UNIVERSITY OF CINCINNATI

______, 20 _____

I,______, hereby submit this as part of the requirements for the degree of:

______in: ______It is entitled: ______

Approved by: ______

THE BALANCED, RECIPROCAL TRANSLOCATION OF

CHROMOSOMAL SUBBANDS 12q15 AND 14q24

AND ALTERED GENE EXPRESSION IN UTERINE LEIOMYOMA

A dissertation submitted to the

Division of Research and Advanced Studies

of the University of Cincinnati

in partial fulfillment of the

requirements for the degree of

DOCTORATE OF PHILOSOPHY (Ph.D.)

in the Department of Molecular Genetics, Biochemistry and Microbiology

of the College of Medicine

2002

by

Susan E. Ingraham

B.S., University of Wisconsin, 1990

Committee Chair: Anil G. Menon

Abstract

A balanced, reciprocal translocation between chromosomes 12 and 14 is frequently observed in uterine leiomyoma (UL), a common benign smooth muscle tumor. Cytogenetic evidence suggests that t(12;14)(q15;q24) is an early event and therefore may represent one of the important steps in UL pathogenesis. The breakpoints of t(12;14)(q15;q24) have been localized to unusually large genomic regions (approximately 0.5 Mb) on each of the involved chromosomes.

In this study, we investigated the molecular events associated with this translocation, specifically the transcription of genes within the breakpoint regions on

14q24 and 12q15. t(12;14)(q15;q24) had previously been associated with activation of HMGA2 on chromosome 12, a gene implicated in promoting cell proliferation, particularly of lipoid tissues. We analyzed this gene and discovered several novel transcripts from 12q15 that are embedded within HMGA2. On chromosome 14, the breakpoint in one UL was found to lie within RAD51L1, a putative DNA repair and recombination gene. Subsequent analysis of two additional t(12;14) UL breakpoints refined the chromosome 14 breakpoint region to between 700 and 1200 kb.

The large size of the breakpoint regions and the mapping of breakpoints well outside both HMGA2 and RAD51L1 suggested that the translocation may alter the structure and long-range regulatory controls of genes including but perhaps not limited to HMGA2 and RAD51L1. To test this hypothesis, an expression map was developed which consisted of ESTs and genes within and flanking both breakpoint regions. Expression of these markers was tested in matched normal and t(12;14) UL

tissue samples to identify a domain of altered expression on chromosomes 12 and 14.

HMGA2 and the three novel ESTs embedded within HMGA2, A15, B6, and D12, were overexpressed six- to more than twenty-fold, while RAD51L1 and other ESTs on chromosome 14 were not consistently or significantly altered in UL. Positional cloning of the UL breakpoint region and mapping of the domain of altered expression in tumors sets the stage for understanding the molecular mechanism for the pathogenesis of UL.

Dedication

This dissertation is dedicated to several people who taught me by their example that life goes on in spite of everything. John Bosanec, Judy Ingraham, Roy Lynch, and Alissa

Winnard, this work is for you, for without your inspiration it might not have been accomplished at all.

Acknowledgements

I thank James Liu, Frank Dill, Sheila Blanck and Urvashi Surti for collecting the leiomyoma samples which were critical to this work; and Bruce Aronow, Kathy Saalfeld,

David Witte, Tim Hubbell, and Betty Davis for their technical expertise.

Judy Harmony, Les Myatt, Bob Colbert, and Terri Berning, administrators of the

Physician Scientist Training Program, deserve recognition of their tremendous efforts which have made the MD/PhD program at the University of Cincinnati one of the best and most student-focused in the country. My appreciation also to Sohaib Khan and Susan

Eder, administrators of NIH Training Grant T32 CA59268 which has supported me financially and intellectually for the past three years.

I thank those who have served on my thesis committee, Anil Menon, Joanna

Groden, Jim Stringer, Sue Heffelfinger, Bob Arceci, and Shelley Barton, for their insight and guidance; and my colleagues in the Menon lab (past and present), Vasily Ivanenkov,

Martha Jiang, Chuck Klanke, Carissa Krane, Roy Lynch, Shodimu Olufemi, Keya Sen,

Zheng Yuan Shan, Katie Smith, Teresa Smolarek, Yan Ru Su, Jennifer Towne, Jessica

Woo, Fan Yang, and Shiping Zhang for their friendship and support.

My deepest gratitude to Alissa and Phil Winnard and Katie and Doug Smith for seeing me through unexpected hardships and getting me back on my feet with extraordinary kindness and efficiency. And finally, I thank my family, Janet, Andy and

Benjamin Ingraham Dwyer and Sam and Judy Ingraham, for always having more faith than I did that what I was doing was important and valuable, even though they rarely understood any of it.

Table of Contents

List of Figures...... 5

List of Tables...... 8

List of Symbols and Abbreviations...... 9

Cytogenetic Notation...... 12

Genes and Their Products...... 12

Units of Measure...... 12

Chapter 1: Introduction ...... 13

EPIDEMIOLOGY AND PATHOLOGY OF LEIOMYOMA ...... 13

HORMONAL RESPONSIVENESS AND REGULATION OF UL ...... 14

ANIMAL MODELS OF UL...... 18

LEIOMYOMA CYTOGENETICS ...... 19

CHROMOSOMAL TRANSLOCATIONS IN HUMAN DISEASE...... 25

POSITIONAL CLONING OF THE UL TRANSLOCATION ...... 27

GENE REGULATION BY ACTION AT A DISTANCE ...... 29

CANDIDATE GENES ON CHROMOSOME 12: HMGA2 ...... 33

CANDIDATE GENES ON CHROMOSOME 14: RAD51L1...... 39

DNA REPAIR IN HUMAN DISEASE ...... 42

ANALYSIS OF GENE EXPRESSION IN T(12;14)(Q15;Q24) UTERINE LEIOMYOMATA ...... 43

Mapping of Chromosome 14 Breakpoints Relative to RAD51L1...... 43

Identification of EST Markers Significantly Altered in Expression by t(12;14)...... 44

- 1 - Initial Characterization of Novel 12q15 Transcripts A15, B6, and D12 in Normal Tissue and in UL

...... 45

STATEMENT OF PREMISE AND DEVELOPMENT OF HYPOTHESIS ...... 46

FORMAL STATEMENT OF HYPOTHESIS...... 46

Chapter 2: Materials & Methods...... 47

RAD51L1 DISRUPTION BY T(12;14)(Q15;Q24) IN A UTERINE LEIOMYOMA ...... 47

cDNA Cloning ...... 47

Polymerase Chain Reaction (PCR)...... 49

MAPPING OF ADDITIONAL UL CHROMOSOME 14 BREAKPOINTS ...... 49

IDENTIFICATION OF NOVEL TRANSCRIPTS OVEREXPRESSED IN UL...... 50

Exon Trapping...... 50

EST Markers ...... 50

Northern Hybridizations ...... 51

Rapid Amplification of cDNA ends (RACE)...... 52

t(12;14) Tumor And Normal Myometrial Samples...... 54

Tumor and Normal Myometrial Samples Not Analyzed Cytogenetically...... 54

cDNA Synthesis from Frozen Tissue Samples...... 57

Relative Reverse Transcriptase-Coupled Polymerase Chain Reaction (RT-PCR)...... 57

RAD51L1 EXPRESSION IN RESPONSE TO DNA DAMAGING AGENTS...... 59

Cell Culture and Treatment with Genotoxic Agents...... 59

Quantitative RT-PCR ...... 59

Western Blotting...... 60

Chapter 3: Rad51-Like Gene 1 (RAD51L1) is Disrupted by t(12;14)(q15;q24) in a

Uterine Leiomyoma...... 62

INTRODUCTION...... 62

- 2 - RESULTS...... 63

DISCUSSION...... 71

Chapter 4: Mapping of Additional UL Chromosome 14 Breakpoints Relative to

RAD51L1 and the GM10964 Breakpoint ...... 73

Chapter 5: Identification of Novel Transcripts Overlapping HMGA2 Which Are

Overexpressed in Uterine Leiomyomas...... 76

INTRODUCTION...... 76

RESULTS...... 84

Identification of Novel Expressed Sequences...... 84

Expression Patterns of Novel Transcripts A15, B6, and D12 in Human Tissues...... 87

Gene and EST expression in t(12;14) tumors and matched normal myometrium...... 91

Expression of HMGA2 and Embedded Transcripts in UL Cell Lines...... 104

Relationship of Transcript B6 to Alternative Splice Form HMGA2b...... 104

DISCUSSION...... 106

Chapter 6: Structure and Conservation of the 12q15 Locus Containing HMGA2,

A15, B6, and D12...... 116

Chapter 7: Discussion ...... 123

CANDIDATE GENES ON CHROMOSOME 14: RAD51L1, CYTOSKELETAL α-ACTININ AND

D14S854...... 124

A COMPLEX LOCUS IN THE BREAKPOINT REGION OF CHROMOSOME 12: HMGA2, A15,

B6 AND D12...... 126

What role(s) might A15, B6 and D12 play? ...... 128

- 3 - WHAT HAVE WE LEARNED ABOUT T(12;14)(Q15;Q24), GENE EXPRESSION AND UL

PATHOGENESIS? ...... 132

FUTURE RESEARCH DIRECTIONS ...... 133

Mechanism of the Translocation...... 133

Chromosome Domains and Mechanism of Alterations in Gene Expression ...... 135

Genetic Basis of UL Tumorigenesis ...... 135

References ...... 138

Appendix I: Analysis of Rad51L1 Expression in Response to DNA-Damaging

Agents ...... 166

EFFECT OF GENOTOXIC AGENTS ON RAD51L1 EXPRESSION...... 167

- 4 - List of Figures

Figure 1: Clinical Classification of Uterine Leiomyomata...... 15

Figure 2: Histopathology of Uterine Leiomyoma...... 16

Figure 3: Uterine Leiomyoma Cytogenetics ...... 22

Figure 4: Partial Karyotypes of UL Tumors Carrying t(12;14) ...... 23

Figure 5: The t(12;14)(q15;q24) balanced, reciprocal translocation...... 24

Figure 6: Translocation breakpoints span large regions on both 12q15 and 14q24

...... 28

Figure 7: Genomic structure of HMGA2...... 34

Figure 8: Genomic Structure of RAD51L1 ...... 40

Figure 9: Nucleotide alignment of RAD51L1 isoforms...... 65

Figure 10: Amino acid alignment of RAD51L1 isoforms...... 66

Figure 11: Location of a leiomyoma t(12;14) breakpoint relative to RAD51L1

exons...... 68

Figure 12: Alignment of the GM10964 chromosome 14 breakpoint with BAC

135h17 sequence...... 69

Figure 13: t(12;14) disrupts the RAD51L1 gene in UL GM10964...... 70

- 5 - Figure 14: Physical Map of RAD51L1 and the Chromosome 14 Breakpoints in

Three Uterine Leiomyomas...... 75

Figure 15: The t(12;14)(q15;q24) balanced reciprocal translocation and the

chromosome 12 breakpoint region ...... 77

Figure 16: Partial cDNA sequences of novel transcripts embedded within HMGA2

...... 85

Figure 17: Normal tissue expression profiles of novel transcripts A15, B6 and D12

by Northern blot...... 88

Figure 18: Expression of EST markers in t(12;14) tumors and matched normal

myometrium...... 94

Figure 19: Semiquantitative RT-PCR of oligo(dT)-primed cDNA consistently

reflects changes in expression of HMGA2, A15, B6 and D12 in t(12;14) tumors

...... 103

Figure 20: Northern blot analysis of HMGA2, A15, B6 and D12 expression in UL

GM10964...... 105

Figure 21: Effect of t(12;14)(q15;q24) on transcript expression from the

breakpoint regions...... 109

Figure 22: Models for Dysregulation of Expression from 12q15 Locus by

t(12;14)(q15;q24) ...... 114

- 6 - Figure 23: Alignment of HMGA1 and HMGA2 Genomic Structures...... 118

Figure 24: Genomic Structure and Human-Mouse Homology of the 12q15 Locus

...... 119

Figure 25: Homology between Human and Mouse Genomic Regions of A15, D12

and B6...... 121

Figure 26: Models for HMGA2 regulation by embedded antisense transcripts ...130

Figure 27: Expression of Rad51L1 is p53-Dependent ...... 168

Figure 28: Alterations in Rad51L1 Expression in Response to Cisplatin...... 170

Figure 29: Rad51L1 Expression Decreases in Response to Low-Dose UV

Irradiation...... 171

Figure 30: RAD51L1 mRNA Decreases in Response to UV Irradiation ...... 172

Figure 31: Effects of Camptothecin, Etoposide, Methyl Methanesulfonate and

Mitomycin C on RAD51L1 Expression...... 173

- 7 - List of Tables

Table 1: Uterine Leiomyoma Cytogenetics...... 20

Table 2: Gene Regulation by Action at a Distance...... 30

Table 3: Cytogenetic profile of UL tumor panel ...... 55

Table 4: Summary of expression results for chromosome 12 and chromosome 14

expression markers ...... 92

- 8 - List of Symbols and Abbreviations

ATPase adenosine trinucleotide phosphatase

AT-rich containing a high proportion of adenosine and thymidine residues

BAC bacterial artificial chromosome

BCR breakpoint cluster region on chromosome 14q24

BLAST basic local alignment search tool bp base pair cDNA complimentary DNA

CMV cytomegalovirus dATP deoxyadenosine 5’-triphosphate dbEST expressed sequence tag database dCTP deoxycytidine 5’-triphosphate der(12) derivative chromosome 12 resulting from t(12;14)(q15;q24) der(14) derivative chromosome 14 resulting from t(12;14)(q15;q24) dGTP deoxyguanosine 5’-triphosphate

DNA deoxyribonucleic acid

DNase I deoxyribonuclease I

DSB(s) double-strand break(s) dTTP thymidine 5’-triphosphate

E(number) embryonic day

EST expressed sequence tag

FISH fluorescence in situ hybribization

- 9 - GTPase guanosine trinucleotide phosphatase

HMGA1 high mobility group gene/protein A1 [formerly HMGI(Y)]

HMGA2 high mobility group gene/protein A2 [formerly HMGI-C]

Ig immunoglobulin kb kilobase

LCR locus control region

MAR multiple aberration region on chromosome 12q14-15

Mb megabase

MHC major histocompatibility complex mRNA messenger RNA

MTN multiple-tissue Northern blot

NCBI National Center from Biotechnology Information ncRNA functional non-coding RNA nt nucleotide orf [or ORF] open reading frame

PCR polymerase chain reaction poly-A+ RNA RNA selected for the presence of a polyadenosine tract

PVDF polyvinylidene difluoride

RACE rapid amplification of cDNA ends

RAD51L1 Rad51-like gene 1

(hREC2, R51L1, RAD51B, hREC2T, hREC2L, hREC2U are

earlier terms for the RAD51L1 gene and/or its splice variants)

RNA ribonucleic acid

- 10 - RNase ribonuclease rRNA ribosomal RNA

RT reverse transcription

SDS-PAGE sodium docecyl sulfate polyacrylamide gel electrophoresis

STS sequence tag site

SV40 Simian virus-40 t(12;14)(q15;q24) balanced translocation between human chromosomes 12

and 14 at sub-bands 12q15 and 14q24

TCR T-cell receptor

TdT terminal deoxynucleotide transferase

UL(s) uterine leiomyoma(s)

ULCR12 uterine leiomyoma cluster region on chromosome 12q15

UniSTS sequence tag site database utr [or UTR] untranslated region

UV ultraviolet

YAC yeast artificial chromosome

+/+ homozygous for the wild-type allele of a genetic locus

+/- heterozygous at the indicated genetic locus

-/- homozygous for a mutant allele of a genetic locus (also “null”)

Abbreviations not listed here are limited in use to a single section of this thesis and are defined in the text at the first usage, with the exception of those specialized forms of notation explained on the next page.

- 11 - Cytogenetic Notation

Karyotypes and other descriptions of cytogenetic changes follow the guidelines of the

International System for Human Cytogenetic Nomenclature.

Genes and Their Products

Commonly-used abbreviated designations for certain genetic loci and their RNA or protein products (e.g. Ras, p53, Rad51, c-fos, abl) are used without exposition if the derivation of the acronym is not relevant to the discussion herein. Information on these genetic loci and their products may be retrieved from NCBI or other databases using these abbreviated designations. One simple interface for obtaining further information on these molecules is LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/).

Units of Measure

Standard units of measure (liter [l], gram [g], molar [M], mole [mol], joule [J], Daltons

[Da], etc.) and the appropriate prefixes (pico- [p], nano- [n], micro- [µ], milli- [m], etc.) are used throughout this thesis. Units of time are abbreviated as follows: sec, second(s); min, minute(s).

- 12 -

Chapter 1: Introduction

EPIDEMIOLOGY AND PATHOLOGY OF LEIOMYOMA

Leiomyoma is a benign tumor of mesenchymal origin. These tumors may arise in any smooth muscle-containing tissue, including the urinary bladder, blood vessels, gastrointestinal tract, and skin, but they are most frequently found in the uterus [1].

Uterine leiomyomata (ULs) are one of the most common neoplasms in females, occurring in at least 20 to 50% of women of reproductive age, and some studies indicate that the incidence may be as high as 77% [2,3]. It is estimated that between 25 and 50% of ULs are symptomatic . They are associated with significant morbidity, including severe menorrhagia, anemia, pelvic pain, urinary incontinence, spontaneous abortion, and infertility . UL is the leading indication for hysterectomy worldwide; in the United

States, one-third of the 3.3 million hysterectomies performed between 1988 and 1993 were for the removal of uterine leiomyomata . More recently, myomectomy (surgical removal of the tumor[s] with preservation of the uterus) has become common for women who wish to preserve their fertility, and embolization (blockage of the blood flow to the tumors) is becoming a wide-spread treatment option for women who find surgery unacceptable. However, there are significant complications associated with these alternative treatment modalities, and they are undergoing further evaluation . The incidence of UL is increased in the black population and several other ethnic groups compared to the white population; other risk factors include a family history of UL, obesity, and nulliparity .

- 13 - ULs can arise in any part of the uterus, and show considerable variability in size and number. Clinically, ULs are classified by their location and the uterine layer in which they occur (Figure 1), which affect the symptomatology and treatment options.

However, there do not appear to be any molecular or cellular distinctions among these classifications. ULs are roughly spherical, well circumscribed, but not encapsulated.

Microscopically, they are comprised of well-differentiated, uniform, spindle-shaped smooth muscle cells (Figure 2). The characteristic firm, fibrous texture has given rise to the common clinical term “fibroids” for these tumors. Multiple ULs are frequently found within the same patient, with an average of 6.5 tumors per uterus . Individual tumors have been found to be monoclonal in origin by glucose-6-phosphate dehydrogenase isozyme analysis and methylation-sensitive X-linked polymorphism analysis , but multiple ULs from the same patient generally have independent clonal origins . In extremely rare cases, leiomyomata may undergo malignant transformation into leiomyosarcomas, but this finding is controversial and ULs are generally not considered to be premalignant lesions . Lessl and coworkers suggest that the non- malignant character of ULs may be related to decreased expression of the protooncogenes c-fos and c-jun in ULs compared to normal myometrium.

HORMONAL RESPONSIVENESS AND REGULATION OF UL

ULs are highly responsive to the ovarian hormones estrogen and progesterone.

The tumors regress following oophorectomy or menopause, and may rapidly increase in

- 14 - Figure 1: Clinical Classification of Uterine Leiomyomata

Diagram of clinical classifications of UL tumors based on position relative to the uterine wall: within the myometrium (intramural), just beneath the endometrium

(submucosal), or beneath the serosa (subserosal). Tumors which are connected to the myometrium only by a thin stalk are called pedunculated. Figure modified from http://www.womenfitness.net/

- 15 - Figure 2: Histopathology of Uterine Leiomyoma

Microscopically, UL tumors are composed of well-differentiated, spindle-shaped smooth muscle cells. The cells form bundles oriented at varying angles, such that some are seen in cross-section (thin arrow) and some in longitudinal section (thick arrow).

The edge of the tumor (right) is well-defined but not encapsulated. Hematoxylin and eosin (H & E) stain. Figure from [4].

- 16 - size during pregnancy or hormone therapy. The incidence of symptomatic ULs requiring surgical intervention reaches its maximum at 45 years of age and then declines rapidly, coinciding with the onset of menopause [5]. In women of reproductive age, ULs are commonly treated with gonadotropin-releasing hormone (GnRH) agonists as an alternative or an adjunct to surgery [6]. These agents shut down ovarian hormone production by inhibiting the release of gonadotropins by the pituitary, and thus induce a reversible menopause. Such treatments generally cause a reduction in the tumor volume by about 50% within several months; cessation of treatment usually results in return of the tumor to pretreatment size [7,8]. To avert negative effects of long-term GnRH agonist treatment, low levels of both progesterone and estrogen may be co-administered without loss of therapeutic effectiveness, although either progesterone or estrogen alone inhibits GnRH agonist-induced shrinkage of the tumor [9-11].

Estrogen and progesterone receptors are expressed at elevated levels in UL cells compared to normal non-pregnant myometrium [12-14] Estrogen receptor levels, which oscillate during the menstrual cycle in normal myometrium, remain uniformly elevated throughout the cycle in ULs [15]. During the follicular phase of the menstrual cycle, the heightened sensitivity of the UL cells to estrogen causes aberrant expression of estrogen-regulated genes. These genes, which include several growth factors (such as

IGF-I and prolactin) and their receptors as well as the collagens, are normally expressed in a cyclical pattern the myometrium; their prolonged expression is believed to contribute to leiomyoma growth [15,16]. During the luteal phase, progesterone increases the mitotic rate of leiomyomas [17,18] and inhibits cell death by inducing expression of the antiapoptotic protein Bcl-2 [19]. The mitotic index is higher in

- 17 - leiomyomata from women treated with progestin only than in patients not on hormone therapy or those treated with both estrogen and progestin [20]. The growth of a UL tumor has been modeled as a deregulated differentiation which results in a benign growth resembling the differentiated myometrium of pregnancy, a state regulated positively by estrogen and negatively by progesterone [15,17,21].

