA). pounds, single- or double-stranded RNA interference (RNAi) 0179 RNAs can be classified into (1) messenger RNAs compounds such as siRNA compounds, and other oligomeric (mRNAS), which are translated into proteins, and (2) non compounds which hybridize to at least a portion of the target protein-coding RNAs (ncRNAs). IncRNAs comprise microR nucleic acid and modulate its function. As such, they may be NAS, antisense transcripts and other Transcriptional Units DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or (TU) containing a high density of stop codons and lacking any may be mimetics of one or more of these. These compounds extensive “Open Reading Frame'. Many ncRNAs appear to may be single-stranded, doublestranded, circular or hairpin start from initiation sites in 3' untranslated regions (3'UTRs) oligomeric compounds and may contain structural elements of protein-coding loci.ncRNAs are often rare and at least half Such as internal or terminal bulges, mismatches or loops. of the nckNAs that have been sequenced by the FANTOM Antisense compounds are routinely prepared linearly but can consortium seem not to be polyadenylated. Most researchers be joined or otherwise prepared to be circular and/or have for obvious reasons focused on polyadenylated mRNAs branched. Antisense compounds can include constructs Such that are processed and exported to the cytoplasm. Recently, it as, for example, two strands hybridized to form a wholly or was shown that the set of non-polyadenylated nuclear RNAs partially double-stranded compound or a single strand with may be very large, and that many Such transcripts arise from sufficient self-complementarity to allow for hybridization intergenic regions. The mechanism by which incRNAS may and formation of a fully or partially double-stranded com regulate gene expression is by base pairing with target tran pound. The two strands can be linked internally leaving free 3' scripts. The RNAs that function by base pairing can be or 5' termini or can be linked to form a continuous hairpin grouped into (1) cis encoded RNAs that are encoded at the structure or loop. The hairpin structure may contain an over same genetic location, but on the opposite strand to the RNAS hang on either the 5' or 3' terminus producing an extension of they act upon and therefore display perfect complementarity single Stranded character. The double stranded compounds to their target, and (2) trans-encoded RNAs that are encoded optionally can include overhangs on the ends. Further modi at a chromosomal location distinct from the RNAs they act fications can include conjugate groups attached to one of the upon and generally do not exhibit perfect base-pairing poten termini, selected nucleotide positions, Sugar positions or to tial with their targets. one of the internucleoside linkages. Alternatively, the two 0180. Without wishing to be bound by theory, perturbation Strands can be linked via a non-nucleic acid moiety or linker of an antisense polynucleotide by the antisense oligonucle group. When formed from only one strand, dsRNA can take otides described herein can alter the expression of the corre the form of a self-complementary hairpin-type molecule that sponding sense messenger RNAS. However, this regulation doubles back on itself to forma duplex. Thus, the dsRNAs can can either be discordant (antisense knockdown results in mes be fully or partially double stranded. Specific modulation of senger RNA elevation) or concordant (antisense knockdown gene expression can be achieved by stable expression of results in concomitant messenger RNA reduction). In these dsRNA hairpins in transgenic cell lines, however, in some cases, antisense oligonucleotides can be targeted to overlap embodiments, the gene expression or function is up regulated. ping or non-overlapping parts of the antisense transcript When formed from two strands, or a single strand that takes resulting in its knockdown or sequestration. Coding as well as the form of a self-complementary hairpin-type molecule non-coding antisense can be targeted in an identical manner doubled back on itself to form a duplex, the two stands (or US 2015/0284724 A1 Oct. 8, 2015 duplex-forming regions of a single strand) are complemen (SIRT) polynucleotide, the modulator may then be employed tary RNA strands that in Watson-Crick fashion. in further investigative studies of the function of a Sirtuin 0184. Once introduced to a system, the compounds of the (SIRT) polynucleotide, or for use as a research, diagnostic, or invention may elicit the action of one or more enzymes or therapeutic agent in accordance with the present invention. structural proteins to effect cleavage or other modification of 0189 Targeting the natural antisense sequence modulates the target nucleic acid or may work via occupancy-based the function of the target gene. For example, the Sirtuin mechanisms. In general, nucleic acids (including oligonucle (SIRT) (e.g. accession numbers NM 12238.4, otides) may be described as “DNA-like' (i.e., generally hav NM 001159589, NM 012237.3, NM 012239, ing one or more 2'-deoxy Sugars and, generally, T rather than NM 012240, NM 012241, NM 016539, NM 016538, U bases) or “RNA-like' (i.e., generally having one or more NM 101142498.1, NM 030593.2, NM 001 193286.1, 2'-hydroxyl or 2'-modified Sugars and, generally Urather than NR 034146.1, NM 001017524.2, NM 031244.2, Tbases). Nucleic acid helices can adopt more than one type of NM 001 193267.1, NM 001 193285.1). In an embodiment, structure, most commonly the A- and B-forms. It is believed the target, is an antisense polynucleotide of the Sirtuin that, in general, oligonucleotides which have B-form-like (SIRT). In an embodiment, an antisense oligonucleotide tar structure are “DNA-like' and those which have A-formlike gets sense and/or natural antisense sequences of a Sirtuin structure are “RNA-like.” In some (chimeric) embodiments, (SIRT) polynucleotide (e.g. accession numbers an antisense compound may contain both A- and B-form NM 012238.4, NM 001159589. NM 012237.3, regions. NM 012239, NM 012240, NM 012241, NM 016539, 0185. In another embodiment, the desired oligonucle NM 016538, NM 001142498.1, NM 030593.2, otides or antisense compounds, comprise at least one of NM 00193286.1, NR 034146.1, NM 001017524.2, antisense RNA, antisense DNA, chimeric antisense oligo NM 031244.2, NM 001 193267.1, NM 001 193285.1), nucleotides, antisense oligonucleotides comprising modified variants, alleles, isoforms, homologs, mutants, derivatives, linkages, interference RNA (RNAi), short interfering RNA fragments and complementary sequences thereto. Preferably (siRNA); a micro, interfering RNA (miRNA); a small, tem the oligonucleotide is an antisense molecule and the targets poral RNA (stRNA); or a short, hairpin RNA (shRNA); small include coding and noncoding regions of antisense and/or RNA-induced gene activation (RNAs); small activating sense Sirtuin (SIRT) polynucleotides. RNAs (saRNAs), or combinations thereof. 0190. The target segments of the present invention may be 0186 dsRNA can also activate gene expression, a mecha also be combined with their respective complementary anti nism that has been termed “small RNA-induced gene activa sense compounds of the present invention to form stabilized tion” or RNAa. dsRNAs targeting gene promoters induce double-stranded (duplexed) oligonucleotides. potent transcriptional activation of associated genes. RNAa 0191 Such double stranded oligonucleotide moieties have was demonstrated in human cells using synthetic dsRNAS, been shown in the art to modulate target expression and termed “small activating RNAs (saRNAs). regulate translation as well as RNA processing via an anti 0187. Small double-stranded RNA (dsRNA), such as sense mechanism. Moreover, the double-stranded moieties small interfering RNA (siRNA) and microRNA (miRNA) may be subject to chemical modifications. For example, Such have been found to be the trigger of an evolutionary con doable-stranded moieties have been shown to inhibit the tar served mechanism known as RNA interference (RNAi), get by the classical hybridization of antisense strand of the RNAi invariably leads to gene silencing. However, in duplex to the target, thereby triggering enzymatic degrada instances described in detail in the examples section which tion of the target. follows, oligonucleotides are shown to increase the expres 0.192 In an embodiment, an antisense oligonucleotide tar sion and/or function of the Sirtuin (SIRT) polynucleotides gets Sirtuin (SIRT) polynucleotides (e.g. accession numbers and encoded products thereof. dsRNAS may also act as Small NM 012238.4, NM 00159589, NM 012237.3, activating RNAs (saRNA). Without wishing to be bound by NM 012239, NM012240, NM 012241, NM 016539, theory, by targeting sequences in gene promoters, SaRNAS NM 016538, NM 001142498.1, NM 030593.2, would induce target gene expression in a phenomenon NM 00193286.1, NRO34146.1, NM 001017524.2, referred to as dsRNA-induced transcriptional activation NM 031244.2, NM 001 193267.1, NM 001 193285.1), (RNAa). variants, alleles, isoforms, homologs, mutants, derivatives, 0188 In a further embodiment, the “target segments’ fragments and complementary sequences thereto. Preferably identified herein may be employed in a screen for additional the oligonucleotide is an antisense molecule. compounds that modulate the expression of a Sirtuin (SIRT) 0193 In accordance with embodiments of the invention, polynucleotide. “Modulators' are those compounds that the target nucleic acid molecule is not limited to Sirtuin decrease or increase the expression of a nucleic acid molecule (SIRT) alone but extends to any of the isoforms, receptors, encoding a Sirtuin (SIRT) and which comprise at least a homologs and the like of a Sirtuin (SIRT) molecule. 5-nucleotide portion that is complementary to a target seg 0194 In another embodiment, an oligonucleotide targets a ment. The screening method comprises the steps of contact natural antisense sequence of a Sirtuin (SIRT) polynucle ing a target segment of a nucleic acid molecule encoding otide, for example, polynucleotides set forth as SEQID NO: sense or natural antisense polynucleotides of a Sirtuin (SIRT) 9 to 23, 141 to 143, and any variants, alleles, homologs, with one or more candidate modulators, and selecting for one mutants, derivatives, fragments and complementary or more candidate modulators which decrease or increase the sequences thereto. Examples of antisense oligonucleotides expression of a nucleic acid molecule encoding a Sirtuin are set forth as SEQID NOS: 24 to 127. (SIRT) polynucleotide, e.g. SEQID NOS: 24 to 127. Once it 0.195. In one embodiment, the oligonucleotides are is shown that the candidate modulator or modulators are complementary to or bind to nucleic acid sequences of a capable of modulating (e.g. either decreasing or increasing) Sirtuin (SIRT) antisense, including without limitation non the expression of a nucleic acid molecule encoding a Sirtuin coding sense and/or antisense sequences associated with a US 2015/0284724 A1 Oct. 8, 2015

Sirtuin (SIRT) polynucleotide and modulate expression and/ tein. After an enzymatic nucleic acid has bound and cleaved or function of a Sirtuin (SIRT) molecule. its RNA target, it is released from that RNA to search for 0196. In another embodiment, the oligonucleotides are another target and can repeatedly bind and cleave new targets. complementary to or bind to nucleic acid sequences of a 0206. Several approaches such as in vitro selection (evo Sirtuin (SIRT) natural antisense, set forth as SEQID NO:9 to lution) strategies have been used to evolve new nucleic acid 23, 141 to 143 and modulate expression and/or function of a catalysts capable of catalyzing a variety of reactions, such as Sirtuin (SIRT) molecule. cleavage and ligation of phosphodiester linkages and amide 0197) In an embodiment, oligonucleotides comprise linkages. sequences of at least 5 consecutive nucleotides of SEQ ID 0207. The development of ribozymes that are optimal for NOS: 24 to 127 and modulate expression and/or function of a catalytic activity would contribute significantly to any strat Sirtuin (SIRT) molecule. egy that employs RNA-cleaving ribozymes for the purpose of 0198 The polynucleotide targets comprise Sirtuin (SIRT), regulating gene expression. The hammerhead ribozyme, for including family members thereof, variants of a Sirtuin example, functions with a catalytic rate (kcat) of about 1 min-1 (SIRT): mutants of a Sirtuin (SIRT), including SNPs: non in the presence of Saturating (10 mM) concentrations of coding sequences of a Sirtuin (SIRT); alleles of a Sirtuin Mg2+ cofactor. An artificial “RNA ligase' ribozyme has been (SIRT); species variants, fragments and the like. Preferably shown to catalyze the corresponding self-modification reac the oligonucleotide is an antisense molecule. tion witharate of about 100 min-1. In addition, it is known that 0199. In another embodiment, the oligonucleotide target certain modified hammerhead ribozymes that have substrate ing Sirtuin (SIRT) polynucleotides, comprise: antisense binding arms made of DNA catalyze RNA cleavage with RNA, interference RNA (RNAi), short interfering RNA multiple turn-over rates that approach 100 min-1. Finally, (siRNA); micro interfering RNA (tmRNA); a small, temporal replacement of a specific residue within the catalytic core of RNA (stRNA); or a short, hairpin RNA (shRNA); small the hammerhead with certain nucleotide analogues gives RNA-induced gene activation (RNAa); or, small activating modified ribozymes that show as much as a 10-fold improve RNA (saRNA). ment in catalytic rate. These findings demonstrate that 0200. In another embodiment, targeting of a Sirtuin ribozymes can promote chemical transformations with cata (SIRT) polynucleotide, e.g. SEQID NO:9 to 23, 141 to 143 lytic rates that are significantly greater than those displayed in modulate the expression or function of these targets. In one vitro by most natural, self-cleaving ribozymes. It is then embodiment, expression or function is upregulated as com possible that the structures of certain selfcleaving ribozymes pared to a control. In another embodiment, expression or may be optimized to give maximal catalytic activity, or that function is down-regulated as compared to a control. entirely new RNA motifs can be made that display signifi 0201 In another embodiment, antisense compounds com cantly faster rates for RNA phosphodiester cleavage. prise sequences set forth as SEQID NOS: 24 to 127. These 0208 Intermolecular cleavage of an RNA substrate by an oligonucleotides can comprise one or more modified nucle RNA catalyst that fits the “hammerhead' model was first otides, shorter or longer fragments, modified bonds and the shown in 1987. The RNA catalyst was recovered and reacted like. with multiple RNA molecules, demonstrating that it was truly (0202) In another embodiment, SEQ ID NOS: 24 to 127 catalytic. comprise one or more LNA nucleotides. 0203 The modulation of a desired target nucleic acid can 0209 Catalytic RNAs designed based on the “hammer be carried out in several ways known in the art, for example, head' motif have been used to cleave specific target antisense oligonucleotides, siRNA etc. Enzymatic nucleic sequences by Snaking appropriate base changes in the cata acid molecules (e.g., ribozymes) are nucleic acid molecules lytic RNA to maintain necessary base pairing with the target capable of catalyzing one or more of a variety of reactions, sequences. This has allowed use of the catalytic RNA to including the ability to repeatedly cleave other separate cleave specific target sequences and indicates that catalytic nucleic acid molecules in a nucleotide base sequence-specific RNAs designed according to the “hammerhead model may manner. Such enzymatic nucleic acid molecules can be used, possibly cleave specific substrate RNAs in vivo. for example, to target virtually any RNA transcript. 0210 RNA interference (RNAi) has become a powerful 0204 Because of their sequence-specificity, trans-cleav tool for modulating gene expression in mammals and mam ing enzymatic nucleic acid molecules show promise as thera malian cells. This approach requires the delivery of Small peutic agents for human disease. Enzymatic nucleic acid mol interfering RNA (siRNA) either as RNA itself or as DNA, ecules can be designed to cleave specific RNA targets within using an expression plasmid or virus and the coding sequence the background of cellular RNA. Such a cleavage event raid for small hairpin RNAs that are processed to siRNAs. This ers the mRNA non-functional and abrogates protein expres system enables efficient transport of the pre-siRNAs to the sion from that RNA. In this manner, synthesis of a protein cytoplasm where they are active and permit the use of regu associated with a disease state can be selectively inhibited. lated and tissue specific promoters for gene expression. 0205. In general, enzymatic nucleic acids with RNA 0211. In one embodiment, an oligonucleotide or antisense cleaving activity act by first binding to a target RNA. Such compound comprises an oligomer or polymer of ribonucleic binding occurs through the target binding portion of a enzy acid (RNA) and/or deoxyribonucleic acid (DNA), or a matic nucleic acid which is held in close proximity to an mimetic, chimera, analog or homolog thereof. This term enzymatic portion of the molecule that acts to cleave the includes oligonucleotides composed of naturally occurring target RNA. Thus, the enzymatic nucleic acid first recognizes nucleotides, Sugars and covalent internucleoside (backbone) and then binds a target RNA through complementary base linkages as well as oligonucleotides having non-naturally pairing, and once bound to the correct site, acts enzymatically occurring portions which function similarly. Such modified to cut the target RNA. Strategic cleavage of such a target RNA or substituted oligonucleotides are often desired over native will destroy its ability to direct synthesis of an encoded pro forms because of desirable properties such as, for example, US 2015/0284724 A1 Oct. 8, 2015 20 enhanced cellular uptake, enhanced affinity for a target nucleosides) in length. This refers to the length of the anti nucleic acid and increased Stability in the presence of sense Strand or portion of the antisense compound. In other nucleases. words, a single-stranded antisense compound of the invention 0212. According to the present invention, the oligonucle comprises front 5 to about 80 nucleotides, and a double otides or “antisense compounds' include antisense oligo Stranded antisense compound of the invention (such as a nucleotides (e.g. RNA, DNA, mimetic, chimera, analog or dsRNA, for example) comprises a sense and an antisense homolog thereof), ribozymes, external guide sequence (EGS) strandorportion of 5 to about 80 nucleotides in length. One of oligonucleotides, siRNA compounds, single- or double ordinary skill in the art will appreciate that this comprehends stranded RNA interference (RNAi) compounds such as antisense portions of 5, 6,7,8,9, 10, 11, 12, 13, 14, 15, 16, 17. siRNA compounds, saRNA, aRNA, and other oligomeric 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, compounds which hybridize to at least a portion of the target 34,35,36, 37,38, 39, 40, 41, 42, 43,44, 45, 46, 47, 48,49, 50, nucleic acid and modulate its function. As such, they may be 51, 52,53,54, 55,56, 57,58, 59, 60, 61, 62,63, 64, 65,66, 67, DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or 68, 69,70, 71,72, 73,74, 75,76, 77, 78,79, or 80 nucleotides may be mimetics of one or more of these. These compounds in length, or any range therewithin. may be single-stranded, double-stranded, circular or hairpin 0215. In one embodiment, the antisense compounds of the oligomeric compounds and may contain structural elements invention have antisense portions of 10 to 50 nucleotides in Such as internal or terminal bulges, mismatches or loops. length. One having ordinary skill in the art will appreciate that Antisense compounds are routinely prepared linearly but can this embodies oligonucleotides having antisense portions of be joined or otherwise prepared to be circular and/or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, branched. Antisense compounds can include constructs Such 27, 28, 29, 30, 31, 32,33, 34,35, 36, 37,38, 39, 40, 41,42, 43, as, for example, two strands hybridized to form a wholly or 44, 45,46, 47, 48,49, or 50 nucleotides in length, or any range partially double-stranded compound or a single strand with therewithin. In some embodiments, the oligonucleotides are sufficient self-complementarity to allow for hybridization 15 nucleotides in length. and formation of a fully or partially double-stranded com 0216. In one embodiment, the antisense or oligonucle pound. The two strands can be linked internally leaving free otide compounds of the invention have antisense portions of 3'or 5' termini or can be linked to form a continuous hairpin 12 or 13 to 30 nucleotides in length. One having ordinary skill structure or loop. The hairpin structure may contain an over in the art will appreciate that this embodies antisense com hang on either the 5' or 3' terminus producing an extension of pounds having antisense portions of 12, 13, 14, 15, 16, 17, 18. single stranded character. The double stranded compounds 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in optionally can include overhangs on the ends. Further modi length, or any range therewithin. fications can include conjugate groups attached to one of the 0217. In another embodiment, the oligomeric compounds termini, selected nucleotide positions, Sugar positions or to of the present invention also include variants in which a one of the internucleoside linkages. Alternatively, the two different base is present at one or more of the nucleotide Strands can be linked via a non-nucleic acid moiety or linker positions in the compound. For example, if the first nucleotide group. When formed from only one strand, dsRNA can take is an adenosine, variants may be produced which contain the form of a self-complementary hairpin-type molecule that thymidine, guauosine or cytidine at this position. This may be doubles back on itself to form a duplex. Thus, the dsRNAs can done at any of the positions of the antisense or dsRNA com be fully or partially double stranded. Specific modulation of pounds. These compounds are then tested using the methods gene expression can be achieved by stable expression of described herein to determine their ability to inhibit expres dsRNA hairpins in transgenic cell lines. When formed from sion of a target nucleic acid. two strands, or a single strand that takes the form of a self 0218. In some embodiments, homology, sequence identity complementary hairpin-type molecule doubled back on itself or complementarity, between the antisense compound and to form a duplex, the two strands (or duplex-forming regions target is from about 40% to about 60%. In some embodi of a single strand) are complementary RNA strands that base ments, homology, sequence identity or complementarity, is pair in Watson-Crick fashion. from about 60% to about 70%. In some embodiments, homol 0213. Once introduced to a system, the compounds of the ogy, sequence identity or complementarity, is from about invention may elicit the action of one or more enzymes or 70% to about 80%. In some embodiments, homology, structural proteins to effect cleavage or other modification of sequence identity or complementarity, is from about 80% to the target nucleic acid or may work via occupancy-based about 90%. In some embodiments, homology, sequence iden mechanisms. In general, nucleic acids (including oligonucle tity or complementarity, is about 90%, about 92%, about otides) may be described as “DNA-like' (i.e., generally hav 94%, about 95%, about 96%, about 97%, about 98%, about ing one or more 2'-deoxy Sugars and, generally, T rather than 99% or about 100%. U bases) or “RNA-like' (i.e., generally having one or more 0219. In another embodiment, the antisense oligonucle 2'-hydroxyl or 2'-modified Sugars and, generally Urather than otides, such as for example, nucleic acid molecules set forth Tbases). Nucleic acid helices can adopt more than one type of in SEQID NOS: 24 to 127 comprise one or more substitutions structure, most commonly the A- and B-forms. It is believed or modifications. In one embodiment, the nucleotides are that, in general, oligonucleotides which have B-form-like substituted with locked nucleic acids (LNA). structure are “DNA-like' and those which have A-formlike 0220. In another embodiment, the oligonucleotides target structure are “RNA-like.” In some (chimeric) embodiments, one or more regions of the nucleic acid molecules sense an antisense compound may contain both A- and B-form and/or antisense of coding and/or non-coding sequences regions. associated with SIRT and the sequences set forth as SEQID 0214. The antisense compounds in accordance with this NOS: 1 to 23 and 133 to 143. The oligonucleotides are also invention can comprise an antisense portion from about 5 to targeted to overlapping regions of SEQID NOS: 1 to 23 and about 80 nucleotides (i.e. from about 5 to about 80 linked 133 to 143. US 2015/0284724 A1 Oct. 8, 2015

