www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 17
KLF4-SQSTM1/p62-associated prosurvival autophagy contributes to carfilzomib resistance in multiple myeloma models
Irene Riz1, Teresa S. Hawley2 and Robert G. Hawley1 1 Department of Anatomy and Regenerative Biology, The George Washington University, Washington, DC, USA 2 Flow Cytometry Core Facility, The George Washington University, Washington, DC, USA Correspondence to: Robert G. Hawley, email: [email protected] Keywords: multiple myeloma, proteasome inhibitor, carfilzomib, autophagy, KLF4 Received: April 29, 2015 Accepted: May 22, 2015 Published: June 19, 2015
This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Multiple myeloma (MM) is an incurable clonal plasma cell malignancy. Because of a high rate of immunoglobulin synthesis, the endoplasmic reticulum of MM cells is subjected to elevated basal levels of stress. Consequently, proteasome inhibitors, which exacerbate this stress by inhibiting ubiquitin-proteasome-mediated protein degradation, are an important new class of chemotherapeutic agents being used to combat this disease. However, MM cells still develop resistance to proteasome inhibitors such as carfilzomib. Toward this end, we have established carfilzomib- resistant derivatives of MM cell lines. We found that resistance to carfilzomib was associated with elevated levels of prosurvival autophagy, and Kruppel-like factor 4 (KLF4) was identified as a contributing factor. Expression levels as well as nuclear localization of KLF4 protein were elevated in MM cells with acquired carfilzomib resistance. Chromatin immunoprecipitations indicated that endogenous KLF4 bound to the promoter regions of the SQSTM1 gene encoding the ubiquitin-binding adaptor protein sequestosome/p62 that links the proteasomal and autophagic protein degradation pathways. Ectopic expression of KLF4 induced upregulation of SQSTM1. On the other hand, inhibitors of autophagy sensitized MM cells to carfilzomib, even in carfilzomib-resistant derivatives having increased expression of the multidrug resistance protein P-glycoprotein. Thus, we report here a novel function for KLF4, one of the Yamanaka reprogramming factors, as being a contributor to autophagy gene expression which moderates preclinical proteasome inhibitor efficacy in MM.
INTRODUCTION of relapsed/refractory MM patients who have received at least two prior therapies including bortezomib and Multiple myeloma (MM), the second most an immunomodulatory drug [9]. While encouraging, common hematologic malignancy in the United States, the overall response rates to carfilzomib monotherapy is characterized by the accumulation of clonal plasma in pivotal phase II studies were <25% (17.1% in the cells in the bone marrow [1]. Although MM patients PX‑171‑004 study and 23.7% in the PX‑171‑003‑A1 initially respond to therapy, they inevitably relapse due study, respectively) [10, 11], indicating that the majority to the development of treatment resistance [2]. The of the MM cells that became resistant to bortezomib also introduction of the proteasome inhibitor bortezomib has exhibited resistance to carfilzomib. Thus, it is important improved clinical outcome of MM patients [3]. However, to elucidate the underlying mechanisms of proteasome MM cells acquire resistance to bortezomib by diverse inhibitor resistance in MM and identify novel agents that mechanisms [4-8]. Carfilzomib is a second generation will enhance therapeutic efficacy of this class of anti-MM proteasome inhibitor that was approved in 2012 by the drugs. U.S. Food and Drug Administration for the treatment MM exhibits considerable genetic heterogeneity, with particular cytogenetic abnormalities such as www.impactjournals.com/oncotarget 14814 Oncotarget the t(4;14) chromosomal translocation consistently approximately 8 weeks. In the current study, KMS-11/Cfz associated with poor outcome [12]. In previous work, we and KMS-34/Cfz cells were profiled for gene expression identified upregulated expression of the ABCB1-encoded after 1 week of growth in the absence of carfilzomib P-glycoprotein multidrug resistance efflux pump in together with parental KMS-11 and KMS-34 cells which t(4;14)-positive KMS-34 MM cells following short-term had not been selected in the drug. exposure to carfilzomib [13]. To gain further insight into We employed GSEA to query gene sets in the the various mechanisms of carfilzomib resistance, we Molecular Signature Database (MSigDB) to uncover subjected another t(4;14)-positive MM cell line, KMS- processes or pathways shared between KMS-11/Cfz 11, together with KMS-34 to long-term selection in and KMS-34/Cfz cells that potentially contributed to increasingly higher concentrations of the drug, deriving carfilzomib resistance [14]. We first applied GSEA to carfilzomib-resistant KMS-11/Cfz and KMS-34/Cfz cells, examine gene sets from the canonical pathways (C2:CP) respectively. Of note, overexpression of ABCB1 was collection of MSigDB (1,330 gene sets). The most not observed in KMS-11/Cfz cells. Gene set enrichment significantly enriched set of upregulated genes in the analysis (GSEA) [14] of microarray gene expression carfilzomib-resistant derivatives was the proteasome profiling data implicated increased expression of the pathway (Kegg: hsa03050), with PSMB5 encoding the pluripotency reprogramming factor Kruppel-like factor 4 β5 proteasome subunit targeted by carfilzomib as the top- (KLF4) [15] as contributing to carfilzomib resistance in ranked gene (normalized enrichment score, NES = 2.62, both cases. false discovery rate, FDR < 0.001; Figure S1A) [23]. The Depending on the type of cancer and genetic context, strength of the GSEA method is its utility in identifying KLF4 can act as either a tumor suppressor or an oncogene modest changes in expression of groups of genes [16]. Notably, high levels of KLF4 expression often occur distributed across entire networks or pathways [14]. Real- in MM patients carrying the t(4;14) translocation [17, time reverse transcription polymerase chain reaction (qRT- 18]. Moreover, it was previously reported that exogenous PCR) analysis validated the microarray expression data expression of KLF4 partially protected some MM cell that PSMB5 mRNA levels were only slightly increased lines from cytotoxicity induced by the alkylating agent (Table 1). Likewise, no marked increase was observed melphalan, and the partial protection was attributed to a in mRNA for the immunoproteasome β5i/LMP7 subunit proliferation block [19]. In the current study, we found (encoded by PSMB8) that is also specifically targeted by that acquisition of carfilzomib resistance in both t(4;14)- carfilzomib [23]. Based on prior findings that bortezomib- positive MM cell line models was associated with reduced resistant cell lines with 2- to 4-fold increased PSMB5 cell proliferation, decreased plasma cell maturation, and mRNA levels retained sensitivity to carfilzomib [24], activation of prosurvival autophagy. Specifically, we show these results suggested that additional mechanisms may that KLF4 plays a role in prosurvival autophagy by binding contribute to carfilzomib resistance in KMS-11/Cfz and to the promoter regions and increasing the expression of KMS-34/Cfz cells. SQSTM1 encoding the ubiquitin-binding adaptor protein It was recently demonstrated that MM cells can sequestosome (SQSTM1/p62) that links the proteasomal acquire resistance to bortezomib via de-commitment to and selective autophagic protein degradation pathways plasma cell differentiation [7]. Notably, among 1,910 gene [20, 21]. Furthermore, resensitization of KMS-11/Cfz and sets in the immunologic signatures (C7) collection, three KMS-34/Cfz cells to carfilzomib could be achieved by of those that were highly scored reflected a partial reversal cotreatment with the autophagy inhibitor chloroquine [22]. of plasma cell maturation in the carfilzomib-resistant MM derivatives. The most significantly enriched gene set in RESULTS KMS-11/Cfz and KMS-34/Cfz cells corresponded to genes with increased expression in IgM-memory B cells versus plasma cells (NES = 1.75, FDR = 0.005; Figure KLF4 contributes to molecular phenotype of 1A). A set containing genes more highly expressed in carfilzomib-resistant MM cells naive B cells than in plasma cells (NES = 1.49, FDR = 0.06; Figure 1B) and one containing genes with higher levels of expression in Ig isotype-switched memory B KMS-11 and KMS-34 cells were exposed to cells relative to plasma cells (NES = 1.46, FDR = 0.06; stepwise increasing concentrations of carfilzomib over Figure 1C) were also significantly enriched. We observed a period of 18 weeks: cells adapted to growth in 4 nM that KLF4 was included within the leading edge subset carfilzomib by 4 weeks, in 6 nM in another 6 weeks and in of upregulated genes in all three gene sets, in line with 12 nM after a further 8 weeks, albeit proliferating slower its higher expression in naive and memory B cells than than parental cells not exposed to the drug. The resulting in plasma cells [25-27]. Furthermore, using GeneSpring MM cell cultures, denoted KMS-11/Cfz and KMS-34/ analysis software, we found overrepresentation of KLF4 Cfz, respectively, retained resistance to carfilzomib target genes previously characterized by genome-wide even when tested after removal of selective pressure for chromatin immunoprecipitation (ChIP) in embryonic stem www.impactjournals.com/oncotarget 14815 Oncotarget Table 1: Gene expression changes associated with acquisition of carfilzomib resistance (KMS-11/Cfz and KMS-34/Cfz) and KLF4 overexpression (KMS-11/KLF4) in MM cells Gene Fold Change KMS-11/Cfz KMS-34/Cfz KMS-11/KLF4 CCND1 0.06 0.17 1.12 CYP1A1 3.02 2.77 2.17 GLIPR1 1.19 1.22 0.70 HGF 0.76 0.45 0.65 HOXB7 1.33 1.69 1.38 ID1 3.61 2.29 1.63 IFIT3 1.25 1.87 0.73 IGF1 0.69 0.93 1.07 MAPT 1.21 0.94 1.13 NQO1 1.85 1.25 1.21 NQO2 1.09 1.05 0.75 P4HA2 0.70 0.67 0.68 PSMB5 1.09 1.11 0.83 SLAMF7 0.12 0.53 0.59 TLR4 1.43 3.56 1.13 Shown are fold changes relative to corresponding parental cells (mean values of three qRT-PCR experiments).
cells by Orkin and colleagues [28] among the differentially suggesting that upregulation of KLF4 may contribute to expressed genes in KMS-11/Cfz (89 out of 887 genes, fold carfilzomib resistance. change, FC ≥ 1.4; P = 2.02 x 10-3) and KMS-34/Cfz (92 We confirmed increased expression of KLF4 out of 888 genes, FC ≥ 1.5; P = 6.47 x 10-4) (Table S1), mRNA in carfilzomib-resistant MM cells by qRT-
Figure 1: GSEA enrichment plots and heat maps of differentially expressed B lineage-related genes associated with acquisition of carfilzomib resistance in KMS-11 and KMS-34 cells. A. Gene set: GSE13411_IGM_MEMORY_BCELL_VS_ PLASMA_CELL_UP (M3249). B. Gene set: GSE13411_NAIVE_BCELL_VS_PLASMA_CELL_UP (M3243). C. Gene set: GSE13411_ SWITCHED_MEMORY_BCELL_VS_PLASMA_CELL_UP (M3251). FDR, false discovery rate; NES, normalized enrichment score; CfzR, carfilzomib-resistant derivatives; KLF4 is indicated. www.impactjournals.com/oncotarget 14816 Oncotarget PCR analysis (Figure 2A), which was paralleled by a the less differentiated plasma cell phenotype revealed corresponding increase in KLF4 protein levels (~3.0 by GSEA analysis above. Moreover, SLAMF7 mRNA ± 0.7-fold, n = 4, P < 0.009 by paired Student’s t test) levels were also reduced following ectopic expression detected by western blotting (Figure 2B). Consistent with of KLF4 in KMS-11 cells. Together, the accumulated its function as a transcriptional regulator and potential data supported the notion that carfilzomib-resistant MM role in the carfilzomib-resistant phenotype [29, 30], cells had increased KLF4 transcriptional activity which immunofluorescence confocal microscopy revealed more was associated with the partial reversal of plasma cell prominent nuclear localization of KLF4 in the carfilzomib- maturation during acquisition of drug resistance. resistant MM derivatives (Figure 2C). We tested the hypothesis that KLF4 might contribute GSEA identifies altered expression of KLF4 target to the molecular phenotype of carfilzomib-resistant genes associated with autophagy and metabolic MM cells by short-term expression of a KLF4 cDNA in pathways in carfilzomib-resistant MM cells KMS-11 cells (denoted KMS-11/KLF4). Fourteen genes showing differential expression in KMS-11/Cfz (FC ≥ 1.4) and/or KMS-34/Cfz (FC ≥ 1.5) versus parental We next used GSEA to examine gene sets from MM cells were selected, and their expression levels the C2:CGP chemical and genetic perturbations (3,395 compared to those in KMS-11/KLF4 cells by qRT-PCR gene sets) and C6 oncogenic signatures (189 gene sets) analysis (Table 1). A substantial degree of correlation collections of MSigDB. A highly enriched C2:CGP gene was found between the expression changes associated set in KMS-11/Cfz and KMS-34/Cfz cells (NES = 2.02, with the introduction of exogenous KLF4 and acquisition FDR < 0.007; Figure 3A) represented molecular targets of carfilzomib resistance in KMS-11/Cfz (r = 0.77) and that were upregulated during inhibition of MM cell growth KMS-34/Cfz cells (r = 0.59) for the selected set of genes following treatment with adaphostin [32]. Bortezomib (Table 1). Of note, several of the genes that exhibited reportedly triggered similar effects, and a recent study KLF4-induced changes in expression — CYP1A1, identifying c-Abl as a regulator of proteasome homeostasis NQO1, HOXB7 and ID1 — were previously identified as provides some insight into the cross-talk between the direct KLF4 targets by genome-wide ChIP analysis [28]. pathways involved [33]. Interestingly, included in the Another of the genes, SLAMF7 encodes CD319, a cell leading edge subset were several genes associated with surface marker specifically upregulated at the plasma cell autophagy (highlighted in Figure 3). Among them were stage during B cell differentiation [27, 31]. We verified MAP1LC3B encoding the autophagic effector protein that SLAMF7 mRNA levels were downregulated in the microtubule-associated protein 1 light chain Cβ, and carfilzomib-resistant MM derivatives in accord with SQSTM1 encoding the selective autophagy receptor
Figure 2: KLF4 expression in KMS-11 and carfilzomib-resistant KMS-11/Cfz cells. A. Relative KLF4 mRNA levels as determined by qRT-PCR. Also shown are KLF4 mRNA levels in KMS-34 and KMS-34/Cfz cells relative to KLF4 mRNA levels in KMS-11 cells. B. KLF4 protein levels were detected by western blotting with rabbit anti-KLF4 monoclonal antibodies against the carboxyl terminus (D1F2; Cell Signaling). Representative of four experiments. KLF4 signal in KMS-11 parental cells is less than in KMS-11/Cfz (P < 0.009). C. Cells were labeled with anti-KLF4 (Alexa Fluor 568, red) or anti-eIF4E (Alexa Fluor 488, green) antibodies, and immunofluorescence staining was analyzed by confocal laser scanning microscopy. www.impactjournals.com/oncotarget 14817 Oncotarget sequestosome 1/p62 [34, 35]. During autophagy, a soluble resistant MM derivatives. form of LC3B (LC3B-I) is converted to a form (LC3B- Conversely, among the downregulated sets of II) that specifically associates with autophagosomes genes that were enriched in KMS-11/Cfz and KMS-34/ and is recognized by SQSTM1/p62 [36]. Also included Cfz cells, one of the most highly scored in the C2:CGP was GADD45A, a growth arrest and DNA repair gene collection corresponded to genes belonging to an IRF4 previously shown to be a KLF4-inducible gene in regulatory network that are expressed at higher levels Hodgkin lymphoma cells and a stimulator of autophagy during B cell differentiation (NES = -1.98, FDR = during skeletal muscle atrophy [37, 38]. Moreover, the 0.01; Figure 3C) [41]. SLAMF7 was included in the most highly enriched gene set in the C6 collection (NES = leading edge subset of downregulated genes. We noted 1.70, FDR = 0.05) corresponded to genes in MCF-7 breast that many of the other downregulated genes in the cancer cells adapted for estrogen-independent growth in leading edge subset are involved in lipid metabolism culture that were upregulated in the carfilzomib-resistant (e.g., INSIG1, HMGCR, SCD, PAM, LDLR, SQLE, MM cells; KLF4 and GADD45A were included in the CYP51A1, MVK), and complementary analysis of the leading edge subset (Figure 3B). A further association C2:CP canonical pathways collection (1,330 gene sets) with autophagy-related processes was suggested by a by GSEA indicated downregulation of genes involved in recent study reporting that one of the genes in the leading cholesterol biosynthesis (Reactome: REACT_9405.3) in edge subset, LAMP3 encoding lysosome-associated the carfilzomib-resistant MM cells as being statistically membrane protein 3, is involved in resistance to the anti- significant (NES = -2.41, FDR = 0.001; Figure S1B). estrogen tamoxifen in breast cancer cells by promoting Consistent with the inverse correlation observed between prosurvival autophagy [39]. Another gene, ISG15, KLF4 levels and expression levels of these genes, several encoding an ubiquitin-like protein, was recently shown were previously demonstrated to be negatively regulated to interact with SQSTM1/p62, augmenting association by ectopic KLF4 expression [42]. Examples included with LC3B-II and facilitating autophagic degradation of three genes involved in cholesterol biosynthesis: HMGCR aggresomes, in response to various types of cellular stress encoding HMG-CoA reductase and MVK encoding including proteasome inhibition [40]. Considered together, mevalonate kinase, early enzymes in the mevalonate the genes represented in the leading edge subsets of the pathway; and CYP51A1 encoding a cytochrome P450 gene sets presented in Figure 3A, 3B suggested potential family member involved in the conversion of lanosterol upregulation of autophagy pathways in the carfilzomib- to cholesterol. Additionally, although no significant
Figure 3: GSEA enrichment plots and heat maps of gene expression changes in sets of genes coregulated in response to chemical and genetic perturbations associated with acquisition of carfilzomib resistance in KMS-11 and KMS-34 cells. A. Gene set: SHAFFER_IRF4_TARGETS_IN_ACTIVATED_B_LYMPHOCYTE (M11189). B. Gene set: PODAR_RESPONSE_ TO_ADAPHOSTIN_UP (M16336). C. Gene set: LTE2_UP.V1_DN (M2721). Abbreviations are as in Figure 1. Selected autophagy-related genes are indicated with a red asterisk. KLF4-repressed genes are indicated with a blue asterisk. www.impactjournals.com/oncotarget 14818 Oncotarget enrichment of glycolysis-related gene sets was revealed colocalization of the two factors correlated with by GSEA, LDHA, which encodes a subunit of lactate acquisition of carfilzomib resistance (P < 0.003; Figure dehydrogenase, a key enzyme in the glycolytic phenotype 4D). To further characterize autophagic activity, we used of cancer cells (known as the Warburg effect) [43] the fluorescent autophagosome-specific reporter construct previously identified as a KLF4-repressed gene [44] encoding a GFP-LC3 fusion protein [50], and examined was downregulated in the carfilzomib-resistant MM GFP-LC3 signals by fluorescence confocal microscopy in derivatives (Figure 3C). In view of increasing evidence KMS-11 and KMS-11/Cfz cells treated with or without that enhanced lipid catabolism and low glycolytic activity carfilzomib. An increased number of GFP-LC3-II puncta in slowly proliferating tumor cells is associated with was observed in KMS-11/Cfz cells (Figure 5A). To autophagy induction and treatment resistance [45], the determine whether this was associated with increased above observations raised the possibility that activation autophagic flux, cells were treated with carfilzomib in of prosurvival autophagy could be a mechanism adopted the presence of lysosomal protease inhibitors and the by the carfilzomib-resistant MM cells to counteract the levels of endogenous LC3B-I and LC3B-II measured by deficiency of proteasome function and metabolic stress western blotting. As shown in Figure 5B, the degree of induced by carfilzomib treatment. LC3B-II stabilization as reflected by the relative increase in the LC3B-II/LC3B-I ratio was greater in carfilzomib- Carfilzomib resistance is associated with resistant versus parental MM cells (P < 0.0001). Similar prosurvival autophagy in MM cells results were obtained when the cells were cotreated with chloroquine which, by increasing lysosomal pH, inhibits autophagic protein degradation and blocks We first examined whether autophagic activity was autophagosome-lysosome fusion (Figure 5B) [51]. increased in carfilzomib-resistant KMS-11/Cfz and KMS- The above results are consistent with the view 34/Cfz cells by flow cytometry using the fluorescent dye that increased autophagic flux was occurring in the Cyto-ID Green [46, 47]. Fluorescence signals reflect carfilzomib-resistant MM cells. Inhibition of autophagy by steady state levels of autophagosomes as a result of two chloroquine treatment was previously reported to enhance offsetting processes: formation of autophagosomes and carfilzomib-induced cell death of head and neck squamous dissolution of autophagosomes upon lysosomal fusion. cell carcinoma cell lines [52]. To test whether concomitant We found higher steady state levels of autophagosomes inhibition of autophagy would sensitize KMS-11/Cfz and in resistant cells versus their parental counterparts in both KMS-34/Cfz to carfilzomib, the cells were treated with MM cell line models (relative increase in autophagic carfilzomib in the presence or absence of chloroquine, activity based on Cyto-ID mean fluorescence intensity and cell growth was measured by alamarBlue assay. values = 16.6 ± 1.3, P < 0.05, paired Student’s t test; see Importantly, cotreatment with chloroquine diminished Materials and Methods for details) (Figure 4A). carfilzomib resistance in both KMS-11/Cfz and KMS- Second, we investigated autophagic flux by 34/Cfz cell lines, indicating that prosurvival autophagy measuring the processing of LC3B, an ubiquitin-like contributes to acquired drug resistance in these MM cell protein that is converted during autophagy to a lipidated line models (Figure 5C). form (LC3B-II) associated with autophagosome membranes [34]. To distinguish between synthesis, KLF4 regulates the autophagy receptor gene modification and degradation rates of LC3B, the ratio SQSTM1 of the LC3B-II faster migrating form to the nonlipidated precursor (LC3B-I) is determined in the absence or presence of inhibitors of lysosome-mediated proteolysis The SQSTM1/p62 protein is of particular interest [48]. Both carfilzomib-resistant MM derivatives exhibited given its role as an adaptor for both proteasomal and higher levels of synthesis and modification of LC3B (as autophagic degradation of ubiquitinated proteins [20, measured by LC3B-II/LC3B-I ratio) in comparison to 21]. As shown in Figure 6A, we confirmed that SQSTM1 parental cells in the presence of a mixture of the lysosomal mRNA levels were higher in the carfilzomib-resistant MM protease inhibitors E64d, pepstatin A and leupeptin (Figure derivatives and we demonstrated that the levels increased 4B). Increased levels of the ubiquitin cargo receptor and upon ectopic expression of KLF4 in KMS-11 cells by autophagy substrate SQSTM1/p62 in KMS-11/Cfz cells in qRT-PCR analysis. A review of the literature revealed that the presence of the lysosomal protease inhibitors was also SQSTM1 was included in a list of direct KLF4 binding consistent with more active autophagy (Figure 4C). targets detected by genome-wide ChIP analysis [53]. Next, since SQSTM1/p62 is recruited into We therefore analyzed the genomic regions upstream autophagosomes by lipidated LC3B-II [49], we assessed of the SQSTM1 transcription start sites, and identified the subcellular localization of LC3B and SQSTM1/p62 evolutionally conserved KLF4-binding motifs (Figure 6B; proteins by immunofluorescence confocal microscopy. Figure S2). We performed qPCR-based ChIP analysis in In both KMS-11 and KMS-34 cell line models increased KMS-11 and KMS-11/Cfz cells and confirmed binding to