ANIMAL MODELS OF UL

Experimental animals, particularly laboratory rodents, have frequently provided useful systems for investigating tumors. Many well-characterized in vivo experimental systems for the study of epithelial carcinogenesis have been developed [22-24]. Animal models of soft tissue tumorigenesis are fewer, but include the induction of mesovarian leiomyomas in rats treated with β-adrenergic agonists [25] and the development of fibromyomatous nodules in the uteri of guinea pigs receiving prolonged estrogen treatments [26-28]. However, the tumors which develop in these animals differ histologically from human uterine leiomyomata [29].

Romagnolo and coworkers [30]. have created a transgenic mouse model for estrogen-dependent UL by expressing the SV40 large T antigen under the control of the rat calbindin-D9K (CaBP9K) gene promoter. The CaBP9K regulatory sequences include an estradiol-responsive element and development of the tumors was strictly under the control of estrogen. Six transgenic lines were obtained, with nearly complete penetrance of the leiomyoma phenotype. Leiomyomas in these animals exhibit very high estrogen-induced mitotic activity compared to human UL.

- 18 - A line of rats first described by Eker and colleagues [31] develops a hereditary cancer syndrome comprising renal cell carcinomas, uterine and cervical leiomyomas and leiomyosarcomas, and splenic hemangiosarcomas [32]. A germline mutation has been identified in the Tuberous Sclerosis gene 2 (TSC2), which encodes a tumor suppressor protein that functions as a GTPase-activating protein for Rap1, a member of the superfamily of Ras-related proteins [33-36]. Evaluation of the reproductive tract tumors in these rats indicated some tumors histologically identical to typical human myometrial leiomyomata and a subset of lesions representing either epithelioid or mixed variants [37]. Other features of these tumors are similar to the human disease, particularly an altered responsiveness to estrogen and progestin characterized by enhanced proliferation and decreased apoptotic index [38]. The 16p region containing

TSC2 has not been implicated by cytogenetic changes in human uterine leiomyomas

(see “Leiomyoma Cytogenetics” below), nor are there any reports of TSC2 mutations in spontaneous leiomyoma development in humans.

LEIOMYOMA CYTOGENETICS

Although normal karyotypes are observed in more than 50% of ULs [39], a variety of nonrandom cytogenetic changes have been reported (Table 1). The most common karyotypic abnormalities have been assigned to four major subgroups: deletions on the long arm of chromosome 7, reciprocal translocations involving the long arms of chromosomes 12 and 14, rearrangements of the short arm of chromosome 6, and trisomy 12 [40]. Complex secondary karyotypic changes are often also present

[40,41],

- 19 - Table 1: Uterine Leiomyoma Cytogenetics

Several studies [39,40,42,43] have identified or cataloged the recurrent cytogenetic changes observable in UL. This table indicates the percent of cytogenetically abnormal tumors carrying the indicated alteration in each report. Several of the studies may overlap (i.e. the same tumor may be included in more than one column of the table) and some tumors carry multiple aberrations (i.e. the same tumor may be included in more than one row of the table).

Sreekantiah Nilbert & Heim Meloni Mitelman 1994 1990 1992 1994 Total tumors analyzed >500 104 93 115 del(7q)(q11.2-22q31-32) 35% 19% 34% 24% t(12;14)(q14-15)(q23-24) 20% 17% 20% 16% other 12q15 aberrations 10% 10% 5% other 14q24 aberrations 5% 7% trisomy 12 <10% 12% 13% del(13)(q12-q33) <10% 11% 4% monosomy 22 <10% 4% ring chromosomes <10% 8% 1p36 rearrangements <10% 29% 8% 6p21 prearrangements <10% 13% 9%

- 20 - leading to speculation that an event which promotes genetic instabilty is involved in UL tumor initiation or progression [41].

Taken together, aberrations involving 12q13-15, 14q23-24, 7q21-31, or 6p (with or without additional karyotypic changes) are found in more than 75% of all karyotypically abnormal ULs (Figure 3) [39,40]. The balanced translocation involving chromosomes 12 and 14 (Figure 4) occurs in approximately 20% of cytogenetically abnormal ULs [42]. High resolution cytogenetic mapping of this recurrent chromosomal translocation allowed the localization of the breakpoints to 12q15 and 14q24.1 (Figure

5) [44]. t(12;14)(q15;q24.1) is often the sole detectable cytogenetic aberration [39,45] or the only consistent alteration among several subclonal populations within a tumor

[46], suggesting that it may represent an early, primary event in the pathogenesis of leiomyoma. Other chromosomal abnormalities, including +20, -22, i(17q), complex rearrangements involving chromosomes 1, 3, 6, 7, and 11, the formation of ring chromosomes and a high frequency of nonrandom telomeric associations, have also been identified in some tumors bearing t(12;14)(q15;q24.1), but these aberrations are thought to represent secondary changes, occurring subsequent to the translocation in the clonal evolution of certain tumors [46,47]. Deletions of 7q, which are among the most common detectable chromosomal abnormalities in ULs, have also been shown to occur subsequent to t(12;14) in some cases, suggesting that del(7q) may in general be a secondary step in the development of UL [48].

Chromosomal translocations involving 12q13-15 have also been described in lipomas, pleiomorphic adenomas of salivary gland, and other benign tumors of mesenchymal origin [49], and recombinations involving 14q24 occur in pulmonary

- 21 - Figure 3: Uterine Leiomyoma Cytogenetics

Half of uterine leiomyomata tested have no detectable cytogenetic aberrations (top); in those that do, several recurring subgroups have been described (bottom). Karyotypic changes involving 12q15 and/or 14q23-24 [red, pink and purple], most often as the simple balanced t(12;14)(q15;q24) [red], are common alterations. Chart based on [39].

normal abnormal

del(7q)(q11-q32) t(12;14)(q14-15;q23-24) Translocations of 14 with other or unknown partners Translocations of 12 with other or unknown partners Trisomy 12 6p21 involvement 1p36 involvement other

- 22 - Figure 4: Partial Karyotypes of UL Tumors Carrying t(12;14)

Four cases are shown. Two cases (cases 8 and 9) have t(12;14) as the sole cytogenetic aberration. Two cases (cases 10 and 11) show t(12;14) with additional karyotypic changes. Figure courtesy of N. Pandis and S. Soukup.

- 23 - Figure 5: The t(12;14)(q15;q24) balanced, reciprocal translocation

The t(12;14)(q15;q24) balanced, reciprocal translocation breakpoints as mapped by

Pandis and colleagues [44]. Regions of wild type chromosomes involved in the translocation are indicated by a horizontal band. Derivative chromosomes 12 [der(12)] and 14 [der(14)] are also shown.

12 14 der(12) der(14) 14p13

12p13.31 14p11.2

12p12.1 14q12

12q12

12q13.13 14q22.1 t(12;14)(q15;q24.1) 12q15 14q24.1

14q31.1

12q22

12q24.11 14q32.33

12q24.31

- 24 - hamartomas [50]. The consistent involvement of specific regions of chromosomes 12 and 14 in karyotypic changes in leiomyoma and related tumors has led to considerable speculation on the presence of genes with tumorigenic potential in these genomic regions [40,50].

CHROMOSOMAL TRANSLOCATIONS IN HUMAN DISEASE

The numerical and structural chromosomal alterations which have been cataloged in various tumors have had a tremendous impact on both tumor biology and clinical oncology. The identification of a particular aberration in a specific tumor type allows the researcher to focus the investigation of that disease on a relatively limited subset of the human genome. Karyotyping and molecular cytogenetic techniques are useful tools in disease diagnosis and patient prognosis. Several major types of cytogenetic changes are observed in tumors, including deletions, inversions, insertions, amplifications and translocations. Such changes may be idiopathic (observed in one tumor from one patient) or specific for certain tumor types (consistently found in tumors of the same type from many patients).

Chromosomal aberrations in tumors may be either primary or secondary changes

[51]. This classification is based on the timing of the alteration relative to tumor development, and thus can rarely be definitively demonstrated. Nonetheless, certain characteristics of a chromosome abnormality signal that it likely represents a primary change. Generally, primary aberrations are tumor type-specific, are observed frequently in the associated tumor type, and are often solitary changes; these features indicate that the change may be crucial for early tumor development. Secondary aberrations are

- 25 - common during tumor evolution, and often signal an acquired genomic instability.

Secondary changes may occur in a non-random manner, but they are generally less specific than primary alterations.

Acquired chromosomal translocations have been identified that are specific for several types of neoplasms. A significant number of translocations are associated with certain leukemias and lymphomas, likely due to the high rate of somatic recombination in lymphoid cells [52]. Tumor type-specific chromosomal translocations are somewhat less common in solid tumors, but have been associated with thyroid carcinomas [53] and several types of malignant sarcomas [54-56], as well as a variety of benign mesenchymal tumors [45,50,57]. The mechanisms resulting in chromosomal rearrangements in solid tumors are largely unknown, and no common sequence motifs have been identified at the translocation breakpoints [58].

Generally, tumor-associated translocations cause an oncogenic event by altering the expression rate of a gene, or via the juxtaposition of portions of two genes, generating a chimeric fusion gene product [59]. A classic example of the latter mechanism is the bcr-abl gene fusion in chronic myeloid leukemia (CML). In 1960,

Nowell and Hungerford [60] described a marker chromosome for CML; this aberrant chromosome 22 came to be called the Philadelphia chromosome, and was subsequently found to be the result of a reciprocal translocation between chromosomes 9 and 22 [61].

This translocation relocates a truncated abl protein kinase gene from chromosome 9 into the bcr (breakpoint cluster region) gene on chromosome 22 [62,63], producing a chimeric protein with enhanced tyrosine kinase activity. A similar translocation produces a slightly smaller bcr-abl fusion protein with even more potent tyrosine kinase

- 26 - activity in a subset of patients with acute lymphoblastic leukemia (ALL), a more aggressive hematopoetic neoplasm [64,65]. Fusions of transcription factor genes, especially the TLS/FUS and EWS families, are frequently found in sarcomas [58], and more than half of thyroid papillary carcinomas express fusions involving tyrosine kinases [66].

Altered gene expression as the result of a chromosomal translocation without the production of a fusion protein is common in lymphoid malignancies. The mechanism of this activation is generally the relocation of a gene with oncogenic potential into the context of immunoglobulin (Ig) or T-cell receptor (TCR) gene regultors, possibly through errors in V(D)J recombination [67]. In the context of neoplasia, the novel proteins produced by gene fusions and the inappropriate expression of protooncogenes as a result of chromosomal translocations each act to subvert the normal cellular control of growth. In addition to direct alteration of growth signal transduction pathways, current models of carcinogenesis resulting from chromosomal translocations include the activation of anti-apoptotic pathways and aberrant chromatin modification [68-70].

POSITIONAL CLONING OF THE UL TRANSLOCATION

Following the identification of t(12;14)(q15;q24.1) and its association with UL, a positional cloning approach was initiated to identify sequences critical to the pathogenesis of UL. Fluorescence in situ hybridization (FISH) and physical mapping led to the identification and subcloning of the segments of 12q15 [71] and 14q24

[72,73] within which the translocation breakpoints of several uterine leiomyomata map

(Figure 6). On chromosome 12, the UL breakpoints, as well as 12q15 translocations of a

- 27 - Figure 6: Translocation breakpoints span large regions on both 12q15 and 14q24

The chromosome 12 breakpoints mapped by Schoenmakers and colleagues [74] (top) are scattered throughout a 445 kb segment of

the chromosome 12 multiple aberration region (MAR). Chromosome 14 breakpoints [73] span a region of at least 400 kb. LM-30.1 LM-609 LM-100 LM-608 LM-5.1 LM-65 LM-67

-28- 445 kb

12 der(12)

14 der(14)

≥400 kb 10964 ST91 ST90 GM

panel of lipomas and pleomorphic salivary gland adenomas, lie within a 1.7Mb interval designated the multiple aberration region (MAR) [57]. The UL breakpoints were subsequently found to cluster within a 445 kb segment of the MAR called the uterine leiomyoma cluster region of chromosome 12 (ULCR12), flanked by STS markers

RM98 and RM33 [71]. Within ULCR12, UL breakpoints were found to be widely distributed, spanning the entire 445 kb [71]. The breakpoint cluster region (BCR) of chromosome 14 is of similar size, with UL breakpoints spanning at least 400 kb [73].

Such a broad distribution of breakpoints on both chromosome partners is unusual in neoplasm-associated translocations. This has led to speculation that the mechanism of gene dysregulation in t(12;14) ULs might involve action at a distance, perhaps by juxtaposition of a gene with heterologous enhancer sequences [71] or by removal of negative cis regulatory elements [73].

GENE REGULATION BY ACTION AT A DISTANCE

Regardless of which gene(s) affected by t(12;14)(q15;q24) is(are) responsible for the tumor phenotype, it is clear from the considerable size of the two breakpoint regions that the causative gene(s) inhabit(s) a domain which extends approximately half a megabase or more. It is likely that the mechanism of tumorigenesis involves the disruption of gene regulators situated at a considerable distance from the gene(s) they control. Gene regulation by action at a distance may be roughly divided into short- distance (up to a few kb), moderate-distance (tens to hundreds of kb) and long-distance

(1 Mb or more) phenomena (Table 2).

- 29 - Table 2: Gene Regulation by Action at a Distance

Gene regulation by action at a distance may be roughly divided into short-distance (up to a few kb), moderate-distance (tens to hundreds of kb) and long-distance (1 Mb or more) phenomena.

Range Regulator Distance short SV40 72 bp enhancer up to 4 kb moderate Drosophila gypsy element up to 85 kb moderate Gene-specific enhancers up to ~100 kb moderate β-actin LCR 105 kb moderate S/MARs 5-275 kb long Imprinting up to 1 Mb long Nucleolar dominance tens of Mb long Xist > 100 Mb

- 30 - The simian virus-40 (SV40) 72 bp repeat element is a non-specific short-range enhancer of gene transcription, capable of increasing transcription from the homologous

SV40 promoter or heterologous promoters. Maximal activation of transcription is obtained with minimal intervening sequence (<150 bp), but even at distances of up to 4 kb, transcription is activated at least 10-fold compared to an enhancerless construct

[75].

The locus control region (LCR) of the β-globin locus, an element which confers copy-number-dependent, position-independent expression to linked genes, is the best- characterized example of a moderate-distance regulator. The LCR consists of five deoxyribonuclease I (DNase I)-hypersensitive sites which lie 5’ of the cluster of globin genes. These genes are expressed in a strict tissue-specific developmental sequence. In the human locus, the hypersensitive sites are located at –6, -11, -15, -18 and –22 kb relative to the 5’-most of the globin genes (ε-globin). Reports of additional conserved hypersensitive sites both 5’ of the “classical” LCR [76] and 3’ of the globin genes [76-

78] suggest that the complete locus may be as large as 105 kb. Since the first physiological demonstration of the regulatory function of the β-globin LCR [79], more than 30 additional LCRs have been described (reviewed in [80]).

A second distinct group of moderate-range regulatory elements are scaffold/matrix attachment regions (S/MARs). S/MARs are DNA sites with high affinity for the nuclear matrix and/or chromatin scaffold believed to have a structural role in delimiting chromatin domains. The sequences of S/MARs are very diverse, and they can only be identified or defined by functional (binding) assays. A recent analysis

[81] of a 1 Mb region of 19q13.12 identified 16 S/MARs, of which 5 intragenic

- 31 - (intronic) sites were proposed to play dynamic regulatory roles and 11 intergenic

S/MARs were structural. These structural S/MARs subdivide the locus into 10 domains ranging in size from 6 to 272 kb, with an average size of 88 kb. This is in close accord with previous estimates of chromatin loop size [82].

Boundary or insulator elements are moderate-range regulators which establish independent domains of gene activity. The gypsy retrotransposon in Drosophila contains an insulator element which inhibits the effect of promoter-distal but not promoter-proximal enhancers. This effect is apparently generated by direct disruption of communication between enhancer and promoter, rather than by generalized structural changes to chromatin or inactivation of either enhancer or promoter [83]. The effect of distance from either the promoter or the enhancer on insulator function has not been systematically studied, but gypsy has been shown to block interaction of a promoter and enhancer spaced 85 kb apart [84].

Imprinting (reviewed in [85]) and nucleolar dominance (reviewed in [86]) are similar epigenetic phenomena in which gene expression is restricted to the allele(s) inherited or derived from only one of the two parents. In the case of the Prader-Willi and Angelman syndrome domain, imprinting has been shown to affect genes that span as much as 1 Mb [87]. Nucleolar dominance controls the expression of ribosomal RNA genes in plant and animal hybrids. The rRNA genes affected are arrayed in clusters of hundreds or thousands of copies, often spanning tens of megabases.

The most extreme example of long-range cis gene regulation is X chromosome inactivation (reviewed in [88]). Following the initiation of inactivation, Xist [89], a large non-coding RNA, coats the future inactive X. Xist RNA then likely recruits

- 32 - regulatory and chromatin proteins, eventually leading to the hypermethylation and hypoacetylation characteristic of the inactive X. Xist RNA spreads and exerts its effect over more than 100 Mb.

The mechanisms by which these regulators exert their influence on transcription have not yet been fully elucidated. Mechanisms common to most or all of these action- at-a-distance regulatory phenomena include chromatin remodeling (reviewed in [90]) and DNA methylation (reviewed in [91]). Recent reports have highlighted a mechanistic and functional link between these two processes [92-97]. Control of the cooperative interplay between these two processes is likely at the root of gene regulation by action at a distance. Furthermore, the importance of chromatin remodeling as a oncogenic process has recently been emphasized [70,98]. Examples include the misregulation of histone acetylation complexes, as in the mixed lineage leukemia/trithorax protein-

CREB binding protein (MLL-CBP) fusions described in some cases of myeloid leukemia [99], and aberrant functioning of histone deacetylase complexes, as is the case with fusions involving the retinoic acid receptor (RAR) in promyelocytic leukemia

[100]. While current examples of this association of chromatin remodeling with cancer involve the aberrant function of trans regulators, it is possible that a similar process could be initiated in a proto-oncogenic locus by translocation of cis regulatory regions.

CANDIDATE GENES ON CHROMOSOME 12: HMGA2

The 445 kb ULCR12 contains the gene for the high mobility group protein A2

(HMGA2; formerly HMGIC), a DNA-binding, non-histone component of chromatin

(Figure 7). This gene has been found to be directly disrupted or altered in expression by

- 33 - Figure 7: Genomic structure of HMGA2

The six exons of HMGA2 span approximately 160 kb within ULCR12. Exons 1-3 encode the DNA-binding AT hook motifs, exon

4 encodes a spacer domain, and exon 5 encodes an acidic tail. Alternative splicing (dotted line) produces the recently identified

HMGA2b transcript [110].

-34-

Exon 12 3B 4 5

Spacer Acidic 5’ UTR and Domain DNA-Binding and 3’ UTR Domain

10 kb the chromosomal translocations in a subset of uterine leiomyomata, lipomas, and other benign mesenchymal tumors [74,101]. HMGA2 has a highly modular structure: each of the first three exons encode a motif known as an “AT hook,” which forms a characteristic three-dimentional domain with non-sequence-specific affinity for binding

AT-rich DNA; the fourth exon excodes a short spacer domain, and the fifth exon encodes an acidic domain, the precise function of which is not yet understood [101-

103]. The modular structure and the AT hook motifs are conserved between HMGA2 and the closely related gene HMGA1 (formerly HMGI(Y)), but there are important differences in the genomic structures of these two genes (discussed in Chapter 6).

Although proteins containing motifs similar to the AT hooks of HMGA2 and

HMGA1 have been identified in species ranging from bacteria to primates [104], homologs of HMGA2 have been described only in vertebrates, including mouse [103], rat [105], goat [Tachi et al., unpublished, GenBank Accession No. AB058681] and chicken [106]. Normal expression of HMGA2 exhibits a distinct developmental course; early in embryogenesis HMGA2 is expressed in all tissues, then becomes restricted to mesenchymal derivatives, parts of the central nervous system and some epithelial cell layers later in development [107]. HMGA2 is not expressed appreciably in most adult tissues, although it is detectable by RT-PCR in normal adult human lung and kidney

[108] and in normal and osteoarthritis-affected synovia [109]. HMGA2 expressionis induced in some pathological states including a variety of mesenchymal tumors [111] and injured vascular smooth muscle [112].

While the expression pattern of HMGA2 suggests tight regulatory control of the locus, few of the regulatory mechanisms or elements have been identified. HMGA2

- 35 - utilizes several alternative tandem sites of transcription initiation [113,114], leading to multiple transcripts of varying size. Transcription factors Sp1, Sp3 and CTF/NF-1 have been implicated in transactivation of the promoter [114,115]. Ayoubi and coworkers

[113] found evidence that HMGA2 is regulated at the transcriptional level by a constitutively active promoter in the 5’ flanking region which can be repressed by negative regulatory elements that lie outside the 1.3 kb promoter region. Borrmann and colleagues [116] found that the HMGA2 3’ UTR has a negative regulatory function at the posttranscriptional level. This is consistent with the finding that alterations in

HMGA2 mRNA expression do not necessarily correlate with HMGA2 protein level

[117]

The relevance of this gene in UL is enhanced by the observation that HMGA1 is affected by rearrangements of chromosome 6p21 which characterize another cytogenetic subset of ULs (Figure 3) [118]. HMGA1 produces two protein products,

HMGA1a (formerly HMGI) and HMG1b (formerly HMGY), by alternative splicing.