0221 Certain oligonucleotides of this invention are chi modifications have been shown to make the oligonucleotide meric oligonucleotides. “Chimeric oligonucleotides’ or “chi into which they are incorporated more resistant to nuclease meras, in the context of this invention, are oligonucleotides digestion than the native oligodeoxynucleotide. Nuclease which contain two or more chemically distinct regions, each resistance is routinely measured by incubating oligonucle made up of at least one nucleotide. These oligonucleotides otides with cellular extracts or isolated nuclease solutions and typically contain at least one region of modified nucleotides measuring the extent of intact oligonucleotide remaining over that confers one or more beneficial properties (such as, for time, usually by gel electrophoresis. Oligonucleotides which example, increased nuclease resistance, increased uptake into have been modified to enhance their nuclease resistance Sur cells, increased binding affinity for the target) and a region Vive intact for a longer time than unmodified oligonucle that is a substrate forenzymes capable of cleaving RNA:DNA otides. A variety of oligonucleotide modifications have been or RNA:RNA hybrids. By way of example, RNase H is a demonstrated to enhance or confer nuclease resistance. Oli cellular endonuclease which cleaves the RNA strand of an gonucleotides which contain at least one phosphorothioate RNA/DNA duplex. Activation of RNase H, therefore, results modification are presently more preferred. In some eases, in cleavage of the RNA target, thereby greatly enhancing the oligonucleotide modifications which enhance target binding efficiency of antisense modulation of gene expression. Con affinity are also, independently, able to enhance nuclease sequently, comparable results can often be obtained with resistance. Some desirable modifications can be found in De shorter oligonucleotides when chimeric oligonucleotides are Mesmaeker et al. (1995) Acc. Chem. Res., 28:366-374. used, compared to phosphorothioate deoxyoligonucleotides 0224 Specific examples of some oligonucleotides envi hybridizing to the same target region. Cleavage of the RNA Sioned for this invention include those comprising modified target can be routinely detected by gel electrophoresis and, if backbones, for example, phosphorothioates, phosphotri necessary, associated nucleic acid hybridization techniques esters, methyl phosphonates, short chain alkyl or cycloalkyl known in the art. In one embodiment, a chimeric oligonucle interSugar linkages or short chain heteroatomic or heterocy otide comprises at least one region modified to increase target clic interSugarlinkages. Most are oligonucleotides with phos binding affinity, and, usually, a region that acts as a Substrate phorothioate backbones and those with heteroatom back for RNAse H. Affinity of an oligonucleotide for its target (in bones, particularly CH2 - NH-O-CH2, CH, this case, a nucleic acid encoding ras) is routinely determined —N(CH3)—O—CH2 known as a methylene(methylimino) by measuring the Tm of an oligonucleotide/target pair, which or MMI backbone), CH2 O N (CH3)—CH2, CH2 – N is the temperature at which the oligonucleotide and target (CH3) N (CH3) CH2 and O N (CH3). CH2 CH2 dissociate; dissociation is detected spectrophotometrically. backbones, wherein the native phosphodiester backbone is The higher the Tm, the greater is the affinity of the oligonucle represented as O—P O—CH.). The amide backbones dis otide for the target. closed by De Mesmaeker et al. (1995) Acc. Chem. Res. 0222 Chimeric antisense compounds of the invention 28:366-374 are also preferred. Also are oligonucleotides hav may be formed as composite structures of two or more oligo ing morpholino backbone structures (Summerton and Weller, nucleotides, modified oligonucleotides, oligonucleosides U.S. Pat. No. 5,034,506). In other embodiments, such as the and/or oligonucleotides mimetics as described above. Such; peptide nucleic acid (PNA) backbone, the phosphodiester compounds have also been referred to in the art as hybrids or backbone of the oligonucleotide is replaced with a polyamide gapmers. Representative United States patents that teach the backbone, the nucleotides being bound directly or indirectly preparation of Such, hybrid structures comprise, but are not to the aza nitrogen atoms of the polyamide backbone. Oligo limited to, U.S. Pat. Nos. 5,013,830; 5,149,797: 5,220,007: nucleotides may also comprise one or more Substituted Sugar 5,256,775; 5,366,878; 5.403,711; 5,491,133: 5,565,350; moieties, oligonucleotides comprise one of the following at 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of the 2' position: OH, SH, SCH3, F, OCN, OCH3OCH3 OCH3 which is herein incorporated by reference. (CH2)n CH3, O(CH2)n NH2 or O(CH2)n CH3 where n is 0223) In another embodiment, the region of the oligo from 1 to about 10; C1 to C10 lower alkyl, alkoxyalkoxy, nucleotide which is modified comprises at least one nucle substituted lower alkyl, alkaryl or aralkyl: Cl; Br; CM; CF3; otide modified at the 2' position of the sugar, most preferably OCF3; O S , or N-alkyl; O—, S , or N-alkenyl: a 2'-O-alkyl. 2'-O-alkyl-O-alkyl or 2'-fluoro-modified nucle SOCH3; SO2 CH3. ONO2: NO2: N3; NH2: heterocy otide. In other embodiments, RNA modifications include cloalkyl; heterocycloalkaryl; aminoalkylamino: polyalky 2'-fluoro. 2'-amino and 2 O-methyl modifications on the lamino; Substituted silyl; an RNA cleaving group; a reporter ribose of pyrimidines, abasic residues or an inverted base at group: an intercalator, a group for improving the pharmaco the 3' end of the RNA. Such modifications are routinely kinetic properties of an oligonucleotide; or a group for incorporated into oligonucleotides and these oligonucle improving the pharmacodynamic properties of an oligonucle otides have been shownto have a higher Tm (i.e., higher target otide and other Substituents having similar properties. A binding affinity) than; 2'-deoxyoligonucleotides against a modification includes 2'-methoxyethoxy 2'-O CH2CH2 given target. The effect of such increased affinity is to greatly OCH3, also known as 2'-O-(2-methoxyethyl). Other modi enhance RNAi oligonucleotide inhibition of gene expression. fications include 2'-methoxy (2'-O-CH3). 2'-propoxy (2'- RNAse H is a cellular endonuclease that cleaves the RNA OCH2CH2CH3) and 2'-fluoro (2'-F). Similar modifications strand of RNA:DNA duplexes; activation of this enzyme may also be made at other positions on the oligonucleotide, therefore results in cleavage of the RNA target, and thus can particularly the 3' position of the sugar on the 3' terminal greatly enhance the efficiency of RNAi inhibition. Cleavage nucleotide and the 5' position of 5' terminal nucleotide. Oli of the RNA target can be routinely demonstrated by gel elec gonucleotides may also have Sugar mimetics such as cyclobu trophoresis. In another embodiment, the chimeric oligonucle tyls in place of the pentofuranosyl group. otide is also modified to enhance nuclease resistance. Cells 0225 Oligonucleotides may also include, additionally or contain a variety of exo and endo-nucleases which can alternatively, nucleobase (often referred to in the art simply as degrade nucleic acids. A number of nucleotide and nucleoside “base') modifications or substitutions. As used herein, US 2015/0284724 A1 Oct. 8, 2015 22

“unmodified’ or “natural nucleotides include adenine (A), labeled, biotinylated or other modified oligonucleotides such guanine (G), thymine (T), cytokine (C) and uracil (U). Modi as cholesterol-modified oligonucleotides. fied nucleotides include nucleotides found only infrequently 0230. In accordance with the invention, use of modifica or transiently in natural nucleic acids, e.g., hypoxanthine, tions such as the use of LNA monomers to enhance the 6-methyladenine. 5-Me pyrimidines, particularly 5-methyl potency, specificity and duration of action and broaden the cytosine (also referred to as 5-methyl-2' deoxycytosine and routes of administration of oligonucleotides comprised of often referred to in the art as 5-Me—C), 5-hydroxymethyl current chemistries such as MOE, ANA, FANA, PS etc. This cytosine (HMC), glycosyl HMC and gentobiosyl HMC, as can be achieved by Substituting some of the monomers in the well as synthetic nucleotides, e.g., 2-aminoadenine, 2-(me current oligonucleotides by LNA monomers. The LNA modi thylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(ami fied oligonucleotide may have a size similar to the parent noalklyamino)adenine or other heterosubstituted alkylad compound or may be larger or preferably Smaller. It is that enines, 2-thiouracil, 2-thiothymine, 5-bromouracil, Such LNA-modified oligonucleotides contain less than about 5-hydroxymetyhluracil, 8-azaguanine, 7-deazaguanine, N6 70%, more preferably less man about 60%, most preferably (6-aminohexyl)adenine and 2,6-diaminopurine. A “univer less man about 50% LNA monomers and that their sizes are sal base known in the art, e.g., inosine, may be included. between about 5 and 25 nucleotides, more preferably between 5-Me-C substitutions have been shown to increase nucleic about 12 and 20 nucleotides. acid duplex stability by 0.6-1.2°C. (Sanghvi, Y. S., in Crooke, 0231. Modified oligonucleotide backbones comprise, but S. T. and Lebleu, B., eds. Antisense Research and Applica are not limited to, phosphorothioates, chiral phosphorothio tions, CRC Press, Boca Raton, 1993, pp. 276-278) and are ates, phosphorodithioates, phosphotriesters, aminoalky presently base Substitutions. lphosphotriesters, methyl, and other alkylphosphonates com 0226. Another modification of the oligonucleotides of the prising 3'alkylene phosphonates and chiral phosphonates, invention involves chemically linking to the oligonucleotide phosphinates, phosphoramidates comprising 3'-amino phos one or more moieties or conjugates which enhance the activ phoramidate and aminoalkylphosphoramidates, thionophos ity or cellular uptake of the oligonucleotide. Such moieties phoramidates. thionoalkylphosphonates, thionoalkylphos include but are not limited to lipid moieties such as a choles photriesters, and boranophosphates having normal 3'-5' terol moiety, a cholesteryl moiety, a thioether, e.g., hexyl-S- linkages. 2'-5' linked analogs of these, and those having trityithiol, a thiocholesterol, an aliphatic chain, e.g., dodecan inverted polarity wherein the adjacent pairs of nucleoside diol or undecyl residues, a phospholipid, e.g., di-hexadecyl units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac mixed salts and free acid forms are also included. glycero-3-H-phosphonate, a polyamine or a polyethylene 0232 Representative United States patents that teach the glycol chain, or adamantane acetic acid. Oligonucleotides preparation of the above phosphorus containing linkages comprising lipophilic moieties, and methods for preparing comprise, but are not limited to, U.S. Pat. Nos. 3,687,808; Such oligonucleotides are known in the art, for example, U.S. 4,469,863; 4,476,301: 5,023,243; 5,177, 196; 5,188,897; Pat. Nos. 5,138,045, 5,218,105 and 5,459.255. 5,264,423: 5,276,019; 5,278.302: 5,286,717: 5,321,131; 0227. It is not necessary for all positions in a given oligo 5,399,676; 5,405,939; 5.453,496; 5,455,233; 5,466,677; nucleotide to be uniformly modified, and in fact more than 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; one of the aforementioned modifications may be incorporated 5,563,253: 5,571,799: 5,587,361; and 5,625,050, each of in a single oligonucleotide or even at within a single nucleo which is herein incorporated by reference. side within an oligonucleotide. The present invention also 0233 Modified oligonucleotide backbones that do not includes oligonucleotides which are chimeric oligonucle include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside otides as hereinbefore defined. linkages, mixed heteroatom and alkyl or cycloalkyl inter 0228. In another embodiment, the nucleic acid molecule nucleoside linkages, or one or more short chain heteroatomic of the present invention is conjugated with another moiety or heterocyclic internucleoside linkages. These comprise including but not limited to abasic nucleotides, polyether, those having morpholino linkages (formed in part from the polyamine, polyamides, peptides, carbohydrates, lipid, or Sugar portion of a nucleoside); siloxane backbones; Sulfide, polyhydrocarbon compounds. Those skilled in the art will sulfoxide and sulfone backbones; formacetyl and thiofor recognize that these molecules can be linked to one or more of macetyl backbones; methylene formacetyl and thiofor any nucleotides comprising the nucleic acid molecule at sev macetylbackbones; alkene containing backbones; Sulfamate eral positions on the Sugar, base orphosphate group. backbones; methyleneimino and methylenehydrazino back 0229. The oligonucleotides used in accordance with this bones; Sulfonate and Sulfonamide backbones; amide back invention may be conveniently and routinely made through bones; and others having mixed N, O, S and CH2 component the well-known technique of Solid phase synthesis. Equip parts. ment for Such synthesis is sold by several vendors including 0234 Representative United States patents that teach the Applied Biosystems. Any other means for Such synthesis may preparation of the above oligonucleotides comprise, but are also be employed; the actual synthesis of the oligonucleotides not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185, is well within the talents of one of ordinary skill in the art. It 444; 5,214,134:5,216,141, 5,235,033: 5,264,562: 5,264,564: is also well known to use similar techniques to prepare other 5,405,938; 5,434,257; 5,466,677; 5,470,967: 5489,677; oligonucleotides such as the phosphorothioates and alkylated 5,541,307: 5,561.225; 5,596,086; 5,602,240; 5,610,289; derivatives. It is also well known to use similar techniques and 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; commercially available modified amidites and controlled 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of pore glass (CPG) products such as biotin, fluorescein, acri which is herein incorporated by reference. dine or psoralen-modified amidites and/or CPG (available 0235. In other oligonucleotide mimetics, both the sugar from Glen Research, Sterling Va.) to synthesize fluorescently and the internucleoside linkage, i.e., the backbone, of the US 2015/0284724 A1 Oct. 8, 2015