www.impactjournals.com/oncotarget 14819 Oncotarget Figure 4: Autophagy is induced in carfilzomib-resistant KMS-11/Cfz and KMS-34/Cfz cells. A. Fluorescence histograms of cells stained with the Cyto-ID Green autophagy detection reagent. Representative examples of three independent experiments are shown (P < 0.05, paired Student’s t test). B., C. To assess complete autophagic flux, cells were treated overnight with or without the lysosomal protease inhibitors E64d (10 µg/ml), pepstatin A (PA; 10 µg/ml), and leupeptin (Leu; 1 µg/ml) [52]. Cell lysates were probed with anti- LC3B B. or anti-SQSTM1 C.. D. Cells were labeled with anti-LC3B (Alexa Fluor 568, red) or anti-SQSTM1 (Alexa Fluor 488, green) antibodies, and immunofluorescence staining was analyzed by confocal laser scanning microscopy. Increased colocalization of the two factors in KMS-11/Cfz versus parental KMS-11 cells (yellow signals) correlated with acquisition of carfilzomib resistance P( < 0.003). www.impactjournals.com/oncotarget 14820 Oncotarget these regions by endogenous KLF4 (Figure 6C). In these regions were used as negative controls [28, 53]. These experiments, the KLF4 promoter region was included observations support the proposal that KLF4 contributes as a positive control [55], whereas GATA6 genomic to carfilzomib resistance by upregulating SQSTM1
Figure 5: Prosurvival autophagy induction in carfilzomib-resistant MM cells is antagonized by lysosomal inhibitors and chloroquine. A. Increased GFP-LC3 puncta formation in KMS-11/Cfz versus parental KMS-11 cells treated overnight with carfilzomib (50 nM). B. Increased stabilization of LC3B-II in KMS-11/Cfz versus parental KMS-11 cells upon autophagy inhibition. Representative western blot of LC3B levels of four independent experiments is shown (P < 0.0001). Cells were treated overnight with carfilzomib (50 nM) in the presence or absence of the lysosomal protease inhibitors E64d (10 µg/ml), pepstatin A (PA; 10 µg/ml), and leupeptin (Leu; 1 µg/ ml) or chloroquine (10 µM). Densitometry was used to calculate the LC3B-II/LC3B-I ratios and the relative increases in the ratios upon autophagy inhibition with respect to carfilzomib only-treated controls are indicated in the graph on the right.C. Cells were treated with the indicated concentrations of carfilzomib for 72 hours in the presence or absence of chloroquine (10 µM). Cell viability was determined by
alamarBlue assay. The data are presented as the mean ± S.D of three experiments. IC50 values were calculated by linear regression of the plots in the absence or presence of chloroquine: KMS-11/Cfz, 35 nM versus 22 nM; KMS-11, 12 nM versus 12 nM; KMS-34/Cfz, 35 nM versus 6 nM; KMS-34, 6 nM versus 6 nM. www.impactjournals.com/oncotarget 14821 Oncotarget expression in these MM cell line models. (designated PR) based on expression of certain cell To further investigate the potential relevance of cycle and proliferation-associated genes [58]. The PR a KLF4-associated autophagy component in MM, we subgroup signature was present in approximately 18% identified KLF4 profile neighbors across 304 MM patient of newly diagnosed MM and increased during disease samples in the Multiple Myeloma Research Consortium progression to 45% of relapsed cases; strikingly, many reference collection dataset (GEO accession number of the WHSC1-defined t(4;14)-positive samples were GSE26760). In agreement with earlier work [17, 18], found to cluster in this subgroup [58]. We used the the two genes dysregulated by the t(4;14) translocation, recently published PROGgeneV2 prognostic biomarker WHSC1 and FGFR3 [56], were among the top KLF4 identification tool [59] to study the implications of neighbors (1,470 out of 54,675 total on the array). WHSC1, KLF4 and SQSTM1 gene expression on Moreover, the set was enriched for genes associated overall survival of 47 MM patients in the PR subgroup with the annotation term “autophagy” in the NCBI Gene (GEO accession number GSE2658). Using median gene database (P = 2.34 x 10-4). Importantly, the list included expression values as bifurcation points, Cox proportional SQSTM1 (Table S2). These results, demonstrating hazards analyses showed that elevated expression of similarity in expression pattern and shared function [57], these genes was associated with inferior 3-year survival suggest that contribution to prosurvival autophagy is a outcomes (Figure 7). Kaplan-Meier plots indicated clinically relevant aspect of KLF4 expression as regards significant segregation in survival outcomes for patients MM pathobiology. with high versus low WHSC1 expression (hazard ratio, HR = 1.95; 95% confidence interval/CI, 1.16-3.28; P = Elevated expression of KLF4 and SQSTM1 is 0.01), with increasingly worse prognosis when high level prognostic of poor survival in a subgroup of coexpression of KLF4 (HR = 4.33; 95% CI, 2.04-9.18; P -4 WHSC1-positive MM patients = 1.0 x 10 ) (Figure 7B), and KLF4 plus SQSTM1 (HR = 8.40; 95% CI, 2.80-25.17; P = 1.0 x 10-4) (Figure 7C) were also considered. When high levels of coexpression of the Shaughnessy and colleagues defined a high-risk autophagy-associated genes MAP1LC3B and GADD45A subgroup of MM patients by gene expression profiling
Figure 6: SQSTM1 is a direct target of KLF4 upregulated in carfilzomib-resistant KMS-11/Cfz and KMS-34/Cfz cells. A. Expression of SQSTM1 determined by qRT-PCR. KMS-11/KLF4, KMS-11 cells expressing a KLF4 cDNA. KMS-11/M11, KMS-11 cells transfected with a control vector. B. Evolutionarily conserved KLF4-binding motifs in the SQSTM1 promoter regions upstream of the NM_001142298 and NM_001142299 transcription start sites (Figure S2; see also Table S3 of Zaret and colleagues [54]). C. Increased binding of KLF4 to the SQSTM1 promoter regions indicated in B. in KMS-11/Cfz versus parental KMS-11 cells as determined by ChIP- qPCR. www.impactjournals.com/oncotarget 14822 Oncotarget Figure 7: Prognostic value of WHSC1, KLF4 and SQSTM1 expression in MM patient survival outcomes. Kaplan-Meier survival plots of 47 MM patients in a high-risk subgroup associated with refractory/relapsed disease (GEO accession number GSE2658) created using PROGgeneV2. A. WHSC1 expression. B. Coexpression of WHSC1 and KLF4. C. Coexpression of WHSC1, KLF4 and SQSTM1. D. Coexpression of WHSC1, KLF4, SQSTM1, MAP1LC3B, and SQSTM1. E. Ratio of KLF4 to HMGCR expression. F. Ratio of KLF4 to LDHA expression. Median gene expression values were used as bifurcation points. HR, hazard ratio determined by Cox proportional hazards model. www.impactjournals.com/oncotarget 14823 Oncotarget were also taken into account, significantly inferior overall is postulated to contribute to prosurvival autophagy survival outcomes were observed (HR = 51.21; 95% by facilitating delivery of aggregated substrates to CI, 7.36-356.61; P = 1.0 x 10-4) (Figure 7D). Moreover, autophagosomes via LC3B-II for subsequent destruction reduced tumor cell metabolism (e.g., as exemplified by [65]. The relevance of this process in the MM therapeutic low HMGCR or LDHA expression) was also associated response to proteasome inhibition is supported by the with adverse outcomes, with high expression ratios of recent finding that short hairpin RNA knockdown of KLF4 to HMGCR (HR = 3.47; 95% CI, 1.61-7.48; P = SQSTM1 mRNA resulted in failure of autophagosomes 0.02) (Figure 7E) and KLF4 to LDHA (HR = 3.74; 95% to trap ubiquitinated cargo in MM cells, converting CI, 1.66-8.43; P = 0.001) (Figure 7F) prognostic of poor prosurvival autophagy to apoptosis [66]. 3-year survival rates. KLF4 expression is consistently associated with MM patients carrying the t(4;14) translocation [17, 18]. DISCUSSION Two genes are aberrantly expressed as a consequence of the translocation: WHSC1, encoding a histone The molecular mechanisms associated with methyltransferase (also referred to as MMSET or NSD2), the development of clinical resistance to proteasome and FGFR3 encoding a transmembrane tyrosine kinase inhibitors remain to be fully elucidated [4-8]. Toward [56]. Gain- and loss-of function studies in MM cell lines this end, we have endeavored to establish clinically- have demonstrated that WHSC1 histone methyltransferase relevant carfilzomib-resistant MM cell lines [60]. Ina activity is involved in the epigenetic upregulation of KLF4 previously published study, we found that upregulation [67, 68]. Notably, there is highly significant overlap (P of the ABCB1-encoded multidrug resistance efflux < 1 x 10-33) between the WHSC1 target genes identified transporter P-glycoprotein contributed to increased and the differentially expressed genes in KMS-11/Cfz carfilzomib resistance in KMS-34 MM cells cultured (86 out of 887; FC ≥ 1.4) and KMS-34/Cfz (69 out of in low concentrations (6 nM) of the drug [13]. Notably, 888 genes, FC ≥ 1.5). Therefore, inhibition of WHSC1 our analysis of microarray data acquired for a MM enzymatic function or its ability to interact with chromatin patient treated with carfilzomib revealed increased may represent a promising future combination therapy for ABCB1 expression during disease progression [61], this subgroup of MM patients [67, 68]. suggesting that the mechanism could be relevant to Although the upstream pathways remain undefined, carfilzomib resistance observed in the clinic [62]. To it is worth noting that induction of KLF4 transcription further elaborate mechanisms of carfilzomib resistance was previously observed in endothelial cells treated with in MM, we adapted KMS-34/Cfz to growth in 12 nM bortezomib or epoxomicin (the natural epoxyketone from carfilzomib and likewise established KMS-11/Cfz which carfilzomib was derived) [69]. Increased levels cells resistant to 12 nM carfilzomib by exposure to of KLF4 have also been observed following inhibition stepwise increasing concentrations of the drug. Unlike of translation by depletion of the translation initiation KMS-34/Cfz, KMS-11/Cfz did not exhibit increased factor eIF4GI [70]. As eIF4GI depletion was reported to expression of ABCB1. Instead, we found that a common phenocopy mTOR inhibition and promote autophagy [70], mechanism of carfilzomib resistance was elevated levels and inhibition of mTOR activity by rapamycin induced of prosurvival autophagy, and that the pluripotency- KLF4 expression in other cells [71], mechanisms linking associated transcription factor KLF4 [15] contributed protein turnover and protein synthesis are implicated in to the carfilzomib-resistant phenotype. Our findings are KLF4 upregulation in the context of acquired proteasome in accord with those of two publications that appeared inhibitor resistance [72]. during revision of this manuscript reporting that KLF4 Overexpression of KLF4 in MM cells was participates in autophagic pathways activated during stress previously reported to result in cell cycle arrest [19]. We responses in other settings [63, 64]. also observed that very high levels of exogenous KLF4 Substrates destined for selective autophagic expression reduced proliferation rates in KMS-11 and destruction are recognized by receptor proteins which KMS-34 cells, with diminished transgene expression in anchor the material to the expanding phagophore cell populations that exhibited a growth advantage after membrane via co-binding to lipidated LC3B-II [35, 36]. 1 month of culture (Figure S3). In this regard, KLF4 has In recent years, the ubiquitin-proteasome and autophagy- been reported to exert growth suppressive effects in B-cell lysosome systems, once considered independent processes non-Hodgkin lymphoma [37], yet a recent study found for protein degradation, are now regarded as being that high nuclear expression of KLF4 in Burkitt pediatric interconnected. Impairment of either pathway has been lymphoma was indicative of inferior overall survival reported to impact the other. Ubiquitination of proteins [73]. Thus, as in other systems [16], KLF4 regulation of targeted for destruction serves as the mechanism of B cell proliferation is complex and likely dependent on crosstalk and ubiquitin-binding cargo protein SQSTM1/ multiple factors. Along these lines, KLF4 was originally p62 is a critical link [20, 21]. By upregulating SQSTM1/ characterized as an epithelial oncogene by Rupert’s group p62 levels in carfilzomib-resistant MM cells, KLF4 imparting a slow growth phenotype to the transformed www.impactjournals.com/oncotarget 14824 Oncotarget cells [74]. In follow-up studies of breast cancer cases, factor that KLF4 target genes in embryonic stem cells these investigators found that small primary tumors having were enriched in the differentially expressed genes in preferential nuclear localization of KLF4 correlated with KMS-11/Cfz and KMS-34/Cfz cells [28]. These results an increased risk of death [30]. The relative proliferative suggest potential parallels with putative cancer stem-like activity of WHSC1-positive KLF4-expressing MM cells cells [13, 85]. In line with this notion, it has been reported with respect to other MM samples in the PR subgroup that overexpression of KLF4 in breast cancer cells led to defined by Shaughnessy and colleagues [58] is not an increase of the cancer stem cell-like population [86]. known. However, the fact that the hazard ratio increased In that work, KLF4-mediated maintenance of stem cell- significantly for these MM patients upon consideration of like characteristics was accompanied by increased cell autophagy-associated gene expression levels (Figure 7D), migration and invasion of the malignant cells. Our future implicates activation of autophagy as a contributing factor studies will further examine the mechanistic ramifications to relapsed/refractory disease. of KLF4 expression as regards relapse and treatment Beyond its function as a direct cell cycle regulator, resistance in MM, and the utility of the KMS-11/Cfz and KLF4 exerts inhibitory effects on metabolic pathways KMS-34/Cfz MM models for the development of novel and macromolecular synthesis [75], which include autophagy-targeting combination therapies. repression of genes encoding key enzymes involved in glycolysis and cholesterol biosynthesis (i.e., HMGCR, MATERIALS AND METHODS HMGCS1, MVK, LDHA) [42, 44]. Recent studies have shown that autophagy plays important roles in glucose homeostasis and lipid metabolism [76, 77], and the Cell lines, plasmids and transfections inverse relationship between autophagy and cell growth is becoming increasingly appreciated [78]. Although the KLF4 metabolic target genes in Figure 3C, including KMS-11 and KMS-34 MM cells were a kind gift HMGCR and LDHA were only modestly downregulated from Dr. P. Leif Bergsagel (Mayo Clinic, Scottsdale, AZ) upon acquisition of carfilzomib resistance, inhibition of [87]. Cells were cultured in RPMI 1640 with GlutaMAX HMGCR or LDHA enzymatic activity has resulted in (Life Technologies) supplemented with 10% fetal bovine autophagy induction in cancer cells [79, 80]. Furthermore, serum (Cambrex BioScience), 100 U/ml penicillin and high gene expression ratios of KLF4 to HMGCR and 100 μg/ml streptomycin. The KLF4 expression vector KLF4 to LDHA were associated with adverse outcomes of containing a KLF4 cDNA (Accession No. BC030811.1) certain MM patients (Figure 7E, 7F). Collectively, these under the control of a cytomegalovirus promoter in results may raise a cautionary note regarding potential the pReceiver-M11 backbone was from GeneCopoeia anti-MM therapeutic strategies that target these metabolic (Cat. No. EX-Z0482-M11). The pBABEpuro GFP-LC3 enzymes [81, 82]. autophagy reporter plasmid was from Addgene (Plasmid KLF4 levels decrease during B cell activation No. 22405) [86]. Transfections were performed using the and differentiation into plasma cells [25-27]. Increased Amaxa nucleofector system with solution V and program expression of KLF4 in the carfilzomib-resistant X-001 settings (Lonza). Transfected cell lines were KMS-11/Cfz and KMS-34/Cfz cells was indicative selected in 0.5 mg/ml G418 (pReceiver-M11 KLF4) or of “dedifferentiation” to an earlier maturation stage 0.5 μg/ml puromycin (pBABEpuro GFP-LC3). GFP-LC3- (Figure 1). Negative regulation of SLAMF7 encoding expressing cells were sorted on a FACSAria instrument plasma cell-specific CD319 [27, 31] by ectopic KLF4 equipped with FACSDiva software (BD Biosciences). expression in KMS-11 cells (Table 1) suggests a potential role in the process. That this MM cell line phenomenon Antibodies and reagents is biologically relevant is supported by work from Yaccoby who first described the ability of primary MM The following antibodies were used: anti-KLF4 cells to dedifferentiate into an immature plasmablastic (D1F2) rabbit mAb (Cell Signaling Technology, Cat. phenotype upon long-term co-culture on osteoclasts [83]. No. 12173); anti-α-tubulin mouse mAb (DM1A) (EMD More recently, Karadimitris and colleagues reported Millipore Corporation, Cat. No. CP06); anti-p62/SQSTM1 epigenetic plasticity in MM patient samples and xenograft (Clone 3) mouse mAb (BD Transduction Laboratories, assays, where clinical drug resistance was attributed Cat. No. 610832); anti-LC3B affinity isolated rabbit to bidirectional transitions between MM plasma cells polyclonal antibody (Sigma-Aldrich, Cat. No. L7543); and and more quiescent pre-plasma cells [84]. Our results anti-eIF4E (P-2) mouse mAb (Santa Cruz Biotechnology, also complement the recent findings of Tiedemann and Cat. No. sc-9976). Carfilzomib was obtained from Active colleagues implicating less mature pre-plasma cells Biochem (Cat. No. A-1098), chloroquine was purchased as contributing to therapeutic proteasome inhibitor from Selleck Chemicals (Cat. No. S4157), and the resistance in MM [7]. Considered from this perspective, lysosomal inhibitors E-64d (Cat. No. E8640), leupeptin it is notable in view of its activity as a reprogramming (Cat. No. 103476-89-7) and pepstatin A (Cat. No. 77170) www.impactjournals.com/oncotarget 14825 Oncotarget were from Sigma-Aldrich. Chromatin immunoprecipitation (ChIP)
Microarray gene expression analysis and ChIP was performed on the SQSTM1 promoter quantitative real-time qRT-PCR validation regions with 20 µg total chromatin and 5 µg of anti-KLF4 (D1F2) rabbit mAb using the SimpleChIP Enzymatic Total RNA was isolated with the miRNeasy mini kit Chromatin IP Kit (Magnetic Beads) (Cell Signaling, (Qiagen, Cat. No. 217004). Microarray gene expression Cat. No. 9003), and 4% of the precipitated material analysis of triplicate samples was carried out by was used per qPCR reaction. GATA6 was included as Expression Analysis, Inc. (Durham, NC) using Affymetrix a non-target promoter. Background ChIP levels were GeneChip Human Genome U133 Plus 2.0 arrays. The data obtained using 5 µg of normal rabbit IgG (Cat. No. have been deposited in GEO (http://www.ncbi.nlm.nih. 2729). Primers used were: SQSTM1 promoter region gov/geo/) under accession number GSE69078. Reverse 1, forward, AGCTTTGTGCCCTGTACTCA, reverse, transcription was performed with the SuperScript VILO TGCAGTGAGCCTGATACCTG; SQSTM1 promoter cDNA synthesis kit (Life Technologies, Catalog No. region 2, ACCTCTGTGACCTTGGGTCT, reverse, 11754-250). Real-time qRT-PCR was performed using GCTGTCCCGACGCTGAG; GATA6 promoter region the Power SYBR Green reagent (Life Technologies, Cat 1, forward, TGTTGAACTGTGCAGCTTTTCT, reverse, No. 4368708) on an ABI Prism 7000 Sequence Detection TAATGATGCACACACAACCTGA; GATA6 promoter System (Life Technologies) as previously described [13]. region 2, forward, ATTCCCAGCAGGCTTATTGTAAA, Primers synthesized by Sigma-Aldrich included: CCND1, reverse, CAGAAGCAGACAACCACGATAG. forward, GCTCACGCTTACCTCAACCA, reverse, GACAGACAAAGCGTCCCTCA; CYP1A1, Confocal microscopy forward, GCTGCCTTCTGGCCTTGTAA, reverse, TGCCTGGATATGTGCACTCC; GLIPR1, Cells (2.5 x 105) were centrifuged onto a microscope forward, GACTGCGTTCGAATCCATAACA, slide at 1,000 rpm for 5 minutes using a Shandon Cytospin reverse, GCTGGGTCCCAAGTCATGTA; HGF, 4 instrument. The cells were then immediately fixed in forward, GACGCAGCTACAAGGGAACA, 3.7% formaldehyde for 5 minutes at room temperature reverse, GGCAAAAAGCTGTGTTCGTG; and permeabilized with 0.5% Triton X-100 in phosphate- HOXB7, forward, TGCAGTTTTGTAAGCCCTCT, buffered saline (PBS) for 15 minutes at room temperature. reverse, GCAACCACAGGGTTAGTCCA; ID1, Following permeabilization, the cells were rinsed with forward, CCAGCACGTCATCGACTACA, PBS and blocked in PBS containing 10% goat serum and reverse, GGGGGTTCCAACTTCGGATT; IFIT3, 0.01% Triton X-100 for 1 hour at room temperature. The forward, CTGGGTGGAAACCTCTTCAGC, cells were then incubated with anti-KLF4 and anti-eIF4E reverse, GACCTCACTCATGATGGCTGTTTC; antibodies diluted to final concentrations of 0.4 µg/ml, IGF1, forward, TGCAGGAGGGACTCTGAAAC, in PBS containing 1% goat and 0.01% Triton X-100 for reverse, GCTGCGTGATATTTGAAAGGT; KLF4, 1 hour at room temperature. The cells were rinsed with forward, TCCATTACCAAGAGCTCATGCC, PBS and then incubated with Alexa Fluor 568-conjugated reverse, CGCGTAATCACAAGTGTGGG; MAPT, goat anti-rabbit and Alexa Fluor 488-conjugated goat anti- forward, AGCTTGTAGCTGCCAACCTC, mouse secondary antibodies (Life Technologies) diluted reverse, TTTCCAAGGGGGTGTGTTCC; NQO1, 1:500 in PBS containing 1% goat serum and 0.01% forward, TAGCATTGGGCACACTCCAG, Triton X-100 for 1 hour at room temperature. The cells reverse, CCAGGCGTTTCTTCCATCCT; P4HA2, were rinsed with PBS and mounted with Fluoromount forward, GACACTTCCCTCTGTGACCA, G (Electron Microscopy Sciences). Cells expressing reverse, TCATGTGCCCAATAGAGGTG; PSMB5, the GFP-LC3 reporter were fixed in 1% methanol free forward, CAGTACAAAGGCATGGGGCT, reverse, paraformaldehyde (Electron Microscopy Sciences) in TCAGACACAGGGCCTCTCTTA; SLAMF7, PBS overnight at 4oC then centrifuged onto a microscope forward, AGTCTGGCACGTAAGATGAACA, slide and mounted with Fluoromount G. Imaging analysis reverse, TCAAAAGCAGCCATTCCCCT; SQSTM1, was performed on a Cell Observer SD spinning disk forward, CTCCGCGTTCGCTACAAAAG, reverse, confocal system equipped with Zen software (Carl Zeiss CAGAAGGTAGGCCTTCACGG; and TLR4, Microscopy). forward, TGCCGTTTTATCACGGAGGT, reverse, GGGAGGTTGTCGGGGATTTT. Cytotoxicity assay