HMGA2, HMGA1a and HMGA1b are architectural factors in the nuclear scaffold, binding preferentially in the minor groove of AT-rich DNA sequences. They do not have direct transcriptional activity, but can alter the conformation of DNA and its accessibility to other transcription factors [101]. A role in cell proliferation is suggested by their expression in embryonic and neoplastic cells [102,111,119], and by the burst of

HMG1a synthesis during lymphocyte activation [120] and of HMGA2 following vascular injury [112]. A specific function for HMGA2 in adipogenesis is indicated by the phenotype of the mouse mutant pygmy, which is associated with complete inactivation of HMGA2 and has a deficiency in adipose tissue [121]. A gene-dose-

- 36 - dependent reduction in leptin deficiency-induced obesity in HMGA2-null and HMGA2 heterozygous (+/-) mice has been reported [122], consistent with a specific role for

HMGA2 in adipocyte growth. A link between HMGA2 expression and UL tumorigenesis is reinforced by the recent observation that the HMGA2 protein is not expressed in the normal myometrium of Eker rats (see “Animal Models of UL,” page

18) but is present in 15 of 22 Eker leiomyomas analyzed [123].

The role that HMGA2 may play in UL tumorigenesis is unknown, and models of its function are complicated by the fact that the impact of t(12;14)(q15;q24.1) on the gene varies from tumor to tumor. The coding sequence of HMGA2 is disrupted in some

ULs, producing aberrant or fusion transcripts [74,111,124]. However, in other cases there is upregulation of HMGA2 expression which is not associated with alterations in the coding sequence or UTRs [108]. Some UL breakpoints map more than 100 kb away from HMGA2, and may disrupt as yet unknown regulatory sequences of the gene [125].

Using antibodies raised to the N-terminal DNA binding domain, Klotzbucher and colleagues [117] detected expression of HMGA2 protein in 9 of 33 tumors studied, versus none of the corresponding normal myometrial samples. In two cases, an abnormal molecular mass was observed for HMGA2, apparently representing truncated or chimeric forms of the protein. These authors suggest that enhanced expression of either mutant or wild-type HMGA2 protein plays a significant role in the pathogenesis of UL. However, truncated and chimeric forms of HMGA2 function differently from wild-type HMGA2 in cell transformation assays. Truncated and chimeric forms of

HMGA2 which retain the DNA-binding AT hook motifs have weak transforming

- 37 - ability in NIH3T3 cells, but wild-type HMGA2 is not transforming and confers no growth advantage over mock-transfected cells [126].

Two different colonies of mice transgenic for a truncated form of HMGA2 often found in tumors (containing the N-terminal DNA binding domains encoded by exons 1-

3 but lacking the spacer and C terminal acid domains) have been described. One transgenic line, in which the HMGA2 transgene is driven by a major histocompatibility complex I promoter, exhibits a high prevalence of lipomas but not leiomyomata or other tumor types [127]. The other, in which transgene expression is under the control of the

CMV promoter, is characterized by gigantism, abdominal and pelvic lipomatosis, and late (>12 months) development of natural killer cell lymphomas (due to activation of interleukin-2 and interleukin-15 promoters by HMGA2 overexpression) [128,129]. This is consistent with involvement of HMGA2 in development of lipomas with translocations involving 12q15. However, despite ubiquitous expression of the transgene in both lines [120], no leiomyomata were observed in mice transgenic for the truncated HMGA2. It is unknown whether the absence of leiomyomata in the uteri or other sites in these transgenic mice is due to species-specific properties, or if it indicates a requirement for additional aberrant factors in leiomyoma formation. Preliminary, unpublished reports of full-length HMGA2 overexpression in mice suggest that there is no increase in tumor formation in these animals. Altered expression levels of intact

HMGA2, therefore, appear to be insufficient to explain UL tumor formation.

A normal splice variant of HMGA2, HMGA2b, has recently been identified

[110]. This splice variant is co-expressed in most tissues and cells which express

HMGA2. HMGA2b contains exons 1-3 spliced to a novel exon located between exons 3

- 38 - and 4. Thus, the novel transcript encodes an HMGA2 protein which retains the DNA binding domains but lacks the spacer and the acidic domain. Hauke and colleagues

[110] speculate that aberrant expression of this splice variant may account for tumorigenesis in cases where the HMGA2 gene remains intact.

CANDIDATE GENES ON CHROMOSOME 14: RAD51L1

Our laboratory [73] identified several expressed sequences that mapped within the chromosome 14 BCR. One of these sequences, RAD51L1 [[130,131], is a member of the RAD51/52 family of double strand break repair enzymes. RAD51L1 is a large gene, spanning approximately 800 kb on 14q24 (Figure 8). A 1.8 kb RAD51L1 cDNA sequence was found to be expressed in all tissues tested, although the detection of transcripts of other sizes suggested the existence of alternative splice forms [130].

Subsequent reports from our laboratory and others have identified 4 additional splice variants [124,132,133].

Rad51L1 is classified as one of 5 paralogs of Rad51 in vertebrates. The similarity of these human proteins to the Saccromyces cerevisiae Rad51 protein

(ScRad51) amino acid sequence ranges from 47.3% to 82.6% [134]; Rad51L1 is 50.6% similar to ScRad51. In yeast, Rad51 plays a critical role in the repair of double-strand

DNA breaks (DSBs), which occur in a number of natural cellular processes including

DNA replication and meiotic recombination. DSBs are also induced by genotoxic

- 39 - Figure 8: Genomic Structure of RAD51L1

The fifteen exons of RAD51L1 span approximately 800 kb overlapping the chromosome 14 BCR. Alternative splicing has been

reported between two eighth exons (8a and 8b) [133] and among 4 eleventh exons (11α, 11a, 11b, and 11c) [124,133]

-40-

Exon 475 6 8a 8b 9-11a 11b 11c 1-3

50 kb

agents such as biradicals, high energy radiation and reactive oxygen species [135].

Therefore, the DSB repair enzymes, which include RecA in prokaryotes and the

RAD51/52 gene family in eukaryotes, play a critical role in the maintenence of genomic integrity. The genes of the RAD52 epistasis group (including RAD51 and RAD52) have been implicated in recombinational repair following exposure to ionizing radiation or chemical agents, as well as in meiotic and mitotic recombination and B cell class switching [136].

Rad51L1 has been shown by co-immunoprecipitation and yeast three-hybrid studies to complex with three other Rad51 paralogs: Rad51L2, Rad51L3, and XRCC2

[137,138]. This complex binds single-stranded gaps and nicks in duplex DNA [137], and a smaller complex of Rad51L1 with Rad51L2 has single-stranded DNA-stimulated

ATPase activity [139].

In vivo, homozygous deletion of the mouse RAD51L1 locus by “knockout” gene targeting results in embryonic lethality [140]. Mice heterozygous for RAD51L1 appear normal and fertile. Homozygous mutant embryos were severely retarded in growth as early as embryonic day 5.5 (E5.5) and were completely resorbed by E8.5. The

RAD51L1-null phenotype was partially rescued on a p53-null background, with

RAD51L1-/-p53-/- embryos surviving surviving 1-2 days longer than RAD51L1-/-p53+/+.

In chicken B lymphocytes, homozygous knockout of the RAD51L1 locus results in viable cells, although about 20% of the cells are killed in each cell cycle through spontaneous chromosomal aberrations [141]. The Rad51L1-null cells are deficient in homologous recombination repair and are very sensitive to cross-linking agents, a phenotype common to all five vertebrate Rad51 paralogs [142]. This indicates that

- 41 - Rad51L1 plays an important role in repairing DNA damage and maintaining genome integrity.

DNA REPAIR IN HUMAN DISEASE

It is tempting to speculate that the disruption of a DNA recombination/repair gene by the 12;14 chromosomal translocation might be an important step in the early pathogenesis of leiomyoma. Disruption of the function of such a gene could result in impaired ability to correct DNA damage, leading to genetic instability and, ultimately, the accumulation of mutations leading to neoplastic transformation.

Genes involved in the detection and repair of DNA damage have been previously implicated in a number of cancer-prone syndromes, including xeroderma pigmentosum, Fanconi's anemia, ataxia telangiectasia, and Bloom syndrome. Mutations in at least seven distinct factors of the nucleotide excision repair pathway have been implicated in xeroderma pigmentosum (reviewed in [143]), a syndrome characterized by extreme photosensitivity and predisposition to skin cancer. There is evidence for eight separate Fanconi’s anemia genes [144], of which three have been cloned. One of these is human XRCC9, a gene which has been implicated in DNA post-replication repair [145]. By contrast, ataxia telangiectasia and Bloom syndrome are single-gene disorders. The product of the ATM (ataxia telangiectasia-mutated) gene belongs to a family of DNA damage-induced protein kinases [146]. The Bloom syndrome gene,

BLM, encodes a DNA helicase of the RecQ family [147].

The importance of DNA damage detection and responsiveness in preventing neoplasia is further emphasized by the high frequency with which mutations in genes

- 42 - critical to these pathways are found in cancers. p53, which is mutated in more than 50% of human cancers, plays a central role in maintaining genomic stability through its influence on cell cycle, DNA repair and apoptosis. p53 interacts directly with the DNA repair machinery including the DSB repair enzyme Rad51 [148,149] and the nucleotide excision repair factors XPB and XPD [150]. Likewise, the breast cancer susceptibility genes BRCA1 and BRCA2 cooperate with Rad50 and Rad51 in a common DNA damage response pathway [151-153].

ANALYSIS OF GENE EXPRESSION IN t(12;14)(q15;q24) UTERINE

LEIOMYOMATA

As described previously, cytogenetic evidence shows that t(12;14)(q15;q24.1) is both an early event and a recurrent alteration in UL, and therefore may represent one of the important steps in uterine leiomyoma pathogenesis. This study analyzes the molecular events associated with this translocation, specifically the transcription of genes within the breakpoint regions on 14q24 and 12q15.

Mapping of Chromosome 14 Breakpoints Relative to RAD51L1

As discussed above, t(12;14) had previously been associated with activation of the HMGA2 gene on chromosome 12, which has been implicated in promoting cell proliferation particularly of lipoid tissues. We sought to determine whether the translocation caused significant changes to chromosome 14 genes as well. Analysis of

- 43 - the cloned breakpoint in one t(12;14) UL yielded sequence data that was compared to available human genome data. This allowed the mapping of the chromosome 14 breakpoint relative to the RAD51L1 gene. The breakpoint was found to lie within this gene, resulting in disruption of the major, ubiquitously-expressed RAD51L1 isoform.

Subsequent analysis of two additional t(12;14) UL breakpoints indicated that these translocations left the RAD51L1 gene intact, and also refined the estimate of the chromosome 14 breakpoint region to between 706 and 1168 kb.

Identification of EST Markers Significantly Altered in Expression by t(12;14)

The breakpoints of t(12;14)(q15;q24.1) span large genomic regions (nearly 0.5

Mb) on each of the involved chromosomes, and breakpoints have been identified mapping well outside each of the leading candidate genes (HMGA2 and RAD51L1).

This suggested a new paradigm for the effect of the translocation: namely, that the aberration alters the structure and long-range regulatory controls of the translocation- derived chromosomes, affecting the expression of a variety of genes including but perhaps not limited to the current candidate genes. To test this hypothesis, the sequence tag site (STS) database, the expressed sequence tag (EST) database, and transcript maps developed in our laboratory [154] were correlated with the human genome project data in order to generate an expression map spanning the breakpoint regions of chromosomes 12 and 14. This expression map consisted of a series of ESTs and genes within and flanking both breakpoint regions, and whose relative positions are known.

Expression levels of these markers were systematically tested in a panel of matched

- 44 - normal and t(12;14) UL tissue samples. This allowed the identification of a domain of altered expression on chromosome 12.

Initial Characterization of Novel 12q15 Transcripts A15, B6, and D12 in Normal Tissue and in UL

The expression markers which were significantly altered in the tumors included

HMGA2 and three uncharacterized ESTs. The three novel ESTs, A15, B6, and D12, all mapped within introns of HMGA2. Northern blot analysis of a t(12;14)(q15;q24) UL cell line confirmed that A15, B6 and D12 represent unique transcripts rather than aberrant splice products of HMGA2. The expression patterns of these novel transcripts in normal tissues were determined, and experiments were initiated to obtain additional cDNA sequence in order to determine the probable function(s) of these genes.

How Could A15, B6, D12, HMGA2 and RAD51L1 Relate to One Another and to

Leiomyoma Pathogenesis?

The mapping of UL breakpoints a considerable distance outside the RAD51L1 gene suggests that this is not a causative gene in the pathogenesis of t(12;14)(q15;q24)

ULs. This DNA repair gene more likely can contribute to the high frequency of secondary cytogenetic aberrations observed in these tumors, and perhaps to enhanced cell proliferation.

HMGA2 fulfills many of the requirements for a causative gene in t(12;14)(q15;q24) ULs. HMGA2 expression is qualitatively or quantitatively altered in

- 45 - many tumors, it influences cell differentiation and growth, and truncated HMGA2 can cause tumors in transgenic animals. However, it is unclear whether altered HMGA2 expression alone can generate the tumor phenotype, nor how distant breakpoints can affect expression of this gene.

The functions of the novel transcripts A15, B6 and D12 remain unknown. Their position, overlapping HMGA2 and in an antisense orientation, suggests that these genes could play a role in regulation of HMGA2 expression at a transcriptional or post- transcriptional level. It is also possible that one or more of these novel genes contributes directly to the tumor phenotype by altering cell growth or differentiation.

STATEMENT OF PREMISE AND DEVELOPMENT OF HYPOTHESIS

As described in this introduction, UL often exhibits the specific balanced translocation, t(12;14)(q15;q24). Furthermore, at least one gene encoding a protein with a role in gene regulation and cell growth and differentiation is known to be located within the genomic regions involved in this transloaction. The specific working hypothesis of this project is that the UL-associated translocation results in altered expression of one or more genes in the region(s) near the translocation breakpoint. If this is true, we infer that altered gene expression contributes to the development of UL.

FORMAL STATEMENT OF HYPOTHESIS

The recurrent translocation in uterine leiomyoma, t(12;14)(q15;q24), is an oncogenic event, altering the expression of a gene or genes in the vicinity of the breakpoint(s) such that cell proliferation increases, resulting in the tumor phenotype.

- 46 - Chapter 2: Materials & Methods

RAD51L1 DISRUPTION BY t(12;14)(q15;q24) IN A UTERINE LEIOMYOMA cDNA Cloning

Physical mapping of 14q24.1 was used to identify DNA clones that spanned translocation breakpoints from ULs [72,73]. Sequences of putative exons isolated by exon amplification [155] from two of these clones, bacterial artificial chromosome

(BAC) 52F18 and cosmid 90C5, were used for homology searches of the expressed sequence tag database (dbEST) using the basic local alignment search tool

(BLAST)[156]. These analyses resulted in the identification of an EST clone (GenBank

Accession #T92120) that contained a partial ORF that was identical to hREC2. To obtain the full length sequence, two rounds of rapid amplification of cDNA ends

(RACE) were performed from a lung cDNA library (Clontech, Palo Alto CA) using gene-specific primers from the T92120 sequence (RR2, 5'-

CAAAGTAGATTGGTGGGTTTC-3' and RR3, 5'-CACTTGCATAATGGTTATG-3') and the vector primer λgt10F (5'-AGCAAGTTCAGCCTGGTTAAG -3'). RACE reactions were performed using the Expand Long Template PCR System (Boehringer

Mannheim, Indianapolis IN) with an initial 2-minute 94°C denaturation, 35 cycles of

94°C for 1 minute, 56°C for 1 minute, 68°C for 3 minutes, and a final extension at 68°C for 7 minutes. One µl of the first-round RACE product (amplified using primers RR2 and λgt10F) was used as template for a second round of amplification with primers RR3 and λgt10F. The second-round product was directly cloned into vector pGEM-TEasy

- 47 - (Promega, Madison WI). The original T92120 clone and a pGEM-TEasy clone of the

5'-extension product were sequenced using either the Sequenase v2.0 DNA sequencing kit (Amersham, Arlington Heights IL) or automated DNA sequencing (Perkin

Elmer/Applied Biosystems Division, Foster City CA, Model 377).

A novel hREC2 isoform expressed in testis, hREC2T, was identified by sequence homology searches of dbEST using BLAST as described above. A

TIGR/ATCC Special Collection cDNA clone (EST96594) from a human testis cDNA library was obtained (ATCC, Rockville MD) and sequenced. Southern blots were performed as previously described [73].

To identify possible t(12;14) fusion gene transcripts, 3’ RACE was performed on primary cDNA from leiomyoma cell culture GM10964 (Coriell Cell Repositories,

Camden NJ). CDNA synthesis was performed using the 3’ RACE System (Gibco-BRL,

Gaithersburg MD). First-round amplification reactions were performed using the gene- specific primer RCHK2.F (5’-GATTACAACCCATCTGAGTGGAGC-3’) and the adaptor primer AUAP (Gibco-BRL, Gaithersburg MD) under the following conditions:

40 cycles of 97º for 45 seconds, 60ºC for 45 seconds, 68ºCfor 3 minutes in 50 µl reactions containing 1x eLONGase buffer B, (Gibco-BRL, Gaithersburg MD), 0.25 mM each dATP, dCTP, dGTP, and dTTP, 25 pmol each primer, and 1 unit eLONGase enzyme mix (Gibco-BRL, Gaithersburg MD). One microliter (1 µl) of a 1:100 dilution of the first-round product was reamplified using a nested gene-specific primer A2/3F

(5’-GCTGTGTGATAGCCGCACTAGG-3’) and the adaptor primer AUAP under the same conditions as above. The second-round product was directly cloned into vector pCR2.1 (Invitrogen, Carlsbad CA) and sequenced using automated DNA sequencing

- 48 - (Perkin Elmer/Applied Biosystems Division, Foster City CA, Model 377).

Polymerase Chain Reaction (PCR)

Polymerase chain reaction (PCR) mapping of the 3’ ends of the isoforms relative to the t(12;14) breakpoint in leiomyoma GM10964 was performed on DNA from normal and translocated chromosomes. Primers specific for HRAD51B (5'-

CAATTCCGTGGCAACTAG-3' and 5'-CAAAGTAGATTGGTGGGTTTC-3'), R51H2

(5'-CCAAGAGAAGCCATAGGG-3' and 5'-CAGCAATCAACTAATTAATCCC-3'), hREC2U (5’-CAACCAGCATTTGAAAACAGAGAG-3’ and 5’-

GGACATTCACAAACACACAATCAC-3’) or hREC2T (5’-

GCTTTTGCAAACACGGCTAT-3’ and 5’-ATGAAAACCAATGTGGGTGG-3’) were used to amplify DNA templates from human, mouse, and monochromosomal hybrids containing either a normal chromosome 14 or the t(12;14) derived chromosome 14

[der(14)] as their only human component [157]. PCR was performed for 36 cycles of

94°C for 45 sec, 56°C for 45 sec, 72°C for 1 min in 25 µl reactions containing 1x PCR buffer J (Invitrogen, Carlsbad CA), 0.25 mM each dATP, dCTP, dGTP, and dTTP, 25 pmol each primer, and 2 units Taq polymerase (Gibco-BRL, Gaithersburg MD).

MAPPING OF ADDITIONAL UL CHROMOSOME 14 BREAKPOINTS

Sequence analysis was performed using the Celera Discovery System 3.5.

RAD51L1 sequence and previously characterized STS markers were retrieved from

GenBank and compared to the human genome database using BLASTN. All RAD51L1

- 49 - exons and STS markers were found to lie within Celera human genome contig

GA_x5L2HTU0SRS.

IDENTIFICATION OF NOVEL TRANSCRIPTS OVEREXPRESSED IN UL

Exon Trapping

The BAC clone 25m16 was identified by screening human BAC library pools (Research

Genetics, Huntsville, AL) using der(14)-derived chromosome 12 probes as previously described [73]. This clone was then used as target DNA for exon trapping as previously described [155]. Both strands of each resulting putative exon were fully sequenced using an automated ABI sequencer at the University of Cincinnati DNA Core Facility or by the Sequenase 2.0 DNA sequencing kit (United States Biochemical, Cleveland

OH). The DNA sequence of each putative exon was analyzed for nucleotide and inferred amino acid sequences homology to known sequences in the NCBI database using BLAST [158].

EST Markers

Information for previously reported STS DNA markers was obtained from the UniSTS database at the National Center for Biotechnology Information

(http://www.ncbi.nlm.nih.gov/genome/sts/). The BLAST algorithm [158] was used to compare STS sequences with the NCBI EST database (dbEST) as well as the NCBI human genome and Celera Genomics (Celera, Rockville MD) databases in order to select markers that were expressed from the chromosomal regions of interest. EST

- 50 - marker A15 was identified by searching dbEST with intronic sequence from the

HMGA2 gene using BLAST. Oligonucleotides were synthesized using an Applied

Biosystems DNA Synthesizer model 394 at the University of Cincinnati DNA Core

Facility and optimized for amplification in a PTC-200 thermocycler (MJ Research,

Waltham MA) using the PCR Optimization System (Invitrogen, Carlsbad CA) according to the manufacturer's protocol. Amplification of the monochromosomal hybrid mapping panel #2 (Coriell Cell Repositories, Camden NJ) was used to confirm unique mapping of each marker to the expected chromosome.