nucleotide units are replaced with novel groups. The base Such as cyclobutyl moieties in place of the pentofuranosyl units are maintained for hybridization with an appropriate sugar. Representative United States patents that teach the nucleic acid target compound. One Such oligomeric com preparation of Such modified Sugar structures comprise, but pound, an oligonucleotide mimetic that has been shown to are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319, have excellent hybridization properties, is referred to as a 080; 5,359,044: 5,393,878; 5,446,137; 5,466,786; 5,514,785; peptide nucleic acid (PNA). In PNA compounds, the sugar 5,519,134: 5,567,811: 5,576.427: 5,591,722; 5,597,909; backbone of an oligonucleotide is replaced with an amide 5,610,300; 5,627,053: 5,639,873; 5,646,265; 5,658,873; containing backbone, in particular an aminoethylglycine 5,670,633; and 5,700,920, each of which is herein incorpo backbone. The nucleobases are retained and are bound rated by reference. directly or indirectly to aza nitrogen atoms of the amide 0239 Oligonucleotides may also comprise nucleobase portion of the backbone. Representative United States patents (often referred to in the art simply as “base') modifications or that teach the preparation of PNA compounds comprise, bat substitutions. As used herein, “unmodified’ or “natural are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and nucleotides comprise the purine bases adenine (A) and gua 5,719,262, each of which is herein incorporated by reference. nine (CO, and the pyrimidine bases thymine (T), cytosine (C) Further teaching of PNA compounds can be found in Nielsen and uracil (U). Modified nucleotides comprise other synthetic et al. (1991) Science 254, 1497-1500. and natural nucleotides such as 5-methylcytosine (5-me-C), 0236. In another embodiment of the invention the oligo 5-hydroxymethyl cytosine, Xanthine, hypoxanthine, 2-ami nucleotides with phosphorothioate backbones and oligo noadenine, 6-methyl and other alkyl derivatives of adenine nucleosides wife heteroatom backbones, and in particular and guanine, 2-propyl and other alkyl derivatives of adenine CH2 NH O CH2 CH2 N (CH3) O CH2 and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, known as a methylene (methylimino) or MMI backbone, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, CH2 O N (CH3) CH2 CH2(CH3) N(CH3) 6-aZO uracil, cytosine and thymine, 5-uracil (pseudo-uracil), CH2-and-O N(CH3)—CH2—CH2— wherein the native 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hy phosphodiester backbone is represented as-O-P O— droxyl and other 8-Substituted adenines and guanines, 5-halo CH2— of the above referenced U.S. Pat. No. 5,489,677, and particularly 5-bromo, 5-trifluoromethyl and other 5-substi the amide backbones of the above referenced U.S. Pat. No. tuted uracils and cytosines, 7-methylguanine and 7-methy 5,602.240. Also are oligonucleotides having morpholino ladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine backbone structures of the above-referenced U.S. Pat. No. and 7-deazaadenine and 3-deazaguanine and 3-deaZaad 5,034,506. enine. 0237 Modified oligonucleotides may also contain one or 0240 Further, nucleotides comprise those disclosed in more Substituted Sugar moieties, oligonucleotides comprise U.S. Pat. No. 3,687,808, those disclosed in The Concise one of the following at the 2' position: OH: F: O , S: , or Encyclopedia of Polymer Science And Engineering, pages N-alkyl: O , or N-alkenyl: O S or N-alkynyl: or O 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be those disclosed by Engisch et al., Angewandle Chemie, substituted or unsubstituted C to CO alkyl or C2 to CO alk International Edition, 1991, 30, page 613, and those dis enyl and alkynyl. Particularly are O (CH2)n OmCH3, closed, by Sanghvi, Y. S., Chapter 15, Antisense Research O(CH2)n,OCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2) and Applications, pages 289-302, Crooke, S.T. and. Lebleu, nCNH2, and O(CH2nON(CH2)nCH3)2 where n and m can B. ea., CRC Press, 1993. Certain of these nucleotides are be from 1 to about 10. Other oligonucleotides comprise one of particularly useful for increasing the binding affinity of the the following at the 2' position; C to CO, (lower alkyl, sub oligomeric compounds of the invention. These comprise stituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 SH, SCH3, OCN, C1, Br, CN, CF3, OCF3, SOCH3, SO2CH3, and 0-6 Substituted purines, comprising 2-aminopropylad ONO2, NO2, N3, NH2, heterocycloalkyl, heterocy enine, 5-propynyluracil and 5-propynylcytosine. 5-methyl oloalkaryl, aminoalkylamino, polyalkylamino, Substituted cytosine Substitutions have been shown to increase nucleic silyl, an RNA cleaving group, a reporter group, an intercala acid duplex stability by 0.6-1.2°C. (Sanghvi, Y. S., Crooks, S. tor, a group for improving the pharmacokinetic properties of T. and Lebleu. B., eds, Antisense Research and Applica an oligonucleotide, or a group for improving the pharmaco tions, CRC Press, Boca Raton, 1993, pp. 276-278) and are dynamic properties of an oligonucleotide, and other Substitu presently base Substitutions, even more particularly when ents having similar properties. A modification comprises combined with 2'-Omethoxyethyl sugar modifications. 2-methoxyethoxy (2'-O-CH2CH2OCH3, also known as 0241 Representative United States patents that teach the 2 O—(2-methoxyethyl) or 2-MOE) i.e., an alkoxyalkoxy preparation of the above noted modified nucleotides as well group. A further modification comprises 2'-dimethylami as other modified nucleotides comprise, but are not limited to, nooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; as 2'-DMAOE, as described in examples herein below, and 5,130,302; 5,134,066; 5,175.273; 5,367,066; 5,432,272: 2'-dimethylaminoethoxyethoxy (also known in the art as 5,457,187; 5,459.255; 5,484,908: 5,502,177; 5,525,711; 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 5,552,540: 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 2' O CH2 O CH2 N(CH2)2. 5,681,941, each of which is herein incorporated by reference. 0238. Other modifications comprise 2'-methoxy (2 O 0242 Another modification of the oligonucleotides of the CH3), 2-aminopropoxy (2 O CH2CH2CH2NH2) and invention involves chemically linking to the oligonucleotide 2'-fluoro (2 F). Similar modifications may also be made at one or more moieties or conjugates, which enhance the activ other positions on the oligonucleotide, particularly the 3' ity, cellular distribution, or cellular uptake of the oligonucle position of the sugar on the 3' terminal nucleotide or in 2'-5' otide. linked oligonucleotides and the 5' position of 5' terminal 0243 Such moieties comprise but are not limited to, lipid nucleotide. Oligonucleotides may also have Sugar mimetics moieties such as a cholesterol moiety, cholic acid, a thioether, US 2015/0284724 A1 Oct. 8, 2015 24 e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, the exogenous nucleic acid is producing the effector RNA. e.g., dodecandiol or undecyl residues, a phospholipid, e.g., Based on sequence conservation, primers can be designed di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- and used to amplify coding regions of the target genes. Ini hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a tially, the most highly expressed coding region from each polyethylene glycol chain, or adamantane acetic acid, a gene can be used to build a model control gene, although any palmityl moiety, oran octadecylamine or hexylamino-carbo coding or noncoding region can be used. Each control gene is nyl-t oxycholesterol moiety. assembled by inserting each coding region between a reporter 0244 Representative United States patents that teach the coding region and its poly(A) signal. These plasmids would preparation of Such oligonucleotides conjugates comprise, produce an mRNA with a reporter gene in the upstream but are not limited to, U.S. Pat. Nos. 4,828,979: 4,948,882; portion of the gene and a potential RNAi target in the 3' 5,218,105: 5,525,465; 5,541,313; 5,545,730; 5,552,538; non-coding region. The effectiveness of individual antisense 5,578,717, 5,580,731: 5,580,731: 5,591584; 5,109,124; oligonucleotides would be assayed by modulation of the 5,118,802; 5,138,045; 5,414,077; 5,486,603: 5,512,439; reporter gene. Reporter genes useful in the methods of the 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; present invention include acetohydroxyacid synthase 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; (AHAS), alkaline phosphatase (AP), beta galactosidase 4,904,582: 4,958,013; 5,082,830; 5,112,963: 5,214,136; (Lac7), beta glucoronidase (GUS), chloramphenicol acetyl 5,082,830; 5,112,963: 5,214,136; 5,245,022: 5,254,469; transferase (CAT), green fluorescent protein (GFP), red fluo 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098: rescent protein (RFP), yellow fluorescent protein (YFP), cyan 5,371,241, 5,391,723; 5,416.203, 5,451,463: 5,510,475; fluorescent protein (CFP), horseradish peroxidase (HRP), 5,512,667: 5,514,785; 5,565,552; 5,567,810: 5,574,142: luciferase (Luc), nopaline synthase (NOS), octopine synthase 5,585,481: 5,587,371; 5,595,726; 5,597.696; 5,599,923; (OCS), and derivatives thereof. Multiple selectable markers 5,599.928 and 5,688,941, each of which is herein incorpo are available that confer resistance to amplicillin, bleomycin, rated by reference. chloramphenicol, gentamycin, hygromycin, kanamycin, lin 0245 Drug discovery: The compounds of the present comycin, methotrexate, phosphinothricin, puromycin, and invention can also be applied in the areas of drug discovery tetracycline. Methods to determine modulation of a reporter and target validation. The present invention comprehends the gene are well known in the art, and include, but are not limited use of the compounds and target segments identified herein in to, flourometric methods (e.g. fluorescence spectroscopy, drug discovery efforts to elucidate relationships that exist Fluorescence Activated Cell Sorting (FACS), fluorescence between a Sirtuin (SIRT) polynucleotide and a disease state, microscopy), antibiotic resistance determination. phenotype, or condition. These methods include detecting or 0248 SIRT1, SIRT3 and SIRT6 proteins and mRNA modulating a Sirtuin (SIRT) polynucleotide comprising con expression can be assayed using methods known to those of tacting a sample, tissue, cell, or organism with the compounds skill in the art and described elsewhere herein. For example, of the present invention, measuring the nucleic acid or protein immunoassays such as the ELISA can be used to measure level of a Sirtuin (SIRT) polynucleotide and/or a related phe protein levels. Sirtuin (SIRT) antibodies for ELISAs are notypic or chemical endpoint at Some time after treatment, available commercially, e.g., from R&D Systems (Minne and optionally comparing the measured value to a non-treated apolis, Minn.), Abcam, Cambridge, Mass. sample or sample treated with a further compound of the 0249. In embodiments, SIRT1, SIRT3 and SIRT6 expres invention. These methods can also be performed in parallel or sion (e.g., mRNA or protein) in a sample (e.g., cells or tissues in combination with other experiments to determine the func in vivo or in vitro) treated using an antisense oligonucleotide tion of unknown genes for the process of target validation or of the invention is evaluated by comparison with Sirtuin to determine the validity of a particular gene product as a (SIRT) expression in a control sample. For example, expres target for treatment or prevention of a particular disease, sion of the protein or nucleic acid can be compared using condition, or phenotype. methods known to those of skill in the art with that in a mock-treated or untreated simple. Alternatively, comparison Assessing Up-Regulation or Inhibition of Gene with a sample treated with a control antisense oligonucleotide Expression (e.g., one having an altered or different sequence) can be 0246 Transfer of an exogenous nucleic acid into a host made depending on the information desired. In another cell or organism can be assessed by directly detecting the embodiment, a difference in the expression of the Sirtuin presence of the nucleic acid in the cell or organism. Such (SIRT) protein or nucleic acid in a treated vs. an untreated detection can be achieved by several methods well known in sample can be compared with the difference in expression of the art. For example, the presence of the exogenous nucleic a different nucleic acid (including any standard deemed acid can be detected by Southern blot or by a polymerase appropriate by the researcher, e.g., a housekeeping gene) in a chain reaction (PCR) technique using primers that specifi treated sample vs. an untreated sample, cally amplify nucleotide sequences associated with the 0250 Observed differences can be expressed as desired, nucleic acid. Expression of the exogenous nucleic acids can e.g., in the form of a ratio or fraction, for use in a comparison also be measured using conventional methods including gene with control. In embodiments, the level of a Sirtuin (SIRT) expression analysis. For instance, mRNA produced from an mRNA or protein, in a sample treated with an antisense oli exogenous nucleic acid can be detected and quantified using gonucleotide of the present invention, is increased or a Northern blot and reverse transcription PCR (RT-PCR). decreased by about 1.25-fold to about 10-fold or more relative 0247 Expression of RNA from the exogenous nucleic to an untreated Sample or a sample treated with a control acid can also be detected by measuring an enzymatic activity nucleic acid. In embodiments, the level of a Sirtuin (SIRT) or a reporter protein activity. For example, antisense modu mRNA or protein is increased or decreased by at least about latory activity can be measured indirectly as a decrease or 1.25-fold, at least about 1.3-fold, at least about 1.4-fold, at increase in target nucleic acid expression as an indication that least about 1.5-fold, at least about 1.6-fold, at least about US 2015/0284724 A1 Oct. 8, 2015

1.7-fold, at least about 1.8-fold, at least about 2-fold, at least oligonucleotides, particularly the primers and probes, of the about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at invention with a nucleic acid encoding a Sirtuin (SIRT) can be least about 4-fold, at least about 4.5-fold, at least about 5-fold, detected by means known in the art. Such means may include at least about 5.5-fold, at least about 6-fold, at least about conjugation of an enzyme to the oligonucleotide, radiolabel 6.5-fold, at least about 7-fold, at least about 7.5-fold, at least ing of the oligonucleotide, or any other suitable detection about 8-fold, at least about 8.5-fold, at least about 9-fold, at means. Kits using such detection means for detecting the level least about 9.5-fold, or at least about 10-fold or more. of a Sirtuin (SIRT) in a sample may also be prepared. 0257 The specificity and sensitivity of antisense are also Kits, Research Regents, Diagnostics, and harnessed by those of skill in the art for therapeutic uses. Therapeutics Antisense compounds have been employed as therapeutic 0251. The compounds of the present invention can be uti moieties in the treatment of disease states in animals, includ lized for diagnostics, therapeutics, and prophylaxis, and as ing humans. Antisense oligonucleotide drugs have been research reagents and components of kits. Furthermore, anti safely and effectively administered to humans and numerous sense oligonucleotides, which are able to inhibit gene expres clinical trials are presently underway. It is thus established sion with exquisite specificity, are often used by those of that antisense compounds can be useful therapeutic modali ordinary skill to elucidate the function of particular genes or ties that can be configured to be useful in treatment regimes to distinguish between functions of various members of a for the treatment of cells, tissues and animals, especially biological pathway. humans. 0252 For use in kits and diagnostics and in various bio 0258 For therapeutics, an animal, preferably a human, logical systems, the compounds of the present invention, Suspected of having a disease or disorder which can be treated either alone or in combination with other compounds or by modulating the expression of a Sirtuin (SIRT) polynucle therapeutics, are useful as tools in differential and/or combi otide is treated by administering antisense compounds in natorial analyses to elucidate expression patterns of a portion accordance with this invention. For example, in one non or the entire complement of genes expressed within cells and limiting embodiment, the methods comprise the step of tissues. administering to the animal in need of treatment, a therapeu 0253) As used herein, the term “biological system” or tically effective amount of a Sirtuin (SIRT) modulator. The “system’ is defined as any organism, cell, cell culture or Sirtuin (SIRT) modulators of the present invention effectively tissue that expresses, or is made competent to express prod modulate the activity of a Sirtuin (SIRT) or modulate the ucts of the Sirtuin (SIRT). These include, but are not limited expression of a Sirtuin (SIRT) protein. In one embodiment, to, humans, transgenic animals, cells, cell cultures, tissues, the activity or expression of a Sirtuin (SIRT) in an animal is Xenografts, transplants and combinations thereof. inhibited by about 10% as compared to a control. Preferably, 0254 As one non limiting example, expression patterns the activity or expression of a Sirtuin (SIRT) in an animal is within cells or tissues treated with one or more antisense inhibited by about 30%. More preferably, the activity or compounds are compared to control cells or tissues not expression of a Sirtuin (SIRT) in an animal is inhibited by treated with antisense compounds and the patterns produced 50% or more. Thus, the oligomeric compounds modulate are analyzed for differential levels of gene expression as they expression of a Sirtuin (SIRT) mRNA by at least 10%, by at pertain, for example, to disease association, signaling path least 50%, by at least 25%, by at least 30%, by at least 40%, way, cellular localization, expression level, size, structure or by at least 50%, by at least 60%, by at least 70%, by at least function of the genes examined. These analyses can be per 75%, by at least 80%, by at least 85%, by at least 90%, by at formed on stimulated or unstimulated cells and in the pres least 95%, by at least 98%, by at least 99%. or by 100% as ence or absence of other compounds that affect expression compared to a control. patterns. 0255 Examples of methods of gene expression analysis 0259. In one embodiment, the activity or expression of a known in the art include DNA arrays or microarrays. SAGE Sirtuin (SIRT) and/or in an animal is increased by about 10% (serial analysis of gene expression), READS (restriction as compared to a control. Preferably, the activity or expres enzyme amplification of digested cDNAs), TOGA (total gene sion of a Sirtuin (SIRT) in an animal is increased by about expression analysis), protein arrays and proteomics, 30%. More preferably, the activity or expression of a Sirtuin expressed sequence tag (EST) sequencing, Subtractive RNA (SIRT) in an animal is increased by 50% or more. Thus, the fingerprinting (SuRF), subtractive clotting, differential dis oligomeric compounds modulate expression of a Sirtuin play (DD), comparative genomic hybridization, FISH (fluo (SIRT) mRNA by at least 10%, by at least 50%, by at least rescent in situ hybridization) techniques and mass spectrom 25%, by at least 30%, by at least 40%, by at least 50%, by at etry methods. least 60%, by at least 70%, by at least 75%, by at least 80%, 0256 The compounds of the invention are useful for by at least 85%, by at least 90%, by at least 95%, by at least research and diagnostics, because these compounds hybrid 98%, by at least 99%, or by 100% as compared to a control. ize to nucleic acids encoding a Sirtuin (SIRT). For example, 0260. In embodiments, Sirtuin modulation is observed by oligonucleotides that hybridize with such efficiency and measuring levels of Sirtuin mRNA, antisense RNA, protein, under such conditions as disclosed herein as to be effective biomarkers for Sirtuins, or combinations thereof, in a biologi Sirtuin (SIRT) modulator are effective primers or probes cal sample. Sirtuin biomarkers include, e.g., MCP-1, BMP under conditions favoring gene amplification or detection, Receptor 1A, Smpd13a, CD14, ApoE, FAS. Transthyretin, respectively. These primers and probes are useful in methods FABP1, Acyl-CoA thioesterase 1, Acyl-CoA thioesterase 2, requiring the specific detection of nucleic acid molecules Aquaporin 4, Rrad, CXCL9, CCL8, Pppltr3g, ApoA-I, encoding a Sirtuin (SIRT) and in the amplification of said ApoA-II, and ApoB. Biomarkers for Sirtuin expression and nucleic acid molecules for detection or for use in further their use in monitoring Sirtuin expression is described, e.g., in studies of a Sirtuin (SIRT). Hybridization of the antisense U.S. Pat. App. Pub. No. 2010/0215632, “Biomarkers of Sir US 2015/0284724 A1 Oct. 8, 2015 26 tuin Activity and Methods of Use Thereof.” incorporated 0263 For example, the reduction of the expression of a herein by reference in its entirety. Sirtuin (SIRT) may be measured in serum, blood, adipose tissue, liver or any other body fluid, tissue or organ of the 0261 Assays for Sirtuin activity include assays for acetyl animal. Preferably, the cells contained within said fluids, tansferase/deacetylase activity. Such assays have been tissues or organs being analyzed contain a nucleic acid mol described in the literature, e.g., in U.S. Pat. App. Pub. No. ecule encoding Sirtuin (SIRT) peptides and/or the Sirtuin 2009/0221.020, “Mass Spectrometry Assays for Acetyltrans (SIRT) protein itself. ferase/Deacetylase Activity, incorporated herein by refer 0264. The compounds of the invention can be utilized in ence in its entirety. Any assay for Sirtuin activity known to pharmaceutical compositions by adding an effective amount those of skill in the art is contemplated for use in measuring of a compound to a suitable pharmaceutically acceptable Sirtuin activity in conjunction with the methods of the present diluent or carrier. Use of the compounds and methods of the invention. invention may also be useful prophylactically. 0262. In certain embodiments, modulation of Sirtuin 0265 Conjugates: Another modification of the oligo expression is identified by an increase in (upregulation of) or nucleotides of the invention involves chemically linking to a decrease in (downregalation of) the Sirtuin mRNA copy the oligonucleotide one or more moieties or conjugates that number, mRNA concentration, or biomarker mRNA or pro enhance the activity, cellular distribution or cellular uptake of tein expression or activity, of at least about 10%, at least about the oligonucleotide. These moieties or conjugates can include 15%, at least about 20%, at least about 25%, at least about conjugate groups covalently bound to functional groups such 30%, at least about 40%, at least about 50%, at least about as primary or secondary hydroxyl groups. Conjugate groups 60%, at least about 70%, at least about 75%, at least about of the invention include intercalators, reporter molecules, 80%, at least about 90%, at least about 100%, at least about polyamines, polyamides, polyethylene glycols, polyethers, 125%, at least about 150%, at least about 200%, at least about groups that enhance the pharmacodynamic properties of oli 250%, at least about 300%, at least about 3500%, at least gomers, and groups that enhance the pharmacokinetic prop about 400%, at least about 450%, or at least about 500%, at erties of oligomers. Typicalconjugate groups include choles least about 600%, at least about 700%, at least about 800%, at terols, lipids, phospholipids, biotin, phenazine, folate, least about 900%, or at least about 1000%, in comparison to phenanthridine, anthraquinone, acridine, fluoresceins, a control, e.g., an untreated or mock-treated Sample. In rhodamines, coumarins, and dyes. Groups that enhance the embodiments, the Sirtuin mRNA copy number, mRNA con pharmacodynamic properties, in the context of this invention, centration, or biomarker mRNA or protein expression or include groups that improve uptake, enhance resistance to activity increases or decreases by about 10% to about 500%. degradation, and/or strengthen sequence-specific hybridiza In embodiments, the Sirtuin mRNA copy number, mRNA tion with the target nucleic acid. Groups that enhance the concentration, or biomarker mRNA or protein expression or pharmacokinetic properties, in the context of this invention, activity increases or decreases by about 10% to about 50%, include groups that improve uptake, distribution, metabolism about 10% to about 100%, about 10% to about 150%, about or excretion of the compounds of the present invention. Rep 10% to about 200%, about 10% to about 250%, about 10% to resentative conjugate groups are disclosed in International about 300%, about 10% to about 350%, about 10% to about Patent Application No. PCT/US92/09196, filed Oct. 23, 400%, about 10% to about 450%, about 10% to about 500%, 1992, and U.S. Pat. No. 6,287,860, which are incorporated about 10% to about 600%, about 10% to about 700%, about herein by reference. Conjugate moieties include, but are not 10% to about 800%, about 10% to about: 900%, about 10% to limited to, lipid moieties such as a cholesterol moiety, cholic about 1000%, about 50% to about 100%, about 50% to about acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an 150%, about 50% to about 200%, about 50% to about 250%, aliphatic chain, e.g., dodecandiolor undecylresidues, a phos about 50% to about 300%, about 50% to about 350%, about pholipid, e.g., di-hexadecyl-rac-glycerol or triethylammo 50% to about 400%, about 50% to about 450%, about 50% to nium 1,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate, a about 500%, about 50% to about 600%, about 50% to about polyamine or a polyethylene glycol chain, or adamantane 700%, about 50% to about 800%, about 50% to about 900%, acetic acid, a palmityl moiety, or an octadecylamine or hexy about 50% to about 1000%, about 100% to about 150%, about lamino-carbonyl-oxycholesterol moiety. Oligonucleotides of 100% to about 200%, about 100% to about 250%, about the invention may also be conjugated to active drug Sub 100% to about 300%, about 100% to about 350%, about stances, for example, aspirin, warfarin, phenylbutaZone, ibu 100% to about 400%, about 100% to about 450%, about profen, Suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, 100% to about 500%, about 100% to about 600%, about carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufe 100% to about 700%, about 100% to about 800%, about namic acid, folinic acid, a benzothiadiazide, chlorothiazide, a 100% to about 900%, about 100% to about 1000%, about diazepine, indomethicin, a barbiturate, a cephalosporin, a 150% to about 200%, about 150% to about 250%, about Sulfa drug, an antidiabetic, an antibacterial or an antibiotic. 150% to about 300%, about 150% to about 350%, about 0266 Representative United States patents that teach the 150% to about 400%, about 150% to about 450%, about preparation of Such oligonucleotide conjugates include, but 150% to about 500%, about 150% to about 600%, about are not limited to, U.S. Pat. Nos. 4,828,979: 4,948,882; 5,218, 150% to about 700%, about 150% to about 800%, about 105:5,525,465; 5,541,313; 5,545,730;5,552,538; 5,578,717, 150% to about 900%, about 150% to about 1000%, about 5,580,731: 5,580,731: 5,591584; 5,109,124; 5,118,802: 200% to about 250%, about 200% to about 300%, about 5,138,045; 5,414,077; 5,486,603: 5,512,439; 5,578,718; 200% to about 350%, about 200% to about 400%, about 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 200% to about 450%, about 200% to about 500%, about 4,789,737; 4,824.941; 4,835,263; 4,876,335; 4,904,582: 200% to about 600%, about 200% to about 700%, about 4,958,013; 5,082,830; 5,112,963: 5,214,136; 5,082,830; 200% to about 800%, about 200% to about 900%, or about 5,112,963: 5,214,136; 5,245,022: 5,254,469: 5,258,506; 200% to about 1000%. 5,262,536; 5,272,250; 5,292,873; 5,317,098: 5,371,241, US 2015/0284724 A1 Oct. 8, 2015 27