Cells were treated with carfilzomib and chloroquine at the indicated concentrations and cell growth was www.impactjournals.com/oncotarget 14826 Oncotarget measured using the alamarBlue cell viability and CC, Ma W, Davis RE, Lin P, Wang H, Madden TL, proliferation reagent (Life Technologies) as previously Wei C, Baladandayuthapani V, Wang M et al. Targeting described [13]. the insulin-like growth factor-1 receptor to overcome bortezomib resistance in preclinical models of multiple Autophagy detection myeloma. Blood. 2012; 120: 3260-3270. 6. Lichter DI, Danaee H, Pickard MD, Tayber O, Sintchak M, Shi H, Richardson PG, Cavenagh J, Blade J, Facon T, Autophagy was measured with the Cyto- Niesvizky R, Alsina M, Dalton W et al. Sequence analysis ID autophagy detection kit (Enzo, Cat. No. ENZ- of beta-subunit genes of the 20S proteasome in patients 51031-K200) using a FACSAria instrument, and data were with relapsed multiple myeloma treated with bortezomib or analyzed with FlowJo Mac v10.0.2 (Tree Star). Autophagy dexamethasone. Blood. 2012; 120: 4513-4516. activity factor (AAF) values were calculated using the following equation: AAF = 100 × (MFI − 7. Leung-Hagesteijn C, Erdmann N, Cheung G, Keats JJ, carfilzomib-resistant Stewart AK, Reece DE, Chung KC, Tiedemann RE. MFI parental) / MFI carfilzomib resistant. MFI is mean fluorescence intensity, and AAF expresses the level of autophagy in Xbp1s-negative tumor B cells and pre-plasmablasts mediate live cells as the difference between the amount of Cyto-ID therapeutic proteasome inhibitor resistance in multiple Green autophagy dye within cells [46]. GFP-LC3 puncta myeloma. Cancer Cell. 2013; 24: 289-304. were detected by confocal microscopy as described above. 8. Niewerth D, Jansen G, Assaraf YG, Zweegman S, Kaspers GJ, Cloos J. Molecular basis of resistance to proteasome ACKNOWLEDGMENTS and funding inhibitors in hematological malignancies. Drug Resist Updat. 2015; 18: 18-35. We thank Leif Bergsagel for providing the KMS- 9. Herndon TM, Deisseroth A, Kaminskas E, Kane RC, Koti 11 and KMS-34 cell lines, and Alex Tzatsos for the GFP- KM, Rothmann MD, Habtemariam B, Bullock J, Bray JD, LC3 plasmid. This work was supported by a Grant from Hawes J, Palmby TR, Jee J, Adams W et al. U.S. Food and the Dr. Cyrus and Myrtle Katzen Cancer Research Center Drug Administration approval: carfilzomib for the treatment at The George Washington University and a King Fahd of multiple myeloma. Clin Cancer Res. 2013; 19: 4559- Endowment from The George Washington University 4563. School of Medicine and Health Sciences. The authors 10. Vij R, Siegel DS, Jagannath S, Jakubowiak AJ, Stewart also gratefully acknowledge the generous support of Marc AK, McDonagh K, Bahlis N, Belch A, Kunkel LA, Wear Cohen. S, Wong AF, Wang M. An open-label, single-arm, phase 2 study of single-agent carfilzomib in patients with relapsed Conflicts of Interest and/or refractory multiple myeloma who have been previously treated with bortezomib. Br J Haematol. 2012; The authors declare no conflict of interest. 158: 739-748. 11. Siegel DS, Martin T, Wang M, Vij R, Jakubowiak AJ, REFERENCES Lonial S, Trudel S, Kukreti V, Bahlis N, Alsina M, Chanan-Khan A, Buadi F, Reu FJ et al. A phase 2 study of 1. Bianchi G, Anderson KC. Understanding biology to tackle single-agent carfilzomib (PX-171-003-A1) in patients with the disease: Multiple myeloma from bench to bedside, and relapsed and refractory multiple myeloma. Blood. 2012; back. CA Cancer J Clin. 2014; 64: 422-444. 120: 2817-2825. 2. Abdi J, Chen G, Chang H. Drug resistance in multiple 12. Chng WJ, Dispenzieri A, Chim CS, Fonseca R, myeloma: latest findings and new concepts on molecular Goldschmidt H, Lentzsch S, Munshi N, Palumbo A, mechanisms. Oncotarget. 2013; 4: 2186-2207. Miguel JS, Sonneveld P, Cavo M, Usmani S, Durie BG et al. IMWG consensus on risk stratification in multiple 3. Moreau P, Richardson PG, Cavo M, Orlowski RZ, San myeloma. Leukemia. 2014; 28: 269-277. Miguel JF, Palumbo A, Harousseau JL. Proteasome inhibitors in multiple myeloma: 10 years later. Blood. 2012; 13. Hawley TS, Riz I, Yang W, Wakabayashi Y, DePalma L, 120: 947-959. Chang YT, Peng W, Zhu J, Hawley RG. Identification of an ABCB1 (P-glycoprotein)-positive carfilzomib-resistant 4. Oerlemans R, Franke NE, Assaraf YG, Cloos J, van myeloma subpopulation by the pluripotent stem cell Zantwijk I, Berkers CR, Scheffer GL, Debipersad K, fluorescent dye CDy1. Am J Hematol. 2013; 88: 265-272. Vojtekova K, Lemos C, van der Heijden JW, Ylstra B, Peters GJ et al. Molecular basis of bortezomib resistance: 14. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, proteasome subunit beta5 (PSMB5) gene mutation and Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub overexpression of PSMB5 protein. Blood. 2008; 112: 2489- TR, Lander ES, Mesirov JP. Gene set enrichment analysis: 2499. a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005; 102: 5. Kuhn DJ, Berkova Z, Jones RJ, Woessner R, Bjorklund 15545-15550. www.impactjournals.com/oncotarget 14827 Oncotarget 15. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, and responsiveness to diverse stimuli compared to naive B Tomoda K, Yamanaka S. Induction of pluripotent stem cells cells. J Immunol. 2009; 182: 890-901. from adult human fibroblasts by defined factors. Cell. 2007; 28. Kim J, Chu J, Shen X, Wang J, Orkin SH. An extended 131: 861-872. transcriptional network for pluripotency of embryonic stem 16. Rowland BD, Peeper DS. KLF4, p21 and context-dependent cells. Cell. 2008; 132: 1049-1061. opposing forces in cancer. Nat Rev Cancer. 2006; 6: 11-23. 29. Shields JM, Yang VW. Two potent nuclear localization 17. Mattioli M, Agnelli L, Fabris S, Baldini L, Morabito F, signals in the gut-enriched Kruppel-like factor define a Bicciato S, Verdelli D, Intini D, Nobili L, Cro L, Pruneri subfamily of closely related Kruppel proteins. J Biol Chem. G, Callea V, Stelitano C et al. Gene expression profiling of 1997; 272: 18504-18507. plasma cell dyscrasias reveals molecular patterns associated 30. Pandya AY, Talley LI, Frost AR, FitzGerald TJ, Trivedi with distinct IGH translocations in multiple myeloma. V, Chakravarthy M, Chhieng DC, Grizzle WE, Engler JA, Oncogene. 2005; 24: 2461-2473. Krontiras H, Bland KI, LoBuglio AF, Lobo-Ruppert SM 18. Agnelli L, Bicciato S, Mattioli M, Fabris S, Intini D, et al. Nuclear localization of KLF4 is associated with an Verdelli D, Baldini L, Morabito F, Callea V, Lombardi aggressive phenotype in early-stage breast cancer. Clin L, Neri A. Molecular classification of multiple myeloma: Cancer Res. 2004; 10: 2709-2719. a distinct transcriptional profile characterizes patients 31. Hsi ED, Steinle R, Balasa B, Szmania S, Draksharapu A, expressing CCND1 and negative for 14q32 translocations. Shum BP, Huseni M, Powers D, Nanisetti A, Zhang Y, Rice J Clin Oncol. 2005; 23: 7296-7306. AG, van Abbema A, Wong M et al. CS1, a potential new 19. Schoenhals M, Kassambara A, Veyrune JL, Moreaux J, therapeutic antibody target for the treatment of multiple Goldschmidt H, Hose D, Klein B. Kruppel-like factor 4 myeloma. Clin Cancer Res. 2008; 14: 2775-2784. blocks tumor cell proliferation and promotes drug resistance 32. Podar K, Raab MS, Tonon G, Sattler M, Barila D, Zhang in multiple myeloma. Haematologica. 2013; 98: 1442-1449. J, Tai YT, Yasui H, Raje N, DePinho RA, Hideshima T, 20. Kirkin V, McEwan DG, Novak I, Dikic I. A role for Chauhan D, Anderson KC. Up-regulation of c-Jun inhibits ubiquitin in selective autophagy. Mol Cell. 2009; 34: 259- proliferation and induces apoptosis via caspase-triggered 269. c-Abl cleavage in human multiple myeloma. Cancer Res. 21. Korolchuk VI, Menzies FM, Rubinsztein DC. Mechanisms 2007; 67: 1680-1688. of cross-talk between the ubiquitin-proteasome and 33. Li D, Dong Q, Tao Q, Gu J, Cui Y, Jiang X, Yuan J, Li W, autophagy-lysosome systems. FEBS Lett. 2010; 584: 1393- Xu R, Jin Y, Li P, Weaver DT, Ma Q et al. c-Abl regulates 1398. proteasome abundance by controlling the ubiquitin- 22. White E. Deconvoluting the context-dependent role for proteasomal degradation of PSMA7 subunit. Cell Rep. autophagy in cancer. Nat Rev Cancer. 2012; 12: 401-410. 2015; 10: 484-496. 23. Kuhn DJ, Chen Q, Voorhees PM, Strader JS, Shenk 34. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako KD, Sun CM, Demo SD, Bennett MK, van Leeuwen T, Noda T, Kominami E, Ohsumi Y, Yoshimori T. LC3, FW, Chanan-Khan AA, Orlowski RZ. Potent activity of a mammalian homologue of yeast Apg8p, is localized in carfilzomib, a novel, irreversible inhibitor of the ubiquitin- autophagosome membranes after processing. EMBO J. proteasome pathway, against preclinical models of multiple 2000; 19: 5720-5728. myeloma. Blood. 2007; 110: 3281-3290. 35. Rogov V, Dotsch V, Johansen T, Kirkin V. Interactions 24. Verbrugge SE, Al M, Assaraf YG, Niewerth D, van MJ, between autophagy receptors and ubiquitin-like proteins Cloos J, van d, V, Scheffer GL, Peters GJ, Chan ET, form the molecular basis for selective autophagy. Mol Cell. Anderl JL, Kirk CJ, Zweegman S et al. Overcoming 2014; 53: 167-178. bortezomib resistance in human B cells by anti-CD20/ 36. Pankiv S, Clausen TH, Lamark T, Brech A, Bruun rituximab-mediated complement-dependent cytotoxicity JA, Outzen H, Overvatn A, Bjorkoy G, Johansen T. and epoxyketone-based irreversible proteasome inhibitors. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate Exp Hematol Oncol. 2013; 2: 2. degradation of ubiquitinated protein aggregates by 25. Klaewsongkram J, Yang Y, Golech S, Katz J, Kaestner KH, autophagy. J Biol Chem. 2007; 282: 24131-24145. Weng NP. Kruppel-like factor 4 regulates B cell number 37. Guan H, Xie L, Leithauser F, Flossbach L, Moller P, Wirth and activation-induced B cell proliferation. J Immunol. T, Ushmorov A. KLF4 is a tumor suppressor in B-cell non- 2007; 179: 4679-4684. Hodgkin lymphoma and in classic Hodgkin lymphoma. 26. Good KL, Tangye SG. Decreased expression of Kruppel- Blood. 2010; 116: 1469-1478. like factors in memory B cells induces the rapid response 38. Ebert SM, Dyle MC, Kunkel SD, Bullard SA, Bongers KS, typical of secondary antibody responses. Proc Natl Acad Sci Fox DK, Dierdorff JM, Foster ED, Adams CM. Stress- U S A. 2007; 104: 13420-13425. induced skeletal muscle Gadd45a expression reprograms 27. Good KL, Avery DT, Tangye SG. Resting human memory myonuclei and causes muscle atrophy. J Biol Chem. 2012; B cells are intrinsically programmed for enhanced survival 287: 27290-27301. www.impactjournals.com/oncotarget 14828 Oncotarget 39. Nagelkerke A, Sieuwerts AM, Bussink J, Sweep FC, composition, and degradation capacity—formation of Look MP, Foekens JA, Martens JW, Span PN. LAMP3 crinosomes. Exp Mol Pathol. 1987; 47: 346-362. is involved in tamoxifen resistance in breast cancer cells 52. Zang Y, Thomas SM, Chan ET, Kirk CJ, Freilino ML, through the modulation of autophagy. Endocr Relat Cancer. DeLancey HM, Grandis JR, Li C, Johnson DE. Carfilzomib 2014; 21: 101-112. and ONX 0912 inhibit cell survival and tumor growth of 40. Nakashima H, Nguyen T, Goins WF, Chiocca EA. head and neck cancer and their activities are enhanced by Interferon-stimulated gene 15 (ISG15) and ISG15-linked suppression of Mcl-1 or autophagy. Clin Cancer Res. 2012; proteins can associate with members of the selective 18: 5639-5649. autophagic process, histone deacetylase 6 (HDAC6) and 53. Sen GL, Boxer LD, Webster DE, Bussat RT, Qu K, SQSTM1/p62. J Biol Chem. 2015; 290: 1485-1495. Zarnegar BJ, Johnston D, Siprashvili Z, Khavari PA. 41. Shaffer AL, Emre NC, Lamy L, Ngo VN, Wright G, Xiao ZNF750 is a p63 target gene that induces KLF4 to drive W, Powell J, Dave S, Yu X, Zhao H, Zeng Y, Chen B, terminal epidermal differentiation. Dev Cell. 2012; 22: 669- Epstein J et al. IRF4 addiction in multiple myeloma. Nature. 677. 2008; 454: 226-231. 54. Soufi A, Donahue G, Zaret KS. Facilitators and 42. Whitney EM, Ghaleb AM, Chen X, Yang VW. impediments of the pluripotency reprogramming factors’ Transcriptional profiling of the cell cycle checkpoint gene initial engagement with the genome. Cell. 2012; 151: 994- Kruppel-like factor 4 reveals a global inhibitory function in 1004. macromolecular biosynthesis. Gene Expr. 2006; 13: 85-96. 55. Mahatan CS, Kaestner KH, Geiman DE, Yang VW. 43. Doherty JR, Cleveland JL. Targeting lactate metabolism for Characterization of the structure and regulation of the cancer therapeutics. J Clin Invest. 2013; 123: 3685-3692. murine gene encoding gut-enriched Kruppel-like factor 44. Shi M, Cui J, Du J, Wei D, Jia Z, Zhang J, Zhu Z, Gao Y, (Kruppel-like factor 4). Nucleic Acids Res. 1999; 27: 4562- Xie K. A novel KLF4/LDHA signaling pathway regulates 4569. aerobic glycolysis in and progression of pancreatic cancer. 56. Chesi M, Nardini E, Lim RS, Smith KD, Kuehl WM, Clin Cancer Res. 2014; 20: 4370-4380. Bergsagel PL. The t(4;14) translocation in myeloma 45. Ye F, Zhang Y, Liu Y, Yamada K, Tso JL, Menjivar JC, dysregulates both FGFR3 and a novel gene, MMSET, Tian JY, Yong WH, Schaue D, Mischel PS, Cloughesy TF, resulting in IgH/MMSET hybrid transcripts. Blood. 1998; Nelson SF, Liau LM et al. Protective properties of radio- 92: 3025-3034. chemoresistant glioblastoma stem cell clones are associated 57. Thompson HG, Harris JW, Wold BJ, Quake SR, Brody JP. with metabolic adaptation to reduced glucose dependence. Identification and confirmation of a module of coexpressed PLoS One. 2013; 8: e80397. genes. Genome Res. 2002; 12: 1517-1522. 46. Chan LL, Shen D, Wilkinson AR, Patton W, Lai N, Chan 58. Zhan F, Huang Y, Colla S, Stewart JP, Hanamura I, Gupta E, Kuksin D, Lin B, Qiu J. A novel image-based cytometry S, Epstein J, Yaccoby S, Sawyer J, Burington B, Anaissie method for autophagy detection in living cells. Autophagy. E, Hollmig K, Pineda-Roman M et al. The molecular 2012; 8: 1371-1382. classification of multiple myeloma. Blood. 2006; 108: 47. Oeste CL, Seco E, Patton WF, Boya P, Perez-Sala D. 2020-2028. Interactions between autophagic and endo-lysosomal 59. Goswami CP, Nakshatri H. PROGgeneV2: enhancements markers in endothelial cells. Histochem Cell Biol. 2013; on the existing database. BMC Cancer. 2014; 14: 970. 139: 659-670. 60. McDermott M, Eustace AJ, Busschots S, Breen L, Crown J, 48. Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Clynes M, O’Donovan N, Stordal B. In vitro development Acevedo-Arozena A, Adeli K, Agholme L, Agnello M, of chemotherapy and targeted therapy drug-resistant cancer Agostinis P, Aguirre-Ghiso JA, Ahn HJ, Ait-Mohamed O, cell lines: a practical guide with case studies. Front Oncol. Ait-Si-Ali S et al. Guidelines for the use and interpretation 2014; 4: 40. of assays for monitoring autophagy. Autophagy. 2012; 8: 61. Keats JJ, Chesi M, Egan JB, Garbitt VM, Palmer SE, 445-544. Braggio E, Van Wier S, Blackburn PR, Baker AS, 49. Shvets E, Fass E, Scherz-Shouval R, Elazar Z. The Dispenzieri A, Kumar S, Rajkumar SV, Carpten JD et al. N-terminus and Phe52 residue of LC3 recruit p62/SQSTM1 Clonal competition with alternating dominance in multiple into autophagosomes. J Cell Sci. 2008; 121: 2685-2695. myeloma. Blood. 2012; 120: 1067-1076. 50. Mizushima N, Yamamoto A, Matsui M, Yoshimori T, 62. Abraham J, Salama NN, Azab AK. The role of Ohsumi Y. In vivo analysis of autophagy in response to P-glycoprotein in drug resistance in multiple myeloma. nutrient starvation using transgenic mice expressing a Leuk Lymphoma. 2015; 56: 26-33. fluorescent autophagosome marker. Mol Biol Cell. 2004; 63. Liu C, DeRoo EP, Stecyk C, Wolsey M, Szuchnicki M, 15: 1101-1111. Hagos EG. Impaired autophagy in mouse embryonic 51. Glaumann H, Ahlberg J. Comparison of different fibroblasts null for Kruppel-like Factor 4 promotes DNA autophagic vacuoles with regard to ultrastructure, enzymatic damage and increases apoptosis upon serum starvation. Mol www.impactjournals.com/oncotarget 14829 Oncotarget Cancer. 2015; 14: 101. JM. Oncogene expression cloning by retroviral transduction 64. Wu Y, Li Y, Zhang H, Huang Y, Zhao P, Tang Y, Qiu of adenovirus E1A-immortalized rat kidney RK3E cells: X, Ying Y, Li W, Ni S, Zhang M, Liu L, Xu Y et al. transformation of a host with epithelial features by c-MYC Autophagy and mTORC1 regulate the stochastic phase of and the zinc finger protein GKLF. Cell Growth Differ. somatic cell reprogramming. Nat Cell Biol. 2015; May 18. 1999; 10: 423-434. doi: 10.1038/ncb3172. [Epub ahead of print] 75. Bellance N, Pabst L, Allen G, Rossignol R, Nagrath D. 65. Viiri J, Hyttinen JM, Ryhanen T, Rilla K, Paimela T, Oncosecretomics coupled to bioenergetics identifies alpha- Kuusisto E, Siitonen A, Urtti A, Salminen A, Kaarniranta amino adipic acid, isoleucine and GABA as potential K. p62/sequestosome 1 as a regulator of proteasome biomarkers of cancer: Differential expression of c-Myc, inhibitor-induced autophagy in human retinal pigment Oct1 and KLF4 coordinates metabolic changes. Biochim epithelial cells. Mol Vis. 2010; 16: 1399-1414. Biophys Acta. 2012; 1817: 2060-2071. 66. Chen S, Zhou L, Zhang Y, Leng Y, Pei XY, Lin H, Jones 76. Karsli-Uzunbas G, Guo JY, Price S, Teng X, Laddha SV, R, Orlowski RZ, Dai Y, Grant S. Targeting SQSTM1/p62 Khor S, Kalaany NY, Jacks T, Chan CS, Rabinowitz JD, induces cargo loading failure and converts autophagy to White E. Autophagy is required for glucose homeostasis apoptosis via NBK/Bik. Mol Cell Biol. 2014; 34: 3435- and lung tumor maintenance. Cancer Discov. 2014; 4: 914- 3449. 927. 67. Huang Z, Wu H, Chuai S, Xu F, Yan F, Englund N, Wang 77. Singh R, Kaushik S, Wang Y, Xiang Y, Novak I, Komatsu Z, Zhang H, Fang M, Wang Y, Gu J, Zhang M, Yang T et M, Tanaka K, Cuervo AM, Czaja MJ. Autophagy regulates al. NSD2 is recruited through its PHD domain to oncogenic lipid metabolism. Nature. 2009; 458: 1131-1135. gene loci to drive multiple myeloma. Cancer Res. 2013; 73: 78. Neufeld TP. Autophagy and cell growth—the yin and yang 6277-6288. of nutrient responses. J Cell Sci. 2012; 125: 2359-2368. 68. Popovic R, Martinez-Garcia E, Giannopoulou EG, Zhang 79. Parikh A, Childress C, Deitrick K, Lin Q, Rukstalis Q, Zhang Q, Ezponda T, Shah MY, Zheng Y, Will D, Yang W. Statin-induced autophagy by inhibition of CM, Small EC, Hua Y, Bulic M, Jiang Y et al. Histone geranylgeranyl biosynthesis in prostate cancer PC3 cells. methyltransferase MMSET/NSD2 alters EZH2 binding and Prostate. 2010; 70: 971-981. reprograms the myeloma epigenome through global and 80. Yang Y, Su D, Zhao L, Zhang D, Xu J, Wan J, Fan S, focal changes in H3K36 and H3K27 methylation. PLoS Chen M. Different effects of LDH-A inhibition by oxamate Genet. 2014; 10: e1004566. in non-small cell lung cancer cells. Oncotarget. 2014; 5: 69. Hiroi T, Deming CB, Zhao H, Hansen BS, Arkenbout EK, 11886-11896. Myers TJ, McDevitt MA, Rade JJ. Proteasome inhibitors 81. Pandyra A, Mullen PJ, Kalkat M, Yu R, Pong JT, Li Z, enhance endothelial thrombomodulin expression via Trudel S, Lang KS, Minden MD, Schimmer AD, Penn LZ. induction of Kruppel-like transcription factors. Arterioscler Immediate utility of two approved agents to target both the Thromb Vasc Biol. 2009; 29: 1587-1593. metabolic mevalonate pathway and its restorative feedback 70. Ramirez-Valle F, Braunstein S, Zavadil J, Formenti SC, loop. Cancer Res. 2014; 74: 4772-4782. Schneider RJ. eIF4GI links nutrient sensing by mTOR to 82. Maiso P, Huynh D, Moschetta M, Sacco A, Aljawai Y, cell proliferation and inhibition of autophagy. J Cell Biol. Mishima Y, Asara JM, Roccaro AM, Kimmelman AC, 2008; 181: 293-307. Ghobrial IM. Metabolic signature identifies novel targets 71. Wang Y, Zhao B, Zhang Y, Tang Z, Shen Q, Zhang Y, for drug resistance in multiple myeloma. Cancer Res. 2015; Zhang W, Du J, Chien S, Wang N. Kruppel-like factor 4 is 75: 2071-2082. induced by rapamycin and mediates the anti-proliferative 83. Yaccoby S. The phenotypic plasticity of myeloma plasma effect of rapamycin in rat carotid arteries after balloon cells as expressed by dedifferentiation into an immature, injury. Br J Pharmacol. 2012; 165: 2378-2388. resilient, and apoptosis-resistant phenotype. Clin Cancer 72. Zhang Y, Nicholatos J, Dreier JR, Ricoult SJ, Widenmaier Res. 2005; 11: 7599-7606. SB, Hotamisligil GS, Kwiatkowski DJ, Manning BD. 84. Chaidos A, Barnes CP, Cowan G, May PC, Melo V, Coordinated regulation of protein synthesis and degradation Hatjiharissi E, Papaioannou M, Harrington H, Doolittle by mTORC1. Nature. 2014; 513: 440-443. H, Terpos E, Dimopoulos M, Abdalla S, Yarranton H 73. Valencia-Hipolito A, Hernandez-Atenogenes M, Vega et al. Clinical drug resistance linked to interconvertible GG, Maldonado-Valenzuela A, Ramon G, Mayani H, Pena phenotypic and functional states of tumor-propagating cells Alonso Y, Martinez-Maza O, Mendez-Tenorio A, Huerta- in multiple myeloma. Blood. 2013; 121: 318-328. Yepez S, Bonavida B, Vega MI. Expression of KLF4 85. Hawley RG. The cancer stem cell conundrum in multiple is a predictive marker for survival in pediatric Burkitt myeloma. J Stem Cell Res Ther. 2012; 2: 1000e110. lymphoma. Leuk Lymphoma. 2014; 55: 1806-1814. 86. Yu F, Li J, Chen H, Fu J, Ray S, Huang S, Zheng H, Ai W. 74. Foster KW, Ren S, Louro ID, Lobo-Ruppert SM, Kie-Bell Kruppel-like factor 4 (KLF4) is required for maintenance of P, Grizzle W, Hayes MR, Broker TR, Chow LT, Ruppert breast cancer stem cells and for cell migration and invasion. www.impactjournals.com/oncotarget 14830 Oncotarget Oncogene. 2011; 30: 2161-2172. 87. Keats JJ, Fonseca R, Chesi M, Schop R, Baker A, Chng WJ, Van WS, Tiedemann R, Shi CX, Sebag M, Braggio E, Henry T, Zhu YX et al. Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma. Cancer Cell. 2007; 12: 131-144.
www.impactjournals.com/oncotarget 14831 Oncotarget
KLF4-SQSTM1/p62-associated prosurvival autophagy contributes to carfilzomib resistance in multiple myeloma models
Supplementary Material
Supplementary Figure S1: GSEA enrichment plots associated with acquisition of carfilzomib resistance in KMS-11/Cfz and KMS-34/Cfz cells. (A) Gene set:
KEGG_PROTEASOME. (B) Gene set: REACTOME_CHOLESTEROL_BIOSYNTHESIS. FDR, false discovery rate; NES, normalized enrichment score; CfzR, carfilzomib-resistant derivatives.
Supplemenatry Figure S2: Evolutionarily conserved KLF4-binding sites in the SQSTM1 promoter regions. (A) Positions of KLF4 consensus motifs (TRANSFAC Motif ID, M01588) in the human SQSTM1 gene. (B) Alignment of the sequences in (A) across species (blue highlighted regions). Note that the KLF4 motif (AGGGCGGGGC) in region 2, chr5: 179233988-
179233997, of the SQSTM1 promoter shows almost perfect conservation across all 14 species.
Supplementary Figure S3: Overexpression of exogenous KLF4 is selected against during growth of KMS-11/KLF4 cells in culture. KLF4 protein levels were detected by western blotting with rabbit anti-KLF4 monoclonal antibodies against the carboxyl terminus (D1F2; Cell
Signaling). Cell populations that grew out after 1 month of culture had diminished levels of exogenous KLF4 expression. A and B denote two independent transfections.