Northern Hybridizations

Multiple tissue Northern filters (2 µg poly-A+ RNA per lane) were commercially prepared and analysis was performed using manufacturer’s protocol (Clontech, Palo

Alto, CA). Total RNA from UL tumor cell line GM10964 (Coriell Cell Repositories,

Camden NJ) was isolated using Tri-Reagent (MRC Inc., Cincinnati, OH) following the manufacturers protocol. Poly-A+ RNA was isolated using Oligotex mRNA purification

(Qiagen, Valencia CA). Northern filters (2 µg poly-A+ RNA per lane) were prepared by standard formaldehyde denaturing gel electrophoresis [153] followed by transfer to

Hybond N+ nylon membranes (Amersham Pharmacia Biotech, Pisscataway NJ). For hybridization probes, PCR products were gel-purified using the QiaQuick Gel

Purification System (Qiagen, Valencia CA) and labeled using the Random Primers labeling system (Gibco-BRL, Grand Island NY). Oligonucleotide probes were labeled by a standard T4 kinase protocol [153].. All probes were purified using NucTrap Probe

- 51 - purification columns (Stratagene, La Jolla CA). Northern blot hybridization buffer was commercially prepared (ExpressHyb; Clontech, Palo Alto, CA) and blots were hybridized and washed according to manufacturer's recommendations.

Rapid Amplification of cDNA ends (RACE)

Total and poly-A+ RNA were isolated from GM10964 cells (Coriell Cell Repositories,

Camden NJ) as described above. For each RACE reaction, 1.2µg total RNA or 0.1µg polyA+ RNA was treated with DNase I (Gibco-BRL, Grand Island NY), then converted to first strand cDNA using the SuperScript First Strand Synthesis System (Gibco-BRL,

Grand Island NY) according to the manufacturer’s protocol except that synthesis incubation time was increased to 90 minutes and 1000 units RNase T1 (Ambion, Austin

TX) were added with the RNase H. Primers for first strand synthesis were as follows:

A15-GSP1R, 5’-GAGTGTCCAAGAGAGTG-3’; B6-GSP1R, 5’-

ATATTATGTGGTGCTCT-3’; D12-GSP1R, 5’-ACATAGAGCTTGTCATC-3’; and

3’ RACE adaptor primer (Gibco-BRL, Grand Island NY). First-strand cDNA was purified using the GeneClean III Kit (Bio 101, Inc., Vista CA). For 3’ RACE, 1/10 of the purified first-strand cDNA synthesized with the 3’ RACE adaptor was used directly in each PCR reaction as described below. For 5’ RACE, the first strand cDNA was subjected to homopolymeric tailing using terminal deoxynucleotide transferase (TdT) after reserving 1/5 of the purified first strand cDNA as a TdT(-) control. Each tailing reaction consisted of 10mM Tris-HCl (pH8.4), 25mM KCl, 1.5mM MgCl2, 200µM dCTP, first strand cDNA and 15 units TdT (Gibco-BRL, Grand Island NY). First strand

- 52 - cDNA was denatured in reaction buffer at 94°C for 2 minutes and chilled immediately on ice for 1 minute prior to addition of TdT. The tailing reaction was allowed to proceed for 10 minutes at 37°C, then TdT was heat-inactivated for 10 minutes at 65°C.

1/5 volume of dC-tailed cDNA was used directly in each PCR reaction. Two rounds of amplification were carried out using appropriate nested gene-specific primers (GS2R then GS3R for 5’ reactions, GS2F then GS3F for 3’ reactions) with the abridged universal adaptor primer (AUAP; Gibco-BRL, Grand Island NY). The gene-specific primer sequences for amplification were as follows: A15-GS2R, 5’-

CAAGAGAGTGCAGGGTAGCC-3’; A15-GS3R, 5’-

CAACCAATTAAGCGTGCAGC-3’; B6-GS2R, 5’-

GGTGAGCAGTCAGTGAGGTGC-3’; B6-GS3R, 5’-

CATTCTTGCTTGGGCTTGAGG-3’; D12-GS2R, 5’-

TTCCTCATTGGGCTCTCTGTA-3’; D12-GS3R, 5’-

GTTCACCCTCCTTTTGAGCTC-3’; A15-GS2F, 5’-GCTGCACGCTTAATTGGTTG-

3’; A15-GS3F, 5’-GGCTACCCTGCACTCTCTTG-3’; B6-GS2F, 5’-

CCTCAAGCCCAAGCAAGAATG-3’; B6-GS3F, 5’-

GCACCTCACTGACTGCTCACC-3’; D12-GS2F, 5’-

GAGCTCAAAAGGAGGGTGAAC-3’; D12-GS3F, 5’-

TACAGAGAGCCCAATGAGGAA-3’. Standard PCR conditions consisted of 60mM

Tris-HCl (pH 9.0), 15 mM (NH4)2SO4, 2mM MgCl2, 0.25mM each dNTP, 200nM each primer, and 2 units Taq polymerase (Gibco-BRL, Grand Island NY) with an initial denaturation of 2 minutes at 94°C and 35 cycles of 30 seconds at 94°C and 4 minutes at

68°C. Long PCR conditions consisted of 60mM Tris-SO4 (pH9.1), 18mM (NH4)2SO4,

- 53 - 1.6mM MgSO4, 200µM each dNTP, 400nM each primer and 1µl Elongase enzyme mix

(Gibco-BRL, Grand Island NY) with an initial denaturation of 2 minutes at 94°C and 35 cycles of 30 seconds at 94°C and 8 minutes at 68°C. PCR products were subcloned using the TOPO XL PCR Cloning Kit (Invitrogen, Carlsbad CA) or were gel-purified using the GeneClean III Kit (Bio 101, Inc., Vista CA) and directly sequenced. All sequencing was performed using an automated ABI sequencer at the University of

Cincinnati DNA Core Facility.

t(12;14) Tumor And Normal Myometrial Samples

A panel of frozen uterine leiomyoma tissue samples and matched normal myometrium were the kind gift of Dr. Urvashi Surti (University of Pittsburgh, Pittsburgh PA). All of these tumors had been previously characterized cytogenetically and found to carry translocations involving chromosomes 12 and 14 (Table 3).

Tumor and Normal Myometrial Samples Not Analyzed Cytogenetically

Tissue samples were obtained from surgical specimens at the University of Cincinnati in accordance with Human Subjects protocol #95-4-11-02. Samples were flash-frozen in liquid nitrogen and stored at -80ºC. All diagnoses were confirmed by the University of Cincinnati Department of Pathology.

- 54 - Table 3: Cytogenetic profile of UL tumor panel

Case number, tissue source and cytogenetic results are given. TT = tumor tissue; numbers indicate multiple tumors from the same patient. Data provided by Dr. U. Surti,

University of Pittsburgh.

- 55 - Case Number Tissue Cytogenetic Results 00047 TT 46, XX,i nv( 1) ( p22q25) . del ( 7)( q11q22), - - -- - 00047 " - - t ( 12; 13; 14) ( q15; q31; q22) [28] /45, i dem,- 22-- - - - 00047 " - - [6] / 43, i dem,-21, -21, -22[ 1] / 44, i dem,- 7, - 20- - - - 00047 " --[1]/49.idem,+4,+8,+10,-15[1]/50,idem,---- 00047 " - - +4, +5, +8,+10[1] 15143 TT 46,XX,del(3)(q13q26),-6,inv(7)(q21q11.2),------15143 " der( 12)t ( 6;12; 14) ( 12pt er - >12q13: : 6p21. 3------15143 " ->6pter),der(14)t(6;12;14)(14pter->------15143 " 14q21::12q15->12qter)(7) 08652 TT1 46,XX,t(5;12;14)[der(5)(5qter->cen->----- 08652 " 5p15. 1: : 12q24. 3- >12q14:: 14q23- >14q11. 2------08652 " : : 5p15. 2) ; der ( 12) ( 12pt er - >cen- >12q12) - -- - - 08652 " ;der(14)(14pter->cen->14q11.2::12q12------08652 " - >12q14: : 14q24->14qt er )] ( 10) ------T1 08652 TT2 46,XX,t(5;12;14)(19)------T2 16886 TT 46,XX,der(1)t(1;7;12;14)(1pter->1q32::------16886 " 12q21.3->12qter),der(7)t(1;7;12;14)------16886 " (7pter->7q11::1q42.1->1qter),der(12)------16886 " t(1;7;12;14)(12pter->12q21.3->14q11.2->------16886 " 14qter),der(14)t(1;7;12;14)(14pter->------16886 " 14q11. 2: : 7->7q22: : 7q36->7qter ) (16) 00359 TT 46, xx( 5) 00359 " - - -/ 46, xx, del ( 13) ( q14q32) ( 5) 00359 " - - -/ 44, xx, -11, t( 12; 14; ?) ( q15; q24; ?), ___ 00359 " -17,-22,+mar(2) 00359 " - - -/ 45, xx, t( 12;14; ?) ( q15; q24; ?), ___ 00359 " -17,-22,+mar(1)---- 00359 " ---/47,xx,t(1;4)(p32;q21),+mar(2) 03706 TT 44, xx, t ( 1; 12; 14) [ ( der ( 1) ( 12pt er- >12q15:: - - -- 03706 " 14q32- >14q21: : 12q15- >12q12:: 1p13- >cen- >-- - 03706 " 1q12: : 14q32- >14qt e r ) ; der ( 12) ( 12pt e r - >c en- >- - - 03706 " 12q12: : 1q12- >1qt er ); der( 14)( 14pt er ->cen- >- -- 03706 " 14q21: : 14q32: : 1p13->1p31: : 1p35->- - - 03706 " 1p31: : 1p35->1pter ) ], - 18, - 22( 12)- - - - 03706 " Same as above + f us( 9; 19) (q34;q13. 4) - -- 03706 " ( 3) / s a me a s a bove + f us( 9; 17) ( q34; q25) ( 2) 04352 TT 46, XX,t ( 12;14) (q15; q22)[ 14]/ 46, i dem,del ( 7) -- - 04352 " - - - ( q11q32) [ 1]/ 47, i dem,t ( 1; 3) (p32; p21), - - - 04352 " --+mar cx[1]/44-45,idem,cp[11]/46,XX[1] 03439 TT 44, XX,der ( 1) t ( 1; 2; 4; 6; 11) ( 1qt er- >1p36: : ------03439 " 4q27->4qter),-2,der(4)t(1;2;4;6;11)(4pter------03439 " - - >4q27: : 6q22- >6qt er ) , der ( 6) t ( 1; 2; 4; 6; 11) ------03439 " (6pter::6p12->6q22::2p16->2pter),der(11)------03439 " t(1;2;4;6;11)(11qter->11p15::2q13->2qter),------03439 " t(12;14)(q14-15;q24),-22(15)/44,idem,------03439 " t ( 6; 19)( p12; q13. 2) (1) 14022 TT 46, XX,-1, t (12; 14) ( q14; q24) , +r ( 15) 14022 " - - -/ 46, XX,t( 12;14) (q14; q24)( 1) 14022 " ---/46,xx,-1,+3,t(12;14)(q14;q24),r aca(1) 14034 TT 46, xx, del ( 7) ( q22q32) , t (12; 14) ( q14; q24) (17) 06140 TT 46,XX,t(14;12)(12;21)(q24;q15p11;q21)------06140 " ( 13) / 46, XX,del (7) ( q11. 23q34) ( 2)/ 46, XX(4) ------06140 " - - -- / 46, XX,t ( 3;9) ( p10; q10) (1) 09053 TT 46, XX(1) / 46, XX,der (7) del ( 7)( q21q31)del (7) ------09053 " -----(q31q31) or del(7)(q21q31),t(12;14)------09053 " -----(q14-q15;q23-q24)(14) 09053 TT 46, XX,del ( 7) ( q22) , t ( 12; 14) (q14-15; q24) [38] -- 09053 " - - -/ 46, i dem,del( 1) (q32)[ 2] /46, idem,del (1) - - 09053 " - - -( q32) , t (2; 8)( q13; q24) [ 2]/ 46, i dem,del ( 1) -- - 09053 " - - -( p32) , - 1, - 3, - 10, - 11, +mar1, +mar 2, +mar3, - -- 09053 " - - -+mar4 cx[ 1] /45, i dem,del (1) ( q32) , t ( 2; 8) - -- 09053 " - - (q13; q24), - 21[ 1] / 45, XX,del ( 1)( q32) , - 13[ 1]

- 56 -

cDNA Synthesis from Frozen Tissue Samples

Tissue samples were pulverized under liquid nitrogen using a mortar and pestle, then suspended in TriReagent (Molecular Research Center, Inc., Cincinnati, OH). RNA extraction was carried out according to the manufacturer’s protocol. One microgram of total RNA from each sample was treated with DNase I (Gibco-BRL Life Technologies,

Gaithersburg, MD) to remove any residual genomic contamination. The resulting mixture was then used for cDNA synthesis using the SuperScript First-Strand

SynthesisSystem for RT-PCR (Gibco-BRL Life Technologies, Gaithersburg, MD). For relative RT-PCR, reactions were primed with random hexamers according to the manufacturer's instructions. For the semiquantitative RT-PCR shown in Figure 19, reactions were primed with oligo(dT) according to the manufacturer’s protocol.

Relative Reverse Transcriptase-Coupled Polymerase Chain Reaction (RT-PCR)

Expression levels of established and novel EST markers were quantitated by relative amplification under multiplex conditions using the quantumRNA 18S system (Ambion,

Austin TX). This system uses attenuated amplification of the 18S ribosomal RNA as a relative amplification control, allowing quantitative determination of gene-specific transcript levels by normalization to this internal control. Gene-specific primers used were as follows: A15, 5'-GCTGCACGCTTAATTGGTTG-3' and 5'-

CAAGAGAGTGCAGGGTAGCC-3'; B6, 5'-CTCCAAGCCCAAGCAAGAATG-3' and either 5'-GGTGAGCAGTCAGTGAGGTGC-3' or 5’-

- 57 - TTGCACTTTGCACACACTGGAT-3’ (latter used only for comparison of B6 expression with HMGA2b); D12, 5'-GAGCTCAAAAGGAGGGTGAAC-3' and 5'-

TTCCTCATTGGGCTCTCTGTA-3'; HMGA2 (exon 1), 5'-

GCAAGACTCAGGAGCTAGCAG-3' and 5'-TTGAGATTGAAAGTGCCTTGG-3';

RAD51L1 (exon 11B) 5'-CAATGGGCACACAGGGAACAG-3' and 5'-

GAGATGCTGGTTGCACATCATG-3'; RAD51L1 (exon 11C), 5'-

GAAAAACAAGGATCCCAGGC-3' and 5'-CTGTTCTGATTCCAGTTGCC-3'; WIF1

5’-CTGCACCATCCAAATTATTG-3’ and 5’-TTTCAGTGCTTTGGGACAGA-3’;

MDM2 5’-AAGGTGGGAGTGATCAAAAGG-3’ and 5’-

CCAGGCTTTCATCAAAGGAA-3’; HMGA2b, 5’-

GAAGCAGCAGCAAGAACCAAC-3’ and 5’-CCAGTGTGTGCAAAGTGCAATA-

3’. For all other markers tested, the previously reported primer sequences were used.

Oligonucleotides were synthesized using an Applied Biosystems DNA Synthesizer model 394 at the University of Cincinnati DNA Core Facility and optimized for amplification in a PTC-200 thermocycler (MJ Research, Waltham MA) using the PCR

Optimization System (Invitrogen, Carlsbad CA) according to the manufacturer's protocol. Following amplification for limited cycles (determined to be in linear range of amplification), transcripts were detected by agarose gel electrophoresis, staining with

SYBR Green I (BioWhittaker Molecular Applications, Rockland ME), and direct scanning on a Storm840 (Molecular Dynamics, Sunnyvale CA) in fluorescence mode.

Results were quantitated using the ImageQuant software package (Molecular Dynamics,

Sunnyvale CA).

- 58 - RAD51L1 EXPRESSION IN RESPONSE TO DNA DAMAGING AGENTS

Cell Culture and Treatment with Genotoxic Agents

Cells were plated in twelve-well plates at an initial density of 0.8 x 105 cells/well for 87MG and Hepa1-6 or 1.2 x 105 cells/well for Hep3B and SV40- transformed fibroblasts. Duplicate plates were prepared for RNA and protein isolations.

After 24 hours, cells were either washed twice with Hank’s balanced salt solution and irradiated in a UV Stratalinker 2400 (Stratagene, La Jolla CA) at the indicated dose or incubated for 3 hours in fresh media . Following treatment, fresh media was provided and cells were grown to the indicated time point. Total RNA was isolated using

TriReagent (Molecular Research Center, Inc., Cincinnati OH) according to the manufacturer’s protocol. For protein isolation, cells were washed once with Hank’s balanced salt solution, then lysed in 100µl of RIPA buffer supplemented 1:1000 with mammalian protease inhibitor cocktail (Sigma, St. Louis MO). The lysate was collected, incubated on ice for 30-60 minutes and centrifuged at 10,000 x g for 10 minutes at 4°C. The supernatant was collected and protein quantitated using the BCA

Assay Kit (Pierce, Rockford IL).

Quantitative RT-PCR

Expression levels of RAD51L1 RNA were quantitated by relative amplification under multiplex conditions as described in the section entitled “Relative Reverse

Transcriptase-Coupled Polymerase Chain Reaction (RT-PCR)” on page 57.

- 59 -

Western Blotting

Polyclonal rabbit antiserum was raised to a peptide corresponding to amino acids 157-169 of Rad51L1 (ESRFPRYFNTEEK) and purified according to the supplier’s protocol (Zymed laboratories, South San Francisco CA). By Western blot, the antibody detected a band of the expected size (39 kDa) which was blocked by the addition of the Rad51L1 C-terminal peptide and was absent from Westerns probed with preimmune serum (data not shown). As a loading control, β-actin was detected on

Westerns using a commericially prepared mouse monoclonal antibody (Sigma, St.

Louis MO). Anti-rabbit and anti-mouse secondary antibodies were obtained commercially (Boehringer Mannheim, Mannheim Germany)

For determination of Rad51L1 protein expression, 10 µg total protein was diluted in Laemmli buffer, boiled for 10 minutes and loaded on a 12 % SDS-PAGE minigel with a 4 % stacking gel. Following electrophoresis, proteins were transferred in

Towbin buffer to Sequi-Blot PDVF membrane (Bio-Rad, Hercules CA) using a Trans-

Blot cell (Bio-Rad, Hercules CA). The membranes were incubated with shaking for 1 hour in 1% blocking reagent (Boehringer Mannheim, Mannheim Germany), followed by addition of primary antibodies (1:500 anti-Rad51L1 and 1:100,000 anti-β-actin in

0.5% blocking reagent) and incubation with gentle shaking overnight at 4°C. After two

10 minute washes in tris-buffered saline with 0.1% Tween-20 (TBST) and two 10 minute incubations in 0.5% blocking reagent, membranes were incubated with secondary antibodies (1:20,000 alkaline phosphatase-linked anti-rabbit IgG and

- 60 - 1:10,000 alkaline phosphatase-linked anti-mouse IgG) for one hour at room temperature. Four 15 minute washes in TBST were performed, followed by detection using the ECF Vistra reagent (Amersham, Piscataway NJ) and the Storm 840

(Molecular Dynamics, Sunnyvale CA) in fluorescence mode. Quantitation was performed using the ImageQuant software package (Molecular Dynamics, Sunnyvale

CA).

- 61 - Chapter 3: Rad51-Like Gene 1 (RAD51L1) is Disrupted by

t(12;14)(q15;q24) in a Uterine Leiomyoma1

INTRODUCTION

Leiomyoma is a benign tumor of smooth muscle which occurs most frequently in the uterus and is diagnosed in 20 to 50% of women of reproductive age [2].

Approximately 20% of uterine leiomyomas (ULs) show a recurrent chromosomal translocation, t(12;14)(q15;q24.1) which is often the sole detectable cytogenetic aberration [39], suggesting that it may represent an early event in the pathogenesis of leiomyoma. The consistent involvement of specific regions of chromosomes 12 and 14 in karyotypic changes in leiomyoma and related tumors has led to considerable speculation on the presence of genes with tumorigenic potential in these genomic regions [40,50]. Other investigators have previously reported the cloning of a 450 kb multiple aberration region (MAR) on chromosome 12 within which several t(12;14) breakpoints have been shown to map, and implicated the high mobility group protein C

(HMGIC) gene in leiomyoma and other tumors of mesenchymal origin [74,101].

Relatively little is known about the region of chromosome 14 involved in t(12;14). We previously reported the isolation of DNA clones spanning the breakpoints

1 This chapter has been previously published as “hREC2, a RAD51-like Gene, is Disrupted by t(12;14)(q15;q24.1) in a Uterine Leiomyoma,” by S. Ingraham, R. Lynch, S. Kathiresan, A. Buckler, and A. Menon, Cancer Genetics and Cytogenetics, Volume 115, Number 1, Nov. 1999, pp. 56-61. The text of the introduction, results and discussion sections are reproduced here revised only for consistency of figure and reference numbering. Figures and references have been renumbered consecutively with the remainder of this thesis. The materials and methods section of the paper has been incorporated into chapter 2. Note that hREC2 has been subsequently renamed RAD51L1.