5,391,723; 5,416.203, 5,451,463: 5,510,475; 5,512,667; nucleotides, examples of pharmaceutically acceptable salts 5,514,785: 5,565,552; 5,567,810; 5,574,142: 5,585,481; and their uses are further described in U.S. Pat. No. 6,287, 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 860, which is incorporated herein by reference. 5,688,941. 0274 The present invention also includes pharmaceutical 0267 Formulations: The compounds of the invention may compositions and formulations that include the antisense also be admixed, encapsulated, conjugated or otherwise asso compounds of the invention. The pharmaceutical composi ciated with other molecules, molecule structures or mixtures tions of the present invention may be administered in a num of compounds, as for example. liposomes, receptor-targeted ber of ways depending upon whether local or systemic treat molecules, oral, rectal, topical or other formulations, for ment is desired and upon the area to be treated. assisting in uptake, distribution and/or absorption. Represen Administration may be topical (including ophthalmic and to tative United States patents that teach the preparation of such mucous membranes including vaginal and rectal delivery), uptake, distribution and/or absorption-assisting formulations pulmonary, e.g., by inhalation or insufflation of powders or include, but are not limited to, U.S. Pat. Nos. 5,108,921; aerosols, including by nebulizer, intratracheal, intranasal, 5,354,844; 5,416,016; 5,459,127: 5,521,291; 5,543,165; epidermal and transdermal), oral or parenteral. Parenteral 5,547,932; 5,583,020; 5,591,721: 4,426,330; 4,534,899; administration includes intravenous, intraarterial, Subcutane 5,013,556; 5,108,921; 5,213,804: 5,227,170, 5,264,221; ous, intraperitoneal or intramuscular injection or infusion; or 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5.462,854; intracranial, e.g., intrathecal or intraventricular, administra 5,469,854: 5,512.295: 5,527,528: 5,534,259; 5,543,152: tion. 5,556,948: 5,580,575; and 5,595,756, each of which is herein 0275 For treating tissues in the central nervous system, incorporated by reference. administration can be made by, e.g., injection or infusion into 0268 Although, the antisense oligonucleotides do not the cerebrospinal fluid. Administration of antisense RNA into need to be administered in the context of a vector in order to cerebrospinal fluid is described, e.g., in U.S. Pat App. Pub. modulate a target expression and/or function, embodiments No. 2007/0117772, “Methods for slowing familial ALS dis of the invention relates to expression vector constructs for the ease progression, incorporated herein by reference in its expression of antisense oligonucleotides, comprising pro entirety. moters, hybrid promoter gene sequences and possess a strong 0276. When it is intended that the antisense oligonucle constitutive promoter activity, or a promoter activity which otide of the present invention be administered to cells in the can be induced in the desired case. central nervous system, administration can be with one or 0269. In an embodiment, invention practice involves more agents capable of promoting penetration of the subject administering at least one of the foregoing antisense oligo antisense oligonucleotide across the blood-brain barrier. nucleotides with a suitable nucleic acid delivery system. In Injection can be made, e.g., in the entorhinal cortex or hip one embodiment, that system includes a non-viral vector pocampus. Delivery of neurotrophic factors by administra operably linked to the polynucleotide. Examples of such non tion of an adenovirus vector to motor neurons in muscle tissue viral vectors include the oligonucleotide alone (e.g. any one is described in, e.g., U.S. Pat. No. 6,632,427, Adenoviral or more of SEQID NOS: 24 to 127) or in combination with a vector-mediated gene transfer into medullary motor neu Suitable protein, polysaccharide or lipid formulation. rons, incorporated herein by reference. Delivery of vectors 0270 Additionally suitable nucleic acid delivery systems directly to the brain, e.g., the striatum, the thalamus, the include viral vector, typically sequence from at least one of an hippocampus, or the Substantia nigra, is known in the art and adenovirus, adenovirus-associated virus (AAV), helper-de described, e.g., in U.S. Pat. No. 6,756.523, Adenovirus vec pendent adenovirus, retrovirus, or hemagglutinatin virus of tors for the transfer of foreign genes into cells of the central Japan-liposome (HVJ) complex. Preferably, the viral vector nervous system particularly in brain, incorporated herein by comprises a strong eukaryotic promoter operably linked to reference. Administration can be rapid as by injection or the polynucleotide e.g., a cytomegalovirus (CMV) promoter. made over a period of time as by slow infusion or adminis 0271 Additionally vectors include viral vectors, fusion tration of slow release formulations. proteins and chemical conjugates. Retroviral vectors include 0277. The subject antisense oligonucleotides can also be Moloney murine leukemia viruses and HIV-based viruses. linked or conjugated with agents that provide desirable phar One HIV-based viral vector comprises at least two vectors maceutical orpharmacodynamic properties. For example, the wherein the gag and pol genes are from an HIV genome and antisense oligonucleotide can be coupled to any Substance, the env gene is from another virus. DNA viral vectors are known in the art to promote penetration or transport across the preferred. These vectors include pox vectors such as orthopox blood-brain barrier, such as an antibody to the transferrin oravipox vectors, herpesvirus vectors such as a herpes sim receptor, and administered by intravenous injection. The anti plex I virus (HSV) vector, Adenovirus Vectors and Adeno sense compound can be linked with a viral vector, for associated Virus Vectors). example, that makes the antisense compound more effective 0272. The antisense compounds of the invention encom and/or increases the transport of the antisense compound pass any pharmaceutically acceptable salts, esters, or salts of across the blood-brain barrier. Osmotic blood brain barrier Such esters, or any other compound which, upon administra disruption can also be accomplished by, e.g., infusion of tion to an animal, including a human, is capable of providing Sugars including, but not limited to, mesoerythritol. Xylitol, (directly or indirectly) the biologically active metabolite or D(+) galactose, D(+) lactose, D(+) Xylose, dulcitol, myo residue thereof. inositol. L(-) fructose, D(-) mannitol, D(+) glucose, D(+) 0273. The term “pharmaceutically acceptable salts' refers arabinose, D(-) arabinose, cellobiose, D(+) maltose, D(+) to physiologically and pharmaceutically acceptable salts of raffinose, L(+)rhamnose, D(+) melibiose, D(-) ribose, adoni the compounds of the invention: i.e., salts that retain the tol, D(+) arabitol L(-) arabitol, D(+) fucose, L(-) fucose, desired biological activity of the parent compound and do not D(-) lyxose, L(+) lyxose, and L(-) lyxose, or amino acids impart undesired toxicological effects thereto. For oligo including, but not limited to, glutamine, lysine, arginine, US 2015/0284724 A1 Oct. 8, 2015 28 asparagine, aspartic acid, cysteine, glutamic acid, glycine, 0284. Formulations of the present invention include lipo histidine, leucine, methionine, phenylalanine, proline, serine, Somal formulations. As used in the present invention, the term threonine, tyrosine, Valine, and taurine. Methods and materi "liposome” means a vesicle composed of amphiphilic lipids als for enhancing blood brain barrier penetration are arranged in a spherical bilayer or bilayers. Liposomes are described, e.g., in U.S. Pat. No. 4,866,042, “Method for the unilamellar or multilamellar vesicles which have a membrane delivery of genetic material across the blood brain barrier' formed from a lipophilic material and an aqueous interior that U.S. Pat. No. 6.294,520, “Material for passage through the contains the composition to be delivered. Cationic liposomes blood-brain barrier, and U.S. Pat. No. 6,936,589, “Parenteral are positively charged liposomes that are believed to interact delivery systems, all incorporated herein by reference in with negatively charged DNA molecules to form a stable their entirety. complex. Liposomes that are pH-sensitive or negatively 0278. The subject antisense compounds may be admixed, charged are believed to entrap DNA rather than complex with encapsulated, conjugated or otherwise associated with other it. Both cationic and noncationic liposomes have been used to molecules, molecule structures or mixtures of compounds, deliver DNA to cells. for example, liposomes, receptor-targeted molecules, oral, 0285 Liposomes also include “sterically stabilized' lipo rectal, topical or other formulations, for assisting in uptake, Somes, a term which, as used herein, refers to liposomes distribution and/or absorption. For example, cationic lipids comprising one or more specialized lipids. When incorpo may be included in the formulation to facilitate oligonucle rated into liposomes, these specialized lipids result in lipo otide uptake. One such composition shown to facilitate somes with enhanced circulation lifetimes relative to lipo uptake is LIPOFECTIN (available from GIBCO-BRL, Somes lacking such specialized lipids. Examples of sterically Bethesda, Md.). stabilized liposomes are those in which part of the vesicle 0279 Oligonucleotides with at least one 2'-O-methoxy forming lipid portion of the liposome comprises one or more ethyl modification are believed to be particularly useful for glycolipids or is derivatized with one or more hydrophilic oral administration. Pharmaceutical compositions and for polymers, such as a polyethylene glycol (PEG) moiety. Lipo mulations for topical administration may include transdermal somes and their uses are further described in U.S. Pat. No. patches, ointments, lotions, creams, gels, drops, supposito 6,287,860. ries, sprays, liquids and powders. Conventional pharmaceu 0286 The pharmaceutical formulations and compositions tical carriers, aqueous, powder or oily bases, thickeners and of the present invention may also include Surfactants. The use the like may be necessary or desirable. Coated condoms, of Surfactants in drug products, formulations and in emul gloves and the like may also be useful. sions is well known in the art. Surfactants and their uses are 0280. The pharmaceutical formulations of the present further described in U.S. Pat. No. 6,287,860, which is incor invention, which may conveniently be presented in unit dos porated herein by reference. age form, may be prepared according to conventional tech 0287. In one embodiment, the present invention employs niques well known in the pharmaceutical industry. Such tech various penetration enhancers to effect the efficient delivery niques include the step of bringing into association the active of nucleic acids, particularly oligonucleotides. In addition to ingredients with the pharmaceutical carrier(s) or excipient(s). aiding the diffusion of non-lipophilic drugs across cell mem In general, the formulations are prepared by uniformly and branes, penetration enhancers also enhance the permeability intimately bringing into association the active ingredients of lipophilic drugs. Penetration enhancers may be classified with liquid carriers or finely divided solid carriers or both, and as belonging to one of five broad categories, i.e., Surfactants, then, if necessary, shaping the product. fatty acids, bile salts, chelating agents, and non-chelating 0281. The compositions of the present invention may be nonsurfactants. Penetration enhancers and their uses are fur formulated into any of many possible dosage forms such as, ther described in U.S. Pat No. 6,287,860, which is incorpo but not limited to, tablets, capsules, gel capsules, liquid Syr rated herein by reference. ups, soft gels, Suppositories, and enemas. The compositions 0288 One of skill in the art will recognize that formula of the present invention may also be formulated as Suspen tions are routinely designed according to their intended use, sions in aqueous, non-aqueous or mixed media. Aqueous i.e. route of administration. Suspensions may further contain Substances that increase the 0289 Formulations for topical administration include Viscosity of the Suspension including, for example, sodium those in which the oligonucleotides of the invention are in carboxymethylcellulose, sorbitol and/or dextran. The suspen admixture with a topical delivery agent such as lipids, lipo sion may also contain stabilizers. Somes, fatty acids, fatty acid esters, , chelating agents 0282 Pharmaceutical compositions of the present inven and Surfactants. Lipids and liposomes include neutral (.g. tion include, but are not limited to, Solutions, emulsions, diolcoyl-phosphatidyl DOPE ethanolamine, dimyris foams and liposome-containing formulations. The pharma toylphosphatidyl choline DMPC, distearolyphosphatidyl ceutical compositions and formulations of the present inven choline) negative (e.g. dimyristoylphosphatidyl glycerol tion may comprise one or more penetration enhancers, carri DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl ers, excipients or other active or inactive ingredients. DOTAP and dioleoyl-phosphatidyl ethanolamine DOTMA). 0283 Emulsions are typically heterogeneous systems of 0290 For topical or other administration, oligonucle one liquid dispersed in another in the form of droplets usually otides of the invention may be encapsulated within liposomes exceeding 0.1 um in diameter. Emulsions may contain addi or may form complexes thereto, in particular to cationic lipo tional components in addition to the dispersed phases, and the Somes. Alternatively, oligonucleotides may be complexed to active drug that may be present as a solution in either the lipids, in particular to cationic lipids. Fatty acids and esters, aqueous phase, oily phase or itself as a separate phase. Micro pharmaceutically acceptable salts thereof, and their uses are emulsions are included as an embodiment of the present further described in U.S. Pat. No. 6,287,860. invention. Emulsions and their uses are well known in the art 0291 Compositions and formulations for oral administra and are further described in U.S. Pat. No. 6,287,860. tion include powders or granules, microparticulates, nanopar US 2015/0284724 A1 Oct. 8, 2015 29 ticulates, Suspensions or solutions in water or non-aqueous agents contemplated for administration to patients in combi media, capsules, gel capsules, Sachets, tablets or minitablets. nation with the antisense oligonucleotides of the present Thickeners, flavoring agents, diluents, emulsifiers, dispersing invention are described in: U.S. Pat. No. 7,855,289 “Sirtuin aids or binders may be desirable, oral formulations are those modulating compounds” and; U.S. Pat. No. 7,829,556 “Sir in which oligonucleotides of the invention are administered in tuin modulating compounds; U.S. Pat. App. Pub. No. 2009/ conjunction with one or more penetration enhancers Surfac 0143376, "Fused Heterocyclic Compounds and Their Use as tants and chelators. Surfactants include fatty acids and/or Sirtuin Modulators;” U.S. Pat. App. Pub. No. 2009/0069301, esters or salts thereof, bile acids and/or salts thereof, bile Acridine and Quinoline Derivatives as Sirtuin Modulators: acids/salts and fatty acids and their uses are further described U.S. Pat. App. Pub. No. 2007/0037865, “Sirtuin modulating in U.S. Pat. No. 6,287,860, which is incorporated herein by compounds;” U.S. Pat. App. Pub. No. 2007/01494.66. “Meth reference. Also are combinations of penetration enhancers, ods and related compositions for treating or preventing obe for example, fatty acids/salts in combination with bile acids/ sity, insulin resistance disorders, and mitochondrial-associ salts. A particularly combination is the Sodium salt of lauric ated disorders; each incorporated herein by reference in its acid, capric acid and UDCA. Further penetration enhancers entirety. include polyoxyethylene-9-lauryl ether, polyoxyethylene 0295 Examples of such chemotherapeutic agents include 20-cetyl ether. Oligonucleotides of the invention may be but are not limited to cancer chemotherapeutic drugs such as delivered orally, in granular form including sprayed dried daunorubicin, daunomycin, dactinomycin, doxorubicin, epi particles, or complexed to form micro or nanoparticles. Oli rubicin, idarubicin, esorubicin, bleomycin, mafosfamide, gonucleotide complexing agents and their uses are further ifosfamide, cytosine arabinoside, bischloroethyl-nitroSurea, described in U.S. Pat. No. 6,287,860, which is incorporated buSulfan, mitomycin C, actinomycin D. mithramycin, pred herein by reference. nisone, hydroxyprogesterone, testosterone, tamoxifen, dac 0292 Compositions and formulations for parenteral, arbazine, procarbazine, hexamethylmelamine, pentameth intrathecal or intraventricular administration may include ylmelamine, mitoxantrone, amsacrine, chlorambucil, sterile aqueous Solutions that may also contain buffers, dilu methylcyclohexylnitroSurea, nitrogen mustards, melphalan, ents and other suitable additives such as, but not limited to, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cyt penetration enhancers, carrier compounds and other pharma arabine, 5-azacytidine, hydroxyurea, deoxycoformycin, ceutically acceptable carriers or excipients. 4-hydroxyperoxycyclo-phosphoramide, 5-fluorouracil 0293 Certain embodiments of the invention provide phar (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate maceutical compositions containing one or more oligomeric (MTX), colchicine, taxol. Vincristine, vinblastine, etoposide compounds in combination with one or more additional (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, agents. The additional agents can function by a non-antisense teniposide, cisplatin and diethylstilbestrol (DES). When used mechanism. A second agent is, e.g., an agent currently used with the compounds of the invention, Such chemotherapeutic for treatment of the Sirtuin-associated disease or disorder. A agents may be used individually (e.g., 5-FU and oligonucle second agent can alternatively be a non-Sirtuin modulating otide), sequentially (e.g., 5-FU and oligonucleotide for a agent, e.g., a chemotherapeutic agent. For example, in the period of time followed by MTX and oligonucleotide), or in treatment of a cancer, one or more chemotherapeutic agents combination with one or more other such chemotherapeutic useful in treating the particular cancer can be administered in agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radio combination with at least one antisense oligonucleotide of the therapy and oligonucleotide). Anti-inflammatory drugs, present invention. A combination treatment regimen encom including but not limited to nonsteroidal anti-inflammatory passes treatment regimens in which administration of a SIRT drugs and corticosteroids, and antiviral drugs, including but antisense oligonucleotide is initiated prior to, during, or after not limited to ribivirin, Vidarabine, acyclovir and ganciclovir, treatment with a second agent, and continues until any time may also be combined in compositions of the invention. Com during treatment with the second agent or after termination of binations of antisense compounds and other non-antisense treatment with the second agent. It also includes treatments in drugs are also within the scope of this invention. Two or more which the agents being used in combination are administered combined compounds may be used together or sequentially. simultaneously or at different times and/or at decreasing or 0296. In another related embodiment, compositions of the increasing intervals during the treatment period. Combina invention may contain one or more antisense. compounds, tion treatment includes periodic treatments that start and stop particularly oligonucleotides, targeted to a first nucleic acid at various times to assist with the clinical management of the and one or more additional antisense compounds targeted to patient. For example, an agent in the combination can be a second nucleic acid target. For example, the first target may administered weekly at the onset of treatment, decreasing to be a particular antisense sequence of a Sirtuin (SIRT), and the biweekly, and decreasing further as appropriate. second target may be a region from another nucleotide 0294 Other Sirtuin-modulating agents that can be admin sequence. Alternatively, compositions of the invention may istered to a patient in combination with the antisense oligo contain two or more antisense compounds targeted to differ nucleotides of the present invention have been described in ent regions of the same Sirtuin (SIRT) nucleic acid target. the literature, e.g., in U.S. Pat. App. Pub. No. 2000/0163476, Numerous examples of antisense compounds are illustrated “N-Phenyl Benzamide Derivatives as Sirtuin Modulators.” herein and others may be selected from among Suitable com incorporated herein by reference in its entirety. This publica pounds known in the art. Two or more combined compounds tion reports the use of certain Sirtuin modulating compounds may be used together or sequentially. for treating neurodegenerative diseases, and traumatic or Dosing mechanical injury to the central nervous system (CNS), Spi nal cord or peripheral nervous system (PNS). It also lists 0297. The formulation of therapeutic compositions and additional therapeutic agents that can be used in combination their Subsequent administration (dosing) is believed to be with Sirtuin-modulating agents. Yet other Sirtuin-modulating within the skill of those in the art. Dosing is dependent on US 2015/0284724 A1 Oct. 8, 2015 30 severity and responsiveness of the disease State to be treated, Example 1 with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of Design of Antisense Oligonucleotides Specific for a the disease state is achieved. Optimal dosing schedules can be Nucleic Acid Molecule Antisense to a Sirtuin (SIRT) calculated from measurements of drug accumulation in the And/or a Sense Sound of a Sirtuin (SIRT) body of the patient. Persons of ordinary skill can easily deter Polynucleotide mine optimum dosages, dosing methodologies and repetition 0302 As indicated above the term, "oligonucleotide spe rates. Optimum dosages may vary depending on the relative cific for or "oligonucleotide targets” refers to an oligonucle potency of individual oligonucleotides, and can generally be otide having a sequence (i) capable of forming a stable com estimated based on EC50s found to be effective in invitro and plex with a portion of the targeted gene, or (ii) capable of in vivo animal models. In general dosage is from 0.01 ug to forming a stable duplex with a portion of an mRNA transcript 100g per kg of body weight, and may be given once or more of the targeted gene. daily, weekly, monthly or yearly, or even once every 2 to 20 0303 Selection of appropriate oligonucleotides is facili years. Persons of ordinary skill in the art can easily estimate tated by using computer programs that automatically align repetition rates for dosing based on measured residence times nucleic acid sequences and indicate regions of identity or homology. Such programs are used to compare nucleic acid and concentrations of the drug in bodily fluids or tissues. sequences obtained, for example, by searching databases Following successful treatment, it may be desirable to have Such as GenBank or by sequencing PCR products. Compari the patient undergo maintenance therapy to prevent the recur Son of nucleic acid sequences from a range of species allows rence of the disease state, wherein the oligonucleotide is the selection of nucleic acid sequences that display an appro administered in maintenance doses, ranging from 0.01 ug to priate degree of identity between species. In the case of genes 100g per kg of body weight, once or more daily, to once every that have not been sequenced, Southern blots are performed to 20 years. allow a determination of the degree of identity between genes 0298. In embodiments, a patient is treated with a dosage of in target species and other species. By performing Southern drug that is at least about 1, at least about 2, at least about 3. blots at varying degrees of stringency, as is well known in the at least about 4, at least about 5, at least about 6, at least about art, it is possible to obtain an approximate measure of identity. These procedures allow the selection of oligonucleotides that 7, at least about 8, at least about 9, at least about 10, at least exhibit a high degree of complementarity to target nucleic about 15, at least about 20, at least about 25, at least about 30, acid sequences in a subject to be controlled and a lower degree at least about 35, at least about 40, at least about 45, at least of complementarity to corresponding nucleic acid sequences about 50, at least about 60, at least, about 70, at least about 80, in other species. One skilled in the art will realize that there is at least about 90, or at least about 100 mg/kg body weight. considerable latitude in selecting appropriate regions of Certain injected dosages of antisense oligonucleotides are genes for use in the present invention. described, e.g., in U.S. Pat. No. 7,563,884, Antisense modu 0304. An antisense compound is “specifically hybridiz lation of PTPIB expression, incorporated herein by reference able' when binding of the compound to the target nucleic acid in its entirety. interferes with the normal function of the target nucleic acid to cause a modulation of function and/or activity, and there is 0299 While various embodiments of the present invention a sufficient degree of complementarity to avoid non-specific have been described above, it should be understood that they binding of the antisense compound to non-target nucleic acid, have been presented by way of example only, and not limita sequences under conditions in which specific binding is tion. Numerous changes to the disclosed embodiments can be desired, i.e., under physiological conditions in the case of in made in accordance with the disclosure herein without Vivo assays or therapeutic treatment, and under conditions in departing from the spirit or scope of the invention. Thus, the which assays are performed in the case of in vitro assays. breadth and scope of the present invention should not be 0305 The hybridization properties of the oligonucleotides limited by any of the above described embodiments. described herein can be determined by one or more in vitro 0300 All documents mentioned herein are incorporated assays as known in the art. for example, the properties of the herein by reference. All publications and patent documents oligonucleotides described herein can be obtained by deter cited in this application are incorporated by reference for all mination of binding strength between the target natural anti purposes to the same extent as if each individual publication sense and a potential drug molecules using melting curve or patent document were so individually denoted. By their assay. citation of various references in this document. Applicants do 0306 The binding strength between the target natural anti sense and a potential drug molecule (Molecule) can be esti not admit any particular reference is “prior art” to their inven mated using any of the established methods of measuring the tion. Embodiments of inventive compositions and methods strength of intermolecolar interactions, for example, a melt are illustrated in the following examples. ing curve assay. 0307 Melting curve assay determines the temperature at EXAMPLES which a rapid transition from double-stranded to single Stranded conformation occurs for the natural antisense/Mo 0301 The following non-limiting Examples serve to illus leoule complex. This temperature is widely accepted as a trate selected embodiments of the invention. It will be appre reliable measure of the interaction strength between the two ciated that variations in proportions and alternatives in ele molecules. ments of the components shown will be apparent to those 0308. A melting curve assay can be performed using a skilled in the art and are within the scope of embodiments of cDNA copy of Ac actual natural antisense RNA molecule or the present invention. a synthetic DNA or RNA nucleotide corresponding to the US 2015/0284724 A1 Oct. 8, 2015