Supplementary Table S1. Differentially expressed genes in KMS‐11/Cfz versus KMS‐11
Probe Set ID Symbol Name Change FC > 1.36 209459_s_at ABAT 4‐aminobutyrate aminotransferase up 1.38 209460_at ABAT 4‐aminobutyrate aminotransferase up 1.42 203192_at ABCB6 ATP‐binding cassette, sub‐family B (MDR/TAP), member 6 up 1.49 205566_at ABHD2 abhydrolase domain containing 2 down 1.55 228490_at ABHD2 abhydrolase domain containing 2 down 1.45 200710_at ACADVL acyl‐CoA dehydrogenase, very long chain up 1.73 204565_at ACOT13 acyl‐CoA thioesterase 13 up 1.40 205942_s_at ACSM3 acyl‐CoA synthetase medium‐chain family member 3 down 1.37 210377_at ACSM3 acyl‐CoA synthetase medium‐chain family member 3 down 1.50 216705_s_at ADA adenosine deaminase down 1.40 202603_at ADAM10 ADAM metallopeptidase domain 10 down 1.39 202604_x_at ADAM10 ADAM metallopeptidase domain 10 down 1.62 214895_s_at ADAM10 ADAM metallopeptidase domain 10 down 1.49 217007_s_at ADAM15 ADAM metallopeptidase domain 15 up 1.38 205997_at ADAM28 ADAM metallopeptidase domain 28 up 1.55 208268_at ADAM28 ADAM metallopeptidase domain 28 up 1.64 203741_s_at ADCY7 adenylate cyclase 7 up 1.52 224480_s_at AGPAT9 1‐acylglycerol‐3‐phosphate O‐acyltransferase 9 up 1.48 224461_s_at AIFM2 apoptosis‐inducing factor, mitochondrion‐associated, 2 up 1.49 228445_at AIFM2 apoptosis‐inducing factor, mitochondrion‐associated, 2 up 1.54 206513_at AIM2 absent in melanoma 2 up 1.69 201951_at ALCAM activated leukocyte cell adhesion molecule down 1.38 201952_at ALCAM activated leukocyte cell adhesion molecule down 1.45 231202_at ALDH1L2 aldehyde dehydrogenase 1 family, member L2 down 3.13 202022_at ALDOC aldolase C, fructose‐bisphosphate down 1.50 225969_at ALKBH6 alkB, alkylation repair homolog 6 (E. coli) up 1.38 204446_s_at ALOX5 arachidonate 5‐lipoxygenase up 1.66 209425_at AMACR alpha‐methylacyl‐CoA racemase down 1.42 229497_at ANKDD1A ankyrin repeat and death domain containing 1A down 1.89 238332_at ANKRD29 ankyrin repeat domain 29 up 1.42 1556183_at ANKRD36BP2 ankyrin repeat domain 36B pseudogene 2 down 1.59 227337_at ANKRD37 ankyrin repeat domain 37 down 1.58 219496_at ANKRD57 ankyrin repeat domain 57 down 1.39 227034_at ANKRD57 ankyrin repeat domain 57 down 1.55 201590_x_at ANXA2 annexin A2 up 1.42 210427_x_at ANXA2 annexin A2 up 1.46 213503_x_at ANXA2 annexin A2 up 1.49 208816_x_at ANXA2P2 annexin A2 pseudogene 2 up 1.45 204894_s_at AOC3 amine oxidase, copper containing 3 (vascular adhesion protein 1) down 1.58 237159_x_at AP1S3 adaptor‐related protein complex 1, sigma 3 subunit down 1.37 1555731_a_at AP1S3 adaptor‐related protein complex 1, sigma 3 subunit down 1.37 209546_s_at APOL1 apolipoprotein L, 1 up 1.61 221087_s_at APOL3 apolipoprotein L, 3 down 1.71 225173_at ARHGAP18 Rho GTPase activating protein 18 down 1.39 58780_s_at ARHGEF40 Rho guanine nucleotide exchange factor (GEF) 40 up 1.37 209135_at ASPH aspartate beta‐hydroxylase up 1.41 233536_at ASXL3 additional sex combs like 3 (Drosophila) up 1.65 204998_s_at ATF5 activating transcription factor 5 down 1.54 204999_s_at ATF5 activating transcription factor 5 down 1.60 212062_at ATP9A ATPase, class II, type 9A down 1.86 212599_at AUTS2 autism susceptibility candidate 2 up 1.43 206435_at B4GALNT1 beta‐1,4‐N‐acetyl‐galactosaminyl transferase 1 up 2.19 1555385_at B4GALNT1 beta‐1,4‐N‐acetyl‐galactosaminyl transferase 1 up 1.67 223632_s_at BCAN brevican up 1.86 223633_s_at BCAN brevican up 2.24 227341_at BEND7 BEN domain containing 7 up 1.38 207399_at BFSP2 beaded filament structural protein 2, phakinin down 1.42 201169_s_at BHLHE40 basic helix‐loop‐helix family, member e40 down 1.42 201170_s_at BHLHE40 basic helix‐loop‐helix family, member e40 down 1.60 202201_at BLVRB biliverdin reductase B (flavin reductase (NADPH)) up 3.66 201848_s_at BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 down 1.41 201849_at BNIP3 BCL2/adenovirus E1B 19kDa interacting protein 3 down 1.56 218954_s_at BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1‐likeup 1.66 218955_at BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1‐likeup 1.50 208906_at BSCL2 Berardinelli‐Seip congenital lipodystrophy 2 (seipin) up 1.39 218792_s_at BSPRY B‐box and SPRY domain containing down 1.41 228434_at BTNL9 butyrophilin‐like 9 up 1.43 226313_at C10orf35 chromosome 10 open reading frame 35 up 1.87 219806_s_at C11orf75 chromosome 11 open reading frame 75 down 1.45 227099_s_at C11orf96 chromosome 11 open reading frame 96 down 1.44 218723_s_at C13orf15 chromosome 13 open reading frame 15 down 1.42 1556588_at C15orf37 chromosome 15 open reading frame 37 down 1.46 214696_at C17orf91 chromosome 17 open reading frame 91 up 1.92 229238_at C17orf97 chromosome 17 open reading frame 97 up 1.42 220918_at C21orf96 chromosome 21 open reading frame 96 up 1.51 212421_at C22orf9 chromosome 22 open reading frame 9 down 1.41 217118_s_at C22orf9 chromosome 22 open reading frame 9 down 1.51 227144_at C22orf9 chromosome 22 open reading frame 9 down 1.49 1554176_a_at C3orf33 chromosome 3 open reading frame 33 down 1.42 208451_s_at C4A /// C4B /// complement component 4A (Rodgers blood group) /// complement compo down 1.44 236634_at C8orf48 chromosome 8 open reading frame 48 up 1.61 59437_at C9orf116 chromosome 9 open reading frame 116 up 1.43 239799_at C9orf130 chromosome 9 open reading frame 130 up 1.37 227534_at C9orf21 chromosome 9 open reading frame 21 up 1.36 225146_at C9orf25 chromosome 9 open reading frame 25 up 1.45 209030_s_at CADM1 cell adhesion molecule 1 down 1.44 209031_at CADM1 cell adhesion molecule 1 down 1.39 209032_s_at CADM1 cell adhesion molecule 1 down 1.47 229029_at CAMK4 calcium/calmodulin‐dependent protein kinase IV up 1.44 208683_at CAPN2 calpain 2, (m/II) large subunit down 1.56 224414_s_at CARD6 caspase recruitment domain family, member 6 up 1.63 1561405_s_at CATSPER2 cation channel, sperm associated 2 up 1.36 203065_s_at CAV1 caveolin 1, caveolae protein, 22kDa down 1.52 212097_at CAV1 caveolin 1, caveolae protein, 22kDa down 1.48 209682_at CBLB Cas‐Br‐M (murine) ecotropic retroviral transforming sequence b up 1.40 242301_at CBLN2 cerebellin 2 precursor up 1.49 205379_at CBR3 carbonyl reductase 3 up 1.43 212816_s_at CBS cystathionine‐beta‐synthase down 2.17 1553972_a_at CBS cystathionine‐beta‐synthase down 1.88 1553645_at CCDC141 coiled‐coil domain containing 141 up 1.46 221912_s_at CCDC28B coiled‐coil domain containing 28B up 1.42 208712_at CCND1 cyclin D1 down 1.90 213523_at CCNE1 cyclin E1 up 1.42 219470_x_at CCNJ cyclin J down 1.52 229091_s_at CCNJ cyclin J down 1.47 220565_at CCR10 chemokine (C‐C motif) receptor 10 down 2.13 204306_s_at CD151 CD151 molecule (Raph blood group) up 1.59 214049_x_at CD7 CD7 molecule down 1.48 214551_s_at CD7 CD7 molecule down 1.61 213182_x_at CDKN1C cyclin‐dependent kinase inhibitor 1C (p57, Kip2) down 1.62 213183_s_at CDKN1C Cyclin‐dependent kinase inhibitor 1C (p57, Kip2) down 1.61 213348_at CDKN1C cyclin‐dependent kinase inhibitor 1C (p57, Kip2) down 1.64 216894_x_at CDKN1C cyclin‐dependent kinase inhibitor 1C (p57, Kip2) down 1.53 219534_x_at CDKN1C cyclin‐dependent kinase inhibitor 1C (p57, Kip2) down 1.46 226185_at CDS1 CDP‐diacylglycerol synthase (phosphatidate cytidylyltransferase) 1 down 1.43 213554_s_at CDV3 CDV3 homolog (mouse) down 1.43 223232_s_at CGN cingulin down 1.36 242157_at CHD9 Chromodomain helicase DNA binding protein 9 up 1.49 229954_at CHDH choline dehydrogenase down 1.61 231994_at CHDH choline dehydrogenase down 1.59 1559590_at CHDH choline dehydrogenase down 1.81 200998_s_at CKAP4 cytoskeleton‐associated protein 4 down 1.53 200999_s_at CKAP4 cytoskeleton‐associated protein 4 down 1.45 204810_s_at CKM creatine kinase, muscle up 1.54 1554406_a_at CLEC7A C‐type lectin domain family 7, member A down 1.38 1555756_a_at CLEC7A C‐type lectin domain family 7, member A down 1.42 208791_at CLU clusterin up 2.88 208792_s_at CLU clusterin up 2.83 222043_at CLU clusterin up 1.56 235099_at CMTM8 CKLF‐like MARVEL transmembrane domain containing 8 up 1.54 203642_s_at COBLL1 COBL‐like 1 down 1.40 225288_at COL27A1 collagen, type XXVII, alpha 1 up 1.37 204724_s_at COL9A3 collagen, type IX, alpha 3 down 1.40 201116_s_at CPE carboxypeptidase E down 1.65 201117_s_at CPE carboxypeptidase E down 1.61 228759_at CREB3L2 cAMP responsive element binding protein 3‐like 2 down 1.36 226455_at CREB3L4 cAMP responsive element binding protein 3‐like 4 down 1.46 218358_at CRELD2 cysteine‐rich with EGF‐like domains 2 down 1.41 209967_s_at CREM cAMP responsive element modulator up 1.49 228092_at CREM cAMP responsive element modulator up 1.45 230511_at CREM cAMP responsive element modulator up 1.38 205081_at CRIP1 cysteine‐rich protein 1 (intestinal) up 2.32 206843_at CRYBA4 crystallin, beta A4 up 1.61 205159_at CSF2RB colony stimulating factor 2 receptor, beta, low‐affinity (granulocyte‐macropdown 1.57 225681_at CTHRC1 collagen triple helix repeat containing 1 down 1.66 200838_at CTSB cathepsin B up 1.42 213274_s_at CTSB cathepsin B up 1.39 227961_at CTSB cathepsin B up 1.40 200766_at CTSD cathepsin D up 1.48 232136_s_at CTTNBP2 cortactin binding protein 2 down 1.37 227757_at CUL4A cullin 4A down 1.36 203532_x_at CUL5 cullin 5 down 1.38 205898_at CX3CR1 chemokine (C‐X3‐C motif) receptor 1 down 2.30 204533_at CXCL10 chemokine (C‐X‐C motif) ligand 10 up 1.52 202263_at CYB5R1 cytochrome b5 reductase 1 up 1.51 227109_at CYP2R1 cytochrome P450, family 2, subfamily R, polypeptide 1 down 1.65 220432_s_at CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 up 2.04 244407_at CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 up 2.88 1553977_a_at CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 up 1.60 230866_at CYSLTR1 cysteinyl leukotriene receptor 1 down 1.82 231747_at CYSLTR1 cysteinyl leukotriene receptor 1 down 1.72 205471_s_at DACH1 dachshund homolog 1 (Drosophila) down 1.36 228915_at DACH1 dachshund homolog 1 (Drosophila) down 1.90 202806_at DBN1 drebrin 1 down 1.80 204850_s_at DCX doublecortin up 1.61 204851_s_at DCX doublecortin up 1.51 202887_s_at DDIT4 DNA‐damage‐inducible transcript 4 down 1.66 218986_s_at DDX60 DEAD (Asp‐Glu‐Ala‐Asp) box polypeptide 60 up 1.67 228152_s_at DDX60L DEAD (Asp‐Glu‐Ala‐Asp) box polypeptide 60‐like up 1.44 212561_at DENND5A DENN/MADD domain containing 5A up 1.72 203385_at DGKA diacylglycerol kinase, alpha 80kDa down 1.49 211272_s_at DGKA diacylglycerol kinase, alpha 80kDa down 1.44 206395_at DGKG diacylglycerol kinase, gamma 90kDa up 1.69 200862_at DHCR24 24‐dehydrocholesterol reductase down 1.49 218976_at DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 down 1.62 223371_s_at DNAJC4 DnaJ (Hsp40) homolog, subfamily C, member 4 up 1.63 204008_at DNAL4 dynein, axonemal, light chain 4 up 1.43 215116_s_at DNM1 dynamin 1 up 1.40 244428_at DNMT3A DNA (cytosine‐5‐)‐methyltransferase 3 alpha down 1.43 225502_at DOCK8 dedicator of cytokinesis 8 down 2.20 232843_s_at DOCK8 dedicator of cytokinesis 8 down 1.60 214844_s_at DOK5 docking protein 5 up 1.38 230158_at DPY19L2 dpy‐19‐like 2 (C. elegans) down 1.43 1554534_at DPYD dihydropyrimidine dehydrogenase up 1.45 208891_at DUSP6 dual specificity phosphatase 6 down 1.54 208892_s_at DUSP6 dual specificity phosphatase 6 down 1.70 211928_at DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 up 1.53 205348_s_at DYNC1I1 dynein, cytoplasmic 1, intermediate chain 1 up 2.20 1569843_at DYNC1I1 dynein, cytoplasmic 1, intermediate chain 1 up 1.41 204271_s_at EDNRB endothelin receptor type B down 2.78 204273_at EDNRB endothelin receptor type B down 3.81 206701_x_at EDNRB endothelin receptor type B down 3.10 223608_at EFCAB2 EF‐hand calcium binding domain 2 up 1.45 206580_s_at EFEMP2 EGF‐containing fibulin‐like extracellular matrix protein 2 up 1.56 209356_x_at EFEMP2 EGF‐containing fibulin‐like extracellular matrix protein 2 up 1.99 1558411_at EGFEM1P EGF‐like and EMI domain containing 1, pseudogene up 1.51 221497_x_at EGLN1 egl nine homolog 1 (C. elegans) down 1.45 223046_at EGLN1 egl nine homolog 1 (C. elegans) down 1.38 224314_s_at EGLN1 egl nine homolog 1 (C. elegans) down 1.51 231292_at EID3 EP300 interacting inhibitor of differentiation 3 up 1.45 218696_at EIF2AK3 eukaryotic translation initiation factor 2‐alpha kinase 3 down 1.39 237145_at EIF2AK4 eukaryotic translation initiation factor 2 alpha kinase 4 down 1.52 203490_at ELF4 E74‐like factor 4 (ets domain transcription factor) up 1.36 1559072_a_at ELFN2 extracellular leucine‐rich repeat and fibronectin type III domain containing 2down 1.50 226982_at ELL2 elongation factor, RNA polymerase II, 2 down 1.37 203729_at EMP3 epithelial membrane protein 3 up 2.06 1561396_at EPHA6 EPH receptor A6 down 1.41 227609_at EPSTI1 epithelial stromal interaction 1 (breast) down 1.36 235745_at ERN1 endoplasmic reticulum to nucleus signaling 1 down 1.41 218498_s_at ERO1L ERO1‐like (S. cerevisiae) down 1.41 222646_s_at ERO1L ERO1‐like (S. cerevisiae) down 1.48 225846_at ESRP1 epithelial splicing regulatory protein 1 down 2.06 203349_s_at ETV5 ets variant 5 up 1.37 221664_s_at F11R F11 receptor down 1.42 223000_s_at F11R F11 receptor down 1.42 224097_s_at F11R F11 receptor down 1.43 208962_s_at FADS1 fatty acid desaturase 1 down 2.07 208964_s_at FADS1 fatty acid desaturase 1 down 1.89 216080_s_at FADS3 fatty acid desaturase 3 up 1.37 221602_s_at FAIM3 Fas apoptotic inhibitory molecule 3 down 1.62 217967_s_at FAM129A family with sequence similarity 129, member A up 1.46 218532_s_at FAM134B family with sequence similarity 134, member B down 1.40 214889_at FAM149A family with sequence similarity 149, member A down 1.43 222291_at FAM149A family with sequence similarity 149, member A down 1.38 235850_at FAM162A family with sequence similarity 162, member A down 1.59 229655_at FAM19A5 family with sequence similarity 19 (chemokine (C‐C motif)‐like), member A5down 1.42 1557014_a_at FAM201A family with sequence similarity 201, member A down 1.48 227410_at FAM43A family with sequence similarity 43, member A up 1.43 226811_at FAM46C family with sequence similarity 46, member C down 1.40 221774_x_at FAM48A family with sequence similarity 48, member A down 1.47 226330_s_at FAM48A family with sequence similarity 48, member A down 1.42 217540_at FAM55C family with sequence similarity 55, member C up 1.39 219895_at FAM70A family with sequence similarity 70, member A up 1.62 203184_at FBN2 fibrillin 2 down 1.71 209696_at FBP1 fructose‐1,6‐bisphosphatase 1 up 1.49 44040_at FBXO41 F‐box protein 41 down 1.44 203620_s_at FCHSD2 FCH and double SH3 domains 2 down 1.42 204422_s_at FGF2 fibroblast growth factor 2 (basic) up 1.49 206742_at FIGF c‐fos induced growth factor (vascular endothelial growth factor D) up 1.49 219117_s_at FKBP11 FK506 binding protein 11, 19 kDa down 1.66 219118_at FKBP11 FK506 binding protein 11, 19 kDa down 1.79 228308_at FKBP11 FK506 binding protein 11, 19 kDa down 1.70 224002_s_at FKBP7 FK506 binding protein 7 down 1.39 231130_at FKBP7 FK506 binding protein 7 down 1.38 208614_s_at FLNB filamin B, beta up 1.40 223950_s_at FLYWCH1 FLYWCH‐type zinc finger 1 up 1.39 234106_s_at FLYWCH1 FLYWCH‐type zinc finger 1 up 1.40 229893_at FRMD3 FERM domain containing 3 up 1.73 230645_at FRMD3 FERM domain containing 3 up 1.66 242600_at FRMD3 FERM domain containing 3 up 1.68 230831_at FRMD5 FERM domain containing 5 down 1.40 206109_at FUT1 fucosyltransferase 1 (galactoside 2‐alpha‐L‐fucosyltransferase, H blood groudown 1.44 202812_at GAA glucosidase, alpha; acid up 1.42 229114_at GAB1 GRB2‐associated binding protein 1 down 1.37 208868_s_at GABARAPL1 GABA(A) receptor‐associated protein like 1 up 1.86 208869_s_at GABARAPL1 GABA(A) receptor‐associated protein like 1 up 2.30 211458_s_at GABARAPL1 /// GABA(A) receptor‐associated protein like 1 /// GABA(A) receptors associateup 2.34 205890_s_at GABBR1 /// UB gamma‐aminobutyric acid (GABA) B receptor, 1 /// ubiquitin D up 1.56 202192_s_at GAS7 growth arrest‐specific 7 down 1.39 207704_s_at GAS7 growth arrest‐specific 7 down 1.62 211067_s_at GAS7 growth arrest‐specific 7 down 1.57 208503_s_at GATAD1 GATA zinc finger domain containing 1 down 1.39 203178_at GATM glycine amidinotransferase (L‐arginine:glycine amidinotransferase) down 1.55 216733_s_at GATM glycine amidinotransferase (L‐arginine:glycine amidinotransferase) down 1.51 210589_s_at GBAP1 glucosidase, beta, acid pseudogene 1 up 1.36 203282_at GBE1 glucan (1,4‐alpha‐), branching enzyme 1 down 1.48 202269_x_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.55 202270_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.53 231577_s_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.50 223434_at GBP3 guanylate binding protein 3 up 2.02 234986_at GCLM glutamate‐cysteine ligase, modifier subunit up 1.58 236140_at GCLM glutamate‐cysteine ligase, modifier subunit up 1.41 228776_at GJC1 gap junction protein, gamma 1, 45kDa up 1.51 214430_at GLA galactosidase, alpha up 1.54 204836_at GLDC glycine dehydrogenase (decarboxylating) down 1.66 204222_s_at GLIPR1 GLI pathogenesis‐related 1 up 1.44 216341_s_at GNRHR gonadotropin‐releasing hormone receptor up 1.37 201141_at GPNMB glycoprotein (transmembrane) nmb up 1.82 221297_at GPRC5D G protein‐coupled receptor, family C, group 5, member D down 1.62 206204_at GRB14 growth factor receptor‐bound protein 14 down 1.82 235405_at GSTA4 glutathione S‐transferase alpha 4 up 1.51 203817_at GUCY1B3 guanylate cyclase 1, soluble, beta 3 up 1.41 211555_s_at GUCY1B3 guanylate cyclase 1, soluble, beta 3 up 1.42 204235_s_at GULP1 GULP, engulfment adaptor PTB domain containing 1 up 1.66 204237_at GULP1 GULP, engulfment adaptor PTB domain containing 1 up 1.64 215913_s_at GULP1 GULP, engulfment adaptor PTB domain containing 1 up 1.68 224301_x_at H2AFJ H2A histone family, member J down 1.54 225245_x_at H2AFJ H2A histone family, member J down 1.56 208579_x_at H2BFS H2B histone family, member S down 1.90 229208_at HAUS2 HAUS augmin‐like complex, subunit 2 down 1.46 206834_at HBD hemoglobin, delta down 1.47 205659_at HDAC9 histone deacetylase 9 down 1.41 1552760_at HDAC9 histone deacetylase 9 down 1.37 1554478_a_at HEATR3 HEAT repeat containing 3 down 1.38 223669_at HEMGN hemogen down 1.39 218839_at HEY1 hairy/enhancer‐of‐split related with YRPW motif 1 up 1.42 44783_s_at HEY1 hairy/enhancer‐of‐split related with YRPW motif 1 up 1.43 210997_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 1.37 204689_at HHEX hematopoietically expressed homeobox up 1.37 208461_at HIC1 hypermethylated in cancer 1 up 1.42 230218_at HIC1 hypermethylated in cancer 1 up 1.72 209398_at HIST1H1C histone cluster 1, H1c down 1.85 215071_s_at HIST1H2AC histone cluster 1, H2ac down 2.20 214472_at HIST1H2AD /// histone cluster 1, H2ad /// histone cluster 1, H3d down 1.38 214522_x_at HIST1H2AD /// histone cluster 1, H2ad /// histone cluster 1, H3d down 1.46 214469_at HIST1H2AE histone cluster 1, H2ae down 1.63 214554_at HIST1H2AL histone cluster 1, H2al down 1.95 214481_at HIST1H2AM histone cluster 1, H2am down 1.40 214455_at HIST1H2BC histone cluster 1, H2bc down 2.05 209911_x_at HIST1H2BD histone cluster 1, H2bd down 1.76 222067_x_at HIST1H2BD histone cluster 1, H2bd down 1.66 208527_x_at HIST1H2BE histone cluster 1, H2be down 1.72 208490_x_at HIST1H2BF histone cluster 1, H2bf down 1.68 208546_x_at HIST1H2BH histone cluster 1, H2bh down 1.91 208523_x_at HIST1H2BI histone cluster 1, H2bi down 1.51 214502_at HIST1H2BJ histone cluster 1, H2bj down 1.44 209806_at HIST1H2BK histone cluster 1, H2bk down 1.50 206110_at HIST1H3H histone cluster 1, H3h down 1.47 208180_s_at HIST1H4H histone cluster 1, H4h down 1.37 214463_x_at HIST1H4J histone cluster 1, H4j down 1.45 214290_s_at HIST2H2AA3 ///histone cluster 2, H2aa3 /// histone cluster 2, H2aa4 down 1.82 218280_x_at HIST2H2AA3 ///histone cluster 2, H2aa3 /// histone cluster 2, H2aa4 down 2.00 202708_s_at HIST2H2BE histone cluster 2, H2be down 1.91 227614_at HKDC1 hexokinase domain containing 1 down 1.60 201137_s_at HLA‐DPB1 major histocompatibility complex, class II, DP beta 1 down 1.97 202983_at HLTF helicase‐like transcription factor down 4.09 224734_at HMGB1 high‐mobility group box 1 down 1.46 205822_s_at HMGCS1 3‐hydroxy‐3‐methylglutaryl‐CoA synthase 1 (soluble) down 2.45 221750_at HMGCS1 3‐hydroxy‐3‐methylglutaryl‐CoA synthase 1 (soluble) down 1.74 211597_s_at HOPX HOP homeobox up 1.76 214639_s_at HOXA1 homeobox A1 up 1.38 204778_x_at HOXB7 homeobox B7 up 1.42 204779_s_at HOXB7 homeobox B7 up 1.62 216973_s_at HOXB7 homeobox B7 up 1.56 203913_s_at HPGD hydroxyprostaglandin dehydrogenase 15‐(NAD) down 1.61 211548_s_at HPGD hydroxyprostaglandin dehydrogenase 15‐(NAD) down 1.43 211549_s_at HPGD hydroxyprostaglandin dehydrogenase 15‐(NAD) down 1.45 1554122_a_at HSD17B12 hydroxysteroid (17‐beta) dehydrogenase 12 up 1.48 200598_s_at HSP90B1 heat shock protein 90kDa beta (Grp94), member 1 down 1.37 209448_at HTATIP2 HIV‐1 Tat interactive protein 2, 30kDa up 1.37 204569_at ICK intestinal cell (MAK‐like) kinase up 1.53 208937_s_at ID1 inhibitor of DNA binding 1, dominant negative helix‐loop‐helix protein up 1.58 1555037_a_at IDH1 isocitrate dehydrogenase 1 (NADP+), soluble down 1.37 214453_s_at IFI44 interferon‐induced protein 44 up 2.14 204747_at IFIT3 interferon‐induced protein with tetratricopeptide repeats 3 up 1.51 229450_at IFIT3 interferon‐induced