- 62 - on chromosome 14 of three uterine leiomyomas [72], and the identification of several expressed sequences that mapped within these clones [73]. One of these expressed sequences, hREC2 [130], is a putative member of the RAD51/52 family of double strand break repair enzymes, which play a key role in DNA recombination. A 1.8 kb hREC2 cDNA sequence (Genbank accession #U92074) has been shown to be expressed in all tissues tested, although the detection of transcripts of other sizes suggested that there are alternative splice forms [130]. We have previously shown that hREC2 is localized within the leiomyoma breakpoint cluster region (BCR) on chromosome 14

[73]. Here, we show that the genomic structure of hREC2 is interrupted by t(12;14)(q15;q24.1) in a UL. This translocation results in the loss of a 656 base pair (bp) exon that contains five carboxyl-terminal codons and the entire 3’ UTR of the ubiquitously expressed hREC2 isoform.

RESULTS

Physical mapping and exon trapping from 14q24.1 resulted in the identification of sequences corresponding to hREC2. This gene was first described by Rice and coworkers [130] as a human homolog of the Ustilago maydis recombinational repair gene REC2, and a nearly identical cDNA sequence (hRAD51B) was reported by Albala et al. [131]. Cartwright and coworkers [132] subsequently reported the identification of a novel gene, R51H2 (Genbank Accession #Y15571), with DNA sequence identical to the hREC2 cDNA in the 5' untranslated region (UTR) and the majority of the hREC2 open reading frame (ORF), but different in the last five codons of the ORF and the entire 3' UTR. We have obtained isoforms of hREC2 from lung, uterus and testis

- 63 - cDNA. While these isoforms have been named for the tissues in which they were first identified, their expression does not appear to be limited to those tissues (data not shown). The lung isoform, hREC2L, is a 1.8 kb transcript that encodes a 350 amino acid protein and is identical to hRAD51B.

3’ RACE performed on cDNA from UL GM10964 did not yield a t(12;14) fusion gene transcript, as initially expected. Rather, a novel isoform of hREC2, hREC2U was identified. The nucleotide sequence of hREC2U is identical to hRAD51B up to nucleotide 1090 of the hRAD51B sequence. The 3’ end of the ORF and the entire

3’ UTR of hREC2U are unique (Figure 9). The inferred amino acid sequence is likewise identical to hRAD51B up to amino acid 345, after which hREC2U encodes three unique residues before a termination codon is reached (Figure 10).

The hREC2T isoform has a short 5' UTR (31 nucleotides) that is distinct from hRAD51B, hREC2U and R51H2, as well as a unique 3’ end (Figure 9). The inferred amino acid sequence of hREC2T is identical to hRAD51B up to amino acid 252, after which hREC2T encodes two unique residues before it is truncated (Figure 10). Southern blot analysis (data not shown) using the unique 3’ end of hREC2T as a probe against genomic, monochromosomal hybrid, and cloned DNA from 14q24.1 localized the 3' end of hREC2T to the same chromosomal region where hREC2, hRAD51B, and R51H2 have previously been mapped [130-132]. A BLAST search using the 3' hREC2T sequence did not yield significant nucleotide similarity to any sequences in the combined GenBank + EMBL + DDBJ + PDB nonredundant database.

Amino acid sequence features shared by all known isoforms of hREC2 (Figure

10) include a bipartite nuclear localization signal [159] and a consensus ATP binding

- 64 - Figure 9: Nucleotide alignment of RAD51L1 isoforms.

Nucleotide alignment of uterus (hREC2U) and testis (hREC2T) isoforms with previously reported hRAD51B and R51H2 sequences. Dots indicate sequence identity with hRAD51B; thick box indicates presumed start site; thin boxes indicate presumed termination codons; arrow indicates apparent truncation site of hRAD51B in leiomyoma

GM10964.

- 65 - Figure 10: Amino acid alignment of RAD51L1 isoforms.

Alignment of uterus (hREC2U) and testis (hREC2T) inferred amino acid sequences with previously reported hRAD51B and R51H2

sequences. Dots indicate sequence identity with hRAD51B; box indicates ATP binding motif; boldface indicates bipartite nuclear

localization signal; arrow indicates apparent truncation site of hRAD51B in leiomyoma GM10964. -66-

site, a highly conserved feature of the prokaryotic recombinase enzyme RecA and its eukaryotic homologs including RAD51 [160].

A BLAST search of the non-redundant nucleotide database using 3’ UTR sequence from hREC2 isoforms resulted in the identification of a bacterial artificial chromosome (BAC135h17; GenBank accession #AC004518) that contained the exons encoding the unique 3' ends of hRAD51B, hREC2U and R51H2, as well as a shared internal exon (Figure 11). The availability of genomic sequence contained in this BAC allowed the precise location of the 3’ exons of the hREC2 isoforms to be determined relative to the t(12;14) breakpoint identified and sequenced from the UL GM10964

[73]. Comparison of the BAC135h17 sequence to the sequence of this breakpoint

(GenBank accession #AF044776) showed that the breakpoint on chromosome 14 is located at nucleotide 24704 of the BAC sequence (Figure 12). This particular translocation, therefore, results in the loss of the 3' hRAD51B exon (nucleotides 39096-

39755 of the BAC135h17 sequence) with retention of the 3' R51H2 exon (nucleotides

19639-20083) on der(14) in GM10964 (Figure 12). The exons encoding hREC2T are not within BAC135h17, but PCR mapping (see below) shows that the hREC2T 3’ end is also retained on the der(14) chromosome.

To confirm that this translocation breakpoint disrupts the hREC2 gene within the 19 kb intron between the 3’ ends of the R51H2 and hREC2 transcripts, PCR mapping of the 3’ ends of the hRAD51B, R51H2, hREC2U and hREC2T isoforms was performed on DNA from normal and translocated chromosomes. Results are shown in

Figure 13. As predicted from the sequence data and confirmed by PCR, the der(14) from the t(12;14) leiomyoma translocation in UL GM10964 lacks the exon which

- 67 - Figure 11: Location of a leiomyoma t(12;14) breakpoint relative to RAD51L1 exons.

Genomic structure of the 3' end of the hREC2 gene contained on BAC135h17. Solid line, BAC135h17; boxes, hREC2 exons;

dotted line, hRAD51B splicing; dashed line, R51H2 splicing; solid line, hREC2U splicing; white arrow, location of t(12;14)

leiomyoma translocation breakpoint in GM10964. The hREC2T 3’ exon and the shared exons which form the 5' UTR and the

majority of the ORF lie upstream (to left of figure) of the exons in the diagram. The scale at the bottom indicates distance in

kilobases from the 5' end of the 135h17 sequence. The 3' hRAD51B exon (white box) extends from nucleotides 39096-39755 of the

-68- BAC135h17 sequence; the 3' R51H2 exon (striped box) is nucleotides 19639-20083; the 3’ hREC2U exon (black box) is

nucleotides 12513-12778; the shared internal exon (gray box) is nucleotides 10162-10240. t(12;14) breakpoint

135h17

shared 5’ exons hREC2U hRAD51B R51H2

5 10 15 20 25 30 35 40 kb

Figure 12: Alignment of the GM10964 chromosome 14 breakpoint with BAC 135h17 sequence.

Sequence alignment of GM10964 translocation breakpoint with chromosome 14 genomic sequence contained in BAC135h17.

der(14), GM10964 translocation breakpoint sequence on derivative chromosome 14; 135h17, BAC135h17 sequence; upper case

letters, chromosome 14 sequence; lower case letters, chromosome 12 sequence; dots, sequence identity with der(14); -, single

nucleotide gap in sequence; numbers at the right indicate nucleotide position number of the corresponding Genbank files

(Accession numbers AF044776 [der(14)] and AC004518 [BAC135h17]).

-69-

der(14) TTTT-CCATGTTTTATTTTCAATATCATCACCATCACTTTTATCCCGTGGCTGTGAAAGGACTTTCTTCATTCCACTCCAGAATTCAAAGAGGCTTCTTT 635 135h17 ....T...... T...... 24653

der(14) TGCACAAATGGAGGGAAGGCACTCATCACACTTCTCAGCCAAACATCCTAgaatggaagaaggcacatgaacactgataacacatggaactctgactcag 735 135h17 ...... AGTGTGAGAGAAAACACACTGCCTACTTCTGAATTTCGGTGAGGGCAGGG 24753

der(14) ctggcatactcacttctggagtttttgttttgtcactatcttgttgataaagcgtcagtacctttgcaccaactatcaagtaatttacaaactccttagt 835 135h17 TTCAGATGGAACACATATTTTCCAAAACTCCAAATAGATCTGGGAGGAGAGGAAACCATTAAATCACTAGACATAAGTCAGGACACATTTGGTTTTGTTC 24853

Figure 13: t(12;14) disrupts the RAD51L1 gene in UL GM10964.

Polymerase chain reaction amplication with exon-specific primers. Templates for amplification were: neg, negative control (dH2O); human, human genomic DNA; wt(14), normal human chromosome 14 monochromosomal hybrid (in murine background); mouse, murine genomic DNA; der(14), derivative chromosome 14 from human leiomyoma GM10964 (in murine background). The positions of 123 or 200 bp

DNA markers are indicated to left of the figure. The specific isoform amplified is indicated to the right of the figure. mouse wt(14) der(14) neg human

123 hRAD51B

200 R51H2

123 hREC2T

123 hREC2U

- 70 - encodes the 3' end of the ORF, the stop codon, and the entire 3' UTR of hRAD51B.

DISCUSSION

Double-strand DNA breaks (DSBs) occur in a number of natural cellular processes including DNA replication, meiotic recombination and immunoglobulin gene rearrangement. DSBs are also induced by genotoxic agents such as biradicals, high energy radiation and reactive oxygen species (reviewed in [135]). Therefore, the DSB repair enzymes, which include RecA in prokaryotes (reviewed in [161]) and the

RAD51/52 gene family in eukaryotes (reviewed in [162]), play a critical role in the maintenance of genomic integrity.

hREC2 shows sequence similarity to the human RAD51 gene and has been speculated to play a role in surveillance of the genome [130] or in meiotic recombination and/or recombinational repair. Four distinct isoforms of this gene, hRAD51B, hREC2U, hREC2T and R51H2, have now been described. Each hREC2 isoform has a unique 3’ end encoded by different exons with in leiomyoma t(12;14)

BCR on 14q24.1.

Translocation (12;14)(q15;q24.1) is one of the most common cytogenetic changes observed in leiomyoma [39]. Other chromosomal abnormalities, including +20,

-22, i(17q10), formation of ring chromosomes and a high frequency of nonrandom telomeric associations, are also identified in these ULs, although these aberrations are thought to occur subsequent to the t(12;14) alteration [46,163]. We have shown in this report that t(12;14) in the uterine leiomyoma GM10964 disrupts the genomic structure of the hREC2 gene, resulting in the loss of the exon encoding the 3’ end of the

- 71 - predominant transcript of this gene. It is tempting to speculate that such a disruption of a DNA recombination/repair gene by chromosomal translocation might be an important step in the early pathogenesis of leiomyoma. However, given that a normal allele of hREC2 is still present in tumors and that other isoforms of the gene may be expressed normally from the translocated chromosome, further investigation of the functions and relative abundances of the various isoforms in normal and tumor cells is needed. We have, as yet, been unable to detect expression of a fusion gene resulting from the t(12;14). We speculate that alteration of the relative expression levels of the various hREC2 isoforms may be a more significant effect of the translocation. Although, to date, we have shown that hREC2 is directly interrupted by a translocation breakpoint in only one case, translocation breakpoints previously characterized [73] in two other leiomyomas map within the BCR that contains this gene, and could affect its expression through alteration of chromatin structure of the translocated chromosome.

- 72 - Chapter 4: Mapping of Additional UL Chromosome 14 Breakpoints

Relative to RAD51L1 and the GM10964 Breakpoint

Recent reports from our laboratory and others [124,133,164] have shown that the RAD51L1 gene is disrupted in several t(12;14)(q15;q24) ULs. In each of these reported cases, the exon encoding the C-terminus and 3’ UTR of a uterus-specific isoform, RAD51B-11c [124], is removed by the translocation. Exon 11c encodes a putative membrane anchor domain, and transcripts containing this exon have not been detected in any tissues or cell lines except uterus [124]. In some t(12;14) UL cases, additional RAD51L1 exons which lie 5’ of the uterus-specific exon 11c are also translocated. Fusion transcripts with HMGA2 have been identified in a few primary tumors and tumor-derived cell lines [124,164]. Schoenmakers and colleagues [124] proposed that in t(12;14) ULs, allelic knockout of the uterus-specific RAD51L1 transcript acts in conjunction with quantitative or qualitative dysregulation of HMGA2 expression to generate the tumor phenotype.

In addition to the GM10964 breakpoint discussed in Chapter 3, our laboratory has previously characterized the t(12;14)(q15;q24) chromosome 14 breakpoints in two other uterine leiomyomas by high resolution physical mapping [72,154]. The breakpoint in UL ST90-32379 lies within the region of overlap between YAC clones 958C2 and

927A12, and is contained within BAC clone 128L13. The breakpoint in UL ST91-

21874 lies within YAC clone 927A12 but outside 958C2; this genomic segment is delimited by inter-Alu STS markers h14a1255.34 and h14a1273. As shown in Figure

- 73 - 14, the fifteen exons of RAD51L1 span approximately 800 kb on 14q24. Using currently available human genome data (http://www.celera.com), the STS markers used to characterize the YAC and BAC clones discussed above were also placed on the Celera genome map. This allowed an estimation of the positions of the t(12;14) UL breakpoints relative to the RAD51L1 gene and a better estimation of the size of the chromosome 14

BCR. As indicated in Figure 14, the ST90-32379 breakpoint lies at least 144 kb and not more than 687 kb telomeric of the 3’ end of RAD51L1. The ST91-21874 breakpoint lies between 577 and 1039 kb telomeric of the 3’ end of RAD51L1. Unlike the breakpoint in

GM10964, therefore, t(12;14)(q15;q24) does not directly disrupt RAD51L1 in either

ST90-32379 or ST91-21874. These data also revise the estimate of the size of the chromosome 14 BCR to between 706 and 1168 kb.

- 74 - Figure 14: Physical Map of RAD51L1 and the Chromosome 14 Breakpoints in Three Uterine Leiomyomas

STS markers (black boxes) and RAD51L1 exons (white boxes) were mapped to the Celera human genome database. Centromeric

(CEN) and telomeric (TEL) orientation is indicated. Positions of previously characterized YAC and BAC clones [72,154] are

shown by white bars, with dotted lines indicating the maximum possible extent of the YAC and BAC ends based on prior

hybridization or PCR analysis. GM10964 [73] and two other t(12;14) UL breakpoints are shown. Bar (lower left) indicates scale. h14a1255.34 AFMb315yf5 D14S1069 h14a1864 h14a1573 h14a1571 h14a1273 h14a793 h14a389 h14a849 h14a232 h14a322 WI-4429 WI-9383 WI-8432 WI-8506 WI-8921 WI-3981 FB3D3 IB526 -75-

CEN TEL RAD51L1 exons 1-7 8a 8b 9 10- 11c

927A12

958C2

128L13

ST91-21874 GM10964 ST90-32379

100 kb

Chapter 5: Identification of Novel Transcripts Overlapping HMGA2

Which Are Overexpressed in Uterine Leiomyomas2

INTRODUCTION

Leiomyoma is a benign tumor of mesenchymal origin most frequently seen in the uterus. Uterine leiomyomata (ULs) occur in at least 20 to 50% of women of reproductive age [2]. They are associated with significant morbidity, including severe menorrhagia, anemia, pelvic pain, urinary incontinence, spontaneous abortion, and infertility [29].

A variety of nonrandom cytogenetic changes have been reported in UL. The most common karyotypic abnormalities have been assigned to four major subgroups.

These are: deletions on the long arm of chromosome 7, reciprocal translocations involving the long arms of chromosomes 12 and 14, rearrangements of the short arm of chromosome 6, and trisomy 12 [40]. The balanced translocation involving chromosomes 12 and 14 represents approximately 20-25% of karyotypically abnormal

ULs [42]. High resolution cytogenetic mapping of this recurrent chromosomal translocation (Figure 15A) allowed the localization of the breakpoints to 12q15 and

14q24.1 [44]. Both of these cytogenetic subbands have also been implicated in other benign mesenchymal tumors. Chromosomal translocations involving 12q13-q15 have

2 This chapter is a preliminary draft of a manuscript being submitted for publication. The text of the introduction, results and discussion are included here, revised for consistency of figure and reference numbering. The materials and methods section of the manuscript has been incorporated into Chapter 2.

- 76 - Figure 15: The t(12;14)(q15;q24) balanced reciprocal translocation and the chromosome 12 breakpoint region

A. The t(12;14)(q15;q24.1) balanced, reciprocal translocation, indicating breakpoints

as mapped by Pandis and colleagues [44]. Regions of wild type chromosomes

involved in the translocation are indicated by a horizontal band. Derivative

chromosomes 12 [der(12)] and 14 [der(14)] are also shown.

B. Positions of novel transcripts embedded within the HMGA2 gene. Position of the

locus on chromosome 12 and within the 445 kb UL breakpoint cluster subregion of

the multiple aberration region (MAR) [74] is indicated. White boxes and arrow

represent HMGA2 exons and line indicates HMGA2 introns (not drawn to scale);

gray arrows show positions and orientations of novel transcripts embedded within

the HMGA2 gene.

C. Relative positions of HMGA2 (white boxes); novel transcripts A15, B6, and D12

(diamonds); ESTs stSG28071, H78365 and sts-T87743 (ovals); and UL breakpoints

(stars for molecularly cloned breakpoints, bars or arrows for breakpoints mapped by

fluorescence in situ hybridization [FISH]) previously reported by (a) Schoenmakers

et al., 1995 [74], (b) Lynch et al., 1998 [73], and (c) Schoenberg Fejzo et al., 1996

[125]. White highlights the domain where significant tumor-associated increases in

transcript expression were detected; dark gray highlights domains where no

significant alterations in expression were found; light gray indicates domains where

no expression markers could be identified.

- 77 - Figure 15 A & B

A 12 14 der(12) der(14) 14p13

12p13.31 14p11.2

12p12.1 14q12

12q12

12q13.13 14q22.1 t(12;14)(q15;q24.1) 12q15 14q24.1

14q31.1

12q22

12q24.11 14q32.33

12q24.31

B

Chromosome12

Subregion of MAR 445 kb

HMGA2 gene 1 2 3 4 5

A15 D12 B6

- 78 - Figure 15 C

C 0.5 Mb

HMGA2

A15

B6

D12

stSG28071

T87743

H78365

LM-100a

LM-30.1a

LM-67a

LM-609a

LM-65a

LM-5.1a

LM-608a

GM10964b

ST90-194c

ST93-738c

ST92-224c

ST94-114c

ST89-171c

ST93-165c

- 79 - also been described in lipomas, pleiomorphic adenomas of salivary gland, and other tumors of mesenchymal origin [49], and recombinations involving 14q24 occur in pulmonary hamartomas [50].

Fluorescence in situ hybridization (FISH) and physical mapping led to the identification and subcloning of the segments of 12q15 [57,71] and 14q24.1 [72,73] within which the translocation breakpoints of several uterine leiomyomata map. On chromosome 12, the UL breakpoints, as well as 12q15 translocation breakpoints of a panel of lipomas and pleomorphic salivary gland adenomas, span a 445 kb interval within a 1.7 Mb domain designated the multiple aberration region (MAR), between sequence tag sites RM33 and RM98 [57,74]. UL breakpoints are widely distributed, spanning this entire 445 kb segment [74]. The breakpoint cluster region (BCR) of chromosome 14 is of comparable size, with UL breakpoints spanning at least 400 kb

[73]. Such a broad distribution of breakpoints on both chromosome partners is unusual in neoplasm-associated translocations. The consistent involvement of specific regions of chromosomes 12 and 14 in karyotypic changes in leiomyoma and related tumors led to speculation that genes with tumorigenic potential are present in these genomic regions

[40,50].

The chromosome 12 MAR contains the gene for the high mobility group protein

A2 (HMGA2; formerly HMGI-C), a DNA-binding, non-histone component of chromatin (Figure 15B). This gene is qualitatively or quantitatively altered by the chromosomal translocations in a subset of uterine leiomyomata, lipomas, and other benign mesenchymal tumors [74,101,108,111,117,165].

- 80 - Normal expression of HMGA2 exhibits a distinct developmental course. Early in embryogenesis HMGA2 is expressed in all tissues; it becomes restricted to mesenchymal derivatives, parts of the central nervous system and some epithelial cell layers later in development [107]. HMGA2 is not expressed appreciably in most adult tissues, although it is detectable by RT-PCR in normal adult human lung and kidney

[108] and in normal and osteoarthritis-affected synovia [109].

While the expression pattern of HMGA2 suggests tight regulatory control of the locus, few of the regulatory mechanisms or elements have been identified. HMGA2 utilizes several alternative tandem sites of transcription initiation [113,114], leading to multiple transcripts of varying size. Transcription factors Sp1, Sp3 and CTF/NF-1 have been implicated in transactivation of the promoter [114,115]. Ayoubi and coworkers

[113] found evidence that HMGA2 is regulated at the transcriptional level by a constitutively active promoter in the 5’ flanking region which can be repressed by negative regulatory elements that lie outside the 1.3 kb promoter region.

The pathogenic relevance of this gene in UL is enhanced by the association of a closely related gene, HMGA1 [formerly HMGI(Y)], with another cytogenetic subset of

ULs which carry aberrations involving 6p21 [118]. HMGA2 and the two protein products of HMGA1, HMGA1a (formerly HMGI) and HMGA1b (formerly HMGY), are architectural factors in the nuclear scaffold, binding preferentially in the minor groove of AT-rich DNA sequences [101]. A role for these genes in cell proliferation was initially suggested by their expression in embryonic and neoplastic cells [102,111], and by the dwarf mutant mouse phenotype pygmy, which is associated with complete inactivation of the HMGA2 gene [121]. HMGA2 plays a critical role in adipose tissue

- 81 - development and has been implicated in obesity [122]. Truncated and chimeric forms of

HMGA2 which retain the DNA-binding AT hook motifs have weak transforming activity in NIH3T3 cells, but wild-type HMGA2 is not transforming and confers no growth advantage over mock-transfected cells [126]. Mice transgenic for a truncated form of HMGA2 under the control of an MHC class I promoter develop lipomas but not leiomyomata or other types of mesenchymal tumors [127]. This limited tumor spectrum, despite ubiquitous expression of the transgene, may be due to species-specific properties of HMGA2 function or could highlight the need for additional aberrant factors in the formation of other tumor types [120].