binding site of the Molecule. Multiple kits containing all using Verso cDNA kit from Thermo Scientific necessary reagents to perform this assay are available (e.g. (cati AB 1453B) or High Capacity cINA Reverse Transcrip Applied Biosystems inc. MeltDoctor kit). These kits include tion Kit (cathá368813) as described in the manufacturers a suitable buffer solution containing one of the double strand protocol. The cDNA from this reverse transcription reaction DNA (dsDNA) binding dyes (such as ABI HRM dyes, SYBR was used to monitor gene expression by real time PCR using Green, SYTO, etc.). The properties of the dsDNA dyes are ABI Taqman Gene Expression Mix (cati4369510) and prim such that they emit almost no fluorescence in free form, but ers/probes designed by ABI (Applied Biosystems Taqman are highly fluorescent when bound to dsDNA. Gene Expression Assay: Hs00202021 ml. Hs00202030 ml, 0309 To perform the assay the cDNA or a corresponding Hs00953479 . .00202033 ml, Hs00978329 ml, oligonucleotide are mixed with Molecule in concentrations Hs00213036 ml and Hs00213029 ml by Applied Biosys defined by the particular manufacturer's protocols. The mix tems Inc. Foster City Calif.). The following PCR cycle was ture is heated to 95°C. to dissociate all pre-formed dsDNA used: 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95°C. complexes, then slowly cooled to room temperature or other for 15 seconds, 60° C. for 1 min) using StepOne Plus Real lower temperature defined by the kit manufacturer to allow Time PCR Machine (Applied Biosystems). Fold change in the DNA molecules to anneal. The newly formed complexes gene expression after treatment with antisense oligonucle are then slowly heated to 95°C. with simultaneous continu otides was calculated based on the difference in 18S-normal ous collection of data on the amount of fluorescence that is ized dOt values between treated and mock-transfected produced by the reaction. The fluorescence intensity is samples. inversely proportional to the amounts of dsDNA present in the reaction. The data can be collected using a real time PCR Results instrument compatible with the kit (e.g. ABI's StepOne Plus 0312 Real time PCR results show that the levels of the Real Time PCR System or LightTyper instrument, Roche SIRT1 mRNA in HepG2 cells significantly increased 48 h. Diagnostics, Lewes, UK). after treatment with Some antisense oligonucleotides to 0310 Melting peaks are constructed by plotting the nega SIRT1 antisense CV396200 (FIGS. 34). tive derivative of fluorescence with respect to temperature 0313 Real Time PCR results show that levels of SIRT1 (-d(Fluorescence)/dT) on the y-axis) against temperature mRNA in HepG2 cells are significantly increased in one of (X-axis) using appropriate Software (for example LightTyper the oligonucleotides designed to SIRT1 antisense CV396.200 (Roche) or SDS Dissociation Curve, ABI). The data is ana (FIG. 8). lyzed to identity the temperature of the rapid transition from 0314 Real Time PCR results show that levels of SIRT1 dsDNA complex to single strand molecules. This temperature mRNA in HepG2 cells are significantly increased in two of is called Tm and is directly proportional to the strength of the oligonucleotides designed to SIRT1 antisense CV428275 interaction between the two molecules. Typically, Tm will (FIG.9). exceed 40° C. 0315. The results show that a significant increase in SIRT1 mRNA levels in HepG2 cells 48 hours after treatment with Example 2 one of the oligonucleotides designed to SIRT antisense BE717453. (FIG. 10). Modulation of SIRT Polynucleotides 0316. The results show that show that the levels of the SIRT1 mRNA in HepG2 cells are significantly increased 48 h. Treatment of HepG2 Cells with Antisense after treatment with three of the oligonucleotides designed to Oligonucleotides SIRT1 antisense AV718812 respectively (FIG. 11). 0311. HepG2 cells from ATCC (catiHB-8065) were 0317 Real time PCR results show that the levels of SIRT1 grown in growth media (MEM/EBSS (Hyclone mRNA in HepG2 cells are significantly increased 48 h after cathSH30024, or Mediatech cat HMT-10-010-CV)+10% FBS treatment with two of the oligos designed to SIRT1 antisense (Mediatech catiMT35-011-CV)+ penicillin/streptomycin AW169958 (FIG. 12). (Mediatech cathMT30-002-CI)) at 37° C. and 5% CO. One 0318 RT PCR results show that sirt3 levels in HepG2 cells day before the experiment the cells were replated at the den are increased 48 hours after treatment with phosphorothioate sity of 1.5x10/ml into 6 well plates and incubated at 37° C. antisense oligonucleotides designed to sirt3 antisense and 5% CO. On the day of the experiment the media in the 6 Hs.683117 (CUR-1545-1550) (FIG. 17). well plates was changed to fresh growth media. Allantisense 0319 RT PCR results show that sirt3 levels in HepG2 cells oligonucleotides were diluted to the concentration of 20 uM. are increased 48 hours after treatment with phosphorothioate Two ul of this solution was incubated with 400 ul of Opti antisense oligonucleotides designed to sirt3 antisense MEM media (Gibco catfi31985-070) and 4 ul of Lipo BQ024738 and BE164357 (FIG. 18). fectamine 2000 (Invitrogen cati 11668019) at room tempera 0320 RT PCR results show that sirt3 levels in HepG2 cells ture for 20 min and applied to each well of the 6 well plates are increased 48 hours after treatment with siRNA oligo with HepG2 cells. A Similar mixture including 2 ul of wafer nucleotides designed to sirt3 antisense RIC8A and PMSD13 instead of the oligonucleotide solution was used for the mock (FIG. 19) transfected controls. After 3-18h of incubation at 37° C. and 0321 Real Time PCR results show that levels of SIRT4 5% CO, the media was changed to fresh growth media. 48 h mRNA in HepG2 cells are significantly increased 48 h after after addition of antisense oligonucleotides the media was treatment with one of the antisense oligonucleotides to SIRT4 removed and RNA was extracted from the cells using SV antisense (FIG. 22). Total RNA Isolation System from Promega (cathZ3105) or 0322 Real Time PCR results show that levels of SIRT5 RNeasy Total RNA. Isolation kit from Qiagen (cati74181) mRNA in HepG2 cells are significantly increased 48 h after following the manufacturers’ instructions. 600 ng of RNA treatment with one of the antisense oligonucleotides to SIRT5 was added to the reverse transcription reaction performed antisense Hs.671550 (FIG. 23). US 2015/0284724 A1 Oct. 8, 2015 32