protein with tetratricopeptide repeats 3 up 1.56 209540_at IGF1 insulin‐like growth factor 1 (somatomedin C) down 1.65 209541_at IGF1 insulin‐like growth factor 1 (somatomedin C) down 1.58 209542_x_at IGF1 insulin‐like growth factor 1 (somatomedin C) down 1.45 211577_s_at IGF1 insulin‐like growth factor 1 (somatomedin C) down 1.42 202718_at IGFBP2 insulin‐like growth factor binding protein 2, 36kDa down 1.46 201508_at IGFBP4 insulin‐like growth factor binding protein 4 up 1.57 1558438_a_at IGHE immunoglobulin heavy constant epsilon up 1.91 211430_s_at IGHG1 /// IGHGimmunoglobulin heavy constant gamma 1 (G1m marker) /// immunoglobul down 1.64 209827_s_at IL16 interleukin 16 (lymphocyte chemoattractant factor) down 1.62 219255_x_at IL17RB interleukin 17 receptor B down 2.19 224156_x_at IL17RB interleukin 17 receptor B down 2.01 224361_s_at IL17RB interleukin 17 receptor B down 1.66 203828_s_at IL32 interleukin 32 down 1.71 210587_at INHBE inhibin, beta E down 1.40 223878_at INPP4B inositol polyphosphate‐4‐phosphatase, type II, 105kDa down 1.39 201625_s_at INSIG1 insulin induced gene 1 down 1.39 204202_at IQCE IQ motif containing E up 1.40 204030_s_at IQCJ‐SCHIP1 ///IQ motif containing J‐schwannomin interacting protein 1 read‐through transdown 1.44 222240_s_at ISYNA1 inositol‐3‐phosphate synthase 1 up 1.36 205884_at ITGA4 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA‐4 receptor) down 1.46 205885_s_at ITGA4 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA‐4 receptor) down 1.45 214265_at ITGA8 integrin, alpha 8 down 1.48 235666_at ITGA8 integrin, alpha 8 down 1.61 213478_at KAZ kazrin down 2.72 229144_at KAZ kazrin down 1.52 223412_at KBTBD7 kelch repeat and BTB (POZ) domain containing 7 down 1.44 239118_at KCNA2 potassium voltage‐gated channel, shaker‐related subfamily, member 2 down 1.39 207237_at KCNA3 potassium voltage‐gated channel, shaker‐related subfamily, member 3 down 1.53 204487_s_at KCNQ1 potassium voltage‐gated channel, KQT‐like subfamily, member 1 down 1.38 205968_at KCNS3 potassium voltage‐gated channel, delayed‐rectifier, subfamily S, member 3 up 1.71 200922_at KDELR1 KDEL (Lys‐Asp‐Glu‐Leu) endoplasmic reticulum protein retention receptor 1down 1.37 204017_at KDELR3 KDEL (Lys‐Asp‐Glu‐Leu) endoplasmic reticulum protein retention receptor 3down 1.76 206478_at KIAA0125 KIAA0125 down 1.43 232366_at KIAA0232 KIAA0232 up 1.52 212427_at KIAA0368 KIAA0368 up 1.40 1554438_at KIAA1217 KIAA1217 down 1.53 231856_at KIAA1244 KIAA1244 down 1.48 232166_at KIAA1377 KIAA1377 up 1.87 235956_at KIAA1377 KIAA1377 up 1.64 236325_at KIAA1377 KIAA1377 up 1.48 243539_at KIAA1841 KIAA1841 up 1.83 226003_at KIF21A kinesin family member 21A up 1.57 231875_at KIF21A kinesin family member 21A up 1.74 242517_at KISS1R KISS1 receptor down 1.77 221841_s_at KLF4 Kruppel‐like factor 4 (gut) up 1.66 240432_x_at KLF7 Kruppel‐like factor 7 (ubiquitous) up 1.48 225961_at KLHDC5 kelch domain containing 5 down 1.44 221837_at KLHL22 kelch‐like 22 (Drosophila) up 1.51 221838_at KLHL22 kelch‐like 22 (Drosophila) up 1.65 228167_at KLHL6 kelch‐like 6 (Drosophila) down 3.32 1555275_a_at KLHL6 kelch‐like 6 (Drosophila) down 1.55 1560396_at KLHL6 kelch‐like 6 (Drosophila) down 1.82 201596_x_at KRT18 keratin 18 down 1.96 215189_at KRT86 /// LOC1 keratin 86 /// hypothetical LOC100509764 down 1.46 234679_at KRTAP9‐3 keratin associated protein 9‐3 up 1.47 233640_x_at KRTAP9‐4 keratin associated protein 9‐4 up 1.72 234639_x_at KRTAP9‐8 keratin associated protein 9‐8 up 1.94 220972_s_at KRTAP9‐9 keratin associated protein 9‐9 up 1.90 235252_at KSR1 kinase suppressor of ras 1 up 1.36 208071_s_at LAIR1 leukocyte‐associated immunoglobulin‐like receptor 1 down 1.64 210644_s_at LAIR1 leukocyte‐associated immunoglobulin‐like receptor 1 down 2.54 1554038_at LARP1B La ribonucleoprotein domain family, member 1B down 1.40 207734_at LAX1 lymphocyte transmembrane adaptor 1 down 1.39 204890_s_at LCK lymphocyte‐specific protein tyrosine kinase down 1.44 204891_s_at LCK lymphocyte‐specific protein tyrosine kinase down 1.60 223228_at LDOC1L leucine zipper, down‐regulated in cancer 1‐like up 1.41 209894_at LEPR leptin receptor down 1.36 211354_s_at LEPR leptin receptor down 1.38 220158_at LGALS14 lectin, galactoside‐binding, soluble, 14 down 1.43 208933_s_at LGALS8 lectin, galactoside‐binding, soluble, 8 up 1.54 208934_s_at LGALS8 lectin, galactoside‐binding, soluble, 8 up 1.54 208935_s_at LGALS8 lectin, galactoside‐binding, soluble, 8 up 1.64 208936_x_at LGALS8 lectin, galactoside‐binding, soluble, 8 up 1.41 210732_s_at LGALS8 lectin, galactoside‐binding, soluble, 8 up 1.57 218326_s_at LGR4 leucine‐rich repeat‐containing G protein‐coupled receptor 4 down 1.41 236048_at LHFPL1 lipoma HMGIC fusion partner‐like 1 up 1.57 206140_at LHX2 LIM homeobox 2 up 2.51 211219_s_at LHX2 LIM homeobox 2 up 1.49 210152_at LILRB4 leukocyte immunoglobulin‐like receptor, subfamily B (with TM and ITIM do up 1.85 217892_s_at LIMA1 LIM domain and actin binding 1 down 1.61 218600_at LIMD2 LIM domain containing 2 down 1.43 203411_s_at LMNA lamin A/C up 1.49 1554600_s_at LMNA lamin A/C up 1.50 236008_at LOC100128909 hypothetical LOC100128909 down 1.40 1559871_s_at LOC100129129 hypothetical LOC100129129 up 1.47 235990_at LOC100130987 similar to hCG1815675 up 1.37 227234_at LOC100132815 hypothetical LOC100132815 up 1.47 236260_at LOC100287598 hypothetical LOC100287598 down 1.41 228381_at LOC100287628 Hypothetical protein LOC100287628 down 1.44 1557638_at LOC100287676 Hypothetical protein LOC100287676 down 1.57 219785_s_at LOC100288525 hypothetical protein LOC100288525 down 1.45 220354_at LOC100289410 hypothetical LOC100289410 down 1.51 227655_at LOC100505806 hypothetical LOC100505806 /// small nucleolar RNA, C/D box 123 down 1.70 221973_at LOC100506076 hypothetical LOC100506076 /// hypothetical LOC100506123 up 1.37 229296_at LOC100506119 hypothetical LOC100506119 /// hypothetical LOC100508342 down 1.49 236193_at LOC100506979 hypothetical LOC100506979 down 1.88 244764_at LOC100507198 hypothetical LOC100507198 up 1.60 214945_at LOC100507397 hypothetical LOC100507397 down 1.85 1569122_at LOC100509533 hypothetical LOC100509533 up 1.37 1561343_a_at LOC150005 hypothetical protein LOC150005 up 1.40 236124_at LOC153546 hypothetical protein LOC153546 down 1.46 237271_at LOC154872 hypothetical protein LOC154872 up 1.39 232034_at LOC203274 Hypothetical protein LOC203274 up 1.36 214162_at LOC284244 hypothetical protein LOC284244 up 1.56 1555847_a_at LOC284454 hypothetical LOC284454 up 1.39 236351_at LOC389023 hypothetical LOC389023 up 1.39 229094_at LOC401431 hypothetical LOC401431 up 1.37 1569110_x_at LOC728613 programmed cell death 6 pseudogene down 1.61 221833_at LONP2 Lon peptidase 2, peroxisomal up 1.39 227145_at LOXL4 lysyl oxidase‐like 4 down 1.52 227889_at LPCAT2 lysophosphatidylcholine acyltransferase 2 up 1.37 219631_at LRP12 low density lipoprotein receptor‐related protein 12 up 1.41 220253_s_at LRP12 low density lipoprotein receptor‐related protein 12 up 1.46 220254_at LRP12 low density lipoprotein receptor‐related protein 12 up 1.39 209468_at LRP5 low density lipoprotein receptor‐related protein 5 down 1.48 219441_s_at LRRK1 leucine‐rich repeat kinase 1 down 1.42 226884_at LRRN1 leucine rich repeat neuronal 1 up 2.11 202145_at LY6E lymphocyte antigen 6 complex, locus E down 1.49 206584_at LY96 lymphocyte antigen 96 up 1.47 209942_x_at MAGEA3 melanoma antigen family A, 3 down 1.76 214612_x_at MAGEA6 melanoma antigen family A, 6 down 1.62 224650_at MAL2 mal, T‐cell differentiation protein 2 down 1.56 224558_s_at MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non‐protein codin up 1.36 224567_x_at MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non‐protein codin up 1.39 231735_s_at MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non‐protein codin up 1.36 205088_at MAMLD1 mastermind‐like domain containing 1 up 1.73 209166_s_at MAN2B1 mannosidase, alpha, class 2B, member 1 up 1.44 203841_x_at MAPRE3 microtubule‐associated protein, RP/EB family, member 3 up 1.38 203929_s_at MAPT microtubule‐associated protein tau up 1.69 203930_s_at MAPT microtubule‐associated protein tau up 1.80 221047_s_at MARK1 MAP/microtubule affinity‐regulating kinase 1 up 1.45 226653_at MARK1 MAP/microtubule affinity‐regulating kinase 1 up 1.65 226726_at MBOAT2 membrane bound O‐acyltransferase domain containing 2 up 1.39 226225_at MCC mutated in colorectal cancers down 1.78 212935_at MCF2L MCF.2 cell line derived transforming sequence‐like down 1.55 35147_at MCF2L MCF.2 cell line derived transforming sequence‐like down 1.51 229797_at MCOLN3 mucolipin 3 down 1.38 220122_at MCTP1 multiple C2 domains, transmembrane 1 up 1.44 235740_at MCTP1 multiple C2 domains, transmembrane 1 up 1.72 220603_s_at MCTP2 multiple C2 domains, transmembrane 2 down 1.42 1558077_s_at MDH1B malate dehydrogenase 1B, NAD (soluble) up 1.37 225160_x_at MDM2 Mdm2 p53 binding protein homolog (mouse) down 1.56 209200_at MEF2C myocyte enhancer factor 2C down 1.42 230011_at MEI1 meiosis inhibitor 1 down 1.49 1554208_at MEI1 meiosis inhibitor 1 down 1.43 219858_s_at MFSD6 major facilitator superfamily domain containing 6 down 1.37 1553708_at MGC16075 hypothetical protein MGC16075 down 1.85 221286_s_at MGC29506 plasma cell‐induced ER protein 1 down 1.41 223565_at MGC29506 plasma cell‐induced ER protein 1 down 1.42 242136_x_at MGC70870 C‐terminal binding protein 2 pseudogene down 1.36 219332_at MICALL2 MICAL‐like 2 up 2.99 204918_s_at MLLT3 myeloid/lymphoid or mixed‐lineage leukemia (trithorax homolog, Drosophi down 1.38 220850_at MORC1 MORC family CW‐type zinc finger 1 down 1.37 233917_s_at MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) up 1.36 235352_at MR1 major histocompatibility complex, class I‐related up 1.56 212277_at MTMR4 myotubularin related protein 4 down 1.38 212096_s_at MTUS1 microtubule associated tumor suppressor 1 down 1.39 213693_s_at MUC1 mucin 1, cell surface associated down 1.36 225673_at MYADM myeloid‐associated differentiation marker down 1.48 206717_at MYH8 myosin, heavy chain 8, skeletal muscle, perinatal up 1.46 224823_at MYLK myosin light chain kinase down 1.54 212338_at MYO1D myosin ID down 1.38 244364_at MYO3A myosin IIIA up 1.37 218966_at MYO5C myosin VC down 1.40 213375_s_at N4BP2L1 NEDD4 binding protein 2‐like 1 down 1.37 214753_at N4BP2L2 NEDD4 binding protein 2‐like 2 down 1.44 212993_at NACC2 NACC family member 2, BEN and BTB (POZ) domain containing down 1.38 219368_at NAP1L2 nucleosome assembly protein 1‐like 2 up 1.52 228062_at NAP1L5 nucleosome assembly protein 1‐like 5 down 1.72 228063_s_at NAP1L5 nucleosome assembly protein 1‐like 5 down 1.77 224772_at NAV1 neuron navigator 1 down 1.65 224773_at NAV1 neuron navigator 1 down 1.61 224774_s_at NAV1 neuron navigator 1 down 1.58 1556017_at NBEAL2 neurobeachin‐like 2 up 1.41 211685_s_at NCALD neurocalcin delta down 1.43 224799_at NDFIP2 Nedd4 family interacting protein 2 down 1.44 224802_at NDFIP2 Nedd4 family interacting protein 2 down 1.47 1554010_at NDST1 N‐deacetylase/N‐sulfotransferase (heparan glucosaminyl) 1 down 1.38 202149_at NEDD9 neural precursor cell expressed, developmentally down‐regulated 9 down 1.80 224976_at NFIA nuclear factor I/A down 1.36 226806_s_at NFIA nuclear factor I/A down 1.54 209289_at NFIB nuclear factor I/B up 1.54 209290_s_at NFIB nuclear factor I/B up 1.73 213032_at NFIB nuclear factor I/B up 1.40 203574_at NFIL3 nuclear factor, interleukin 3 regulated down 1.39 218557_at NIT2 nitrilase family, member 2 up 1.48 207031_at NKX3‐2 NK3 homeobox 2 up 1.77 203964_at NMI N‐myc (and STAT) interactor up 1.64 235410_at NPHP3 nephronophthisis 3 (adolescent) down 1.37 221210_s_at NPL N‐acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) up 1.60 223405_at NPL N‐acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) up 1.50 240440_at NPL N‐acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) up 1.46 201467_s_at NQO1 NAD(P)H dehydrogenase, quinone 1 up 1.45 210519_s_at NQO1 NAD(P)H dehydrogenase, quinone 1 up 1.40 203814_s_at NQO2 NAD(P)H dehydrogenase, quinone 2 up 1.52 203939_at NT5E 5'‐nucleotidase, ecto (CD73) down 1.49 1553994_at NT5E 5'‐nucleotidase, ecto (CD73) down 1.45 1553995_a_at NT5E 5'‐nucleotidase, ecto (CD73) down 1.61 236930_at NUMB Numb homolog (Drosophila) down 1.37 219489_s_at NXN nucleoredoxin up 2.17 204972_at OAS2 2'‐5'‐oligoadenylate synthetase 2, 69/71kDa down 1.42 217551_at OR7E14P olfactory receptor, family 7, subfamily E, member 14 pseudogene down 1.74 223464_at OSBPL5 oxysterol binding protein‐like 5 up 2.17 219475_at OSGIN1 oxidative stress induced growth inhibitor 1 up 1.49 207543_s_at P4HA1 prolyl 4‐hydroxylase, alpha polypeptide I down 1.63 202733_at P4HA2 prolyl 4‐hydroxylase, alpha polypeptide II down 1.43 227053_at PACSIN1 protein kinase C and casein kinase substrate in neurons 1 down 1.98 239067_s_at PANX2 pannexin 2 up 1.40 203060_s_at PAPSS2 3'‐phosphoadenosine 5'‐phosphosulfate synthase 2 down 1.66 204629_at PARVB parvin, beta down 1.46 37965_at PARVB parvin, beta down 1.40 37966_at PARVB parvin, beta down 1.41 228635_at PCDH10 protocadherin 10 up 1.81 231726_at PCDHB14 protocadherin beta 14 down 1.51 231789_at PCDHB15 protocadherin beta 15 up 1.57 228905_at PCM1 pericentriolar material 1 up 1.43 205549_at PCP4 Purkinje cell protein 4 down 2.51 205463_s_at PDGFA platelet‐derived growth factor alpha polypeptide down 2.12 229830_at PDGFA Platelet‐derived growth factor alpha polypeptide down 2.87 206691_s_at PDIA2 protein disulfide isomerase family A, member 2 down 2.15 208612_at PDIA3 protein disulfide isomerase family A, member 3 down 1.58 208658_at PDIA4 protein disulfide isomerase family A, member 4 down 1.36 206686_at PDK1 pyruvate dehydrogenase kinase, isozyme 1 down 1.43 226452_at PDK1 pyruvate dehydrogenase kinase, isozyme 1 down 1.51 208982_at PECAM1 platelet/endothelial cell adhesion molecule down 1.39 208983_s_at PECAM1 platelet/endothelial cell adhesion molecule down 1.38 228499_at PFKFB4 6‐phosphofructo‐2‐kinase/fructose‐2,6‐biphosphatase 4 down 2.02 220944_at PGLYRP4 peptidoglycan recognition protein 4 up 1.39 239229_at PHEX phosphate regulating endopeptidase homolog, X‐linked up 1.50 221816_s_at PHF11 PHD finger protein 11 up 1.36 231967_at PHF20L1 PHD finger protein 20‐like 1 down 1.43 201397_at PHGDH phosphoglycerate dehydrogenase down 1.62 217997_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 down 1.36 217999_s_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 down 1.36 225842_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 down 1.76 209803_s_at PHLDA2 pleckstrin homology‐like domain, family A, member 2 down 1.48 210191_s_at PHTF1 putative homeodomain transcription factor 1 up 1.44 215285_s_at PHTF1 putative homeodomain transcription factor 1 up 1.41 203879_at PIK3CD phosphoinositide‐3‐kinase, catalytic, delta polypeptide up 1.44 221605_s_at PIPOX pipecolic acid oxidase down 1.38 207469_s_at PIR pirin (iron‐binding nuclear protein) up 2.62 219014_at PLAC8 placenta‐specific 8 down 1.51 213222_at PLCB1 phospholipase C, beta 1 (phosphoinositide‐specific) down 1.59 205934_at PLCL1 phospholipase C‐like 1 down 1.62 228450_at PLEKHA7 pleckstrin homology domain containing, family A member 7 down 1.40 226122_at PLEKHG1 pleckstrin homology domain containing, family G (with RhoGef domain) me up 1.58 201215_at PLS3 plastin 3 up 1.40 213241_at PLXNC1 plexin C1 down 1.37 217875_s_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 1.44 222449_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 1.52 222450_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 1.56 1554743_x_at PMS1 PMS1 postmeiotic segregation increased 1 (S. cerevisiae) down 1.43 209598_at PNMA2 paraneoplastic antigen MA2 down 2.18 242455_at POU3F2 POU class 3 homeobox 2 down 1.44 211341_at POU4F1 POU class 4 homeobox 1 down 1.36 209529_at PPAP2C phosphatidic acid phosphatase type 2C up 1.96 219195_at PPARGC1A peroxisome proliferator‐activated receptor gamma, coactivator 1 alpha down 1.36 212750_at PPP1R16B protein phosphatase 1, regulatory (inhibitor) subunit 16B down 1.62 228494_at PPP1R9A protein phosphatase 1, regulatory (inhibitor) subunit 9A down 1.37 204507_s_at PPP3R1 protein phosphatase 3, regulatory subunit B, alpha down 1.36 209685_s_at PRKCB protein kinase C, beta down 1.42 209282_at PRKD2 protein kinase D2 down 1.41 38269_at PRKD2 protein kinase D2 down 1.41 202098_s_at PRMT2 protein arginine methyltransferase 2 up 1.39 226961_at PRR15 proline rich 15 down 1.37 219168_s_at PRR5 proline rich 5 (renal) down 2.25 47069_at PRR5 proline rich 5 (renal) down 2.23 216470_x_at PRSS1 /// PRSS2protease, serine, 1 (trypsin 1) /// protease, serine, 2 (trypsin 2) /// proteasedown 2.14 215395_x_at PRSS1 /// TRY6 protease, serine, 1 (trypsin 1) /// trypsinogen C down 1.60 205402_x_at PRSS2 protease, serine, 2 (trypsin 2) down 2.25 207341_at PRTN3 proteinase 3 up 1.78 200866_s_at PSAP prosaposin up 1.44 200871_s_at PSAP prosaposin up 1.37 240091_at PSMA8 proteasome (prosome, macropain) subunit, alpha type, 8 up 1.70 201067_at PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 up 1.40 238020_at PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 up 1.65 233314_at PTEN phosphatase and tensin homolog up 1.86 204897_at PTGER4 prostaglandin E receptor 4 (subtype EP4) up 1.43 206060_s_at PTPN22 protein tyrosine phosphatase, non‐receptor type 22 (lymphoid) down 1.48 236539_at PTPN22 protein tyrosine phosphatase, non‐receptor type 22 (lymphoid) down 1.58 206687_s_at PTPN6 protein tyrosine phosphatase, non‐receptor type 6 down 1.45 204960_at PTPRCAP protein tyrosine phosphatase, receptor type, C‐associated protein down 1.47 221840_at PTPRE protein tyrosine phosphatase, receptor type, E up 1.48 204944_at PTPRG protein tyrosine phosphatase, receptor type, G down 1.46 227396_at PTPRJ protein tyrosine phosphatase, receptor type, J up 1.44 203329_at PTPRM protein tyrosine phosphatase, receptor type, M up 1.43 210675_s_at PTPRR protein tyrosine phosphatase, receptor type, R up 1.42 226762_at PURB purine‐rich element binding protein B down 1.39 212012_at PXDN peroxidasin homolog (Drosophila) down 1.65 212013_at PXDN peroxidasin homolog (Drosophila) down 1.78 220438_at QPCTL glutaminyl‐peptide cyclotransferase‐like down 1.41 242414_at QPRT quinolinate phosphoribosyltransferase up 1.40 219622_at RAB20 RAB20, member RAS oncogene family down 1.79 209514_s_at RAB27A RAB27A, member RAS oncogene family down 1.37 210951_x_at RAB27A RAB27A, member RAS oncogene family down 1.38 215342_s_at RABGAP1L RAB GTPase activating protein 1‐like up 1.48 219151_s_at RABL2A /// RABRAB, member of RAS oncogene family‐like 2A /// RAB, member of RAS oncoup 1.36 222742_s_at RABL5 RAB, member RAS oncogene family‐like 5 up 2.03 219494_at RAD54B RAD54 homolog B (S. cerevisiae) down 1.54 213280_at RAP1GAP2 RAP1 GTPase activating protein 2 up 1.59 49306_at RASSF4 Ras association (RalGDS/AF‐6) domain family member 4 up 1.37 229147_at RASSF6 Ras association (RalGDS/AF‐6) domain family member 6 up 1.70 232549_at RBM11 RNA binding motif protein 11 up 2.14 205923_at RELN reelin down 1.91 214409_at RFPL3S RFPL3 antisense RNA (non‐protein coding) up 1.41 210138_at RGS20 regulator of G‐protein signaling 20 down 1.60 212119_at RHOQ ras homolog gene family, member Q down 1.37 221287_at RNASEL ribonuclease L (2',5'‐oligoisoadenylate synthetase‐dependent) up 1.36 229285_at RNASEL ribonuclease L (2',5'‐oligoisoadenylate synthetase‐dependent) up 1.77 213467_at RND2 Rho family GTPase 2 down 1.38 202636_at RNF103 ring finger protein 103 down 1.48 242985_x_at RNF180 ring finger protein 180 down 1.37 235153_at RNF183 ring finger protein 183 down 1.63 226682_at RORA RAR‐related orphan receptor A down 1.92 235567_at RORA RAR‐related orphan receptor A down 1.38 225150_s_at RTKN rhotekin up 1.38 213555_at RWDD2A RWD domain containing 2A down 1.44 217728_at S100A6 S100 calcium binding protein A6 up 2.15 226603_at SAMD9L sterile alpha motif domain containing 9‐like up 1.37 214997_at SCAI suppressor of cancer cell invasion down 1.46 228930_at SCARNA15 Small Cajal body‐specific RNA 15 down 1.39 211162_x_at SCD stearoyl‐CoA desaturase (delta‐9‐desaturase) down 1.46 211708_s_at SCD stearoyl‐CoA desaturase (delta‐9‐desaturase) down 1.46 224901_at SCD5 stearoyl‐CoA desaturase 5 down 1.69 218217_at SCPEP1 serine carboxypeptidase 1 up 1.40 212158_at SDC2 syndecan 2 up 1.41 202071_at SDC4 syndecan 4 up 1.55 212451_at SECISBP2L SECIS binding protein 2‐like down 1.57 202061_s_at SEL1L sel‐1 suppressor of lin‐12‐like (C. elegans) down 1.37 202062_s_at SEL1L sel‐1 suppressor of lin‐12‐like (C. elegans) down 1.36 202064_s_at SEL1L sel‐1 suppressor of lin‐12‐like (C. elegans) down 1.44 212314_at SEL1L3 sel‐1 suppressor of lin‐12‐like 3 (C. elegans) up 1.61 219259_at SEMA4A sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) adown 2.41 234072_at SEMA4A sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) adown 1.95 213169_at SEMA5A sema domain, seven thrombospondin repeats (type 1 and type 1‐like), transdown 1.40 209723_at SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9 down 3.41 36545_s_at SFI1 Sfi1 homolog, spindle assembly associated (yeast) up 1.37 222258_s_at SH3BP4 SH3‐domain binding protein 4 up 1.42 1557458_s_at SHB