Thus, whether HMGA2 plays a direct role in UL tumorigenesis is still unknown.

Models of its potential function are complicated by the observation that the relative positions of the t(12;14)(q15;q24.1) breakpoints and the HMGA2 gene varies from tumor to tumor (Figure 15C). The coding sequence of HMGA2 is disrupted in some

ULs, producing aberrant or fusion transcripts [74,111,124]. However, in other tumors there is upregulation of HMGA2 expression which is not associated with alterations in the coding sequence or UTRs [108]. Some UL breakpoints which map more than 100 kb upstream of HMGA2 may disrupt as yet unknown regulatory sequences of the gene

[125].

A normal splice variant of HMGA2, HMGA2b, has recently been identified

[110]. This splice variant is co-expressed in most tissues and cells which express

HMGA2. HMGA2b contains exons 1-3 spliced to a novel exon located between exons 3 and 4. Thus, the novel transcript encodes an HMGA2 protein which retains the DNA binding domains but lacks the spacer and the acidic domain. It is possible that aberrant

- 82 - expression of this splice variant could account for tumorigenesis in cases where the

HMGA2 gene remains intact.

Chromosomal region 14q24 is the most frequent translocation partner of 12q15 in UL. Our laboratory [73] has previously identified several expressed sequences that mapped within the chromosome 14 BCR. One of these expressed sequences, RAD51L1

[130,131], is a putative member of the RAD51/52 family of double strand break repair enzymes. Reports from our laboratory and others [124,133] have shown that the

RAD51L1 gene is directly disrupted in several t(12;14) ULs. In certain UL tumors and tumor-derived cell lines, HMGA2/RAD51L1 and/or RAD51L1/HMGA2 fusion transcripts have been identified [124,164].

Previous studies [73,74] have shown that the breakpoints of t(12;14)(q15;q24.1) span large genomic regions (nearly 0.5 Mb) on each of the involved chromosomes, raising the question of how the translocation causes long-range structural or regulatory alterations affecting gene expression from loci on one or both translocation-derived chromosomes. Here, we show that the effect of the translocation is not limited to

HMGA2 and RAD51L1. We have identified three novel transcripts embedded within the

HMGA2 gene on 12q15 (Figure 15B). The expression of these transcripts is significantly increased in tumors carrying translocations involving 12q15 and 14q24 compared to control tissue. We also show that a domain of overexpression extends as much as 500 kb on chromosome 12 but does not extend to genes on chromosome 14.

- 83 - RESULTS

Identification of Novel Expressed Sequences

A putative exon sequence obtained by exon trapping from 12q15 clones (B6; bold type in Figure 16A) showed 100% homology to a partial cDNA clone in the EST database (Genbank Accession #AA501802). PCR primers were designed from the B6 sequence and reverse transcription-coupled polymerase chain reaction (RT-PCR) analysis showed the presence of this transcript in total RNA isolated from normal human uterus, pancreas, kidney, and three of three t(12;14) uterine leiomyoma tumors tested (data not shown). 5’ and 3’ rapid amplification of cDNA (RACE) experiments were performed from UL cell line GM10964, which resulted in a 1 kb composite sequence (Figure 16A) which included a 3’ UTR, polyadenylation signal and polyA tail.

There are two open reading frames (ORFs) which overlap the start of our partial cDNA sequence. Additional 5’ extensions will be needed to determine which, if either, of these represent a protein encoded by this transcript. BLAST searches with each predicted peptide sequence resulted in no significant hits against the available databases of reported proteins. A second 3’ RACE product was obtained from GM10964 which was found to be a fusion of chromosome 12 and chromosome 14 sequences; it contained the same B6 trapped exon (bold type in Figure 16A), a different, 151 nt downstream exon which mapped to chromosome 12, and a 150 nt segment from chromosome 14 immediately adjacent to the previously cloned breakpoint of GM10964 [73] and containing a consensus polyadenylation signal. All intron-exon boundaries derived from the B6 RACE products matched well with previously reported

- 84 - Figure 16: Partial cDNA sequences of novel transcripts embedded within HMGA2

A. B6 partial cDNA sequence with translations of two partial ORFs indicated.

Boldface indicates exon initially cloned by exon trapping from BAC 25m16.

B. A15 partial cDNA sequence with translation of a 92 codon ORF indicated

C. D12 partial cDNA sequence with translation of a partial ORF indicated.

A ITGSFHYLVAHRRICWSGFLFCFVLL HNWIFPLLGSTQEDLLEWFFVLFCSA B6 1 tcataactggatctttccattacttggtagcacacaggaggatttgttggagtggttttttgttttgttttgttctgcta

LLSKIASStop TIKQDCFIILStop B6 81 ctattaagcaagattgcttcataatcctttaagggttttttttagccaagtcttatttacatatcctggccagcaagcac B6 161 gtgattaacccaaggatgttggagggaaggcagatgctacatctgaaaaaaatctgattatgtttcattctggagataca B6 241 aacagccgagctgtcaaaaggacaacagtctcttgggccaacatgacaccaaactctcaaactctggagaccctcagaga B6 321 caaggaggaggagctgctgagttcaaacaagaacaatgaattcctcaagcccaagcaagaatgtgacaaggtgtcaacaa B6 401 agccaaccaggaaggtgatgtatggcccataaatcacttcacaaaccagggctgcaaagaaagcacccagcaacccagag B6 481 ccccgagtgtgagttttttctactcctaaaccttcacaccccccacatccaccctcctccagcacctcactgactgctca B6 561 cctgtcactcctccactgaccaattggcctactcatggggtgataaatgagatctatgaaactgtaaaggataaattctt B6 641 actcttattcccaacaagctggtgtcaacaataatgcatacaaggaagaaaacataattgaaaaattagtacaaatttgc B6 721 ttctgttttattgtccactcattcagcagatgtttatccagtgtgtgcaaagtgcaatagtaggctatagagagataaaa B6 801 aacaaaatctcactaactgtgggccattaattggcatacctcaaactgccctatattgttacctaccttttttggtgtct B6 881 gatttttgaattccataaggacagcgaccatatgttaaacctccatgtgtgcctgctcttttcagtcatctaataaatga B6 961 ttctgccattattgttaaaaaaaaaaaaaaaaaaa

B A15 1 tgatgaacgtcctcaatgaaaattcgcatcccatttagagaattcgggaaggttccctgcaagcttctgtgggaccacta A15 81 gcaccagtgggcacatcgagagcaaacacatcggagacaaatttttctttctttgtgaactctgccttaactcaaaggta A15 161 aagtatccaatcacctccagaccccattgtaatttcttttccattttttttttttttggagggagggcaattagtgagtt

MRC A15 241 agaactgggtggcgggtgggaaacaagtgggggagggcagagacttcctgggaggtgtaaaacaggattcaaatgcggtg

KVSLGQSGKTQGPLDRLVSFDDFKKV A15 321 taaagtgtcgcttgggcagagcgggaaaactcaggggcctctagatcggcttgtttcctttgatgatttcaaaaaggtac

QLSIFLKCTGKQTLFSFPTLLSDNFGT A15 401 aactctcaatttttctaaaatgcactggcaagcaaacattgttcagtttccccaccttgctctcggacaactttgggact

LGLFSNRRVCHEGSDLRLSREQVLKPE A15 481 ctaggattattttctaatcggcgtgtttgccatgaaggaagcgatttaagactaagcagagagcaagttttaaagcccga

KVEFKCSQStop A15 561 gaaagtggagtttaaatgttctcaatagacatatcccgctccaactctgcccgccgcggcttggaaattacagcgaacaa A15 641 aacccccagccctgcgcgctgagcgcagctctgcaagcgccggctgcacgcttaattggttgcatccgcagacaaaaccc A15 721 tccactccgcagggtcccgggcgcccctcgatcgtcccctactcaacccccggccactggccttggagaagagcatttaa A15 801 tggctgcagctctgaggcgcgagatccaggggcaaaagggggaccgggcccctgacaaggaagcgaccctggctaccctg A15 881 cactctcttggacactcctttcaacgcgcccttagctgggcgagttaaccccgtcctgcggggaaccaggctccccgtag A15 961 cccctgccccgggctccctccggcggccgccgcatatttaaagagcccaaaaaggaccaggcaaaaaaaaaaaaaaaaaa C RPGHLSSLQMKKVSDSKNStop D12 1 gtcgacctgggcatcttagctcactgcaaatgaaaaaagtttcagactcaaagaattaacaatttaaccactagtttccc D12 81 cttgagatgttactgtcacaagagatccttacatttccagtggcattcaacagattctcctctttagtgaggacagctgc D12 161 agaaagttactgagtatttgctccctctcagatgcataaagattattttgtaagcaatgttggagaaagaaagagctcaa D12 241 aaggagggtgaacatcagaagaaaaaagggacagatctacaaggtgcttgtgacatctgttttcactttgtgctgtggcc D12 321 agtggcagagtggaagaccaacctttaatcaacttagcaacatggtgcccatgtccagttattcaagtgcttagtaaata D12 401 ctgttacagagagcccaatgaggaatgtgggtcttctgggaatgtgtaagaaagaaaaggcacgttcttaccctcgagat D12 481 gcttatagtcctgttcagatgacaagctctatgtgttaatacgttaattcagatcttttcctcacttccttcaaaactcc D12 561 atccaaagttcttctcctgcaggcagccttacggctctgactaatagc - 85 - splice junction consensus sequences [166]. The 151 nt alternative exon from chromosome 12 is contained within a predicted gene (Genbank Accession

#XM_096571). Attempts to extend the sequence further 5’ to the sizes observed on

Northern blots (see below) have been unsuccessful. Analysis of a skeletal muscle cDNA library (Clontech, Palo Alto CA) yielded only one partial clone which did not extend any further 5’ than the sequence shown in Figure 16A.

Comparison of the available HMGA2 intron sequences (Genbank Accession

#L41044) with dbEST identified a partial cDNA clone (975A15, Genbank Accession

#W86975, referred to hereafter as “A15”) that maps within intron 1 of HMGA2. 5’ and

3’ RACE experiments were performed, resulting in the 1kb composite sequence reported in Figure 16B. RACE experiments have failed to yield further 5’ extension products, and A15 was not represented in a commercially-obtained skeletal muscle cDNA library (Clontech, Palo Alta CA). The available cDNA sequence contains a small

(92 codon) ORF indicated in Figure 16B. A BLAST search with this predicted peptide sequence resulted in no significant hits against the non-redundant database of reported proteins. Comparison of the composite A15 sequence to human genome data confirmed mapping of A15 within intron 1 of HMGA2.

Another STS marker (D12S1521; UniSTS:18688) lies within the third intron of

HMGA2. RT-PCR showed the presence of a transcript corresponding to this STS in poly-A+ RNA from normal myometrium and UL tumors. Northern blots of multiple normal human tissues (see below) confirmed that this represented a transcript distinct from B6 or A15. For convenience and consistency with the other novel cDNAs, this transcript is referred to hereafter as D12. RACE and cDNA cloning experiments have

- 86 - not been successful in extending this sequence beyond the 195 bp of the RT-PCR product, the sequence of which is shown in Figure 16C. This sequence contains a partial

ORF, as indicated.

Expression Patterns of Novel Transcripts A15, B6, and D12 in Human Tissues

Northern blot analysis (Figure 17) shows that A15, B6, and D12 have patterns of expression in normal tissues that are distinct from each other and from HMGA2, indicating that regulation of expression from this region is complex. A15 (Figure 17A) is detectable only in skeletal muscle, as a 1.6 kb transcript. B6 (Figure 17B) is expressed at the highest levels in skeletal muscle, where a 6.3 kb transcript is present.

RT-PCR analysis indicates that B6 is also expressed in normal pancreas and kidney

(data not shown).

Available D12 sequence does not include a complete open reading frame, polyadenylation signal, or polyA tail. With minimal information thus available to orient the D12 cDNA sequence and identify the sense and antisense strands, we chose to probe the multiple tissue Northern blot with oligonucleotide probes corresponding to each strand of the cDNA (identical to the D12S1521 PCR primers) rather than with a cDNA fragments as had been done for A15 and B6. As shown in Figure 17C and D, bands were detected with the reverse but not the forward oligonucleotide probe, confirming the orientation of the cDNA sequence as presented in Figure 15 and Figure 16C. The

D12 transcript, like A15 and B6, is encoded on the opposite strand from HMGA2. D12 is found in skeletal muscle as three distinct transcripts of 7.2 kb, 5.6 kb and 1.5 kb. The

- 87 - Figure 17: Normal tissue expression profiles of novel transcripts A15, B6 and D12 by Northern blot

Numbers and black arrowheads indicate positions of RNA molecular weight markers, in kilobases.

A. Poly A+ multiple tissue northern (MTN) blot (Clontech, Palo Alta CA) probed with

208 bp A15 PCR fragment. Positions of 4.4 kb and 1.6 kb bands are indicated. Note

that after more stringent wash (data not shown) the 1.6 kb band predominated

(indicated by gray shading of label for 4.4 kb band).

B. Poly A+ MTN blot probed with 200 bp B6 PCR fragment. Position of 6.3 kb band is

indicated.

C. Poly A+ MTN blot probed with D12R oligonucleotide. Positions of 7.2 kb, 5.6 kb &

1.5 kb bands are indicated.

D. Overexposure of polyA+ MTN blot probed with D12F oligonucleotide

- 88 - Figure 17

AB sk. musc lung brain placenta heart sk. musc kidney lung liver liver pancreas heart brain placenta kidney pancreas

9.5 9.5

-89- 7.5 7.5 B6 4.4 4.4 2.4 2.4

1.35 A15 1.35

0.24 0.24

Figure 17

CD placenta sk. musc heart brain kidney lung pancreas liver kidney sk. musc lung placenta pancreas heart brain liver

-90- 9.5 9.5 7.5 D12 7.5 D12 4.4 4.4

2.4 2.4

1.35 D12 1.35

0.24 0.24

5.6 kb band is also present in heart, placenta, liver, kidney and pancreas. Consistent with previous reports [108,111], HMGA2 was undetectable by Northern blot of normal adult tissues (data not shown).

Gene and EST expression in t(12;14) tumors and matched normal myometrium

We used available sequence data (Human genome database, UniSTS and dbEST; http://www.ncbi.nlm.nih.gov) to identify transcripts mapping within and flanking the UL breakpoint regions on chromosomes 12 and 14. We then tested expression levels of these expressed sequence tags (ESTs) and genes by relative

(quantitative) RT-PCR in panel of ULs characterized by translocations involving chromosomes 12 and 14 (Table 3). Following normalization to the 18S rRNA, expression levels in each tumor were compared to expression levels in matched normal myometrium. The results are summarized in Table 4. Although there was considerable fluctuation in the expression of some markers, the UL tumors showed no statistically significant alterations from normal expression of any genes or ESTs from chromosome

14. As shown in Figure 18, a significant increase in expression in the tumors (compared to matched normal myometrium) was observed for HMGA2 (p= 0.011), A15 (p=0.022),

B6 (p=0.007) and D12 (p=0.027), all of which map within the breakpoint cluster region on chromosome 12.

One tumor [case #16886] was included in this study because it fit our criteria of cytogenetic evidence of a translocation involving chromosomes 12 and 14. However, the cytogenetically characterized breakpoints in this tumor (12q21.3 and 14q11.2) are

- 91 - Table 4: Summary of expression results for chromosome 12 and chromosome 14 expression markers

Chromosomal position on Celera human genome map (http://www.celera.com) is given in Mb from the p-terminus of the chromosome. STS name and/or gene designation of each marker is given. Where the gene corresponding to an STS/EST marker has not been identified, a UniGene database (http://www.ncbi.nlm.nih.gov) cluster designation is given. T/N is the mean of the ratio of RT-PCR product from each t(12;14) tumor to product from the corresponding normal myometrium (both normalized to 18S rRNA amplification). Data were analyzed by a paired-samples t test. Boxes indicate markers within the previously identified breakpoint region on each chromosome; asterisks indicate transcripts with significantly altered expression in the tumors. Note that due to the minimal availability of tissue from some patients, not every expression marker was tested on every tumor/normal sample pair.

- 92 - Table 4

Chromosomal Chromosome Position (Mb) STS name Gene/Unigene Cluster T/N n p value 12 56.77 stSG15405 OS4 0.91 7 0.2 12 62.14 sts-L25615 AVPR1A 0.81 8 0.12 12 64.26 Bdac3b10 Exportin T 1.19 3 0.07 12 64.87 WIF1 1.96 5 0.28 12 65.43 stSG28071 NpwBP 1.85 5 0.82 12 65.64 HMGA2 exon 1 10.95 8 0.013 * 12 65.65 A15 22.48 5 0.023 *

-93- 12 65.69 D12S1521 D12 8.77 6 0.027 * 12 65.70 B6 12.26 6 0.007 * 12 65.79 N27126 HMGA2 exon 5 6.75 6 0.011 * 12 65.94 T87743 Hs.175569 1.51 9 0.49 12 65.96 H78365 Hs.283670 1.81 7 0.57 12 66.07 stSG10234 Hs.170056 1.34 6 0.68 12 68.48 WI-9486 RAP1B 1.38 10 0.39 12 68.64 stSG21512 Hs.166835 (mdm2 homolog) 1.54 4 0.36

14 47.54 WI-22628 unknown 1.77 5 0.75 14 48.13 stSG63046 Hs.306219 1.64 9 0.45 14 48.39 L19783 PIGH 1.66 5 0.38 14 48.55 A008C26 Hs.8663 1.89 8 0.46 14 49.27 D14S854 Hs.290600 1.56 6 0.86 14 49.30 Rad51L1e11b Rad51L1 exon 11b 1.67 5 0.82 14 49.41 Rad51L1e11c Rad51L1 exon 11c 1.28 5 0.98 14 49.68 D14S1222 α-actinin 1.18 7 0.31 14 51.17 Cda0Mg08 Hs.151014 1.19 7 0.06

Figure 18: Expression of EST markers in t(12;14) tumors and matched normal myometrium

For each expression marker, the upper panel shows products amplified under quantitative relative RT-PCR conditions then electrophoresed, stained with SybrGreen I and scanned on a Storm 840. Lower panels show the corresponding histogram of tumor vs. normal expression levels. Individual case number and normal (N) or tumor (T) samples are indicated. 18S+ = positive control for reverse transcription and 18S rRNA amplification; - = negative (water) control. P value calculated by paired samples t test is indicated on each histogram.

A. HMGA2 exon 5 (STS marker N27126) is increased in t(12;14) tumors.

B. Novel transcript A15 is increased in t(12;14) tumors.

C. Novel transcript B6 is increased in t(12;14) tumors.

D. Novel transcript D12 is increased in t(12;14) tumors.

E. Centromeric flanking marker stSG28071 is not significantly altered in t(12;14)

tumors.

F. Telomeric flanking marker T87743 is not significantly altered in t(12;14) tumors.

- 94 - Figure 18A

A 00359 15143 16886 03439 06140 09053 18S NT NT NT NT NT NT+ - 18S rRNA HMGA2

1.2

Normal 1 Tumor p = 0.011 0.8

0.6

0.4 HMGA2 Expression (Normalized to 18S)

0.2

0 00359 15143 16886 03439 06140 09053

- 95 - Figure 18B

B 00359 15143 16886 06140 09053 18S NT N T NT NT NT + - 18S rRNA A15

3.5

3 Normal Tumor 2.5 p = 0.023

2

1.5 A15 Expression A15

(Normalized to 18S) to (Normalized 1

0.5

0 00359 15143 16886 06140 09053

- 96 - Figure 18C

15413 03439 00359 16886 06140 09053 C 18S NT NT NT NT NT N T + - 18S rRNA B6

2 1.8 Normal 1.6 Tumor 1.4 p = 0.007 1.2 1 0.8 B6 Expression 0.6 (Normalized to 18S) 0.4

0.2 0 00359 15143 16886 03439 06140 09053

- 97 - Figure 18D

14034 00359 04352 15143 16886 D 06140 18S NT NTNTNT NT NT + - 18S rRNA D12

7

6 Normal Tumor 5 p = 0.026

4

3 D12 ExpressionD12

(Normalized to 18S) 2

1

0 14034 00359 04352 15143 16886 06140

- 98 - Figure 18E

E 14022 14034 00359 03436 06140 NT NT N TNTNT+ - 18S rRNA stSG28071

1 0.9 0.8 Normal 0.7 Tumor 0.6 p = 0.82 0.5

0.4 0.3 (Normalized to 18S) to (Normalized stSG28071 Expression Expression stSG28071 0.2 0.1 0 14022 14034 00359 03439 06140

- 99 - Figure 18F

03439 06140 09053 00047 14022 14034 00359 03706 15143 F N T N T N T N T N T N T N T N T N T + - 18S rRNA T87743 2 1.8 1.6

1.4 Normal Tumor 1.2 1 p =0.45 0.8 T87743 Expression (Normalized to 18S) 0.6 0.4 0.2 0 00047 14022 14034 00359 03706 15143 03439 06140 09053

- 100 - well outside the previously characterized breakpoint regions (12q13-15 and 14q23-24).