0323 Real time PCR results show that the levels of SIRT6 treatment with five of the oligonucleotides designed to mRNA in HepG2 cells are significantly increased 48 h after SIRT1 mouse antisense AK044604 (FIG. 14). treatment with one of the oligos designed to SIRT6 antisense 0329 Real time PCR results show that the levels of NM 133475 (FIG. 24). SIRT1 mRNA are significantly increased in 3T3 cells 48 h. 0324 Real time PCR results show that the levels of SIRT6 after treatment with two of the oligonucleotides designed to mRNA in HepG2 cells are significantly increased 48 h after SIRT1 mouse antisense AK044604 (FIG. 15). treatment with one of the oligos designed to SIRT6 antisense 0330. Real time PCR results show that the levels of bf772662 (FIG. 25). SIRT1 mRNA are significantly increased in 3T3 cells 48 h. 0325 Real time PCR results show that the levels of SIRT7 after treatment with two of the oligonucleotides designed to mRNA in HepG2 cells are significantly increased 48 h after SIRT1 mouse antisense AK044604 (FIG. 16). treatment with one of the oligos designed to SIRT7 antisense (FIG. 29). Treatment of Vero76 Cells with Antisense Oligonucleotides Treatment of 3T3 Cells with Antisense Oligonucleotides 0331 Vero76 cells from ATCC (cath.CRL-1587) were grown in growth media (MEM/EBSS (Hyclone 0326) 3T3 cells from ATCC (cathicRL-1658) were grown cathSH30024, or Mediatech cathi MT-10-10-010-CV)+10% in growth media (MEM/EBSS (Hyclone cathSH30024, or FBS (Mediatech catiMT35-011-CV)+ penicillin/streptomy Mediatech cathi MT-10-010-CV) +10% FBS (Mediatech cin (Mediatech cathMT30-002-CI)) at 37° C. and 5% CO2. catiMT35-011-CV)+ penicillin/streptomycin (Mediatech One day before the experiment the cells were replated at the cathMT30-002-CI)) at 37° C. and 5% CO. One day before density of 1.5x10/ml into 6 well plates and incubated at 37° the experiment the cells were replated at the density of 1.5x C. and 5% CO2. On the day of the experiment the media in the 10/ml into 6 well plates and incubated at 37° C. and 5% CO. 6 well plates was changed to fresh growth media. All anti On the day of the experiment the media in the 6 well plates sense oligonucleotides were diluted in water to the concen was changed to fresh growth media. Allantisense oligonucle tration of 20 uM. 2 ul of this solution was incubated with 400 otides were diluted to the concentration of 20 LM. Two ul of ul of Opti-MEM media (Gibco cati31985-070) and 4 ul of this solution was incubated with 400 ul of Opti-MEM media Lipofectamine 2000 (Invitrogen cati 11668019) at room tem (Gibco cath31985-070) and 4 ul of Lipofectamine 2000 (In perature for 20 min and applied to each well of the 6 well vitrogen cath 11668019) at room temperature for 20 min and plates with Vero76 cells. Similar mixture including 2 ul of applied to each well of the 6 well plates with 3T3 cells. A water instead of the oligonucleotide solution was used for the Similar mixture including 2 ul of water instead of the oligo mock-transfected controls. After 3-18h of incubation at 37° nucleotide solution was used for the mock-transfected con C. and 5% CO2 the media was changed to fresh growth trols. After 3-18 h of incubation at 37° C. and 5% CO, the media. 48 h after addition of antisense oligonucleotides the media was changed to fresh growth media. 48 h after addition media was removed and RNA was extracted from the cells of antisense oligonucleotides the media was removed and using SV Total RNA. Isolation System from Promega RNA was extracted from the cells using SV Total RNA. Iso (catiZ3105) or RNeasy Total RNAIsolation kit from Qiagen lation System from Promega (catiZ3105) or RNeasy Total (cati74181), following the Manufacturers instructions. 600 RNA. Isolation kit from Qiagen (cati74181) following the ng of RNA was added to the reverse transcription reaction manufacturers instructions. 600 ng of RNA was added to the performed using Verso cDNA kit from Thermo Scientific reverse transcription reaction performed using Verso cDNA (cati AB 1453B) as described in the manufacturer's protocol. kit from Thermo Scientific (catiAB1453B) or High Capacity The cDNA from this reverse transcription reaction was used cDNA Reverse Transcription Kit (cathA368813) as described to monitor gene expression by real time PCR using ABI in the manufacturer's protocol. The cDNA from this reverse Taqman Gene Expression Mix (cathA3695.10) and primers/ transcription reaction was used to monitor gene expression by probes designed by ABI (Applied Biosystems Taqman Gene real time PCR rising ABI Taqman Gene Expression Mix Expression Assay: Hs00202021 ml by Applied Biosystems (cati4369510) and primers/probes designed by ABI (Applied Inc., Foster City Calif.). The following PCR cycle was used: Biosystems Taqman Gene Expression Assay: Hs00202021 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95° C. for 15 ml by Applied Biosystems Inc., Foster City Calif.). The fol seconds, 60° C. for 1 min) using StepOne Plus Real Time lowing PCR cycle was used: 50° C. for 2 min, 95°C. for 10 PCR Machine (Applied Biosystems). Fold change in gene min, 40 cycles of (95°C. for 15 seconds. 60° C. for 1 min) expression after treatment with antisense oligonucleotides using StepOne Plus Real Time PCR Machine (Applied Bio was calculated based on the difference in 18S-normalized dOt systems). Fold change in gene expression after treatment with values between treated and mock-transfected Samples. antisense oligonucleotides was calculated based on the dif ference in 18S-normalized dOt values between treated and Results mock-transfected samples. 0332 Real time PCR results show that the levels of the Results SIRT1 mRNA in Vero cells significantly increased 48 h after treatment with antisense oligonucleotides to SIRT1 antisense 0327. Real time PCR results show that the levels of CV396200 (FIG. 5). SIRT1 mRNA are significantly increased in 3T3 cells 48 h. 0333 Real time PCR results show that the levels of the after treatment with three of the oligonucleotides designed to SIRT3 mRNA in Vero cells significantly increased 48 h after SIRT1 mouse antisense AK044604 (FIG. 13). treatment with antisense oligonucleotides to SIRT3 antisense 0328. Real time PCR results show that the levels of SIRT1 PSMD13 (FIG. 20). RealTime PCR results show that levels mRNA are significantly increased in 3T3 cells 48 h after of SIRT7 mRNA in Vero76 cells are significantly increased US 2015/0284724 A1 Oct. 8, 2015

48 h after treatment with one of the antisense oligonucle applied to each well of the 6 well plates with 3T3 cells. A otides to SIRT7 antisense CA308253 (FIG. 27). Similar mixture including 2 ul of water instead of the oligo nucleotide solution was used for the mock-transfected con Treatment of HUVEC Cells with Antisense trols. After 3-18 h of incubation at 37° C. and 5% CO, the Oligonucleotides media was changed to fresh growth media. 48 h after addition of antisense oligonucleotides the media was removed and 0334 HUVEC cells from ATCC (Promo Cell cathC RNA was extracted from the cells using SV Total RNA. Iso 12253) were grown in Epithelial Growth Media (Promo Cell lation System from Promega (cathZ3105) or RNeasy Total cathic-22010) at 37° C. and 5% CO2. One day before the RNA. Isolation kit from Qiagen (cati74181) following the experiment the cells were replated using Promo Cell Detach manufacturers instructions. 600 ng of RNA was added to the Kit (cathC-41200) at the density of 1.5x10/ml into 6 well reverse transcription reaction performed using Verso cDNA plates and incubated at 37° C. and 5% CO2. On the day of the kit from Thermo Scientific (catiAB1453B) or High Capacity experiment the media in the 6 well plates was changed to cDNA Reverse Transcription Kit (cathA368813) as described fresh Epithelial Growth Media. All antisense oligonucle in the manufacturer's protocol. The cDNA from this reverse otides were diluted to the concentration of 20 LM. Two ul of transcription reaction was used to monitor gene expression by this solution was incubated with 400 ul of Opti-MEM media real time PCR using ABI Taqman Gene Expression Mix (Gibco cath31985-070) and 4 ul of Lipofectamine 2000 (In (cati4369510) and primers/probes designed by ABI (Applied vitrogen cati 11668019) at room temperature for 20 min and Biosystems Taqman Gene Expression Assay: Hs00202021 applied to each well of the 6 well plates with HUVEC cells. ml Hs00202030 ml, Ms00202033 ml, Hs00978329 ml, Similar mixture including 2 ul of water instead of the oligo Hs00213036 ml and Hs00213029 ml by Applied Biosys nucleotide solution was used for the mock-transfected con tems Inc., Foster City Calif.). The following PCR cycle was trols. After 3-18 h of incubation at 37° C. and 5% CO2 the used: 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95°C. media was changed to fresh growth media. 48 h after addition for 15 seconds, 60° C. for 1 min) using StepOne Plus Real of antisense oligonucleotides the media was removed and Time PCR Machine (Applied Biosystems). Fold change in RNA was extracted from the cells using SV Total RNA. Iso gene expression after treatment with antisense oligonucle lation System from Promega (catiZ3105) or RNeasy Total otides was calculated based on the difference in 18S-normal RNA. Isolation kit from Qiagen (cati74181) following the ized dOt values between treated and mock-transfected manufacturers instructions. 600 ng of RNA was added to the samples. reverse transcription reaction performed using Verso cDNA 0337 Results: Real time PCR results show that the levels kit from Thermo Scientific (catiAB1453B) as described in of SIRT6 mRNA in DBS cells are significantly increased 48 the manufacturer's protocol. The cDNA from this reverse transcription reaction was used to monitor gene expression by h after treatment with two of the oligo designed to SIRT6 real time PCR using ABI Taqman gene Expression Mix antisense bf772662 and one oligo designed to NM 133475 (cati4369510) and primers/probes designed by ABI (Applied (FIG. 26). Biosystems Taqman Gene Expression Assay: Hs00202033 Treatment of SK-N-AS Cells with Antisense ml by Applied Biosystems Inc., Foster City Calif.). The fol Oligonucleotides lowing PCR cycle was used: 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95°C. for 15 seconds, 60° C. for 1 min) 0338 SK-N-AS cells (neuroblastoma ATCCHCRL-2137) using StepOne Plus Real Time PCR Machine (Applied Bio were grown in DMEM (Mediatech cathi 10-013-CV)+10% systems Inc.) or MX4000 thermal cycler (Stratagene). Fold FBS (Mediatech cathMT35-011-CV)+penicillin/streptomy change in gene expression after treatment with antisense oli cin (Mediatech cathMT30-002-CI) at 37° C. and 5% CO2. gonucleotides was calculated based on the difference in 18S One day before the experiment the cells were replated at the normalized dOt values between treated and mock-transfected density of approximately 3x10/well into 6 well plates and samples. incubated at 37°C. and 5% CO2 overnight. At dosing the cells 0335 Results: Real Time PCR results show that levels of were about 75% confluent. To dose, the media in the 6 well SIRT4 mRNA in HUVEC cells are significantly increased 48 plates was changed to fresh DMEM+10% FBS-penicillin+ hafter treatment with one of the antisense oligonucleotides to streptomycin (1.5 ml/well). All antisense oligonucleotides SIRT4 antisense AA 156947 (FIG. 21). were diluted to the concentration of 20uMinDNAse?RNAse free sterile water (working stock). To dose one well, 2 ul of Treatment of DBS Cells with Antisense this solution was incubated with 400 ul of Opti-MEM media Oligonucleotides (Gibco catfi31985-070) and 4 ul of Lipofectamine 2000 (In vitrogen cati 11668019) at room temperature for 20 min, then 0336 DBS cells from ATCC (cathCCL-161) were grown applied dropwise to one well of a 6 well plate with SK-N-AS in growth media (MEM/EBSS (Hyclone catfiSSH30024, or cells (final oligo concentration=20 nM). An inactive oligo Mediatech cathMT-010-010-CV)+10% FBS (Mediatech nucleotide at the same concentration was used as control. catiMT35-011-CV)+ penicillin/streptomycin (Mediatech Additionally one well on each plate was dosed with a mixture cathMT30-002-CI)) at 37° C. and 5% CO. One day before of 400 ul of Opti-MEM media, 4 ul of Lipofectamine 2000 the experiment the cells were replated at the density of 1.5x and 2 ul of DNAse?RNAse-free sterile water was for the 10/ml into 6 well plates and incubated at 37° C. and 5% CO. mock-transfected controls. After about 18 h of incubation at On the day of the experiment the media in the 6 well plates 37° C. and 5% CO2 the media was changed to fresh DMEM+ was changed to fresh growth media. Allantisense oligonucle 10% FBS-penicillin+streptomycin. Approximately 48 h otides were diluted to the concentration of 20 LM. Two ul of after addition of antisense oligonuclotides the media was this solution was incubated with 400 ul of Opti-MEM media removed and RNA was extracted from the cells using SV (Gibco cath31985-070) and 4 ul of Lipofectamine 2000 (In Total RNA. Isolation System from Promega (cathZ3105) fol vitrogen cati 11668019) at room temperature for 20 min and lowing the manufacturers’ instructions. 600 ng of RNA was US 2015/0284724 A1 Oct. 8, 2015 34 added to the reverse transcription reaction performed using for 15 seconds, 60° C. for 1 min) using StepOne Plus Real High Capacity cDNA kit from Applied Biosystems Time PCR Machine (Applied Biosystems). Fold change in (cati4368813) as described in the manufacturer's protocol. gene expression after treatment with antisense oligonucle The cDNA from this reverse transcription reaction was used otides was calculated based on the difference in 18S-normal to monitor gene expression by real time PCR using ABI ized dOt values between treated and mock-transfected Taqman Gene Expression Mix (cathA3695.10) and primers/ samples. probes designed by ABI (assay ID#Hs00213029 ml for 0341 Primers and probe for the custom designed Taqman SIRT7). The following PCR cycle was used: 50° C. for 2 min, assay for exon 4; 95°C. for 10 min, 40 cycles of (95° C. for 15 seconds, 60° C. for 1 min) on the StepOne Plus Real Time PCR system (Ap plied Biosystems). The assay for 18S was manufactured by (SEQ ID NO: 128) ABI (cati4319413E). Fold change in gene expression after AACTGGAGCTGGGGTGTCTGTTTCA treatment with antisense oligonuclotides was calculated the SIRT1 natural antisense CW3962OO. based on the difference in 18S-normalized dOt values Forward Primer Seq. between treated and mock-transfected samples. (SEQ ID NO: 129) 0339 Results: Real time PCR results show that the levels CCATCAGACGACATCCCTTAACAAA of SIRT7 mRNA in SK-N-AS cells are significantly increased Reverse Primer Seq. 48 h after treatment with oligos designed to SIRT7 antisense (SEQ ID NO: 130) (FIG. 28). ACATTATATCATAGCTCCTAAAGGAGATGCA Reporter Seq. Example 3 (SEQ ID NO: 131) CAGAGTTTCAATTCCC Modulation of SIRT Gene Expression Results: The results show that the levels of the SIRT1 mRNA Materials and Methods in HepG2 cells are significantly increased 48 h after treatment with one of the siRNAs designed to sirtas (sirtas 5, P=0.01). Treatment of HepG2 Cells with Naked Antisense In the same samples the levels of sirtas RNA were signifi Oligonucleotides cantly decreased after treatment with sirtas 5, but unchanged after treatment with sirtas 6 and sirtas 7, which 0340 HepG2 cells from ATCC (catfiHB-8065) were also had no effect on the SIRT1 mRNA levels (FIG.2). Sirtas grown in growth media (MEM/EBSS (Hyclone 5, sirtas 6 and sirtas 7 SEQID NOs: 47.48 and 49 respec cathSH30024, or Mediatech cathi MT-10-010-CV)+10% FBS tively. (Mediatech catfiMT35-011-CV)+penicillin/streptomycin (Mediatech cathMT30-002-CI)) at 37° C. and 5% CO2. One Treatment of Primary Monkey Hepatocytes day before the experiment the cells were replated at the den sity of 0.5x10/ml into 6 well plates and incubated at 37° C. 0342 Primary monkey hepatocytes were introduced into and 5% CO2. On the day of the experiment the media in the culture by RxGen Inc. and plated in 6 well plates. They were 6 well plates was replaced with 1.5 ml/well of fresh growth treated with oligonucleotides as follows. The media in the 6 media. Allantisense oligonucleotides were diluted in water to well plates was changed to fresh growth media consisting of the concentration of 20 uM.2ul of this solution was incubated William's Medium E (Sigma catiW4128) supplemented with 400 ul of Opti-MEM media (Gibco cath31985-070) and with 5% FBS, 50U/ml penicillin and 50 ug/ml streptomycin, 4 ul of Lipofectamine 2000 (Invitrogen cati 11668019) at 4 ug/ml insulin, 1 uM dexamethasone, 10 ug/ml Fungin (In room temperature for 20 min and applied to each well of the Vivogen, San Diego Calif.). All antisense oligonucleotides 6 well plates with HepG2 cells. Similar mixture including 2 ul were diluted to the concentration of 20 uM, 2 ul of this of water instead of the oligonucleotide solution was used for solution was incubated with 400 ul of Opti-MEM media the mock-transfected controls. After 3-18 h of incubation at (Gibco cathi 1985-070) and 4 ul of Lipofectamine 2000 (Invit 37° C. and 5% CO2 the media was changed to fresh growth rogen cati 11668019) at room temperature for 20 min and media. 72 h after addition of antisense oligonucleotides the applied to each well of the 6 well plates with cells. Similar cells were redosed as described above, 48 h after the second mixture including 2 ul of water instead of the oligonucleotide dosing of antisense oligonucleotides the media was removed solution was used for the mock-transfected controls. After and RNA was extracted from the cells using SV Total RNA 3-18 h of incubation at 37° C. and 5% CO2 the media was Isolation System from Promega (catiZ3105) or RNeasy Total changed to fresh growth media. 48 h after addition of anti RNA. Isolation kit from Qiagen (cati74181) following the sense oligonucleotides the media was removed and RNA was manufacturers instructions. 600 ng of RNA was added to the extracted from the cells using SVTotal RNAIsolation System reverse transcription reaction performed using Verso cDNA from Promega (cathZ3105) or RNeasy Total RNA. Isolation kit from Thermo Scientific (catiAB1453B) as described in kit from Qiagen (cati74181) following the manufacturers the manufacturer's protocol. The cDNA from this reverse instructions. 600 ug of RNA was added to the reverse tran transcription reaction was used to monitor gene expression by scription reaction performed using Verso cDNA kit from real time PCR using ABI Taqman Gene Expression Mix Thermo Scientific (catfi AB 1453B) as described in the manu (cati4369510) and primers/probes designed by ABI (Applied facturer's protocol. The cDNA from this reverse transcription Biosystems Taqman Gene Expression Assay: Hs00202021 reaction was used to monitor gene expression by real time ml, Hs00202030 ml, Hs00202033 ml, Hs00978329 ml, PCR using ABI Taqman Gene Expression Mix Hs00213036 ml and Hs00213029 ml by Applied Biosys (cati4369510) and primers/probes designed by ABI (Applied tems Inc., Foster City Calif.). The following PCR cycle was Biosystems Taqman Gene Expression Assay: Hs00202021 used: 50° C. for 2 min, 95°C. for 10 min, 40 cycles of (95°C. ml, Hs00202030 ml, Hs00202033 ml, Hs00978329 ml, US 2015/0284724 A1 Oct. 8, 2015