Src homology 2 domain containing adaptor protein B up 1.44 233587_s_at SIPA1L2 signal‐induced proliferation‐associated 1 like 2 down 1.43 210567_s_at SKP2 S‐phase kinase‐associated protein 2 (p45) down 1.43 219159_s_at SLAMF7 SLAM family member 7 down 1.99 222838_at SLAMF7 SLAM family member 7 down 1.99 234306_s_at SLAMF7 SLAM family member 7 down 1.91 219874_at SLC12A8 solute carrier family 12 (potassium/chloride transporters), member 8 down 1.40 205856_at SLC14A1 solute carrier family 14 (urea transporter), member 1 (Kidd blood group) up 1.67 238029_s_at SLC16A14 solute carrier family 16, member 14 (monocarboxylic acid transporter 14) down 2.01 202856_s_at SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) down 1.45 209610_s_at SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), memberdown 1.71 209611_s_at SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), memberdown 1.48 212810_s_at SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), memberdown 1.59 212811_x_at SLC1A4 solute carrier family 1 (glutamate/neutral amino acid transporter), memberdown 1.69 222705_s_at SLC25A15 solute carrier family 25 (mitochondrial carrier; ornithine transporter) membdown 1.41 230624_at SLC25A27 solute carrier family 25, member 27 up 1.79 1552774_a_at SLC25A27 solute carrier family 25, member 27 up 1.42 1554161_at SLC25A27 solute carrier family 25, member 27 up 1.40 205768_s_at SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 down 1.95 205769_at SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 down 1.99 235050_at SLC2A12 solute carrier family 2 (facilitated glucose transporter), member 12 down 1.36 240799_at SLC35F4 solute carrier family 35, member F4 up 1.38 230448_at SLC38A10 solute carrier family 38, member 10 down 1.61 214830_at SLC38A6 solute carrier family 38, member 6 up 1.39 228486_at SLC44A1 solute carrier family 44, member 1 down 1.53 232263_at SLC6A15 solute carrier family 6 (neutral amino acid transporter), member 15 down 1.36 219911_s_at SLCO4A1 solute carrier organic anion transporter family, member 4A1 down 1.52 222071_s_at SLCO4C1 solute carrier organic anion transporter family, member 4C1 down 1.36 226743_at SLFN11 schlafen family member 11 down 1.55 218788_s_at SMYD3 SET and MYND domain containing 3 up 1.36 213139_at SNAI2 snail homolog 2 (Drosophila) up 1.72 218032_at SNN stannin up 1.38 228869_at SNX20 sorting nexin 20 down 1.49 225728_at SORBS2 sorbin and SH3 domain containing 2 down 1.84 202935_s_at SOX9 SRY (sex determining region Y)‐box 9 up 1.87 202936_s_at SOX9 SRY (sex determining region Y)‐box 9 up 1.64 207777_s_at SP140 SP140 nuclear body protein down 1.44 234995_at SPICE1 spindle and centriole associated protein 1 down 1.40 210715_s_at SPINT2 serine peptidase inhibitor, Kunitz type, 2 down 1.50 204011_at SPRY2 sprouty homolog 2 (Drosophila) down 1.38 213562_s_at SQLE squalene epoxidase down 1.36 213577_at SQLE squalene epoxidase down 1.36 201471_s_at SQSTM1 sequestosome 1 up 1.62 213112_s_at SQSTM1 sequestosome 1 up 1.64 244804_at SQSTM1 sequestosome 1 up 1.47 225252_at SRXN1 sulfiredoxin 1 up 1.40 217790_s_at SSR3 signal sequence receptor, gamma (translocon‐associated protein gamma) down 1.44 210942_s_at ST3GAL6 ST3 beta‐galactoside alpha‐2,3‐sialyltransferase 6 down 1.38 213355_at ST3GAL6 ST3 beta‐galactoside alpha‐2,3‐sialyltransferase 6 down 1.58 201998_at ST6GAL1 ST6 beta‐galactosamide alpha‐2,6‐sialyltranferase 1 down 1.40 214971_s_at ST6GAL1 ST6 beta‐galactosamide alpha‐2,6‐sialyltranferase 1 down 1.42 228821_at ST6GAL2 ST6 beta‐galactosamide alpha‐2,6‐sialyltranferase 2 down 2.53 1555123_at ST6GAL2 ST6 beta‐galactosamide alpha‐2,6‐sialyltranferase 2 down 1.63 226390_at STARD4 StAR‐related lipid transfer (START) domain containing 4 down 1.38 217503_at STK17B serine/threonine kinase 17b down 1.45 203767_s_at STS steroid sulfatase (microsomal), isozyme S down 1.51 224724_at SULF2 sulfatase 2 down 1.46 233555_s_at SULF2 sulfatase 2 down 1.47 206546_at SYCP2 synaptonemal complex protein 2 up 1.82 201463_s_at TALDO1 transaldolase 1 up 1.58 227611_at TARSL2 threonyl‐tRNA synthetase‐like 2 down 1.42 213912_at TBC1D30 TBC1 domain family, member 30 down 1.50 213913_s_at TBC1D30 TBC1 domain family, member 30 down 1.42 227279_at TCEAL3 transcription elongation factor A (SII)‐like 3 down 1.77 228837_at TCF4 transcription factor 4 up 1.43 205943_at TDO2 tryptophan 2,3‐dioxygenase up 2.89 232692_at TDRD6 tudor domain containing 6 up 1.52 228906_at TET1 tet oncogene 1 down 1.58 221035_s_at TEX14 testis expressed 14 down 1.81 226157_at TFDP2 transcription factor Dp‐2 (E2F dimerization partner 2) up 1.50 237346_at TGDS TDP‐glucose 4,6‐dehydratase down 1.39 205015_s_at TGFA transforming growth factor, alpha down 1.43 205016_at TGFA transforming growth factor, alpha down 2.24 1566901_at TGIF1 TGFB‐induced factor homeobox 1 up 1.38 203167_at TIMP2 TIMP metallopeptidase inhibitor 2 down 1.37 1552360_a_at TIRAP toll‐interleukin 1 receptor (TIR) domain containing adaptor protein up 1.36 202011_at TJP1 tight junction protein 1 (zona occludens 1) down 1.65 214168_s_at TJP1 tight junction protein 1 (zona occludens 1) down 1.41 212769_at TLE3 transducin‐like enhancer of split 3 (E(sp1) homolog, Drosophila) down 1.37 220532_s_at TMEM176B transmembrane protein 176B down 1.40 230467_at TMEM52 transmembrane protein 52 down 1.38 241364_at TMEM57 transmembrane protein 57 up 1.52 207638_at TMPRSS15 transmembrane protease, serine 15 down 1.49 226322_at TMTC1 transmembrane and tetratricopeptide repeat containing 1 up 1.58 226931_at TMTC1 transmembrane and tetratricopeptide repeat containing 1 up 1.63 1552822_at TMX3 thioredoxin‐related transmembrane protein 3 down 1.38 210260_s_at TNFAIP8 tumor necrosis factor, alpha‐induced protein 8 down 1.40 203671_at TPMT thiopurine S‐methyltransferase up 1.48 217147_s_at TRAT1 T cell receptor associated transmembrane adaptor 1 down 1.94 210705_s_at TRIM5 tripartite motif‐containing 5 up 1.65 210055_at TSHR thyroid stimulating hormone receptor down 1.39 215442_s_at TSHR thyroid stimulating hormone receptor down 1.40 215443_at TSHR thyroid stimulating hormone receptor down 1.37 217979_at TSPAN13 tetraspanin 13 down 1.64 227307_at TSPAN18 tetraspanin 18 up 2.12 225775_at TSPAN33 tetraspanin 33 down 1.39 213122_at TSPYL5 TSPY‐like 5 down 1.41 229170_s_at TTC18 tetratricopeptide repeat domain 18 up 1.43 210652_s_at TTC39A tetratricopeptide repeat domain 39A up 1.51 228724_at TTLL7 tubulin tyrosine ligase‐like family, member 7 up 1.40 235561_at TXNL1 thioredoxin‐like 1 up 1.83 214755_at UAP1L1 UDP‐N‐acteylglucosamine pyrophosphorylase 1‐like 1 down 1.43 1555834_at UCHL1 Ubiquitin carboxyl‐terminal esterase L1 (ubiquitin thiolesterase) up 1.37 235749_at UGGT2 UDP‐glucose glycoprotein glucosyltransferase 2 down 1.36 219740_at VASH2 vasohibin 2 up 2.27 235343_at VASH2 vasohibin 2 up 2.80 218807_at VAV3 vav 3 guanine nucleotide exchange factor down 1.44 205506_at VIL1 villin 1 down 2.12 228912_at VIL1 villin 1 down 1.54 209822_s_at VLDLR very low density lipoprotein receptor down 1.43 220917_s_at WDR19 WD repeat domain 19 up 1.40 231251_at WIPF2 WAS/WASL interacting protein family, member 2 down 1.41 229849_at WIPF3 WAS/WASL interacting protein family, member 3 up 1.57 203827_at WIPI1 WD repeat domain, phosphoinositide interacting 1 down 1.59 213836_s_at WIPI1 WD repeat domain, phosphoinositide interacting 1 down 1.55 221958_s_at WLS wntless homolog (Drosophila) down 1.52 228950_s_at WLS wntless homolog (Drosophila) down 1.50 228617_at XAF1 XIAP associated factor 1 down 1.52 213725_x_at XYLT1 xylosyltransferase I down 2.24 232574_at XYLT1 xylosyltransferase I down 1.37 227020_at YPEL2 yippee‐like 2 (Drosophila) down 1.44 224503_s_at ZCCHC2 zinc finger, CCHC domain containing 2 up 1.37 228637_at ZDHHC1 zinc finger, DHHC‐type containing 1 up 1.39 203603_s_at ZEB2 zinc finger E‐box binding homeobox 2 up 1.37 235366_at ZNF10 zinc finger protein 10 up 1.39 243312_at ZNF107 Zinc finger protein 107 up 1.38 206683_at ZNF165 zinc finger protein 165 down 1.70 206175_x_at ZNF222 zinc finger protein 222 up 1.43 1558888_x_at ZNF321 zinc finger protein 321 up 1.36 244007_at ZNF462 zinc finger protein 462 up 1.40 1552794_a_at ZNF547 zinc finger protein 547 up 1.40 243790_at ZNF585A zinc finger protein 585A up 1.37 207781_s_at ZNF711 zinc finger protein 711 down 1.49 228988_at ZNF711 zinc finger protein 711 down 1.54 229732_at ZNF823 zinc finger protein 823 up 1.39 244640_at ZNF850 zinc finger protein 850 up 1.51 230421_at ZNF879 zinc finger protein 879 up 1.41 200808_s_at ZYX zyxin up 1.38 215059_at up 1.37 215386_at up 1.48 220467_at down 1.37 222111_at down 1.41 226348_at down 1.39 226560_at down 1.46 227591_at up 1.42 227755_at down 1.42 228390_at down 1.53 228643_at down 1.37 229072_at down 1.70 229298_at down 1.39 229423_at up 1.46 230319_at up 1.42 230499_at up 1.46 230795_at down 1.51 230913_at up 1.48 231040_at up 1.39 231644_at down 1.43 233401_at up 1.50 234562_x_at up 1.40 235251_at up 1.47 235456_at down 1.49 235738_at down 1.36 235875_at down 1.80 236198_at up 1.67 236451_at down 2.33 236513_at down 1.42 236520_at up 1.46 236598_at down 1.52 238091_at down 1.52 238668_at up 1.40 238735_at down 1.49 238946_at down 1.46 238953_at up 1.53 239784_at up 1.43 240121_x_at up 1.41 240574_at down 1.49 241356_at up 1.37 241394_at up 1.48 242384_at down 1.45 242723_at down 1.42 242798_at down 1.41 243134_at down 1.41 243154_at down 1.85 243366_s_at down 1.36 243489_at up 1.40 243543_at down 1.42 243810_at down 1.48 244139_s_at down 1.40 244700_at down 1.44 1556111_s_at down 1.37 1556261_a_at up 1.50 1557139_at up 1.43 1557149_at up 1.54 1557383_a_at down 1.41 1558401_at down 1.50 1558710_at down 1.56 1558795_at down 1.58 1558937_s_at down 1.39 1559007_s_at up 1.37 1560738_at down 1.42 1562529_s_at down 1.50 1564424_at down 1.46 Supplementary Table S1. Differentially expressed genes in KMS‐34/Cfz versus KMS‐34
Probe Set ID Symbol Name Change FC > 1.5 210852_s_at AASS aminoadipate‐semialdehyde synthase up 1.82 209993_at ABCB1 ATP‐binding cassette, sub‐family B (MDR/TAP), member 1 up 3.99 209994_s_at ABCB1 /// ABCBATP‐binding cassette, sub‐family B (MDR/TAP), member 1 /// ATP‐binding cup 3.25 207623_at ABCF2 ATP‐binding cassette, sub‐family F (GCN20), member 2 down 1.71 210006_at ABHD14A abhydrolase domain containing 14A down 1.53 226893_at ABL2 v‐abl Abelson murine leukemia viral oncogene homolog 2 down 1.50 228132_at ABLIM2 actin binding LIM protein family, member 2 up 1.72 236514_at ACOT8 acyl‐CoA thioesterase 8 up 1.90 228603_at ACTR3 ARP3 actin‐related protein 3 homolog (yeast) up 1.69 223874_at ACTR3C ARP3 actin‐related protein 3 homolog C (yeast) up 1.69 203935_at ACVR1 activin A receptor, type I up 1.55 213808_at ADAM23 ADAM metallopeptidase domain 23 up 1.64 201752_s_at ADD3 adducin 3 (gamma) up 1.54 201753_s_at ADD3 adducin 3 (gamma) up 1.55 205882_x_at ADD3 adducin 3 (gamma) up 1.51 217729_s_at AES amino‐terminal enhancer of split down 1.58 223779_at AFAP1‐AS AFAP1 antisense RNA (non‐protein coding) up 2.05 231299_at AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 up 1.71 239026_x_at AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 up 1.55 232395_x_at AGBL3 ATP/GTP binding protein‐like 3 up 1.86 226665_at AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) up 1.54 215789_s_at AJAP1 adherens junctions associated protein 1 down 1.64 204348_s_at AK4 adenylate kinase 4 down 1.72 225342_at AK4 adenylate kinase 4 down 1.87 227530_at AKAP12 A kinase (PRKA) anchor protein 12 up 1.54 223143_s_at AKIRIN2 akirin 2 up 1.66 223144_s_at AKIRIN2 akirin 2 up 1.61 223145_s_at AKIRIN2 akirin 2 up 1.51 202022_at ALDOC aldolase C, fructose‐bisphosphate down 1.53 242900_at ALG10B asparagine‐linked glycosylation 10, alpha‐1,2‐glucosyltransferase homolog Bup 1.55 204174_at ALOX5AP arachidonate 5‐lipoxygenase‐activating protein up 2.31 229596_at AMDHD1 amidohydrolase domain containing 1 down 1.59 206385_s_at ANK3 ankyrin 3, node of Ranvier (ankyrin G) up 1.93 1559640_at ANKFN1 Ankyrin‐repeat and fibronectin type III domain containing 1 up 1.61 226663_at ANKRD10 ankyrin repeat domain 10 up 1.55 204671_s_at ANKRD6 ankyrin repeat domain 6 up 1.83 206112_at ANKRD7 ankyrin repeat domain 7 up 1.81 201012_at ANXA1 annexin A1 up 1.66 201301_s_at ANXA4 annexin A4 up 1.96 201302_at ANXA4 annexin A4 up 1.82 1557236_at APOL6 apolipoprotein L, 6 up 1.64 225166_at ARHGAP18 Rho GTPase activating protein 18 up 1.72 225173_at ARHGAP18 Rho GTPase activating protein 18 up 1.56 233849_s_at ARHGAP5 Rho GTPase activating protein 5 up 1.54 201335_s_at ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 up 1.74 227197_at ARHGEF26 Rho guanine nucleotide exchange factor (GEF) 26 up 1.94 58780_s_at ARHGEF40 Rho guanine nucleotide exchange factor (GEF) 40 up 2.10 213138_at ARID5A AT rich interactive domain 5A (MRF1‐like) up 1.67 220658_s_at ARNTL2 aryl hydrocarbon receptor nuclear translocator‐like 2 up 2.41 224204_x_at ARNTL2 aryl hydrocarbon receptor nuclear translocator‐like 2 up 1.70 206414_s_at ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 up 2.03 232838_at ASXL3 additional sex combs like 3 (Drosophila) up 1.94 233536_at ASXL3 additional sex combs like 3 (Drosophila) up 2.38 201242_s_at ATP1B1 ATPase, Na+/K+ transporting, beta 1 polypeptide up 1.87 201243_s_at ATP1B1 ATPase, Na+/K+ transporting, beta 1 polypeptide up 1.70 217867_x_at BACE2 beta‐site APP‐cleaving enzyme 2 down 1.65 222446_s_at BACE2 beta‐site APP‐cleaving enzyme 2 down 1.72 221234_s_at BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 up 1.70 227173_s_at BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 up 1.59 236796_at BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 up 1.74 219667_s_at BANK1 B‐cell scaffold protein with ankyrin repeats 1 down 2.49 222915_s_at BANK1 B‐cell scaffold protein with ankyrin repeats 1 down 1.87 1558662_s_at BANK1 B‐cell scaffold protein with ankyrin repeats 1 down 1.82 203080_s_at BAZ2B bromodomain adjacent to zinc finger domain, 2B up 1.56 223227_at BBS2 Bardet‐Biedl syndrome 2 up 1.55 214452_at BCAT1 branched chain amino‐acid transaminase 1, cytosolic up 2.44 225285_at BCAT1 branched chain amino‐acid transaminase 1, cytosolic up 3.13 226517_at BCAT1 branched chain amino‐acid transaminase 1, cytosolic up 4.41 227896_at BCCIP BRCA2 and CDKN1A interacting protein down 1.54 203685_at BCL2 B‐cell CLL/lymphoma 2 up 1.65 211715_s_at BDH1 3‐hydroxybutyrate dehydrogenase, type 1 down 1.82 206956_at BGLAP /// PMF1bone gamma‐carboxyglutamate (gla) protein /// polyamine‐modulated fact down 1.63 228636_at BHLHE22 basic helix‐loop‐helix family, member e22 up 1.57 223185_s_at BHLHE41 basic helix‐loop‐helix family, member e41 down 1.50 1554020_at BICD1 bicaudal D homolog 1 (Drosophila) up 1.54 219546_at BMP2K BMP2 inducible kinase up 1.57 59644_at BMP2K BMP2 inducible kinase up 1.55 243829_at BRAF v‐raf murine sarcoma viral oncogene homolog B1 up 1.51 202946_s_at BTBD3 BTB (POZ) domain containing 3 up 2.40 214117_s_at BTD biotinidase down 1.59 228434_at BTNL9 butyrophilin‐like 9 down 1.54 205839_s_at BZRAP1 benzodiazapine receptor (peripheral) associated protein 1 up 2.48 220560_at C11orf21 chromosome 11 open reading frame 21 up 1.50 236646_at C12orf59 chromosome 12 open reading frame 59 down 2.43 209574_s_at C18orf1 chromosome 18 open reading frame 1 up 1.53 230033_at C19orf51 chromosome 19 open reading frame 51 down 2.98 230256_at C1orf104 Chromosome 1 open reading frame 104 down 1.52 219010_at C1orf106 chromosome 1 open reading frame 106 down 10.85 1558508_a_at C1orf53 chromosome 1 open reading frame 53 down 1.59 225401_at C1orf85 chromosome 1 open reading frame 85 down 1.83 1558693_s_at C1orf85 chromosome 1 open reading frame 85 down 1.53 212067_s_at C1R complement component 1, r subcomponent down 1.51 219463_at C20orf103 chromosome 20 open reading frame 103 down 1.74 224690_at C20orf108 chromosome 20 open reading frame 108 up 1.56 225224_at C20orf112 chromosome 20 open reading frame 112 up 1.60 233829_at C20orf118 chromosome 20 open reading frame 118 up 1.55 223157_at C4orf14 chromosome 4 open reading frame 14 down 1.54 219450_at C4orf19 chromosome 4 open reading frame 19 up 1.93 235350_at C4orf19 chromosome 4 open reading frame 19 up 1.75 219747_at C4orf31 chromosome 4 open reading frame 31 down 1.63 220770_s_at C5orf54 chromosome 5 open reading frame 54 up 1.61 207963_at C6orf54 chromosome 6 open reading frame 54 up 1.52 237592_at C6orf94 chromosome 6 open reading frame 94 down 1.80 229146_at C7orf31 chromosome 7 open reading frame 31 up 1.58 220032_at C7orf58 chromosome 7 open reading frame 58 up 2.17 228728_at C7orf58 chromosome 7 open reading frame 58 up 2.06 209726_at CA11 carbonic anhydrase XI down 1.83 220234_at CA8 carbonic anhydrase VIII up 1.59 206331_at CALCRL calcitonin receptor‐like up 1.77 210815_s_at CALCRL calcitonin receptor‐like up 2.07 212765_at CAMSAP1L1 calmodulin regulated spectrin‐associated protein 1‐like 1 down 1.79 217196_s_at CAMSAP1L1 calmodulin regulated spectrin‐associated protein 1‐like 1 down 1.61 208683_at CAPN2 calpain 2, (m/II) large subunit down 6.64 1552703_s_at CARD16 /// CAScaspase recruitment domain family, member 16 /// caspase 1, apoptosis‐re up 1.78 206011_at CASP1 caspase 1, apoptosis‐related cysteine peptidase (interleukin 1, beta, conver up 1.58 209970_x_at CASP1 caspase 1, apoptosis‐related cysteine peptidase (interleukin 1, beta, conver up 1.58 211366_x_at CASP1 caspase 1, apoptosis‐related cysteine peptidase (interleukin 1, beta, conver up 1.66 211367_s_at CASP1 caspase 1, apoptosis‐related cysteine peptidase (interleukin 1, beta, conver up 1.72 211368_s_at CASP1 caspase 1, apoptosis‐related cysteine peptidase (interleukin 1, beta, conver up 1.79 203323_at CAV2 caveolin 2 down 1.51 209145_s_at CBFA2T2 core‐binding factor, runt domain, alpha subunit 2; translocated to, 2 up 1.58 238549_at CBFA2T2 core‐binding factor, runt domain, alpha subunit 2; translocated to, 2 up 1.69 209682_at CBLB Cas‐Br‐M (murine) ecotropic retroviral transforming sequence b up 1.53 205379_at CBR3 carbonyl reductase 3 up 1.54 230900_at CCDC110 coiled‐coil domain containing 110 down 1.55 1554216_at CCDC132 coiled‐coil domain containing 132 up 1.54 1554217_a_at CCDC132 coiled‐coil domain containing 132 up 1.58 226972_s_at CCDC136 coiled‐coil domain containing 136 up 1.84 236745_at CCDC78 coiled‐coil domain containing 78 up 1.60 216598_s_at CCL2 chemokine (C‐C motif) ligand 2 up 6.55 1405_i_at CCL5 chemokine (C‐C motif) ligand 5 up 1.58 208711_s_at CCND1 cyclin D1 down 2.75 208712_at CCND1 cyclin D1 down 6.15 222156_x_at CCPG1 cell cycle progression 1 up 1.58 206587_at CCT6B chaperonin containing TCP1, subunit 6B (zeta 2) up 1.53 201925_s_at CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood grdown 1.60 201926_s_at CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood grdown 1.57 1555950_a_at CD55 CD55 molecule, decay accelerating factor for complement (Cromer blood grdown 1.57 202910_s_at CD97 CD97 molecule (CD55 ligand) down 1.66 208022_s_at CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) up 2.18 221555_x_at CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) up 1.77 221556_at CDC14B CDC14 cell division cycle 14 homolog B (S. cerevisiae) up 4.17 204693_at CDC42EP1 CDC42 effector protein (Rho GTPase binding) 1 down 3.54 214721_x_at CDC42EP4 CDC42 effector protein (Rho GTPase binding) 4 down 1.50 218157_x_at CDC42SE1 CDC42 small effector 1 down 1.60 229120_s_at CDC42SE1 CDC42 small effector 1 down 1.62 204995_at CDK5R1 cyclin‐dependent kinase 5, regulatory subunit 1 (p35) up 1.51 203973_s_at CEBPD CCAAT/enhancer binding protein (C/EBP), delta down 1.50 218421_at CERK ceramide kinase down 1.51 203166_at CFDP1 craniofacial development protein 1 up 1.52 215388_s_at CFH /// CFHR1 complement factor H /// complement factor H‐related 1 up 1.69 207486_x_at CHN2 chimerin (chimaerin) 2 up 1.98 211419_s_at CHN2 chimerin (chimaerin) 2 up 2.74 213385_at CHN2 chimerin (chimaerin) 2 up 3.12 242488_at CHRM3 cholinergic receptor, muscarinic 3 down 1.92 1553705_a_at CHRM3 cholinergic receptor, muscarinic 3 down 1.51 1559633_a_at CHRM3 cholinergic receptor, muscarinic 3 down 2.35 239146_at CLDND1 claudin domain containing 1 down 1.60 233500_x_at CLEC2D C‐type lectin domain family 2, member D up 1.69 213317_at CLIC5 chloride intracellular channel 5 up 3.26 217628_at CLIC5 chloride intracellular channel 5 up 1.58 219944_at CLIP4 CAP‐GLY domain containing linker protein family, member 4 up 2.26 226425_at CLIP4 CAP‐GLY domain containing linker protein family, member 4 up 2.42 1554677_s_at CMTM4 CKLF‐like MARVEL transmembrane domain containing 4 up 1.53 201445_at CNN3 calponin 3, acidic up 1.65 227209_at CNTN1 Contactin 1 down 1.73 244632_at CNTN5 Contactin 5 up 1.60 213110_s_at COL4A5 collagen, type IV, alpha 5 down 1.82 205081_at CRIP1 cysteine‐rich protein 1 (intestinal) down 1.70 219049_at CSGALNACT1 chondroitin sulfate N‐acetylgalactosaminyltransferase 1 up 2.05 201218_at CTBP2 C‐terminal binding protein 2 down 1.98 210554_s_at CTBP2 C‐terminal binding protein 2 down 1.55 210835_s_at CTBP2 C‐terminal binding protein 2 down 1.53 225681_at CTHRC1 collagen triple helix repeat containing 1 up 2.03 213274_s_at CTSB cathepsin B up 1.52 