Interestingly, this tumor shows only slight increases in expression of HMGA2, B6, and

D12 compared to normal myometrium from the same patient (Figure 18A, C, and D).

A15 expression was essentially identical in tumor and normal in this case (Figure 18B).

When this patient is excluded, the mean change in expression in the tumors is 7.63-fold for HMGA2 (p = 0.00083), 27.84-fold for A15 (p = 0.0049), 14.22-fold for B6 (p =

0.0034), and 9.86-fold for D12 (p = 0.032).

None of the markers which map to chromosome 12 outside the breakpoint region were significantly altered in our tumor panel. Of these, the closest flanking markers to the HMGA2 locus are sts-T87743 and stSG28071 (Figure 18E and F). These two markers map 0.5 Mb apart (Figure 15C), corresponding closely to the previous estimate (445 kb) for the size of the chromosome 12 uterine leiomyoma breakpoint region [74].

In contrast to a previous report [108] which found no HMGA2 expression in normal adult myometrium, we found that HMGA2 was detectable at very low levels in normal myometrium. All our RNA samples were treated with DNase I to eliminate genomic DNA contamination, so the low-level but detectable product in our normal samples reflects amplification of an HMGA2 transcript. Detection of this very rare transcript may reflect the more sensitive detection method (staining with Sybr Green and scanning on a Storm 840 phosphoimager) selected for our study. Our findings are consistent with Rogalla and colleagues’ detection of HMGA2 expression in some normal myometrial samples using a very sensitive assay combining RT-PCR and

Southern blotting [111].

- 101 - A15, B6 and D12 are located within introns of HMGA2 (Figure 15B). The use of the 18S rRNA as a normalization control necessitated the generation of randomly- primed cDNA for the RT-PCR analysis, so there was a possibility that the alterations in expression of A15, B6 and D12 observed in these experiments were the result of detection of increased levels of HMGA2 pre-mRNA. Additional RT-PCR experiments were therefore performed using first-strand cDNA primed with oligo(dT) to minimize representation of unprocessed transcripts in the PCR template. Typical results are shown in Figure 19. Robust amplification was observed for UL templates, and minimal or no amplification for normal controls. This indicates that A15, B6 and D12 are overexpressed in the tumors as fully processed, polyadenylated transcripts.

The t(12;14) is found in only 8-15% of all UL tumors [39,40,42,43]. In order to determine whether changes in expression of HMGA2, A15, B6 and D12 can occur independent of gross aberrations of 12q15, we analyzed cytogenetically uncharacterized tumors from six patients by semiquantitative RT-PCR. Given previous estimates of the frequency of 12q15 aberrations in UL, we would expect at most one tumor in a random sampling this size to carry a cytogenetically detectable alteration involving 12q15.

Three of six tumors tested had increased expression of HMGA2 compared to matched normal myometrium. All three of these tumors also showed increased levels of the A15 transcript. In one tumor, HMGA2, A15, B6 and D12 were all increased in expression.

The data on the cytogenically uncharacterized tumors did not reach statistical significance (data not shown). Further studies will help to clarify the role(s) that these transcripts play in UL tumors which do and which do not carry the t(12;14)(q15;q24).

- 102 - Figure 19: Semiquantitative RT-PCR of oligo(dT)-primed cDNA consistently reflects changes in expression of HMGA2, A15, B6 and D12 in t(12;14) tumors

Each panel shows RT-PCR products amplified under semiquantitative conditions using primers for the gene indicated to left of panel. - = amplification negative control

(water); + = amplification positive control (genomic DNA); N = normal myometrium; T

= tumor; T1 and T2 are multiple tumors from patient 08652). 04352 00359 03439 03706 08652 06140 00047

- + N T N T N T N T N T N T N T1 T2

HMGA2 exon1

A15

D12

B6

- 103 - Expression of HMGA2 and Embedded Transcripts in UL Cell Lines

Aberrant splicing of HMGA2 to intronic sequences is a common occurrence in

UL and related tumors [165,167-169]. In order to determine whether A15, B6 and D12 were being overexpressed in t(12;14)(q15;q24.1) ULs as independent transcripts or as aberrant splice variants of HMGA2, we serially probed a Northern blot of RNA from

GM10964 cells for each of the embedded transcripts and HMGA2. GM10964 cells are derived from a human uterine leiomyoma whose t(12;14)(q15;q24.1) breakpoints have been previously characterized [73]. As shown in Figure 20, HMGA2 transcripts of 4.8 and 3.4 kb were detected. The A15 transcript in GM10964 cells is 2.2 kb, and B6 transcripts of 7 kb and >9.5 kb were detected. Our D12 oligonucleotide probe detected several transcripts in GM10964 RNA, ranging in size from 1.3 kb to 7.8 kb. Although one of these (3.3 kb) is very close in size to the smaller HMGA2 transcript (3.4 kb), these must represent two distinct transcripts because the D12R oligonucleotide probe is complimentary to the HMGA2 antisense strand and could not hybridize to any potential

HMGA2 transcript. A D12 probe complimentary to the HMGA2 sense strand (D12F) did not detect any transcripts in UL GM10964 RNA. A15, B6 and D12 overexpression in t(12;14) UL is therefore distinct from HMGA2 expression.

Relationship of Transcript B6 to Alternative Splice Form HMGA2b

An alternative splice form of HMGA2, HMGA2b, has recently been reported

[110]. HMGA2b contains the first three exons of HMGA2 spliced to a novel exon B within the large third intron of the gene. The antisense sequence to this novel exon

- 104 - Figure 20: Northern blot analysis of HMGA2, A15, B6 and D12 expression in UL GM10964

Lane shown contains 2µg of poly-A+ RNA from UL cell line GM10964. A15, B6 and D12 probes were the same as in Figure 17.

HMGA2 probe was a 192 bp PCR product generated from exon 1. Estimated size (in kb) is indicated to the right of each panel. -105-

is entirely contained within the B6 cDNA sequence (nucleotides 708 to 784 in Figure

16A). To begin an analysis of the interrelationship between these two transcripts, we attempted to measure the relative expression of HMGA2b and B6 in UL tissue samples, normal myometrium and several types of cultured human cells and cell lines. We were unable to detect HMGA2b in any of the normal or tumor tissue samples tested, although the transcript is expressed in normal human smooth muscle cell cultures (UtSMC),

GM10964 leiomyoma cells, GM14525 leiomyoma cells, Hep3B human hepatocellular carcinoma cell line, 87MG human glioma cell line, and SV40-transformed human fibroblasts (GL-SV40). B6 expression was detected in UtSMC, GM10964 and

GM14525 but not in Hep3B, 87MG or GL-SV40. Thus, expression of these two overlapping transcripts is neither mutually dependent nor mutually exclusive. Further studies may indicate whether co-expression of HMGA2b and B6 can cause post- transcriptional gene silencing akin to RNA interference.

DISCUSSION

Chromosomal translocations are frequently observed in tumors and in many cases a causal relationship between the translocation and the tumor phenotype has been demonstrated, generally through a gene fusion event or a dysregulation of gene expression (reviewed in [59]). In many cases, such as t(9;22)(q34;q11) in chronic myeloid leukemia (the “Philadelphia” chromosome) and translocations involving 18q21 in B-cell non-Hodgkin’s lymphoma, the size of the chromosomal domain affected on one or both of the involved chromosomes is small (less than 50kb) [170]. The

- 106 - t(12;14)(q15;q24) in uterine leiomyoma is of particular interest due to the unusual size and complexity of the two breakpoint cluster regions. On chromosome 12, breakpoints span a region of approximately 445 kb within the multiple aberration region (MAR) initially described by van de Ven and colleagues [57,74]. On chromosome 14, the breakpoint cluster region (BCR) likewise extends at least 400 kb [73]. We and others have previously described the involvement of RAD51L1, a DNA repair gene which overlaps the chromosome 14 BCR, by t(12;14)(q15;q24) in UL [74,133,164].

In this study we examined the structure and expression of the HMGA2 gene and its genomic environs. HMGA2, which spans approximately 160 kb within the chromosome 12 MAR, is, to date, the most promising candidate in the pathogenesis of these ULs. HMGA2 is disrupted by some t(12;14)(q15;q24) breakpoints, leading to production of a truncated or fusion transcript [74,101]. In other cases, the HMGA2 gene remains intact but aberrant splice products or dysregulation of expression have been observed [165]. The tumorigenic potential of a truncated form of HMGA2 has been demonstrated in transgenic mice, which develop lipomas at an increased frequency

[127]. Interestingly, these mice do not develop leiomyomata despite the ubiquitous expression of the transgene [120]. Several unusual features of the HMGA2 gene have remained unexplained, including the high evolutionary conservation of its large third intron [171] and its apparent dysregulation by translocation breakpoints that have been mapped more than 100 kb away from the start of the HMGA2 gene [125].

We have identified three novel expressed sequence tags (ESTs) that are embedded within the breakpoint cluster regions on chromosomes 12 and 14, and investigated these ESTs for translocation-associated alterations in their expression. The

- 107 - results of this analysis (summarized in Table 4 and illustrated in Figure 21) show that there is abnormally increased gene expression from within the 445 kb subregion of the

MAR on chromosome 12, but not of chromosome 14-derived transcripts. No genes or

ESTs that we tested outside this 0.5 Mb region were significantly altered in expression.

Unfortunately, no expressed sequences have been identified within this 0.5 kb domain outside the HMGA2/A15/B6/D12 locus, so we have been unable to map the precise boundaries of this altered domain (light gray shading in Figure 15C). Our findings suggest complex and long-range transcriptional regulation of this genomic locus.

Consistent with previous reports [108,111], HMGA2 was found to be overexpressed in ten of ten t(12;14)(q15;q24) tumors (Figure 18A and Figure 19). We further report the novel finding that three other ESTs are also significantly altered.

These novel ESTS, A15, B6 and D12 are embedded in the introns of HMGA2, and B6 shares part of one exon with the splice variant HMGA2b. A15 lies within the first

HMGA2 intron, and B6 and D12 in the third intron (Figure 15B). All three novel transcripts are in the opposite orientation to the transcription of HMGA2. The partial sequences obtained thus far for the three novel transcripts (Figure 16) do not indicate sequence similarity to any known genes or proteins, so their function remains unknown at this time. However, all three novel transcripts could be detected in a tissue-specific manner in poly A+ RNA from normal human tissues (Figure 17). The expression of all three novel transcripts is highest and most complex in skeletal muscle, suggesting a possible role in muscle function or growth. Alternatively, the position and orientation of the novel transcripts relative to HMGA2 suggest the possibility of a role in the

- 108 - Figure 21: Effect of t(12;14)(q15;q24) on transcript expression from the breakpoint regions

The previously cloned breakpoints in UL GM10964, which map 13.5 kb centromeric of the HMGA2 transcription start site on

chromosome 12 and 14.4 kb centromeric of RAD51L1 exon 11b on chromosome 14, are used for illustration. Segments of

derivative chromosome 12 [der(12)] and derivative chromosome 14 [der(14)] are shown. Thin black line represents chromosome

12-derived sequence, thick black line represents chromosome 14-derived sequence. Jagged line indicates the breakpoint. HMGA2

(white boxes) and the novel embedded transcripts (white diamonds) within the 445 kb segment of the MAR (delimited by

-109- parentheses) are significantly increased in expression (arrows) following the translocation. Chromosome 12 ESTs flanking the 445

kb segment of the MAR (white ovals) are not affected. Chromosome 14 genes (gray boxes) and ESTs (gray ovals) are also not

altered in expression. Figure is not drawn to scale.

der(12) ( stSG28071 D14S854 R11b R11c AA Cda0Mg08

der(14) )

A008C26 ex1 A15 D12 B6 ex5 T87743

regulation of that gene, possibly by RNA interference (RNAi) or another RNA- mediated mechanism.

It is possible that one or more of these transcripts belong to a rapidly growing class of functional non-coding RNAs (ncRNA; reviewed in [172,173]). These ncRNAs function directly as RNA rather than encoding proteins, and have a diverse range of functions. They include ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear

RNA (snRNA) of the splicosome, and small nucleolar RNA (snoRNA) involved in processing rRNA precursors. Of particular interest are a group of RNAs which, like mRNA, are large (>1 kb), spliced and polyadenylated, yet lack significant ORFs and apparently function as stable RNA molecules. These include Xist and Tsix, which are involved in mammalian X chromosome inactivation [174,175]; roX1 and roX2, which direct sex chromosome dosage compensation in Drosophila [176,177]; HIS-1 RNA, which is active in mammalian viral response and carcinogenesis [178]; heat shock response RNA hsrω[179]; SCA8, a naturally-occurring antisense transcript mutated in some spinocerebellar ataxia patients [180]; and the human H19 transcript, which acts as a tumor suppressor through an unknown mechanism [181,182]. ncRNAs often have very complex secondary structures [172]; if A15, B6, and/or D12 are in this group, this could explain the difficulty encountered in our RACE and cDNA cloning experiments.

The antisense orientation of the novel transcripts to HMGA2 is reminiscent of

RNA-dependent regulatory mechanisms such as Tsix and Xist in X inactivation

(reviewed in [183]) and RNA interference (RNAi; reviewed in [184,185]). X inactivation is regulated in cis from a locus known as the X inactivation center (Xic).

The Tsix and Xist genes overlap in opposite orientations within Xic, and Tsix appears to

- 110 - regulate Xist in the early steps of X inactivation [175]. Before the onset of X inactivation, Xist is expressed at low levels and Tsix is expressed at moderate levels from both X chromosomes. After the onset of X inactivation, Tsix expression is associated with the future active X (Xa) only and persists until Xist is turned off on Xa.

Tsix is not found on the inactive X (Xi) once cells enter the X-inactivation pathway, as

Xist expression increases and Xist transcripts spread in cis to coat Xi. Deletion of the

Tsix transcription start site results in constitutive Xist expression on the X carrying the deletion, resulting in inactivation of that allele. The location and orientation of A15, B6 and D12 relative to HMGA2 suggest that they could play a role in the regulation of

HMGA2 expression similar to Tsix and Xist; however, the expression patterns of A15,

B6, and D12 compared to HMGA2 do not fit the inverse pattern characteristic of Xist and Tsix, at least in the context of UL tumors.

RNAi is a process by which the presence of double-stranded RNA induces post-transcriptional silencing of the homologous gene [186]. The antisense orientation of A15, B6 and D12 to HMGA2 would allow the formation of a partially double- stranded RNA involving either HMGA2 pre-mRNA (which contains sequence complimentary to all three novel transcripts) or the HMGA2 splice variant HMGA2b

(which contains sequence complimentary to B6). However, the extremely low normal adult expression level of HMGA2 is inconsistent with the post-transcriptional gene silencing mechanism driven by RNAi, and the high levels of all of the overlapping transcripts in tumors do not appear to activate an RNAi-like silencing mechanism.

Although the expression patterns of HMGA2, A15, B6 and D12 do not fit either of these models for gene regulation by RNA, it is possible that the embedded transcripts

- 111 - are involved in the regulation of HMGA2 gene by an as yet uncharacterized mechanism.

Several possible modes of interaction require further investigation: (i) modulation of the chromatin structure in the shared locus associated with expression of the embedded transcripts; (ii) cooperative recruitment of the transcriptional machinery or (iii) competition for expression. The latter two mechanisms are, presumably, mutually exclusive; however, until it can be determined whether HMGA2 and the embedded transcripts are expressed coordinately in their normal context (as opposed to the situation in tumors) and particularly during development (when HMGA2 transcription is most active), both remain possible modes of interaction among these genes.

In addition to the B6 construct shown in Figure 16A, we identified a second B6 transcript in cDNA from t(12;14) UL cell line GM10964. This second transcript contains a fusion of chromosome 12 and chromosome 14 sequences within its 3’ tail.

Although the fusion does not lie in a coding region of the transcript, it could have an effect on mRNA metabolism, including transcript processing, export, stability, or translation control [187]. This B6 fusion transcript may also represent a broader class of fusions involving these novel ESTs which may be produced in t(12;14)(q15;q24) ULs.

Additionally, the sizes of the A15, B6 and D12 transcripts in UL GM10964 (Figure 20) differ from those detected in normal tissues (Figure 17). It is unknown whether this difference is due to tissue-specific splicing of the transcripts or to translocation-induced aberrant splicing.

Our finding that chromosome 12 MAR transcripts are significantly affected by the translocation but chromosome 14 transcripts are not was unexpected. We tested previously identified genes within the chromosome 14 BCR [73,124,133], including

- 112 - RAD51L1 (transcripts 11b and 11c) and cytoskeletal α-actinin, as well as an uncharacterized gene within the BCR represented by STS marker D14S854 (UniGene

Cluster Hs.290600).

Two models are proposed to explain our findings (Figure 22). First, t(12;14)(q15;q24) might disrupt a 12q15-specific transcriptional repressor, such that chromosome 12 genes become de-repressed without a consistent or widespread effect on the expression of chromosome 14 genes. One mechanism by which this could occur is translocation of only one half of a bipartite element. Second, t(12;14)(q15;q24) may cause the translocation of an enhancer element to chromosome 12 from chromosome 14 such that basal expression from chromsome 14 is unchanged but expression from chromosome 12 loci is significantly increased. Ayoubi and coworkers [113] have previously found evidence that HMGA2 is regulated by a constitutively active promoter in the 5’ flanking region which can be repressed by negative regulatory elements that lie outside the 1.3 kb promoter region. Thus, the chromosome 12-specific repressor model is most consistent with the available data. It should be noted that there may be highly localized effects of the translocation on chromosome 14 gene expression, such that the widely varying chromosome 14 breakpoints do not generate consistent, statistically significant changes in any one gene across our tumor panel. We did observe fluctuations from tumor to tumor in the expression of the chromsome 14 BCR genes consistent with this possibility (data not shown).

The mechanism by which t(12;14)(q15;q24) increases expression of HMGA2,

A15, B6 and D12 requires further investigation. Both DNA methylation (reviewed in

[91]) and chromatin remodeling by histone modification and positioning (reviewed in

- 113 - Figure 22: Models for Dysregulation of Expression from 12q15 Locus by t(12;14)(q15;q24)

Dysregulation of expression from 12q15 could be due to disruption of a negative regulatory element (A) or juxtaposition with a

positive regulatory element (B). In each panel, only one derivative chromosome is shown.

A. A negative regulator (shown as a bipartite element, dark red arrows) normally directs silencing of the 12q15 locus (dark red).

This element is disrupted as a result of the translocation, allowing expression of the 12q15 genes (curved arrows).

B. A positive regulator (light green) normally directs expression from 14q24. This element is brought into juxtaposition with the

12q15 locus by the translocation, activating the locus (light green) and allowing expression of the 12q15 genes (curved arrows). -114- A B Nuclear Scaffold Nuclear Nuclear Scaffold Nuclear

12q15 12q15 Nuclear Scaffold Nuclear Nuclear Scaffold Nuclear Nuclear Scaffold Nuclear t(12;14)(q15;q24) Scaffold Nuclear t(12;14)(q15;q24) +

14q24 14q24

+

[90]) are common mechanisms of achieving selective gene expression in the cell. Initial analyses of histone acetylation patterns in HMGA2 and the embedded ESTs have been inconclusive (data not shown). Further characterization of these transcripts and their regulators will, we expect, provide additional insights into how the complex and long- range regulation of this locus is achieved.

The identification of these novel transcripts within HMGA2, the finding that they are transcriptionally overexpressed in tumors compared to normal myometrium, and the identification of a domain of overexpression which extends as much as 500kb on chromosome 12 but not chromosome 14 provide important new information in elucidating the mechanisms involved in HMGA2 regulation and through which t(12;14)(q15;q24) promotes leiomyoma formation.

- 115 - Chapter 6: Structure and Conservation of the 12q15 Locus

Containing HMGA2, A15, B6, and D12

Computational and comparitive genomics provide extremely powerful tools for the characterization of both coding and noncoding genes. Conservation of sequence among paralogs (similar genes within a genome, presumably arising from an ancient gene duplication event) and orthologs (homologous genes in different species) is one of the tenets of molecular biology. Furthermore, conservation of sequence or structure between species is a powerful tool to analyze newly-identified non-coding RNA species

[188]. The HMGA2 gene has one paralog, the HMGA1 gene on human chromosome

6p21. HMGA2 orthologs have been identified in several vertebrate species

[103,105,106], but only in the mouse has the orthologous genomic locus been fully sequenced. Using available comuptational means, the human HMGA2/A15/B6/D12 locus was therefore compared to the closely related HMGA1 gene locus in humans, as well as to the homologous HMGA2 region in mouse.

The HMGA1 protein shares 42% amino acid identity and 54% similarity with the HMGA2 gene product. The arrangement of the coding regions of these two genes is similar: the coding region of HMGA2 exon 1 corresponds to the coding region of

HMGA1 exon V, and both encode the first of three AT hook motifs; HMGA2 exon 2 and HMGA1 exon VI encode the second AT hook domain. HMGA1 exon VII encodes both the third AT hook motif and most of the acidic domain; in HMGA2, these are encoded by the third and fifth exons, respectively. HMGA1 lacks the spacer domain encoded by HMGA2 exon 4, and the 5’ and 3’ UTRs differ significantly between the

- 116 - two genes. The 5’ UTR of HMGA1 is subject to very complex alternative splicing involving up to five exons (I through V), whereas the 5’ UTR of HMGA2 is contained entirely within exon 1 and several different transcripts are produced by the use of multiple transcription start sites. Taken together, the evidence from the structures of the

HMGA genes and their transcripts suggests that HMGA2 is likely regulated in a fundamentally different manner from HMGA1. HMGA1 is a much smaller gene than

HMGA2 (8 kb vs. ~150 kb); most notably, there is no HMGA1 gene segment that corresponds to the very large and highly conserved third intron of HMGA2 (Figure 23).