Hs00213036 ml and Hs00213029 ml by Applied Biosys Test System Rationale tems Inc., Foster City Calif.). The following PCR cycle was used: 50° C. for 2 min, 95°C. or 10 min, 40 cycles of (95°C. 0350. The primate is a suitable non rodent species, accept for 15 seconds, 60° C. for 1 min) using MX4000 thermal able to regulatory authorities as an indicator of potential cycler (Stratagene). Fold change in gene expression after hazards, and for which extensive background data are avail treatment with antisense oligonucleotides was calculated able. The African green monkey specifically is a highly clini based on the difference in 18S-normalized dOt values cally relevant model of multiple human physiologic and dis between treated and mock-transfected samples. ease States. 0343 Results: The results are shown in FIG. 7. Real time 0351. The intravenous route of administration corre PCR results show an increase in SIRT1 mRNA levels after sponds to a possible human therapeutic route. The dose of the test articles was based on the results of the dose finding treatment with an oligonucleotide against SIRT1 antisense. studies of analogous compounds previously performed in the Example 4 African green monkey. 0352 African green monkeys were chosen as the primate Efficacy and Duration of Action Study of CUR 963 of choice as the test Substances target sequences are con in the African Green Monkey served across species with 100% homology in primates. Additionally, the test Substance is a synthetic oligonucleotide. 0344) The objective of this study was to assess and com Consequently, dosing in primates allows for a Superior pare the effect of antisense knockdown of the discordant assessment of the efficacy of these compounds that would be noncoding antisense sequences that regulate the SIRT1 genes more reflective of the uptake likely to be seen in humans than following intravenous administration in a nonhuman primate in any other species. model. The antisense oligonucleotide testarticles designed to inhibit the SIRT1 regulatory sequences were designated as Animals CUR 963. 0353 Species Chorocebus sabaeus, non-human primate 0354 Breed: African green monkey indigenous to St. CUR 96.3 : Kitts. (SEQ ID NO: 43) 0355 Source: RxGen. Lower Bourryeau, Si, Kitts, West G'k-Tik CikTikGik AikTikGik Gik-Ask-Gik A. Indies. CUR 962 (control) ; 0356 Expected Age: The test animals were adults. (SEQ ID NO: 132) 0357 Expected Body Weight: The monkeys weigh G'k-C kT k Ak G'kT kC kT kG kT kT kg. approximately 3-4 kg. The actual range may vary but will be documented in the data. Regulatory Test Guidelines 0358 Sex: The test animals were adult females. 0345. This study was designed in accordance with 0359. Number of Animals: Ten animals were screened to accepted toxicological principles and to comply with Inter ensure identification of 8 animals appropriate for enrollment national Conference of Harmonization (ICH) Harmonized in the study. Tripartite Guidelines (Non-Clinical Safety Studies for the 0360 Number on Study: Females: 8 Conduct of Human Clinical Trials for Pharmaceuticals ICH 0361. Justification for Number on Study: This study was M3 (m), 2000 Nov. 9), and generally accepted procedures for designed to use the fewest number of animals possible, con the testing of therapeutic agents. sistent with the primary objective of evaluating the therapeu tic efficacy of the testarticle in the African green monkey and Test And Control Articles prior studies of the systemic administration of this type of oligonucleotide in this Species. Test Article Identity and Preparation 0362 Animal Specification: Ten adult African Green monkeys in the weight range of 3 to 4 kg, were employed in (0346. The testarticle, CUR-963, is a chemically stabilized the study. The monkeys were drug-naive adult animals antisense oligonucleotide. The vehicle for intravenous deliv humanely trapped from the feral population that inhabits the ery is phosphate-buffered saline (PBS). island. Trapped monkeys were treated with antihelminthics to eliminate any possible intestinal parasite burden and were Vehicle Characterization observed in quarantine for a minimum of 4 weeks prior to 0347 For the PBS vehicle, the composition, batch num screening for study enrollment. The age of trapped monkeys ber, expiry date and storage conditions (temperature and were estimated by size and dentation, with the exclusion of Light/dark) was obtained from the supplier. older animals from the study. Prior to study enrollment, a clinical exam was performed on each monkey, including Test Article Storage and Handling evaluation of locomotion and dexterity. Blood samples were taken and sent to Antech Diagnostics (Memphis, Tenn.) for 0348. The test substance and vehicle were stored accord comprehensive clinical chemistries and a complete blood ing to the received storage conditions Supplied by the Sponsor count and lipid profiles (see sections 9.2 and 319507928 for and manufacturer, accordingly. specifications). Monkeys with abnormal lab values, as deter mined by comparison to the established normal range for Analysis of the Test Article Formulations monkeys in the St. Kitts colony, were excluded from the 0349 Samples of the test article formulation will be cryo study. In order to identify 8 monkeys that satisfy this criterion, preserved for analysis of the concentration, stability and 10 monkeys were screened, with the screening of additional homogeneity of the test Substance formulations. animals as needed. Before study initiation, the selected mon US 2015/0284724 A1 Oct. 8, 2015 36 keys will be transferred to individual cages to acclimate to numbering system. This system uniquely identifies each individual housing for a one-week period. Only animals monkey by a letter followed by a three digit number, e.g. deemed suitable for experimentation will be enrolled in the YO32. study. The actual (or estimated) age and weight ranges at the 0368 Route and Frequency of Administration: Animals start of the study will be detailed in the raw data and final were dosed once daily on Days 1, 3, and 5 delivered intrave report. nously by manual infusion over-10 min. The infusion rate will 0363 Animals Health and Welfare: The highest standards be 24 mL/kg/h. The animals were sedated with ketamine and of animal welfare were followed and adhered to guidelines Xylazinc prior to and during the dosing procedure. A venous stipulated by the St. Kitts Department of Agriculture and the catheter (Terumo mini infusion set, 20 gauge needle, or U.S. Department of Health and Human Services. All studies similar appropriate infusion set) was inserted into the Saphe will be conducted in accordance with these requirements and nous vein. Dosing took place in each monkey between 8:00 all applicable codes of practice for the care and housing of and 10:00 a.m. shortly after the animals wake and prior to laboratory animals. All applicable standards for veterinary feeding. A blood sample to assess plasma cholesterol and care, operation, and review as contained in the NIH Guide for other lipid levels as described in Blood Chemistry section the Care and Use of Animals. The St. Kitts facility maintains below, was collected just prior to each infusion. Blood col an animal research committee that reviews the protocols and lection preceded feeding at both sampling intervals to mini inspects the facilities as required by the Guide. The Founda mize dietary effects on cholesterol measurements. tion has an approved assurance filed with the Office of Labo 0369 Clinical Observations: All visible signs of reaction ratory Animal Welfare, as required by the Guide, #A4384-01 to treatment were recorded on each day of dosing. In addition, (Axion Research Foundation/St. Kitts Biomedical Founda the animals were examined at least once each week for physi tion). There are no special nonhuman primate Veterinary care cal attributes Such as appearance and general condition. issues and biohazard issues raised by the research specified in 0370 Body Weights: Body weights were recorded at this study. weekly intervals during the treatment and post-treatment 0364 Housing and Environment: To allow detection of periods. any treatment-related clinical signs, the animals were housed 0371 Food Consumption: Individual food consumption individually prior to Surgery and postoperatively until sacri was not quantified. Feeding patterns were however monitored fice. The primate building in which the individual cages were and a note made of any major changes. situated were illuminated entirely by ambient light, which at 0372 Mortality and Morbidity: Mortality and morbidity 17 degrees north latitude approximates a 12 hr. 12 hr light will be recorded. Any decision regarding premature sacrifice dark cycle as recommended in the U.S. D.H.H.S guidelines. will be made after consultation with the Study Director and The RxGen primate building was completely ventilated to the wish the Sponsor's Monitoring Scientist, if possible. Animals outside. Additional air movement was assured by ceiling fans that are found dead or killed prematurely will be subjected to to maintain a constant target temperature of 23-35°C., as is necropsy with collection of liver, kidney, heart and spleen typical of St. Kitts throughout the year. Twenty-four hour lung tissues for histopathology. In the event of premature extremes of temperature and relative humidity (which also sacrifice a blood sample will also be taken (if possible) and the parameters determined. Animals that are found dead after will not be controlled) were measured daily. During the study, regular working hours will be refrigerated overnight and the cages were cleaned at regular intervals, necropsies performed at the start of the next working day. If 0365 Diet and Water: Bach animal was offered approxi mately 90 grams per day of a standard monkey chow diet the condition of an animal requires premature sacrifice, it will (TekLad, Madison, Wis.). The specific nutritional composi be euthanized by intravenous overdose of sodium pentobar tion of the diet was recorded. The water was periodically bital. All research is governed by the Principles for Use of analyzed for microbiological purity. The criteria for accept Animals. RxGen is required by law to comply with the U.S. able levels of contaminants in Stock diet and water Supply Department of Health and Human Services standards for were within the analytical specifications established by the primate facility, which dictates the levels of severity that the diet manufacturer and the periodic facility water evaluations, procedures within this study, specified as mild, must abide. respectively. The water met all criteria necessary for certifi cation as acceptable for human consumption. Clinical Laboratory Studies 0373 Fat Biopsies: A subcutaneous fat biopsy was per Experimental Design formed on all study monkeys except Y775 on study days 26 by tissue extraction through a 1 cm midline incision inferior 0366 Animal Identification and Randomization: Alloca to the umbilicus. Biopsies were immediately immersed in a tion was done by means of a stratified randomization proce labeled cryotube containing 2 mls of RNAlater (Qiagen) and dure based on bodyweight and plasma cholesterol profiles. incubated at 4°C. overnight, after which the RNAlater was Prior to and after allocation to a group, each animal was aspirated and the sample tube flash frozen in liquid nitrogen. identified by a tattoo on the abdomen. Tattoos are placed on Following transportation in liquid nitrogen total RNA was all colony animals as a means of identification in the course of isolated for real-time qPCR of target genes. routine health inspections. A cage plan was drawn up to 0374 Results. Real time PCR results show an increase in identify the individuals housed within, and individual mon SIRT1 mRNA levels in fat biopsies from monkeys dosed with keys were further identified by a labeled tag attached to their CUR-963, an oligonucleotide designed to SIRT1 antisense respective cage. CV396200.1, compared to monkeys dosed with CUR-962 0367 Group sizes, doses and identification numbers: The (SEQ ID NO.: 132), an oligonucleotide which had no effect animals were assigned to 2 treatment groups, comprised of 4 on SIRT1 expression in vivo (designed to ApoA1 antisense monkeys in each group. Specific animal identification num DA327409, data not shown). mRNA levels were determined bers were provided to each monkey according to the facility by real time PCR (FIG. 6). US 2015/0284724 A1 Oct. 8, 2015 37

Example 5 (0380 Blood Collection by Facial Vein Puncture: Mice are restrained by the scruff of the neck and base of the tail, In vivo Modulation of Sirtuin (SIRT) by Antisense slightly compressing the blood vessels of the neck through the DNA Oligonucleotides tautness of the grip on the neck skin. The sampling site is on 0375 Treatment with Antisense DNA Oligonucleotides the jaw slightly in front of the angle of the mandible. The skin (ASO); Antisense oligonucleotides (ASO) specific for SIRT1 at the sampling site is punctured with an 18 G needle or a AS are administered to C57Bl/6J mice which are fed a high lancet at a 90° angle until the tip of the needle/lancer just fat diet for 12 weeks to induce obesity and diabetes. The passes through the skin. Blood samples are collected using treatment of the mice with ASO will start at the time of the microhematocrit tubes. After blood has been collected, the implementation of the high fat diet. Mice are injected IP once grip on the neck is loosened and pressure is applied at the a week with ASO prepared in normal saline, at a concentra insertion site with agauze sponge to ensure hemostasis. 0.05 tion of 5 mg/kg. 0.2ml of blood will be collected by this method. This proce 0376 Measurements of body weight and food intake: dure will be performed only once in week 5 of the high fat diet Body weight and food intake of mice are measured twice per and eventually in week 12 if the intracardiac puncture is not week, prior to IP injection of the ASO. working (see below). Blood hormones which regulate the 0377 Blood glucose measurements: Fed and fasted blood metabolism of glucose and lipids (such as insulin, adiponec glucose concentrations are measured each week by taking a tin and leptin) are measured using commercially available sample of blood from the tail vein. ELISA kits. (e.g., R&D Systems, Minneapolis, Minn., Assay 0378. Glucose Tolerance Tests (GTT): The GTT will be done totally twice per mouse, halfway through the diet (at Pro St. Charles, Mo., Mabtech, Mariemont, Ohio) week 4) and near the end (at week 10) of the high fat diet. The 0381 Intracardiac Puncture: At the end of the 12 week GTT will inform us about the glucose tolerance of the mice high fat diet, mice will be anesthetized by continuous isoflu that is the capacity to rapidly clear a glucose bolus from the rane inhalation. Anesthesia is induced by placing the mice in blood stream. This is a measure for diabetes. Mice are fasted an induction box, which is Supplied with isoflurane and oxy overnight for 16 hours. Mice are injected IP glucose 2 g/kg. gen. Mice will be restrained on their back. The heart is punc This translates into a final volume of 0.2 ml 30% (w/v) glu tured with a 27 G needle. Following exsanguineation, the cose solution for a mouse of 30 g weight. Glucose measure head is decapitated to ensure death. Tissues (liver, pancreas, ments are taken prior to glucose injection and at 5, 15, 30, 60. white and brown adipose tissue, and skeletal muscle) are 90 and 120 min post-injection. Glucose is measured by cut collected for further investigations (RNA and protein mea ting the tail tip 1 mm from the end of the tail under isoflurane surements and histology). Around 0.5-1 ml of blood will be anesthesia prior to IP glucose injection. The blood droplet is obtained and used to determine several critical parameters of aspirated into a strip and glucose concentration is measured glucose and lipid metabolism (glucose, insulin, cholesterol, with a glucometer. The GTT will be done totally twice per triglycerides, free fatty acids, leptin, adipokines, corticoster mouse, halfway through the diet (at week 4) and near the end oids, thyroid hormones). If difficulties occur in this method, (at week 10) of the high fat diet. The GTT will informus about we will collect blood by facial vein puncture under isoflurane the glucose tolerance of the mice that is the capacity to rapidly anesthesia instead (see above). clear a glucose bolus from the blood stream. This is a measure for diabetes. 0382 Although the invention has been illustrated and 0379 Insulin Tolerance Test (ITT): Mice are fasted for 6 described with respect to one or more implementations, hours from 9 am till 3 pm. Mice are then injected IP 0.5-1U equivalent alterations and modifications will occur to others Insulin/kg. The insulin concentration will be adjusted Such skilled in the art upon the reading and understanding of this that the final injected volume is 0.1-0.15 ml. Blood, glucose specification and the annexed drawings. In addition, while a measurements are taken prior to injection and at 5, 15, 30.45, particular feature of the invention may have been disclosed and 60 minutes post-injection. Blood is collected exactly as with respect to only one of several implementations, such described under GTT. In addition to monitoring the glucose feature may be combined with one or more other features of levels, the behavior of the mice is constantly observed during the other implementations as may be desired and advanta the ITT. Hypoglycemia can manifest as a change in behavior geous for any given or particular application. with the animals becoming very quiet and showing discom 0383. The Abstract of the disclosure will allow the reader fort. To prevent hypoglycemia, glucose (1 g/kg) is injected IP to quickly ascertain the nature of the technical disclosure. It is in a final volume of 0.1 -0.15 ml as soon as the blood glucose submitted with the understanding that it will not be used to concentration falls below 50 mg/ml or signs of discomfort are interpret or limit the scope or meaning of the following observed. claims.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 145

<21 Os SEQ ID NO 1 &211s LENGTH: 4110 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 3 O Os PUBLICATION INFORMATION: <3O8 DATABASE ACCESSION NUMBER: NMO 12238.4 &309s DATABASE ENTRY DATE: 2011 - 01-03

US 2015/0284724 A1 Oct. 8, 2015 39

- Continued aagatgagcc tatgttcca gagagagctg gaggagctgg atttgggact gatggagatg 222 O atcaagaggc aattaatgaa gCt at atctg taalacagga agtaacagac atgaact at C 228O catcaaacaa at catagtgt aataattgtg caggtacagg aattgttcca ccago attag 234 O gaactittagc atgtcaaaat gaatgtttac ttgttgaactic gatagagcaa ggaalaccaga 24 OO aaggtgtaat atttataggit togg taaaata gattgtttitt catggataat ttitta acttic 246 O attatttctg tacttgtaca aact caacac taacttittitt ttttittaaaa aaaaaaaggit 252O actaagtatic ttcaat cago togttggtcaa gactaactitt cittittaaagg tt catttgta 2580 tgataaattic atatgtgitat atataattitt ttttgttttgtctagtgagt ttcaa.cattt 264 O ttaaagttitt caaaaa.gc.ca toggaatgtt aaattaatgt aaagggalaca gctaatc tag 27 OO accaaagaat gig tattitt ca cittitt ctittg taa cattgaa toggtttgaag tactcaaaat 276 O ctgttacgct aaacttittga ttctittaa.ca caattattitt taalacactgg catttitccaa 282O aactgtggca gctaacttitt taaaatctica aatgacatgc agtgtgagta gaaggaagtic 288O aacaatatgt ggggaga.gca citcggttgtc. titt acttitta aaagtaatac ttggtgctaa 294 O gaattt cagg attattgt at ttacgttcaa atgaagatgg ctitttgtact tcc tdtggac 3 OOO atgtag taat gtctatattg gct cataaaa cita acctgaaaaacaaataa atgctittgga 3 O 6 O aatgttt cag ttgctittaga aac attagtg cct gcctgga t coccittagt tttgaaatat 312 O ttgc cattgttgtttaaata cctat cactg tdgtagagct togcattgat c ttitt coacala 318O gtattaaact gccaaaatgt gaatatgcaa agc ctittctgaatctataat aatgg tactt 324 O

Ctactgggga gagtgtaata ttittggactg. Ctgttitt coa ttaatgagga gagcaac agg 33 OO cc cctdatta tacagttcca aagtaataag atgttaattig taatticagoc agaaagtaca 3360 tgtctic cc at tdgaggatt ttgttaaa taccaaactg. Ctagc cc tag tattatggag 342O atgaacatga tigatgtaact totaatagca gaatagittaa togaatgaaac tagttctitat 3480 aattitat citt tatttaaaag cittagcctgc cittaaaacta gagat caact ttct cagotg 354 O caaaagctitc tagt ctitt ca agaagttcat actittatgaa attgcacagt aag catttat 36OO ttitt cagacc atttittgaac at cacticcita aattaataaa gtatt cotct gttgctittag 366 O tatttattac aataaaaagg gtttgaaata tagctgttct titatgcataa aac acccagc 372 O taggac catt act gccagag aaaaaaatcg tattgaatgg ccatttic cct acttataaga 378 O tgtc.tcaatc tdaatttatt toggctacact aaagaatgca gtatatt tag titt to cattt 384 O gcatgatgtt tdtgtgctat agatgatatt ttaaattgaaaagtttgttt taaattattt 3900 ttacagtgaa gactgttitt.c agct citttitt at attgtaca tagt cittitta totaatttac 396 O tggcatatgt tttgtag act gtttaatgac toggatat citt cct tcaactt ttgaaataca 4 O2O aaac cagtgt tttitt acttg tacactgttt taaagtictat taaaattgtc atttgactitt 4 O8O tittctgttaa cittaaaaaaa aaaaaaaaaa 411 O