202295_s_at CTSH cathepsin H down 1.76 202902_s_at CTSS cathepsin S down 1.52 218097_s_at CUEDC2 CUE domain containing 2 down 1.59 205898_at CX3CR1 chemokine (C‐X3‐C motif) receptor 1 up 2.35 209687_at CXCL12 chemokine (C‐X‐C motif) ligand 12 up 1.60 209201_x_at CXCR4 chemokine (C‐X‐C motif) receptor 4 up 1.52 211919_s_at CXCR4 chemokine (C‐X‐C motif) receptor 4 up 1.51 217028_at CXCR4 chemokine (C‐X‐C motif) receptor 4 up 1.58 232087_at CXorf23 chromosome X open reading frame 23 up 1.50 227382_at CYB5B cytochrome b5 type B (outer mitochondrial membrane) up 1.76 238554_at CYB5B cytochrome b5 type B (outer mitochondrial membrane) up 1.72 226833_at CYB5D1 cytochrome b5 domain containing 1 down 1.50 206424_at CYP26A1 cytochrome P450, family 26, subfamily A, polypeptide 1 down 2.16 231747_at CYSLTR1 cysteinyl leukotriene receptor 1 down 1.90 216060_s_at DAAM1 dishevelled associated activator of morphogenesis 1 up 1.54 205337_at DCT dopachrome tautomerase (dopachrome delta‐isomerase, tyrosine‐related pup 2.02 205338_s_at DCT dopachrome tautomerase (dopachrome delta‐isomerase, tyrosine‐related pup 1.58 209094_at DDAH1 dimethylarginine dimethylaminohydrolase 1 up 1.93 220004_at DDX43 DEAD (Asp‐Glu‐Ala‐Asp) box polypeptide 43 up 2.05 1568815_a_at DDX50 DEAD (Asp‐Glu‐Ala‐Asp) box polypeptide 50 down 1.50 219696_at DENND1B DENN/MADD domain containing 1B down 1.55 228032_s_at DENND1B DENN/MADD domain containing 1B down 1.67 238787_at DENND1B DENN/MADD domain containing 1B down 1.54 47553_at DFNB31 deafness, autosomal recessive 31 up 1.52 226064_s_at DGAT2 diacylglycerol O‐acyltransferase 2 down 1.81 229579_s_at DISP2 dispatched homolog 2 (Drosophila) up 1.62 230426_at DLD dihydrolipoamide dehydrogenase up 1.57 226994_at DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 up 1.50 215116_s_at DNM1 dynamin 1 up 1.71 220668_s_at DNMT3B DNA (cytosine‐5‐)‐methyltransferase 3 beta up 1.51 205003_at DOCK4 dedicator of cytokinesis 4 up 1.70 236442_at DPF3 D4, zinc and double PHD fingers, family 3 down 2.04 238532_at DPF3 D4, zinc and double PHD fingers, family 3 down 1.82 215143_at DPY19L2P2 dpy‐19‐like 2 pseudogene 2 (C. elegans) up 1.51 1554534_at DPYD dihydropyrimidine dehydrogenase up 2.09 1554536_at DPYD dihydropyrimidine dehydrogenase up 2.30 218627_at DRAM1 DNA‐damage regulated autophagy modulator 1 up 1.53 210091_s_at DTNA dystrobrevin, alpha up 1.51 225415_at DTX3L deltex 3‐like (Drosophila) up 2.11 208891_at DUSP6 dual specificity phosphatase 6 up 1.97 208892_s_at DUSP6 dual specificity phosphatase 6 up 1.87 208893_s_at DUSP6 dual specificity phosphatase 6 up 1.68 202971_s_at DYRK2 dual‐specificity tyrosine‐(Y)‐phosphorylation regulated kinase 2 up 1.50 219551_at EAF2 ELL associated factor 2 down 1.89 1568672_at EAF2 ELL associated factor 2 down 2.01 1568673_s_at EAF2 ELL associated factor 2 down 2.10 227103_s_at ECE2 endothelin converting enzyme 2 down 1.72 220342_x_at EDEM3 ER degradation enhancer, mannosidase alpha‐like 3 down 1.73 220926_s_at EDEM3 ER degradation enhancer, mannosidase alpha‐like 3 down 1.55 223243_s_at EDEM3 ER degradation enhancer, mannosidase alpha‐like 3 down 1.66 225885_at EEA1 early endosome antigen 1 up 1.59 201694_s_at EGR1 early growth response 1 up 1.63 227404_s_at EGR1 Early growth response 1 up 2.34 227930_at EIF2C4 Eukaryotic translation initiation factor 2C, 4 up 1.81 1554309_at EIF4G3 eukaryotic translation initiation factor 4 gamma, 3 up 1.63 31845_at ELF4 E74‐like factor 4 (ets domain transcription factor) up 2.10 225159_s_at ELK4 ELK4, ETS‐domain protein (SRF accessory protein 1) down 1.51 231930_at ELMOD1 ELMO/CED‐12 domain containing 1 down 1.50 213779_at EMID1 EMI domain containing 1 up 1.66 204975_at EMP2 epithelial membrane protein 2 down 1.75 225078_at EMP2 epithelial membrane protein 2 down 1.81 225079_at EMP2 epithelial membrane protein 2 down 2.21 1553672_at ENAH enabled homolog (Drosophila) down 1.59 212573_at ENDOD1 endonuclease domain containing 1 up 1.68 212336_at EPB41L1 erythrocyte membrane protein band 4.1‐like 1 up 1.54 202017_at EPHX1 epoxide hydrolase 1, microsomal (xenobiotic) down 1.75 227609_at EPSTI1 epithelial stromal interaction 1 (breast) up 2.00 235276_at EPSTI1 epithelial stromal interaction 1 (breast) up 2.03 230183_at EXT1 exostosin 1 up 1.62 228298_at FAM113B family with sequence similarity 113, member B up 1.73 212979_s_at FAM115A family with sequence similarity 115, member A up 1.57 212981_s_at FAM115A family with sequence similarity 115, member A up 1.59 229512_at FAM120C family with sequence similarity 120C up 1.73 217966_s_at FAM129A family with sequence similarity 129, member A up 2.23 217967_s_at FAM129A family with sequence similarity 129, member A up 2.53 203550_s_at FAM189B family with sequence similarity 189, member B down 1.57 229762_at FAM200A Family with sequence similarity 200, member A up 1.50 231146_at FAM24B family with sequence similarity 24, member B down 1.61 236316_at FAM3C family with sequence similarity 3, member C up 1.69 221766_s_at FAM46A family with sequence similarity 46, member A up 1.95 220306_at FAM46C family with sequence similarity 46, member C down 1.64 226811_at FAM46C family with sequence similarity 46, member C down 1.51 203986_at FAM47E /// STBfamily with sequence similarity 47, member E /// starch binding domain 1 down 1.53 208092_s_at FAM49A family with sequence similarity 49, member A up 1.69 219895_at FAM70A family with sequence similarity 70, member A up 2.90 1568609_s_at FAM91A2 /// FLfamily with sequence similarity 91, member A2 /// hypothetical FLJ39739 //up 1.60 228427_at FBXO16 F‐box protein 16 up 1.53 209209_s_at FERMT2 fermitin family member 2 up 1.65 227948_at FGD4 FYVE, RhoGEF and PH domain containing 4 up 1.64 219522_at FJX1 four jointed box 1 (Drosophila) down 1.83 1562904_s_at FLJ10661 family with sequence similarity 86, member A pseudogene up 1.71 235291_s_at FLJ32255 hypothetical LOC643977 up 1.68 235292_at FLJ32255 hypothetical LOC643977 up 1.82 227883_at FLJ36031 hypothetical protein FLJ36031 up 1.55 239657_x_at FOXO6 forkhead box O6 up 1.71 243278_at FOXP2 forkhead box P2 up 1.52 1555352_at FOXP2 forkhead box P2 up 1.57 1555516_at FOXP2 forkhead box P2 up 1.51 204072_s_at FRY furry homolog (Drosophila) down 1.79 238551_at FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) down 1.58 212486_s_at FYN FYN oncogene related to SRC, FGR, YES up 1.61 210220_at FZD2 frizzled homolog 2 (Drosophila) down 1.63 208868_s_at GABARAPL1 GABA(A) receptor‐associated protein like 1 down 1.56 208869_s_at GABARAPL1 GABA(A) receptor‐associated protein like 1 down 1.58 211458_s_at GABARAPL1 /// GABA(A) receptor‐associated protein like 1 /// GABA(A) receptors associatedown 1.63 203725_at GADD45A growth arrest and DNA‐damage‐inducible, alpha up 1.52 219271_at GALNT14 UDP‐N‐acetyl‐alpha‐D‐galactosamine:polypeptide N‐acetylgalactosaminyltr down 1.51 224741_x_at GAS5 growth arrest‐specific 5 (non‐protein coding) down 1.51 227517_s_at GAS5 growth arrest‐specific 5 (non‐protein coding) down 1.53 228238_at GAS5 growth arrest‐specific 5 (non‐protein coding) down 1.59 203178_at GATM glycine amidinotransferase (L‐arginine:glycine amidinotransferase) down 1.83 216733_s_at GATM glycine amidinotransferase (L‐arginine:glycine amidinotransferase) down 1.83 202269_x_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.58 202270_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.56 231577_s_at GBP1 guanylate binding protein 1, interferon‐inducible, 67kDa up 1.94 239761_at GCNT1 glucosaminyl (N‐acetyl) transferase 1, core 2 up 1.53 221279_at GDAP1 ganglioside‐induced differentiation‐associated protein 1 up 1.56 226269_at GDAP1 ganglioside‐induced differentiation‐associated protein 1 up 1.86 226271_at GDAP1 ganglioside‐induced differentiation‐associated protein 1 up 1.62 226136_at GLIPR1 GLI pathogenesis‐related 1 up 1.55 200648_s_at GLUL glutamate‐ammonia ligase up 1.61 215001_s_at GLUL glutamate‐ammonia ligase up 1.54 217202_s_at GLUL glutamate‐ammonia ligase up 1.55 204993_at GNAZ guanine nucleotide binding protein (G protein), alpha z polypeptide up 1.51 206896_s_at GNG7 guanine nucleotide binding protein (G protein), gamma 7 down 1.53 212959_s_at GNPTAB N‐acetylglucosamine‐1‐phosphate transferase, alpha and beta subunits up 1.66 219078_at GPATCH2 G patch domain containing 2 down 1.91 1556126_s_at GPATCH2 G patch domain containing 2 down 1.60 204983_s_at GPC4 glypican 4 down 1.82 204984_at GPC4 glypican 4 down 1.81 225447_at GPD2 glycerol‐3‐phosphate dehydrogenase 2 (mitochondrial) up 1.84 210473_s_at GPR125 G protein‐coupled receptor 125 down 1.52 232267_at GPR133 G protein‐coupled receptor 133 down 1.89 203817_at GUCY1B3 guanylate cyclase 1, soluble, beta 3 down 1.52 227471_at HACE1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 up 1.53 206834_at HBD hemoglobin, delta down 2.37 206106_at HDAC10 /// LOChistone deacetylase 10 /// mitogen‐activated protein kinase 12‐like /// mitoup 1.63 209524_at HDGFRP3 hepatoma‐derived growth factor, related protein 3 up 1.53 209526_s_at HDGFRP3 hepatoma‐derived growth factor, related protein 3 up 1.56 1552628_a_at HERPUD2 HERPUD family member 2 up 1.57 218839_at HEY1 hairy/enhancer‐of‐split related with YRPW motif 1 up 1.52 44783_s_at HEY1 hairy/enhancer‐of‐split related with YRPW motif 1 up 1.69 209960_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 2.58 209961_s_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 1.79 210755_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 2.00 210997_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 2.32 210998_s_at HGF hepatocyte growth factor (hepapoietin A; scatter factor) down 2.01 205425_at HIP1 huntingtin interacting protein 1 up 1.65 226364_at HIP1 huntingtin interacting protein 1 up 1.89 209398_at HIST1H1C histone cluster 1, H1c down 2.36 208546_x_at HIST1H2BH histone cluster 1, H2bh down 1.53 214290_s_at HIST2H2AA3 ///histone cluster 2, H2aa3 /// histone cluster 2, H2aa4 down 2.32 218280_x_at HIST2H2AA3 ///histone cluster 2, H2aa3 /// histone cluster 2, H2aa4 down 2.09 221582_at HIST3H2A histone cluster 3, H2a down 1.83 208894_at HLA‐DRA major histocompatibility complex, class II, DR alpha up 1.60 205822_s_at HMGCS1 3‐hydroxy‐3‐methylglutaryl‐CoA synthase 1 (soluble) down 1.57 207456_at HNF4G hepatocyte nuclear factor 4, gamma up 1.72 232271_at HNF4G hepatocyte nuclear factor 4, gamma up 2.53 232004_at HNRNPR heterogeneous nuclear ribonucleoprotein R up 1.57 222222_s_at HOMER3 homer homolog 3 (Drosophila) down 1.53 227361_at HS3ST3B1 heparan sulfate (glucosamine) 3‐O‐sulfotransferase 3B1 down 2.02 208937_s_at ID1 inhibitor of DNA binding 1, dominant negative helix‐loop‐helix protein up 1.66 210045_at IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial up 2.17 210046_s_at IDH2 isocitrate dehydrogenase 2 (NADP+), mitochondrial up 2.16 229450_at IFIT3 interferon‐induced protein with tetratricopeptide repeats 3 up 1.56 214022_s_at IFITM1 interferon induced transmembrane protein 1 (9‐27) up 1.59 201162_at IGFBP7 insulin‐like growth factor binding protein 7 down 1.87 201163_s_at IGFBP7 insulin‐like growth factor binding protein 7 down 2.44 215118_s_at IGHA1 Immunoglobulin heavy constant alpha 1 up 1.64 1558438_a_at IGHE immunoglobulin heavy constant epsilon up 1.64 228518_at IGHG1 /// IGHMimmunoglobulin heavy constant gamma 1 (G1m marker) /// immunoglobul up 1.97 212592_at IGJ immunoglobulin J polypeptide, linker protein for immunoglobulin alpha andup 1.64 223807_at IGSF1 immunoglobulin superfamily, member 1 down 1.85 228375_at IGSF11 immunoglobulin superfamily, member 11 down 1.84 207160_at IL12A interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocytedown 1.58 201887_at IL13RA1 interleukin 13 receptor, alpha 1 up 1.52 222062_at IL27RA interleukin 27 receptor, alpha up 1.76 205945_at IL6R interleukin 6 receptor down 3.29 217489_s_at IL6R interleukin 6 receptor down 2.46 226333_at IL6R interleukin 6 receptor down 2.55 1568695_s_at INTS6 integrator complex subunit 6 up 1.52 213785_at IPO9 importin 9 down 1.52 216986_s_at IRF4 interferon regulatory factor 4 down 1.50 215734_at IZUMO4 IZUMO family member 4 down 1.58 226267_at JDP2 Jun dimerization protein 2 up 1.58 213005_s_at KANK1 KN motif and ankyrin repeat domains 1 down 1.57 213478_at KAZ kazrin down 1.62 229144_at KAZ kazrin down 1.55 239835_at KBTBD8 kelch repeat and BTB (POZ) domain containing 8 down 1.72 210036_s_at KCNH2 potassium voltage‐gated channel, subfamily H (eag‐related), member 2 up 1.97 229850_at KDSR 3‐ketodihydrosphingosine reductase up 1.98 1558279_a_at KDSR 3‐ketodihydrosphingosine reductase up 1.56 214185_at KHDRBS1 KH domain containing, RNA binding, signal transduction associated 1 up 1.72 209781_s_at KHDRBS3 KH domain containing, RNA binding, signal transduction associated 3 up 1.93 213358_at KIAA0802 KIAA0802 up 1.55 231807_at KIAA1217 KIAA1217 up 1.53 212453_at KIAA1279 KIAA1279 down 1.95 222139_at KIAA1466 KIAA1466 gene up 1.62 228565_at KIAA1804 mixed lineage kinase 4 down 1.77 227435_at KIAA2018 KIAA2018 down 1.51 242517_at KISS1R KISS1 receptor up 1.76 219371_s_at KLF2 Kruppel‐like factor 2 (lung) down 1.88 229310_at KLHL29 kelch‐like 29 (Drosophila) down 1.62 227565_at KLHL5 kelch‐like 5 (Drosophila) down 1.59 232297_at KLHL5 kelch‐like 5 (Drosophila) down 1.51 220238_s_at KLHL7 kelch‐like 7 (Drosophila) up 1.54 231849_at KRT80 keratin 80 up 2.03 221581_s_at LAT2 linker for activation of T cells family, member 2 up 1.53 1569469_a_at LHX8 LIM homeobox 8 down 2.91 211336_x_at LILRB1 leukocyte immunoglobulin‐like receptor, subfamily B (with TM and ITIM do down 1.66 229937_x_at LILRB1 Leukocyte immunoglobulin‐like receptor, subfamily B (with TM and ITIM dodown 1.96 1554600_s_at LMNA lamin A/C down 1.57 227181_at LNP1 leukemia NUP98 fusion partner 1 down 1.63 229872_s_at LOC100132999 hypothetical LOC100132999 up 1.68 1556301_at LOC100287015 Hypothetical protein LOC100287015 up 1.50 235147_at LOC100288092 Hypothetical protein LOC100288092 up 2.04 230277_at LOC100289187 transmembrane protein 225‐like /// hypothetical protein LOC100506199 up 1.65 52940_at LOC100294402 single Ig IL‐1‐related receptor‐like /// single immunoglobulin and toll‐interledown 1.52 235171_at LOC100505501 hypothetical LOC100505501 down 1.61 231443_at LOC100505644 hypothetical LOC100505644 down 1.63 241262_at LOC100505728 hypothetical LOC100505728 down 2.19 238898_at LOC100505730 hypothetical LOC100505730 /// hypothetical LOC100509599 up 1.55 229815_at LOC100505894 hypothetical LOC100505894 down 1.76 230710_at LOC100506211 hypothetical LOC100506211 down 1.57 228493_at LOC100506992 hypothetical LOC100506992 up 1.53 230249_at LOC100507185 hypothetical LOC100507185 up 1.83 1558256_at LOC148189 hypothetical LOC148189 up 1.70 232645_at LOC153684 hypothetical LOC153684 up 1.62 214162_at LOC284244 hypothetical protein LOC284244 up 1.95 1557359_at LOC285758 hypothetical LOC285758 up 3.15 1560762_at LOC285972 hypothetical LOC285972 up 1.61 232298_at LOC401093 hypothetical LOC401093 down 1.79 235173_at LOC401093 hypothetical LOC401093 down 1.89 225028_at LOC550643 hypothetical LOC550643 down 1.60 242770_at LOC642236 Similar to FRG1 protein (FSHD region gene 1 protein) up 1.75 1561759_at LOC645513 Hypothetical LOC645513 down 1.53 1561760_s_at LOC645513 Hypothetical LOC645513 down 1.53 203488_at LPHN1 latrophilin 1 down 3.35 219145_at LPHN1 latrophilin 1 down 1.90 47560_at LPHN1 latrophilin 1 down 4.65 206953_s_at LPHN2 latrophilin 2 up 1.54 202459_s_at LPIN2 lipin 2 up 2.01 202460_s_at LPIN2 lipin 2 up 1.61 216250_s_at LPXN leupaxin down 1.84 204674_at LRMP lymphoid‐restricted membrane protein up 1.74 35974_at LRMP lymphoid‐restricted membrane protein up 1.94 225060_at LRP11 low density lipoprotein receptor‐related protein 11 up 2.80 233499_at LRRC7 leucine rich repeat containing 7 down 2.40 1552666_a_at LRRC7 leucine rich repeat containing 7 down 1.58 205036_at LSM6 LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) down 1.52 1557066_at LUC7L LUC7‐like (S. cerevisiae) up 1.55 206276_at LY6D lymphocyte antigen 6 complex, locus D down 1.56 206584_at LY96 lymphocyte antigen 96 up 1.95 235278_at MACROD2 MACRO domain containing 2 down 2.65 1563209_a_at MACROD2 MACRO domain containing 2 down 2.48 1552913_at MAGEB18 melanoma antigen family B, 18 up 1.78 232859_s_at MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 down 1.55 235457_at MAML2 mastermind‐like 2 (Drosophila) up 2.61 208786_s_at MAP1LC3B microtubule‐associated protein 1 light chain 3 beta up 1.55 210015_s_at MAP2 microtubule‐associated protein 2 up 1.62 203836_s_at MAP3K5 mitogen‐activated protein kinase kinase kinase 5 up 1.64 203837_at MAP3K5 mitogen‐activated protein kinase kinase kinase 5 up 1.69 202501_at MAPRE2 microtubule‐associated protein, RP/EB family, member 2 up 1.75 213489_at MAPRE2 microtubule‐associated protein, RP/EB family, member 2 up 1.67 201668_x_at MARCKS myristoylated alanine‐rich protein kinase C substrate up 2.13 201669_s_at MARCKS myristoylated alanine‐rich protein kinase C substrate up 2.15 201670_s_at MARCKS myristoylated alanine‐rich protein kinase C substrate up 2.46 213002_at MARCKS myristoylated alanine‐rich protein kinase C substrate up 1.79 225897_at MARCKS myristoylated alanine‐rich protein kinase C substrate up 2.57 200644_at MARCKSL1 MARCKS‐like 1 down 1.51 241813_at MBD1 methyl‐CpG binding domain protein 1 up 1.58 227839_at MBD5 methyl‐CpG binding domain protein 5 down 1.74 215663_at MBNL1 muscleblind‐like (Drosophila) down 2.47 206132_at MCC mutated in colorectal cancers down 1.71 226225_at MCC mutated in colorectal cancers down 1.70 220484_at MCOLN3 mucolipin 3 up 1.87 229797_at MCOLN3 mucolipin 3 up 2.04 242176_at MEF2A Myocyte enhancer factor 2A up 2.18 230011_at MEI1 meiosis inhibitor 1 down 1.71 1554208_at MEI1 meiosis inhibitor 1 down 1.60 201403_s_at MGST3 microsomal glutathione S‐transferase 3 down 1.72 212472_at MICAL2 microtubule associated monoxygenase, calponin and LIM domain containin up 1.98 212473_s_at MICAL2 microtubule associated monoxygenase, calponin and LIM domain containin up 2.83 243611_at MICALCL MICAL C‐terminal like up 1.84 224917_at MIR21 microRNA 21 up 1.66 207233_s_at MITF microphthalmia‐associated transcription factor up 1.64 226066_at MITF microphthalmia‐associated transcription factor up 2.22 239468_at MKX mohawk homeobox down 5.43 241902_at MKX mohawk homeobox down 4.91 211071_s_at MLLT11 myeloid/lymphoid or mixed‐lineage leukemia (trithorax homolog, Drosophi down 2.30 204917_s_at MLLT3 myeloid/lymphoid or mixed‐lineage leukemia (trithorax homolog, Drosophi down 1.59 236208_at MOCS2 molybdenum cofactor synthesis 2 up 1.52 218865_at MOSC1 MOCO sulphurase C‐terminal domain containing 1 down 1.67 235352_at MR1 major histocompatibility complex, class I‐related down 1.61 223154_at MRPL1 mitochondrial ribosomal protein L1 down 1.57 222997_s_at MRPS21 mitochondrial ribosomal protein S21 down 1.71 225782_at MSRB3 methionine sulfoxide reductase B3 down 2.14 225790_at MSRB3 methionine sulfoxide reductase B3 down 2.18 238583_at MSRB3 methionine sulfoxide reductase B3 down 2.01 1554127_s_at MSRB3 methionine sulfoxide reductase B3 down 2.37 205106_at MTCP1 /// MTCmature T‐cell proliferation 1 /// mature T‐cell proliferation 1 neighbor up 1.50 212248_at MTDH metadherin down 1.60 227277_at MTDH metadherin down 1.95 1559822_s_at MTDH metadherin down 1.72 212093_s_at MTUS1 microtubule associated tumor suppressor 1 up 1.57 212095_s_at MTUS1 microtubule associated tumor suppressor 1 up 1.70 218687_s_at MUC13 mucin 13, cell surface associated up 1.57 222712_s_at MUC13 mucin 13, cell surface associated up 1.64 209757_s_at MYCN v‐myc myelocytomatosis viral related oncogene, neuroblastoma derived (avup 1.77 201976_s_at MYO10 myosin X up 2.76 1554026_a_at MYO10 myosin X up 1.79 227761_at MYO5A myosin VA (heavy chain 12, myoxin) up 1.59 203215_s_at MYO6 myosin VI up 2.39 203216_s_at MYO6 myosin VI up 2.78 210480_s_at MYO6 myosin VI up 2.22 228523_at NANOS1 nanos homolog 1 (Drosophila) down 1.70 212843_at NCAM1 neural cell adhesion molecule 1 down 3.09 227394_at NCAM1 neural cell adhesion molecule 1 down 2.06 225786_at NCRNA00201 non‐protein coding RNA 201 down 1.61 209159_s_at NDRG4 NDRG family member 4 up 1.94 224984_at NFAT5 nuclear factor of activated T‐cells 5, tonicity‐responsive up 1.50 217963_s_at NGFRAP1 nerve growth factor receptor (TNFRSF16) associated protein 1 down 1.90 229491_at NHEDC2 Na+/H+ exchanger domain containing 2 down 1.58 1564746_at NHEDC2 Na+/H+ exchanger domain containing 2 down 1.52 225930_at NKIRAS1 NFKB inhibitor interacting Ras‐like 1 down 2.70 212739_s_at NME4 non‐metastatic cells 4, protein expressed in down 1.60 227556_at NME7 non‐metastatic cells 7, protein expressed in (nucleoside‐diphosphate kinaseup 1.58 203964_at NMI N‐myc (and STAT) interactor up 1.61 206023_at NMU neuromedin U down 2.52 244531_at NNT nicotinamide nucleotide transhydrogenase up 1.57 221348_at NPPC natriuretic peptide C down 1.58 225768_at NR1D2 nuclear receptor subfamily 1, group D, member 2 down 1.51 209505_at NR2F1 nuclear receptor subfamily 2, group F, member 1 up 3.47 209506_s_at NR2F1 nuclear receptor subfamily 2, group F, member 1 up 1.79 204105_s_at NRCAM neuronal cell adhesion molecule up 3.28 202599_s_at NRIP1 nuclear