<210s, SEQ ID NO 2 &211s LENGTH: 3806 &212s. TYPE: DNA <213s ORGANISM: Mus musculus &3 OO PUBLICATION INFORMATION: <3O8 DATABASE ACCESSION NUMBER: NMOO1159589.1 309s. DATABASE ENTRY DATE: 2010-07-18 <313> RELEVANT RESIDUES IN SEO ID NO : (1) ... (3806

US 2015/0284724 A1 Oct. 8, 2015 49

- Continued atatacgacc ticciccatgta ctagt cittac at accc.cago to cagttaga actataattit 42O ttittgcactic ttgcagtaat titcacagoat cittcaattgt attaatat ct tttcttttitt 48O t cctttittgg toggttctgaa aggat attaa taacaatctg. ccacagtgtc. atat catcca 54 O acticaggtgg agg tattgtt t cc.ggcaata aatctittaag aattgttcga ggatctgtgc 6OO

Caat cataag atgttgctga acaaaagt at atggacctac aataaggggg aaaaggctta 660 aagttcaactt atcaagtaat tcaaaatcto atttatttitc tdaagtaatg agittagcatt 72 O ctgtgagggit tttittgcaaa gtaagaaaat gcaatttaat gig tattt cat t ct cqgtaca 78O Ctcaga atta atgctatatc C caatgagat taggaagatc taatgaagag ttgggalagac 84 O cc cctt cago totaagtata tatttcaaga gtctaattaa ttaacaacca gaattaagtt 9 OO cittatggitta at atctagaa acacacacca taataccaaa agtatttaca aaagggttct 96.O acga cataga aaaatcgtac cagtic ctaaa agcct gtact actitat catt aaaac cacac 1 O2O aggaaaaa 1028

<210s, SEQ ID NO 10 &211s LENGTH: 429 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (7) . . (7) <223> OTHER INFORMATION: n is a, c, g, or t & 22 O FEATURE; <221 > NAMEAKEY: misc feature <222s. LOCATION: (373) ... (373) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (400) ... (4 OO) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 10 cgacganaac ataagc actt ttaattitcct citct attatgctacagacaa gogo cqaagac 6 O tgggttttitt aggttgttta aggctgtaaa gaaaacaaag alacatatgac agaga.ccct a 12 O tgcagtctgc aaag.catact acatatttac taccaggc.cc tacct tact a cagaaagttt 18O gctgat coag ctgtgaac at at accc.cgat gcagatgaaa acaaatacaa aacaaac cta 24 O acttgc catt ttggtcacaa gagcaagtaa gtag cagagc cct gttittga tatgaaaatc 3OO cago actgga citgggcaa.ca toggcgaga cc ccatctotac caaaaatact aaaaaaatag 360 ccgggcatgg triggcacat Ctgtag tact agct acttgn gaggctgaga Caggaga at C 42O atttgagcc 429

<210s, SEQ ID NO 11 &211s LENGTH: 508 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens

<4 OOs, SEQUENCE: 11 gaagaagaag cagc.catgat gat aggtgat agat.ccgaaa taatggccac atttgttaac 6 O atttitt coat ttctaalacca to cittaaaga aaatcatagt atggggt cac accatcc to a 12 O cgg tagt cca atagagcaac catgc catct ggatt catgt titt caccaat aaagaactgg 18O tagtttittga aattagcaag gatgtgcttg atttgttctg cagcc cctdt cataaaaggit 24 O

US 2015/0284724 A1 Oct. 8, 2015 57

- Continued ttgg tatt.ca caag 14

<210s, SEQ ID NO 25 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 25 aaactggaaa ccta 14

<210s, SEQ ID NO 26 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <4 OOs, SEQUENCE: 26 gatctittatg agaa 14

<210s, SEQ ID NO 27 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 27 gatggaga aa ttgg 14

<210s, SEQ ID NO 28 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 28 agtctgatgg agaa 14

<210s, SEQ ID NO 29 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 29 tgttaaggga tigt C 14

<210s, SEQ ID NO 3 O &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 30 aatctgcttt tott 14

<210s, SEQ ID NO 31 US 2015/0284724 A1 Oct. 8, 2015 58

- Continued

&211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 31 agggaattga aatc 14

<210s, SEQ ID NO 32 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 32 taaggcaaga titt c 14

<210s, SEQ ID NO 33 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 33 taaatggagt taag 14

<210s, SEQ ID NO 34 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 34 ttatttatag caca 14

<210s, SEQ ID NO 35 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 35 ttgcttctgc titat 14

<210s, SEQ ID NO 36 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 36 aaaaaaat at ttgc 14

<210s, SEQ ID NO 37 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2015/0284724 A1 Oct. 8, 2015 59

- Continued <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 37 cago cittaaa aaaa 14

<210s, SEQ ID NO 38 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 38 ttittaaaa.cc totC 14

<210s, SEQ ID NO 39 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 39 tagttcagat ttitt 14

<210s, SEQ ID NO 4 O &211s LENGTH: 14 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 4 O agcagttgct aaat 14

<210s, SEQ ID NO 41 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 41

Ctgagtgcag cagc 14

<210s, SEQ ID NO 42 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 42 gtctgatgga ga 12

<210s, SEQ ID NO 43 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 43 US 2015/0284724 A1 Oct. 8, 2015 60

- Continued gtctgatgga ga 12

<210s, SEQ ID NO 44 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 44 gtctgatgga ga 12

<210s, SEQ ID NO 45 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 45 guctgatgga ga 12

<210s, SEQ ID NO 46 &211s LENGTH: 12 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 46 gluculgalugga ga 12

<210s, SEQ ID NO 47 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 47 actgacacct aattgt attc acatgaa 27

<210s, SEQ ID NO 48 &211s LENGTH: 26 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 48 tgagcagcag ttgctaaatt agttca 26

<210s, SEQ ID NO 49 &211s LENGTH: 27 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 49 tctacctaca ttatat cata gct cota 27

<210s, SEQ ID NO 50 US 2015/0284724 A1 Oct. 8, 2015 61

- Continued

&211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 50 ttgg tatt.ca caagtgaaa 19

<210s, SEQ ID NO 51 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 51 ttgctaaatt agttcagat 19

<210s, SEQ ID NO 52 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 52 gcagcagcag ttgctaaat 19

<210s, SEQ ID NO 53 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 53 gcagttgcta aattagttc 19

<210s, SEQ ID NO 54 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 54 gccatgttgc C cagtic cagt

<210s, SEQ ID NO 55 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 55 gggctctgct act tacttgc

<210s, SEQ ID NO 56 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2015/0284724 A1 Oct. 8, 2015 62

- Continued <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 56 cc.cagt ctitc agccttgtct

<210s, SEQ ID NO 57 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 57 gggit citctgt catatgttct t 21

<210s, SEQ ID NO 58 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 58 titcc tacct t c cct coat a 19

<210s, SEQ ID NO 59 &211s LENGTH: 19 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 59 attic citacct tcc ct coat 19

<210s, SEQ ID NO 60 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 60 CCttagggitt gcagotaatt

<210s, SEQ ID NO 61 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 61 atcc.ca.gcta ct caggaggc

<210s, SEQ ID NO 62 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 62 US 2015/0284724 A1 Oct. 8, 2015 63

- Continued tctggctgag tec agtggct

<210s, SEQ ID NO 63 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 63 Cctgggagtt ggaggttgca

<210s, SEQ ID NO 64 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 64

Cagatcc.cat gaa.gc.caaga g 21

<210s, SEQ ID NO 65 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 65

Ctgactgc.ca t cagaagtgg 21

<210s, SEQ ID NO 66 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 66 gcc catctgc titgcttgat 19

<210s, SEQ ID NO 67 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 67 atcc to acca cagt cittgt 19

<210s, SEQ ID NO 68 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 68 gct tactitcc toc tocctitt

<210s, SEQ ID NO 69 US 2015/0284724 A1 Oct. 8, 2015 64

- Continued

&211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 69 cCaggtgata ggagcagaac t 21

<210s, SEQ ID NO 70 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 7 O accct cottic ct coct cit ct

<210s, SEQ ID NO 71 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 71 ccactic tocc ttctgtcc to t 21

<210s, SEQ ID NO 72 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 72 cotcott.cct coctict ct ct

<210s, SEQ ID NO 73 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 73 gtctgtc.cca t catgcCagg

<210s, SEQ ID NO 74 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 74 tittctgat co togctgcct ct

<210s, SEQ ID NO 75 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2015/0284724 A1 Oct. 8, 2015 65

- Continued <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 75 accct cottic ct coc 15

<210s, SEQ ID NO 76 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 76 cit cott cotic cct c 14

<210s, SEQ ID NO 77 &211s LENGTH: 11 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 77 cit cott cotc. c. 11

<210s, SEQ ID NO 78 &211s LENGTH: 15 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 78 ct tcc tocct citctic 15

<210s, SEQ ID NO 79 &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 79 atcc togctgc ct ct 14

<210s, SEQ ID NO 8O &211s LENGTH: 14 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 80 cit cott cotic cct c 14

<210s, SEQ ID NO 81 &211s LENGTH: 15 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 81 US 2015/0284724 A1 Oct. 8, 2015 66

- Continued accct cottic ct coc 15

<210s, SEQ ID NO 82 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 82 gttctggctic tictgtagga

<210s, SEQ ID NO 83 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 83 atgct cactic act tcc.ggcg

<210s, SEQ ID NO 84 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 84

Ctttgttggtg tdagcc tittg t 21

<210s, SEQ ID NO 85 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 85 aggtgtgagc gCaggg taca

<210s, SEQ ID NO 86 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 86 citcggittaca gcgcgt.ct ct

<210s, SEQ ID NO 87 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OO > SEQUENCE: 87 aact ct cogg C9tttgcag 19

<210s, SEQ ID NO 88 US 2015/0284724 A1 Oct. 8, 2015 67

- Continued

&211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 88 tgttgtc.cca gttact cot 19

<210s, SEQ ID NO 89 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 89 gccaggagtt Caagagcagc

<210s, SEQ ID NO 90 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 90 ccttgttggc acct cactgt

<210s, SEQ ID NO 91 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 91 gttgttgcggit taatactic cc

<210s, SEQ ID NO 92 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 92 gtgagt ct cq aagtgg tagc t 21

<210s, SEQ ID NO 93 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 93 gact cittatc tacctgtggg a 21

<210s, SEQ ID NO 94 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2015/0284724 A1 Oct. 8, 2015 68

- Continued <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 94 gtc.ccaccac acctagdaca

<210s, SEQ ID NO 95 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 95 ggctatgtgt gg tatgtggit

<210s, SEQ ID NO 96 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 96 tCagggtgga gtgcggtgtt

<210s, SEQ ID NO 97 &211s LENGTH: 2O & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OO > SEQUENCE: 97 acccacctgc acatcc tic ct

<210s, SEQ ID NO 98 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 98 gtaatgcc.ca cagt cccacc t 21

<210s, SEQ ID NO 99 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 99 Cagagggtgg tggtcatggit

<210s, SEQ ID NO 100 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 1.OO US 2015/0284724 A1 Oct. 8, 2015 69

- Continued tctgtgggtg Cttcaagtgt

<210s, SEQ ID NO 101 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 101 agggcc atgc ticgttcttgc

<210s, SEQ ID NO 102 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 102 gtgttgttgg aagttggaggc

<210s, SEQ ID NO 103 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 103 tcc cattctt gaaccttgcc t 21

<210s, SEQ ID NO 104 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 104 cagatticoag titcc cattca

<210s, SEQ ID NO 105 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 105 gttgttggaga gttgctgc ct

<210s, SEQ ID NO 106 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 106 gatagaccca tdctgaccac a 21

<210s, SEQ ID NO 107 US 2015/0284724 A1 Oct. 8, 2015 70

- Continued

&211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 107 gcqttt coaa gtc.ctgaacc c 21

<210s, SEQ ID NO 108 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 108 gcct tctotc citccct coat

<210s, SEQ ID NO 109 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 109 toctitcct co citcccttgct

<210s, SEQ ID NO 110 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 110 gcatct caaa goctoctic cc

<210s, SEQ ID NO 111 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 111

Cttctaga cc Caggagtgag C 21

<210s, SEQ ID NO 112 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 112 toctitcto ct cittgttctotc c 21

<210s, SEQ ID NO 113 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 2015/0284724 A1 Oct. 8, 2015 71

- Continued <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 113 gcc.ctgtgtt tot cotct co

<210s, SEQ ID NO 114 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 114 actic cc.gtgg totctgttgtc. t 21

<210s, SEQ ID NO 115 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 115 tccago aacc ticact citccc

<210s, SEQ ID NO 116 &211s LENGTH: 2O & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 116 gcgtgggtgt ggt cagtgta

<210s, SEQ ID NO 117 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 117 accaccitcct gct coagact

<210s, SEQ ID NO 118 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 118 cctcitccctc. tctctgtc.to t 21

<210s, SEQ ID NO 119 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 119 US 2015/0284724 A1 Oct. 8, 2015 72

- Continued at cit to cotic to accott c 19

<210s, SEQ ID NO 120 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 120 ccctitctgtc. tcatct tccc t 21

<210s, SEQ ID NO 121 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense Oligonucleotide <4 OOs, SEQUENCE: 121 tctgtgtc.ca cct gtc.t.ccc

<210s, SEQ ID NO 122 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 122 cggg tattta ttgctgtac 19

<210s, SEQ ID NO 123 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide <4 OOs, SEQUENCE: 123 gccagt ccca cacatttcca c 21

<210s, SEQ ID NO 124 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 124 gggaggttgt gttgttgttggga

<210s, SEQ ID NO 125 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Antisense oligonucleotide

<4 OOs, SEQUENCE: 125 caac cittgttgtcc cagoc ct

<210s, SEQ ID NO 126 US 2015/0284724 A1 Oct. 8, 2015 73

- Continued

LENGTH: 27 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense oligonucleotide SEQUENCE: 126 ccagugu.gcc aaluccCagau ggugcuu. 27

SEO ID NO 127 LENGTH: 27 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense oligonucleotide SEQUENCE: 127 clugclucagac acuggulagau cculugau. 27

SEQ ID NO 128 LENGTH: 25 TYPE: DNA ORGANISM: Homo sapiens

< 4 OOs SEQUENCE: 128 aactggagct ggggtgtctg titt.ca 25

SEQ ID NO 129 LENGTH: 25 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Forward Primer Sequence SEQUENCE: 129 c catcagacg a catcc citta acaaa 25

SEQ ID NO 130 LENGTH: 31 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Reverse Primer Sequence SEQUENCE: 13 O acattatat catagotcc ta aaggagatgc a 31

SEQ ID NO 131 LENGTH: 16 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Reporter Sequence

SEQUENCE: 131 cagagttt ca attic cc 16

SEQ ID NO 132 LENGTH: 12 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense Oligonucleotide

US 2015/0284724 A1 Oct. 8, 2015 75

- Continued tgtgcaggta Caggaattgt t ccaccagca ttaggaactt tag catgtca aaatgaatgt 1860 ttacttgttga act cataga gcaaggaaac Cagaaaggtg taatatttat aggttggtaa 1920 aatagattgt ttitt catgga taatttittaa citt cattatt totgtactitg tacaaactica 198O acactaactt tttitttittitt aaaaaaaaaa agg tact aag tat cittcaat cagctgttgg 2O4. O t caagacitaa ctittcttitta aaggttcatt td tatgataa att catatgt gtatatataa 21OO tttitttttgt tttgtctagt gagtttcaac atttittaaag titt to aaaaa gocatcggaa 216 O tgttaaatta atgtaaaggg aac agctaat citagaccaaa gaatgg tatt ttcacttitt c 222 O tttgtaac at tdaatggttt gaagtactica aaatctgtta cqctaaactt ttgattctitt 228O aacacaatta tttittaaa.ca citggcatttt coaaaactgt gigcagctaac tttittaaaat 234 O Ctcaaatgac atgcagtgtgagtagaagga agt caacaat atgtggggag agc acticggit 24 OO tgtc.tt tact tittaaaagta at acttggtg ctaagaattt caggattatt g tatttacgt. 246 O tcaaatgaag atggcttittg tact tcctgt giga catgtag taatgtctat attggct cat 252O aaaact aacc tdaaaaacaa ataaatgctt tdgaaatgtt toagttgctt tagaaac att 2580 agtgcc tigcc toggat.cccct tagttittgaa at atttgcca ttgttgttta aatacctatic 264 O actgtggtag agcttgcatt gat cittitt co acaagtatta aactgccaaa atgtgaatat 27 OO gcaaagcct t t ctdaatcta taataatggit acttic tactg giggagagtgt aatattittgg 276 O actgctgttt to cattaatgaggaga.gcaa caggc.ccctg attatacagt to caaagtaa 282O talagatgtta attgtaattic agc.ca.gaaag tacatgtctic ccattgggag gatttggtgt 288O taaataccaa actgctagoc ctag tatt at ggagatgaac atgatgatgt aacttgtaat 294 O agcagaatag ttaatgaatgaaact agttc titataattta t ctittattta aaa.gcttagc 3 OOO ctgc cittaaa act agagat.c aactittctica gctgcaaaag cittctagt ct ttcaagaagt 3 O 6 O t catactitta tdaaattgca cagtaag.cat ttatttitt.ca gaccatttitt gaa catcact 312 O cctaaattaa taaagtatt c citctgttgct ttagt attta ttacaataaa aagggitttga 318O aatatagotg ttctittatgc ataaaacacc cagctaggac cattact gcc agagaaaaaa 324 O atcg tattga atggccattt coc tactitat aagatgtct c aatctgaatt tatttggcta 33 OO cactaaagaa tdcagtatat ttagttitt co atttgcatga tigtttgttgttg ctatagatga 3360 tattittaaat tdaaaagttt gttittaaatt atttitta cag togaag actgt titt cagotct 342O ttittatattg tacatagt ct tittatgtaat titactgg cat atgttttgta gactgtttaa 3480 tgactggata t ct tcc titca acttittgaaa tacaaaacca gtgttttitta cittgtacact 354 O gttittaaagt ct attaaaat tdt catttga ctitttittctg tta acttaaa aaaaaaaaaa 36OO aaaa. 36O4

<210s, SEQ ID NO 134 &211s LENGTH: 2O78 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens &3 OO PUBLICATION INFORMATION: <3O8 DATABASE ACCESSION NUMBER: NM O30593.2 309s. DATABASE ENTRY DATE: 2010- 08-15 <313> RELEVANT RESIDUES IN SEO ID NO : (1) ... (2O78

<4 OOs, SEQUENCE: 134 agag tatt cq ggaggactac aact citctag ccgttcc cac attitt coggg cqc cotttac 6 O