receptor interacting protein 1 up 1.55 202600_s_at NRIP1 nuclear receptor interacting protein 1 up 1.68 221796_at NTRK2 neurotrophic tyrosine kinase, receptor, type 2 down 1.70 203675_at NUCB2 nucleobindin 2 up 1.51 220183_s_at NUDT6 nudix (nucleoside diphosphate linked moiety X)‐type motif 6 down 1.54 230329_s_at NUDT6 nudix (nucleoside diphosphate linked moiety X)‐type motif 6 down 1.82 205552_s_at OAS1 2',5'‐oligoadenylate synthetase 1, 40/46kDa up 2.00 227492_at OCLN occludin down 1.86 213125_at OLFML2B olfactomedin‐like 2B up 1.58 213568_at OSR2 odd‐skipped related 2 (Drosophila) up 1.73 214615_at P2RY10 purinergic receptor P2Y, G‐protein coupled, 10 down 1.88 1553856_s_at P2RY10 purinergic receptor P2Y, G‐protein coupled, 10 down 2.41 202733_at P4HA2 prolyl 4‐hydroxylase, alpha polypeptide II down 1.60 221868_at PAIP2B poly(A) binding protein interacting protein 2B up 1.67 202336_s_at PAM peptidylglycine alpha‐amidating monooxygenase down 1.64 212958_x_at PAM peptidylglycine alpha‐amidating monooxygenase down 1.53 226649_at PANK1 pantothenate kinase 1 down 1.55 218543_s_at PARP12 poly (ADP‐ribose) polymerase family, member 12 up 1.72 224701_at PARP14 poly (ADP‐ribose) polymerase family, member 14 up 2.08 223220_s_at PARP9 poly (ADP‐ribose) polymerase family, member 9 up 2.20 227807_at PARP9 poly (ADP‐ribose) polymerase family, member 9 up 1.73 212148_at PBX1 pre‐B‐cell leukemia homeobox 1 down 2.31 212151_at PBX1 pre‐B‐cell leukemia homeobox 1 down 1.83 213263_s_at PCBP2 poly(rC) binding protein 2 up 1.73 213264_at PCBP2 poly(rC) binding protein 2 up 1.66 205689_at PCNXL2 pecanex‐like 2 (Drosophila) down 1.50 219295_s_at PCOLCE2 procollagen C‐endopeptidase enhancer 2 down 2.21 205559_s_at PCSK5 proprotein convertase subtilisin/kexin type 5 down 1.73 223358_s_at PDE7A phosphodiesterase 7A up 1.52 203857_s_at PDIA5 protein disulfide isomerase family A, member 5 down 1.50 208981_at PECAM1 platelet/endothelial cell adhesion molecule down 2.06 208982_at PECAM1 platelet/endothelial cell adhesion molecule down 2.32 208983_s_at PECAM1 platelet/endothelial cell adhesion molecule down 1.98 217744_s_at PERP PERP, TP53 apoptosis effector up 1.62 236009_at PERP PERP, TP53 apoptosis effector up 1.74 228499_at PFKFB4 6‐phosphofructo‐2‐kinase/fructose‐2,6‐biphosphatase 4 down 1.84 217996_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 up 1.63 217997_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 up 1.91 217999_s_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 up 1.68 225842_at PHLDA1 pleckstrin homology‐like domain, family A, member 1 up 1.84 212719_at PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 up 1.69 203335_at PHYH phytanoyl‐CoA 2‐hydroxylase up 1.54 205632_s_at PIP5K1B phosphatidylinositol‐4‐phosphate 5‐kinase, type I, beta down 1.72 214717_at PK155 hypothetical protein DKFZp434H1419 up 1.73 225380_at PKDCC protein kinase domain containing, cytoplasmic homolog (mouse) down 1.77 202732_at PKIG protein kinase (cAMP‐dependent, catalytic) inhibitor gamma up 2.45 224758_at PL‐5283 PL‐5283 protein up 1.50 204458_at PLA2G15 phospholipase A2, group XV up 1.76 219014_at PLAC8 placenta‐specific 8 up 4.24 207002_s_at PLAGL1 pleiomorphic adenoma gene‐like 1 up 1.57 204613_at PLCG2 phospholipase C, gamma 2 (phosphatidylinositol‐specific) up 1.65 205934_at PLCL1 phospholipase C‐like 1 up 2.17 1560556_a_at PLEKHA8 Pleckstrin homology domain containing, family A (phosphoinositide bindingup 1.55 218640_s_at PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) membup 1.81 222699_s_at PLEKHF2 pleckstrin homology domain containing, family F (with FYVE domain) membup 1.68 202446_s_at PLSCR1 phospholipid scramblase 1 up 1.54 206470_at PLXNC1 plexin C1 up 1.52 204285_s_at PMAIP1 phorbol‐12‐myristate‐13‐acetate‐induced protein 1 up 1.66 204286_s_at PMAIP1 phorbol‐12‐myristate‐13‐acetate‐induced protein 1 up 1.84 217875_s_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 2.52 222449_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 2.24 222450_at PMEPA1 prostate transmembrane protein, androgen induced 1 down 2.23 202337_at PMF1 polyamine‐modulated factor 1 down 1.65 218224_at PNMA1 paraneoplastic antigen MA1 up 2.06 242455_at POU3F2 POU class 3 homeobox 2 up 1.95 220741_s_at PPA2 pyrophosphatase (inorganic) 2 down 1.56 1556285_s_at PPA2 pyrophosphatase (inorganic) 2 down 1.52 209433_s_at PPAT phosphoribosyl pyrophosphate amidotransferase down 1.53 236302_at PPM1E protein phosphatase, Mg2+/Mn2+ dependent, 1E up 2.14 225066_at PPP2R2D protein phosphatase 2, regulatory subunit B, delta down 1.54 202741_at PRKACB protein kinase, cAMP‐dependent, catalytic, beta up 2.17 202742_s_at PRKACB protein kinase, cAMP‐dependent, catalytic, beta up 2.62 235780_at PRKACB protein kinase, cAMP‐dependent, catalytic, beta up 2.12 207957_s_at PRKCB protein kinase C, beta up 2.21 209685_s_at PRKCB protein kinase C, beta up 1.79 227817_at PRKCB protein kinase C, beta up 2.08 227824_at PRKCB protein kinase C, beta up 1.54 219168_s_at PRR5 proline rich 5 (renal) up 1.84 47069_at PRR5 proline rich 5 (renal) up 1.66 227126_at PTPRG protein tyrosine phosphatase, receptor type, G up 1.68 205336_at PVALB parvalbumin up 1.64 212636_at QKI quaking homolog, KH domain RNA binding (mouse) up 1.62 219681_s_at RAB11FIP1 RAB11 family interacting protein 1 (class I) up 1.96 219562_at RAB26 RAB26, member RAS oncogene family down 1.59 222846_at RAB8B RAB8B, member RAS oncogene family up 1.54 219125_s_at RAG1AP1 recombination activating gene 1 activating protein 1 down 1.61 209444_at RAP1GDS1 RAP1, GTP‐GDP dissociation stimulator 1 down 1.93 217457_s_at RAP1GDS1 RAP1, GTP‐GDP dissociation stimulator 1 down 1.78 229905_at RAP1GDS1 RAP1, GTP‐GDP dissociation stimulator 1 down 1.62 204070_at RARRES3 retinoic acid receptor responder (tazarotene induced) 3 up 1.76 208534_s_at RASA4 /// RASARAS p21 protein activator 4 /// RAS p21 protein activator 4 pseudogene up 1.50 205801_s_at RASGRP3 RAS guanyl releasing protein 3 (calcium and DAG‐regulated) up 1.83 220680_at RAVER2 ribonucleoprotein, PTB‐binding 2 up 1.74 225396_at RBBP4 retinoblastoma binding protein 4 up 1.56 207713_s_at RBCK1 RanBP‐type and C3HC4‐type zinc finger containing 1 up 1.56 218035_s_at RBM47 RNA binding motif protein 47 down 1.84 222496_s_at RBM47 RNA binding motif protein 47 down 1.52 203498_at RCAN2 regulator of calcineurin 2 up 1.95 226272_at RCAN3 RCAN family member 3 up 1.51 226021_at RDH10 retinol dehydrogenase 10 (all‐trans) down 1.65 1552378_s_at RDH10 retinol dehydrogenase 10 (all‐trans) down 1.54 228980_at RFFL ring finger and FYVE‐like domain containing 1 up 1.71 1552651_a_at RFFL ring finger and FYVE‐like domain containing 1 up 1.61 229431_at RFXAP regulatory factor X‐associated protein up 1.60 209324_s_at RGS16 regulator of G‐protein signaling 16 down 1.56 209325_s_at RGS16 regulator of G‐protein signaling 16 down 1.51 227633_at RHEB Ras homolog enriched in brain up 1.50 202975_s_at RHOBTB3 Rho‐related BTB domain containing 3 up 1.58 202976_s_at RHOBTB3 Rho‐related BTB domain containing 3 up 1.58 216048_s_at RHOBTB3 Rho‐related BTB domain containing 3 up 1.72 216049_at RHOBTB3 Rho‐related BTB domain containing 3 up 1.56 225202_at RHOBTB3 Rho‐related BTB domain containing 3 up 1.63 236293_at RHOH ras homolog gene family, member H down 1.57 241771_at RIMBP2 RIMS binding protein 2 down 1.54 212724_at RND3 Rho family GTPase 3 down 1.59 217865_at RNF130 ring finger protein 130 down 1.61 204040_at RNF144A ring finger protein 144A up 1.66 227726_at RNF166 ring finger protein 166 up 1.54 238026_at RPL35A ribosomal protein L35a down 1.79 228566_at RPRD1A Regulation of nuclear pre‐mRNA domain containing 1A up 1.51 218909_at RPS6KC1 ribosomal protein S6 kinase, 52kDa, polypeptide 1 down 1.60 221523_s_at RRAGD Ras‐related GTP binding D up 1.50 230093_at RSPH1 radial spoke head 1 homolog (Chlamydomonas) down 1.53 204198_s_at RUNX3 runt‐related transcription factor 3 down 1.50 214044_at RYR2 ryanodine receptor 2 (cardiac) down 1.52 200872_at S100A10 S100 calcium binding protein A10 down 1.53 229402_at SAMD13 sterile alpha motif domain containing 13 up 1.83 1559883_s_at SAMHD1 SAM domain and HD domain 1 up 1.51 211162_x_at SCD stearoyl‐CoA desaturase (delta‐9‐desaturase) down 1.58 211708_s_at SCD stearoyl‐CoA desaturase (delta‐9‐desaturase) down 1.57 226923_at SCFD2 sec1 family domain containing 2 down 1.55 236487_at SCLT1 sodium channel and clathrin linker 1 down 1.51 205464_at SCNN1B sodium channel, nonvoltage‐gated 1, beta up 2.00 202004_x_at SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 1down 2.52 210131_x_at SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 1down 2.77 215088_s_at SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 1down 2.50 216591_s_at SDHC succinate dehydrogenase complex, subunit C, integral membrane protein, 1down 3.38 228274_at SDSL serine dehydratase‐like up 1.64 209879_at SELPLG selectin P ligand down 1.61 206805_at SEMA3A sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (sup 1.83 201427_s_at SEPP1 selenoprotein P, plasma, 1 up 6.14 231669_at SEPP1 Selenoprotein P, plasma, 1 up 2.59 232183_at SERAC1 serine active site containing 1 up 1.60 223196_s_at SESN2 sestrin 2 up 1.56 235683_at SESN3 sestrin 3 up 1.81 205120_s_at SGCB sarcoglycan, beta (43kDa dystrophin‐associated glycoprotein) down 1.88 226112_at SGCB sarcoglycan, beta (43kDa dystrophin‐associated glycoprotein) down 1.54 228584_at SGCB sarcoglycan, beta (43kDa dystrophin‐associated glycoprotein) down 1.67 221268_s_at SGPP1 sphingosine‐1‐phosphate phosphatase 1 up 1.63 225354_s_at SH3BGRL2 SH3 domain binding glutamic acid‐rich protein like 2 up 1.66 201810_s_at SH3BP5 SH3‐domain binding protein 5 (BTK‐associated) up 1.62 201811_x_at SH3BP5 SH3‐domain binding protein 5 (BTK‐associated) up 2.22 225548_at SHROOM3 shroom family member 3 down 1.53 219159_s_at SLAMF7 SLAM family member 7 down 1.91 222838_at SLAMF7 SLAM family member 7 down 2.19 234306_s_at SLAMF7 SLAM family member 7 down 1.90 205316_at SLC15A2 solute carrier family 15 (H+/peptide transporter), member 2 down 2.10 205317_s_at SLC15A2 solute carrier family 15 (H+/peptide transporter), member 2 down 1.61 240159_at SLC15A2 solute carrier family 15 (H+/peptide transporter), member 2 down 1.69 227506_at SLC16A9 solute carrier family 16, member 9 (monocarboxylic acid transporter 9) down 2.76 220123_at SLC35F5 solute carrier family 35, member F5 up 1.67 225872_at SLC35F5 solute carrier family 35, member F5 up 1.52 226629_at SLC43A2 solute carrier family 43, member 2 up 1.62 228486_at SLC44A1 solute carrier family 44, member 1 down 1.72 219525_at SLC47A1 solute carrier family 47, member 1 up 1.74 204588_s_at SLC7A7 solute carrier family 7 (cationic amino acid transporter, y+ system), membe up 3.97 215043_s_at SMA4 /// SMA5glucuronidase, beta pseudogene /// glucuronidase, beta pseudogene down 1.52 212579_at SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1up 1.52 219695_at SMPD3 sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyup 2.10 218404_at SNX10 sorting nexin 10 up 1.58 212560_at SORL1 sortilin‐related receptor, L(DLR class) A repeats‐containing up 1.77 214791_at SP140L SP140 nuclear body protein‐like up 1.54 219888_at SPAG4 sperm associated antigen 4 up 1.70 212458_at SPRED2 sprouty‐related, EVH1 domain containing 2 up 1.51 219205_at SRR serine racemase up 1.52 222844_s_at SRR serine racemase up 1.78 230836_at ST8SIA4 ST8 alpha‐N‐acetyl‐neuraminide alpha‐2,8‐sialyltransferase 4 up 1.53 205542_at STEAP1 six transmembrane epithelial antigen of the prostate 1 up 2.09 222557_at STMN3 stathmin‐like 3 up 3.02 212353_at SULF1 sulfatase 1 down 1.54 212354_at SULF1 sulfatase 1 down 1.59 226850_at SUMF1 sulfatase modifying factor 1 down 1.67 243139_at SV2C synaptic vesicle glycoprotein 2C up 1.79 218692_at SYBU syntabulin (syntaxin‐interacting) down 1.65 202761_s_at SYNE2 spectrin repeat containing, nuclear envelope 2 up 1.71 210053_at TAF5 TAF5 RNA polymerase II, TATA box binding protein (TBP)‐associated factor, down 1.51 225308_s_at TANC1 tetratricopeptide repeat, ankyrin repeat and coiled‐coil containing 1 up 1.55 222116_s_at TBC1D16 TBC1 domain family, member 16 down 1.60 228488_at TBC1D16 TBC1 domain family, member 16 down 1.51 209152_s_at TCF3 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E down 1.58 212387_at TCF4 transcription factor 4 up 1.51 222146_s_at TCF4 transcription factor 4 up 1.58 228837_at TCF4 transcription factor 4 up 2.11 204043_at TCN2 transcobalamin II up 2.04 221035_s_at TEX14 testis expressed 14 down 1.55 241367_at TEX19 testis expressed 19 up 1.93 204731_at TGFBR3 transforming growth factor, beta receptor III up 1.72 203313_s_at TGIF1 TGFB‐induced factor homeobox 1 up 1.56 229253_at THEM4 thioesterase superfamily member 4 down 1.62 228619_x_at TIPRL TIP41, TOR signaling pathway regulator‐like (S. cerevisiae) down 1.61 204227_s_at TK2 thymidine kinase 2, mitochondrial up 1.69 204276_at TK2 thymidine kinase 2, mitochondrial up 1.73 204872_at TLE4 transducin‐like enhancer of split 4 (E(sp1) homolog, Drosophila) up 1.65 216997_x_at TLE4 transducin‐like enhancer of split 4 (E(sp1) homolog, Drosophila) up 1.80 233575_s_at TLE4 transducin‐like enhancer of split 4 (E(sp1) homolog, Drosophila) up 1.90 221060_s_at TLR4 toll‐like receptor 4 up 1.86 224341_x_at TLR4 toll‐like receptor 4 up 1.55 1552798_a_at TLR4 toll‐like receptor 4 up 1.68 219892_at TM6SF1 transmembrane 6 superfamily member 1 up 1.54 226478_at TM7SF3 transmembrane 7 superfamily member 3 up 1.58 1552302_at TMEM106A transmembrane protein 106A up 1.99 1552303_a_at TMEM106A transmembrane protein 106A up 1.66 227172_at TMEM116 transmembrane protein 116 up 1.59 243708_at TMEM132E transmembrane protein 132E up 1.51 218999_at TMEM140 transmembrane protein 140 up 2.05 227890_at TMEM198 transmembrane protein 198 up 1.62 222752_s_at TMEM206 transmembrane protein 206 down 1.70 222896_at TMEM38A transmembrane protein 38A down 2.45 219410_at TMEM45A transmembrane protein 45A down 1.53 209656_s_at TMEM47 transmembrane protein 47 up 1.58 226338_at TMEM55A transmembrane protein 55A up 1.52 203661_s_at TMOD1 tropomodulin 1 up 1.63 202644_s_at TNFAIP3 tumor necrosis factor, alpha‐induced protein 3 up 1.57 223851_s_at TNFRSF18 tumor necrosis factor receptor superfamily, member 18 up 1.91 224553_s_at TNFRSF18 tumor necrosis factor receptor superfamily, member 18 up 1.90 202687_s_at TNFSF10 tumor necrosis factor (ligand) superfamily, member 10 up 1.54 213201_s_at TNNT1 troponin T type 1 (skeletal, slow) down 1.61 204529_s_at TOX thymocyte selection‐associated high mobility group box down 1.64 213888_s_at TRAF3IP3 TRAF3 interacting protein 3 down 1.66 1554287_at TRIM4 tripartite motif‐containing 4 up 1.55 215047_at TRIM58 tripartite motif‐containing 58 down 1.63 214908_s_at TRRAP transformation/transcription domain‐associated protein up 1.73 215111_s_at TSC22D1 TSC22 domain family, member 1 up 1.86 219274_at TSPAN12 tetraspanin 12 up 1.52 230626_at TSPAN12 tetraspanin 12 up 1.69 212928_at TSPYL4 TSPY‐like 4 up 1.58 1569472_s_at TTC3 tetratricopeptide repeat domain 3 up 1.52 210652_s_at TTC39A tetratricopeptide repeat domain 39A up 1.68 226152_at TTC7B tetratricopeptide repeat domain 7B up 1.62 219882_at TTLL7 tubulin tyrosine ligase‐like family, member 7 down 1.95 228724_at TTLL7 tubulin tyrosine ligase‐like family, member 7 down 1.58 244839_at TTN titin up 1.84 223741_s_at TTYH2 tweety homolog 2 (Drosophila) down 1.62 204141_at TUBB2A tubulin, beta 2A up 1.55 209372_x_at TUBB2A /// TUBtubulin, beta 2A /// tubulin, beta 2B up 1.84 214023_x_at TUBB2B tubulin, beta 2B up 2.55 213943_at TWIST1 twist homolog 1 (Drosophila) up 1.68 235749_at UGGT2 UDP‐glucose glycoprotein glucosyltransferase 2 up 1.58 1555561_a_at UGGT2 UDP‐glucose glycoprotein glucosyltransferase 2 up 1.53 235003_at UHMK1 U2AF homology motif (UHM) kinase 1 down 1.57 1556095_at UNC13C unc‐13 homolog C (C. elegans) down 1.74 1556096_s_at UNC13C unc‐13 homolog C (C. elegans) down 2.45 1569969_a_at UNC13C unc‐13 homolog C (C. elegans) down 1.93 203031_s_at UROS uroporphyrinogen III synthase down 1.59 223167_s_at USP25 ubiquitin specific peptidase 25 up 1.55 213022_s_at UTRN utrophin up 2.40 225093_at UTRN utrophin up 2.62 228912_at VIL1 villin 1 up 1.67 209822_s_at VLDLR very low density lipoprotein receptor up 1.69 204165_at WASF1 WAS protein family, member 1 down 1.56 230152_at WDR52 WD repeat domain 52 down 1.53 1556429_a_at WDR67 WD repeat domain 67 up 1.70 228953_at WHAMM WAS protein homolog associated with actin, golgi membranes and microtubup 1.50 228949_at WLS wntless homolog (Drosophila) down 1.67 215150_at YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) down 1.91 227309_at YOD1 YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) down 8.67 219312_s_at ZBTB10 zinc finger and BTB domain containing 10 up 1.68 222863_at ZBTB10 zinc finger and BTB domain containing 10 up 1.77 228562_at ZBTB10 zinc finger and BTB domain containing 10 up 1.92 233899_x_at ZBTB10 zinc finger and BTB domain containing 10 up 1.99 236105_at ZBTB10 zinc finger and BTB domain containing 10 up 1.86 231899_at ZC3H12C zinc finger CCCH‐type containing 12C up 1.77 219062_s_at ZCCHC2 zinc finger, CCHC domain containing 2 up 1.74 222816_s_at ZCCHC2 zinc finger, CCHC domain containing 2 up 1.59 1552557_a_at ZDHHC15 zinc finger, DHHC‐type containing 15 up 1.91 226124_at ZFP90 zinc finger protein 90 homolog (mouse) up 1.76 235698_at ZFP90 zinc finger protein 90 homolog (mouse) up 1.89 219778_at ZFPM2 zinc finger protein, multitype 2 down 1.54 203651_at ZFYVE16 zinc finger, FYVE domain containing 16 up 1.53 218645_at ZNF277 zinc finger protein 277 up 1.53 1555193_a_at ZNF277 zinc finger protein 277 up 1.62 218401_s_at ZNF281 zinc finger protein 281 down 1.67 233082_at ZNF630 zinc finger protein 630 up 1.53 222624_s_at ZNF639 zinc finger protein 639 down 1.52 223302_s_at ZNF655 zinc finger protein 655 up 1.70 225945_at ZNF655 zinc finger protein 655 up 1.94 1554726_at ZNF655 zinc finger protein 655 up 1.89 1553247_a_at ZNF709 zinc finger protein 709 up 1.55 238149_at ZNF818P zinc finger protein 818, pseudogene up 1.60 1569241_a_at ZNF93 zinc finger protein 93 up 1.54 237335_at ZP1 zona pellucida glycoprotein 1 (sperm receptor) up 1.98 213448_at down 1.55 213657_s_at up 1.77 213658_at up 1.68 216247_at up 1.53 37590_g_at up 1.90 225123_at up 2.62 225567_at up 1.53 225722_at down 1.66 226756_at up 1.84 226993_at up 1.59 227290_at up 1.53 227368_at up 1.63 227531_at down 1.52 227547_at up 1.73 227682_at up 1.52 228297_at up 1.60 228478_at up 1.53 228812_at up 1.65 228987_at up 1.57 229202_at down 2.29 229575_at up 1.52 229580_at down 1.90 229620_at up 2.08 230319_at down 1.79 230416_at down 1.65 230655_at up 1.72 230778_at up 1.93 230795_at down 1.52 230917_at up 2.31 231644_at up 1.51 233016_at down 1.69 233401_at up 1.62 235008_at up 1.55 235242_at up 1.55 235286_at up 1.87 235785_at up 1.68 235947_at down 1.59 236198_at up 1.70 236277_at up 1.84 236280_at down 2.54 236307_at up 1.98 236310_at down 1.51 236330_at down 1.67 236660_at up 1.58 237035_at up 1.75 237203_at down 1.58 237563_s_at down 1.73 238191_at down 1.76 239253_at up 1.53 239264_at up 1.54 239423_at up 1.64 239729_at up 1.91 239767_at down 1.80 239945_at up 1.67 239999_at up 1.74 240064_at down 1.66 240118_at down 1.93 240143_at up 1.51 241416_at up 1.50 241845_at down 1.52 242358_at up 1.60 242494_at up 1.55 242598_at up 1.51 242801_at up 1.88 243049_at up 1.56 243465_at up 1.87 243489_at down 2.03 243543_at down 1.66 243718_at down 1.59 243918_at up 1.50 243931_at down 1.50 244290_at up 1.53 244414_at up 1.59 1556211_a_at up 1.54 1556602_at down 1.61 1556911_at up 2.14 1558237_x_at up 1.62 1558409_at up 1.61 1558410_s_at up 1.60 1558522_at up 1.50 1558801_at up 1.53 1561195_at up 1.53 1561511_at down 2.21 1566491_at up 2.10 1566698_at up 1.56 1568781_at down 1.51 1570561_at up 126.45 Supplementary Table S2. Top KLF4 profile neighbors across 304 MM patient samples in the Multiple Myeloma Research Consortium reference collection dataset (GEO accession number GSE26760) with the annotation term "autophagy".
Probe Set ID r ≥ 0.2 wrt 221841_s_at (KLF4) Symbol Gene ID 200620_at 0.27 TMEM59 9528 201848_s_at 0.21 BNIP3 664 201849_at 0.24 BNIP3 664 202877_s_at 0.30 CD93 22918 202878_s_at 0.26 CD93 22918 204006_s_at 0.30 FCGR3A///FCGR3B 2214///2215 204007_at 0.31 FCGR3B 2215 200645_at 0.24 GABARAP 11337 208868_s_at 0.25 GABARAPL1 23710 208869_s_at 0.29 GABARAPL1 23710 211458_s_at 0.30 GABARAPL1///GABARAPL3 23710///23766 208786_s_at 0.21 MAP1LC3B 81631 209733_at 0.22 MID2 11043 1559822_s_at 0.20 MTDH 92140 207075_at 0.22 NLRP3 114548 216015_s_at 0.24 NLRP3 114548 209018_s_at 0.27 PINK1 65018 209019_s_at 0.27 PINK1 65018 227892_at 0.24 PRKAA2 5563 242531_at 0.21 RRAGC 64121 202917_s_at 0.30 S100A8 6279 214370_at 0.27 S100A8 6279 203535_at 0.31 S100A9 6280 222258_s_at 0.23 SH3BP4 23677 1558331_at 0.25 SIRT2 22933 244804_at 0.21 SQSTM1 8878 241018_at 0.22 TMEM59 9528 212602_at 0.33 WDFY3 23001 212606_at 0.30 WDFY3 23001 238660_at 0.23 WDFY3 23001 218810_at 0.27 ZC3H12A 80149
Complete list @ http://amigo.geneontology.org/amigo/search/bioentity?q=*:*&fq=regulates _closure:%22GO:0006914%22&sfq=document_category:%22bioentity%22