Thus, there are no paralogs of B6 or D12 at the 6p21 HMGA1 locus. A comparison of

HMGA2 intron 1 with HMGA1 intron 5 by BLAST yielded no significant homology, suggesting that A15 is also not highly conserved between these two loci.

With the assistance of Dr. Bruce Aronow and the Bioinformatics core facility at the University of Cincinnati and Children’s Hospital Research Foundation, an analysis was performed to determine the conservation between the human 12q15 locus and the homologous region(s) in the mouse genome. In the 500 kb segment of the human genome between STS markers T87743 and stSG28071, sixty-six local alignments between human and mouse sequence were found. These homology “hits” ranged in length from 29 to 10,579 bp, with a mean size of 1.6 kb. The weighted percent identity of these homologous segments was 56%. Three-fourths of these hits were within the

160 kb HMGA2/A15/B6/D12 gene locus, which is shown in Figure 24. A cis-element hit density graph in the context of sequence similarity (“regulogram”) for each of the individual embedded exons is shown in Figure 25.

- 117 - Figure 23: Alignment of HMGA1 and HMGA2 Genomic Structures

The HMGA2 gene (top) spans approximately 150 kb and contains 6 exons. HMGA1 (bottom) spans less than 8 kb and contains 8

exons. HMGA1 exon V corresponds to part of HMGA2 exon 1, HMGA1 exon VI to HMGA2 exon 2, HMGA1 exon VII to HMGA2

exon 3 and part of HMGA2 exon 5. There is no segment of HMGA1 which corresponds to HMGA2 intron 3, exon B or exon 4.

5’ UTR & Acidic “AT Hooks” Domain Spacer & 3’UTR -118- Exon 12 3B 4 5 HMGA2

HMGA1

Exon V VII VIII 10 kb

Figure 24: Genomic Structure and Human-Mouse Homology of the 12q15 Locus

Exons are overlaid on the percentage identity plot (PIP) for human vs. mouse; lower bar corresponds to 50% homology, upper bar corresponds to 100% homology. Notations above the PIP indicate exon order for HMGA2 and B6. B6 exons are coded by Greek letters, since all the exons have not yet been identified: χ, ψ, and ω form the 3’ end of normal B6 (Figure 16A); χ, ψ, and ω' are fused to a chromosome 14 sequence in the fusion transcript identified in UL GM10964. Notations below the PIP indicate distance from the t(12;14)(q15;q24) breakpoint in UL GM10964. Color codes are as follows:

HMGA2 exons HMGA2b novel exon (overlaps B6 ω exon) A15 D12 B6 exons B6 alternative exon ω' in GM10964 fusion transcript

- 119 - Figure 24 ' ω 80kb 100kb 110kb 150kb 70kb 120kb 130kb 140kb 12 3 40kb 50kb 60kb ωψ χ 45 90kb 12kb 20kb 30kb

- 120 - Figure 25: Homology between Human and Mouse Genomic Regions of A15, D12 and B6

Each regulogram (or cis-element hit density graph) depicts the average of the number of shared cis-elements occurring in each phylogenetically conserved region. The light gray line traces the percent identity between human and mouse sequences in the indicated region. The dark gray line traces the number of conserved cis elements (“hits”) found within the region. Top panel represents the 1 kb A15 sequence shown in Figure 16B.

Second panel shows the D12 sequence from Figure 16C. The bottom panels indicate the human-mouse homology for each of the three B6 exons shown in Figure 16B and

Figure 24.

- 121 - Figure 25

A15

D12

B6χ

B6ψ

B6ω

- 122 - Chapter 7: Discussion

Chromosomal translocations are a common feature in tumor cells. In many cases, a causal relationship between the translocation and the tumor phenotype has been demonstrated, generally through creation of an oncogenic fusion protein or a dysregulation of gene expression (reviewed in [59,189]). When the breakpoints in a series of similar tumors are identified and mapped, they often cluster within a relatively small (less than 50 kb) region on one or both of the involved chromosomes, as in t(9;22)(q34;q11) in chronic myeloid leukemia (the “Philadelphia” chromosome) and in translocations involving 18q21 in B-cell non-Hodgkin’s lymphoma [170]. Molecular characterization of these breakpoint cluster regions has frequently facilitated the identification of the gene or genes causative of the tumor phenotype.

The t(12;14)(q15;q24) translocation in uterine leiomyoma is of particular interest due to the unusual size and complexity of the breakpoint cluster regions on both chromosome 12 and chromosome 14. On chromosome 12, breakpoints span a region of approximately 445 kb within the multiple aberration region (MAR) initially described by van de Ven and colleagues [57,71]. On chromosome 14, the breakpoint cluster region (BCR) was initially estimated to be at least 400 kb [73]. More recent analysis facilitated by the human genome databases (Chapter 4) has revised this estimate to between 700 and 1200 kb.

Several genes have been identified within the MAR on chromosome 12 and the

BCR on chromosome 14. Each of these has been examined in this and other studies for quantitative or qualitative alteration by t(12;14)(q15;q24) in uterine leiomyoma.

- 123 -

CANDIDATE GENES ON CHROMOSOME 14: RAD51L1, CYTOSKELETAL α-

ACTININ AND D14S854

The chromosomal region 14q23-24 is involved in nearly 25% of karyotypically abnormal UL tumors, most often with 12q14-15 as its translocation partner (Figure 3;

[39]). The gene for cytoskeletal α-actinin and an uncharacterized EST (UniGene cluster

Hs. 290600; STS marker D14S854) both lie within the BCR on chromosome 14 ([73];

Chapter 5). However, neither of these genes show significant alterations in expression in t(12;14)(q15;q24) UL tumors compared to normal myometrium (Table 4). It is therefore difficult to evaluate their potential role in UL pathogenesis using an

“expression dysregulation” model.

We and others have described the involvement of RAD51L1, a DNA repair gene which overlaps the chromosome 14 BCR, by t(12;14)(q15;q24) in UL (Chapter 3;

[124,133,164]. The breakpoints in several ULs lie within this gene, and both the ubiquitously expressed RAD51L1-11b transcript and the uterus-specific RAD51L1-11c transcript are disrupted by the translocation in these tumors [124,133,164]. RAD51L1-

HMGA2 and HMGA2-RAD51L1 fusion transcripts have been identified in several tumor-derived cell lines [124]. However, in 81 primary UL tumors from 30 patients, only two cases of RAD51L1-HMGA2 fusion transcripts and no HMGA2-RAD51L1 fusions were found [164], suggesting that this gene fusion is not a critical event in UL pathogenesis. Other UL translocation breakpoints lie a considerable distance (at least

150 kb and possibly as much as 1.2 Mb) outside the RAD51L1 gene (Chapter 4).

Furthermore, expression levels of exons RAD51L1-11b and RAD51L1-11c were not

- 124 - consistently or significantly altered in t(12;14)(q15;q24) tumors (Table 4). Although UL

14q24 translocations have been identified with partners other than 12q15 (Figure 3), most evidence suggests that this may be an associated but not a causative event in tumor formation. It is unlikely, therefore, that RAD51L1 is a critical target of t(12;14)(q15;q24) in UL pathogenesis. However, a secondary role for this gene in tumor progression is suggested by the function of Rad51L1 in DNA damage detection and/or repair (Appendix I; [137,139,141]) and translocations involving this gene likely contribute to the tumor phenotype by altering genomic stability. This could explain the high degree of karyotypic complexity and secondary cytogenetic aberrations observed in many t(12;14)(q15;q24) UL tumors [40,41].

In addition to an alteration in genomic stability, disruption of the RAD51L1 locus may increase the proliferative rate of tumor cells. Amant and coworkers [190] observed a dosage effect of RAD51L1 loss in an unusual UL case presenting with ascites and pleural effusion. Two subclones of cells were isolated from the tumor: one with a complex karyotype involving chromosome 2, chromosome 14 and both chromosome 12 alleles [46, XX, t(2;12)(q31;q21),ins(14;12)(q23-

24;q15q21),del(12)(q15q15)] and a second with the same karyotype plus a deletion on the long arm of the other chromosome 14 allele [idem,del(14)(q21q24)]. Due to insertion of an intact HMGA2 allele proximal to RAD51L1, both cell populations expressed wild-type HMGA2 as well as normal splice forms RAD51L1-11a, RAD51L1-

11b, and RAD51L1-11c from the der(14); no truncated or fusion transcripts could be detected. On the other chromosome 14, del(14)(q21q24) resulted in loss of one allele of

RAD51L1, and conferred a growth advantage to the cells with this additional aberration.

- 125 - This is consistent with a model in which chromosomal rearrangement causes disruption of the normally tight regulation of the 12q15 locus (see below), and decreased expression of one or more of the RAD51L1 isoforms could contribute to tumor progression by altering genomic stability, bypassing cell cycle checkpoints, and/or increasing the rate of cellular proliferation.

A COMPLEX LOCUS IN THE BREAKPOINT REGION OF CHROMOSOME 12:

HMGA2, A15, B6 AND D12

The chromosomal region 12q14-15 is involved in approximately 30% of karyotypically abnormal UL tumors, most often with 14q23-24 as its translocation partner. In addition to t(12;14)(q15;q24), other chromosomal rearrangements involving

12q13-15 are observed in about 10% of cytogenetically aberrant UL tumors, and trisomy 12 is found an another 8-13% [39,43]. The same region of chromosome 12 has been implicated in translocations associated with other benign mesenchymal tumors including lipomas and pleiomorphic adenomas of salivary gland [49,57,74]. For these reasons, considerable interest has focused on 12q15 and particularly on the HMGA2 gene within this region (reviewed in [120]). HMGA2, which spans 150 kb within the chromosome 12 MAR (Figure 7), is, to date, the most promising candidate in the pathogenesis of t(12;14) ULs. HMGA2 is disrupted by some t(12;14)(q15;q24) breakpoints, leading to production of a truncated or fusion transcript [74,101]. In other cases, the HMGA2 gene remains intact but aberrant splice products or dysregulation of expression have been observed [165]. The tumorigenic potential of a truncated form of

HMGA2 has been demonstrated in transgenic mice, which develop lipomas and natural

- 126 - killer T-cell lymphomas [127,129]. Interestingly, these mice do not develop leiomyomata or other tumor types associated with aberrations of 12q15 despite the ubiquitous expression of the transgene [120]. Furthermore, a normal splice variant of

HMGA2 (HMGA2b), which lacks the C-terminal acidic domain, is co-expressed in most tissues and cell types which express HMGA2; it is possible that misexpression of this isoform is responsible for UL pathogenesis in tumors where the primary transcript remains intact [110]. Several unusual features of the HMGA2 gene have remained unexplained, including the high evolutionary conservation of its large third intron [171] and its apparent dysregulation by translocation breakpoints that have been mapped more than 100 kb away from the start of the HMGA2 gene [125]. An analysis of the structure and expression of the HMGA2 gene and its genomic environs is presented in Chapters 5 and 6.

We have identified three novel expressed sequence tags (ESTs) that are located within the multiple aberration region (MAR) on chromosome 12, and investigated these

ESTs for translocation-associated alterations in their expression. Consistent with previous reports [108,111], HMGA2 is overexpressed in ten of ten t(12;14)(q15;q24) tumors (Figure 18A and Figure 19). This study reports the novel finding that three other

ESTs are also significantly altered. A15, B6 and D12 all map to introns of HMGA2:

A15 within the first intron, and B6 and D12 in the large third intron (Figure 15B). All three novel transcripts are in the opposite orientation to the transcription of HMGA2.

The function(s) of these novel transcripts remains unknown at this time. However, all could be detected in a tissue-specific manner in poly A+ RNA from normal human tissues (Figure 17). The expression of all three transcripts is highest and most complex

- 127 - in skeletal muscle, suggesting a possible role in muscle function or growth.

Alternatively, the position and orientation of the novel transcripts relative to HMGA2 suggest the possibility of a role in the regulation of that gene.

The results of our analysis, summarized in Table 4 and illustrated in Figure 21, show that in UL tumors with t(12;14)(q15;q24) there is abnormally increased expression of several transcripts from within the 445 kb subregion of the MAR on chromosome 12.

No genes or ESTs tested outside this 0.5 Mb region were significantly altered in expression. Furthermore, preliminary results suggest that expression from this locus may be altered in some ULs that do not carry the t(12;14)(q15;q24). Overall, our findings suggest complex and long-range transcriptional dysregulation of this genomic locus in UL. To our knowledge, both the structure of 12q15 locus (multiple genes transcribed in an antisense orientation from the introns of another gene) and the impact of the translocation on the region (characterized by overexpression of this gene and the antisense transcripts embedded within it) are unprecedented in tumor expression studies.

What role(s) might A15, B6 and D12 play?

The partial cDNA sequence of A15 contains a small (92 codon) but complete open reading frame (Figure 16B). The B6 and D12 sequences obtained thus far each contain partial open reading frames which could encode the C-terminus of a protein

(Figure 16A and C). None of the deduced amino acid sequences have significant similarity to known proteins, and no previously characterized functional motifs could be identified. The expression of these transcripts primarily in skeletal muscle (Figure 17)

- 128 - suggests that the role of these genes may be specific for muscle function or muscle cell growth and maintenance. The connection, if any, between the expression of these transcripts in skeletal muscle and their role in the smooth muscle tumor leiomyoma remains unknown, as skeletal and smooth muscle are not closely related developmentally.

Alternatively, it is possible that one or more of these transcripts belong to a rapidly growing class of functional non-coding RNAs (ncRNA; reviewed in [172,173]). ncRNAs are defined as those transcripts which function directly as RNA rather than encoding proteins; the members of this very broad class of molecules have a diverse range of functions. Of particular interest are a group of RNAs which, like mRNA, are large (>1 kb), spliced and polyadenlyated, yet lack significant ORFs and apparently function as stable RNA molecules.

The antisense orientation of the novel transcripts to HMGA2 is reminiscent of

RNA-dependent regulatory mechanisms such as Tsix and Xist in X inactivation

(reviewed in [183]) and RNA interference (RNAi; reviewed in [184,185]). However, the expression patterns of A15, B6, and D12 compared to HMGA2 do not fit the inverse pattern characteristic of Xist and Tsix, nor do the high levels of the overlapping transcripts in tumors appear to activate an RNAi-like silencing mechanism.

Although the expression patterns of HMGA2, A15, B6 and D12 do not fit either of these models for regulation of gene expression by RNA, it is possible that the embedded transcripts are involved in the regulation of HMGA2 gene by an as yet uncharacterized mechanism (Figure 26). Several possible modes of interaction require

- 129 - Figure 26: Models for HMGA2 regulation by embedded antisense transcripts

Three possible modes of interaction between overlapping genes are shown. Coordinated expression of transcripts from this locus could be cooperative (expression of all transcripts increases or decreases together) or antagonistic (expression of one transcript decreases as another increases)

A. Modulation of chromatin structure. Chromatin remodeling factors (gold) interact with proximal (red-brown) and distal (light green) regulatory domains of 12q15 locus genes, resulting in alterations in chromatin structure (indicated by repositioning of blue nucleosomes) and altered gene expression (arrows). This model would be consistent with cooperative or antagonistic expression patterns; cooperative expression is shown.

B. Cooperative recruitment of transcriptional machinery. Initiation of transcription from any promoter (triangles) within the locus causes a cooperative activation of the overlapping gene(s) by increasing their accessibility to the transcriptional machinery

(orange). This model would be consistent with cooperative expression patterns.

C. Competition for transcription. Multiple promoters within the locus (triangles) compete for interaction with transcription factors (gold) and/or distal regulatory elements (light green). This model would be consistent with antagonistic expression patterns.

- 130 - Figure 26

A B Promoter 1

Promoter 2 Promoter 3

Chromatin Remodeling Factor(s)

Chromatin Remodeling

C

Promoter 1 Enhancer

Promoter 2 Promoter 3

Transcription Factor(s)

Gene 1 activated Gene 2 activated - 131 - further investigation: (i) modulation of the chromatin structure in the shared locus associated with expression of the embedded transcripts; (ii) cooperative recruitment of the transcriptional machinery or (iii) competition for transcriptional regulators. The latter two mechanisms are, presumably, mutually exclusive; however, until it can be determined whether HMGA2 and the embedded transcripts are expressed coordinately in their normal context (as opposed to the situation in tumors), both remain possible modes of interaction among these genes.

WHAT HAVE WE LEARNED ABOUT t(12;14)(q15;q24), GENE EXPRESSION

AND UL PATHOGENESIS?

The primary effect of t(12;14) on gene expression is a dramatic increase of several transcripts from a complex locus within the MAR on chromosome 12. The affected domain extends as much as 500 kb on chromosome 12, but does not involve chromosome 14 transcripts. This suggests the presence of a regulatory element capable of mediating gene expression over a considerable distance. t(12;14)(q15;q24) disrupts the normal context of this element and the domain it controls, resulting in either activation or de-repression of the chromosome 12 MAR locus. The genes affected include HMGA2 and three novel transcripts: A15, B6, and D12. HMGA2 influences cell growth and differentiation in the adipocyte lineage and, when truncated, to promote lipoma and natural killer cell lymphoma formation in transgenic mice. One major challenge for future studies is to elucidate more fully the mechanism by which overexpression of HMGA2 and the embedded genes impacts smooth muscle growth and the development of leiomyomata. The recently reported splice variant HMGA2b, very

- 132 - similar in structure to tumorigenic truncated forms of HMGA2, may play a critical role in this process. The novel transcripts, one of which shares part of an exon with the

HMGA2 splice variant and all of which are encoded on the opposite strand to HMGA2, may also play a role in the regulation of HMGA2 and/or in the development of UL. The tumorigenic mechanisms of t(12;14)(q15;q24) are likely to be understood through a detailed analysis of these transcripts and evaluation of their functions in normal and tumor cells.

FUTURE RESEARCH DIRECTIONS

Many questions remain to be answered before the tumorigenic pathways leading to UL are fully elucidated. Scientific consensus is that HMGA2 plays a critical role

[191-194], yet puzzling questions remain as to the mechanism(s) of its activation and its tumorigenic role. Identification of the processes which lead to tumor formation in the absence of t(12;14)(q15;q24), and at what point(s) they overlap the pathways involved in t(12;14), may also be critical to our understanding of UL pathogenesis. The enigma of UL also raises wide-ranging questions regarding the fundamental nature and causes of neoplasia.

Mechanism of the Translocation

Chromosomal translocations remain relatively poorly understood at a mechanistic level, despite their well-documented association with many different tumor types and the detailed functional elucidation of their effects in select cases. The non-

- 133 - random nature of recurrent translocations is likely explained by the combined effects of two phenomena. First, “susceptible” or “fragile” loci may predispose certain chromosomal regions to rearrangement. For example, the 11q23 region contains multiple DNA topoisomerase II cleavage sites which coincide with translocation breakpoints in mixed lineage leukemia [195,196]. Second, the aberration may confer a selective advantage, allowing the clonal outgrowth of cells that carry a particular change. The relative contribution of these two processes likely varies among recurrent translocations. In the case of t(12;14) and UL, the wide-ranging breakpoints on both chromosomes argues against the existence of specific fragile sites responsible for the translocation. Because of the attention focused on HMGA2 expression in benign tumors, many fusions of this gene with ectopic sequences have been reported in a variety of tumor types. However, there are no obvious sequence or structure similarities between the different partner genes (reviewed in [58]). Kazmierczak and colleagues [165] found a high frequency of endogenous retroviral RTLV-H-related sequences in the 12q15 region, which could predispose the region to homologous recombination. Analysis of

14q24 for similar sites could clarify the role these sequences may play in the frequency of t(12;14). Three-dimentional subnuclear localization of the 12q15 and the 14q24 region could aid in determining whether spatial juxtaposition of the breakpoint regions contributes to their high frequency of translocation. A systematic study in normal cells of the frequency (relative to other genomic regions) of breakage or translocation involving 12q15 or 14q24 could enhance our understanding of whether t(12;14)(q15;q24) is a rare event which is intensely selected in UL, or a common event not requiring arduous selection to account for its frequency in UL.

- 134 - Chromosome Domains and Mechanism of Alterations in Gene Expression

This study establishes that t(12;14)(q15;q24) is associated with dramatically increased expression of several transcripts from a region of 12q15 that may extend as much as 500 kb. Direct extensions of this work include precise delineation of the boundaries of this domain, and determination of the mechanism(s) responsible for the alterations in expression. The former is hampered by the absence of testable expression markers within the critial genomic regions, and may have to be delayed until the knowledge gained from the latter can be applied to the problem. Chromatin restructuring and methylation are the molecular changes most likely responsible for the expression changes, as these processes are at the root of many gene expression phenomena (see “Gene Regulation by Action at a Distance,” page 29). A useful adjunct approach to these studies would be analysis of changes in 12q15 gene expression in

ULs in which the breakpoints have been or can be precisely mapped. Correlation of expression changes with breakpoint locations could provide useful insights into the nature and regulation of this genomic locus.

Genetic Basis of UL Tumorigenesis

Overexpression of HMGA2 and/or HMGA1 may occur in as many as 50% of UL tumors [197], and has recently been demonstrated in the Eker rat model of UL [123].

The tumorigenic potential of truncated HMGA2 has been established by transgenic animal studies [127-129]. However, several puzzling questions and contradictions regarding HMGA2 and UL remain to be addressed. The mechanism by which overexpression could result from wide-ranging translocation breakpoints is not

- 135 - understood. Identification of the distal regulatory elements of HMGA2 and elucidation of the regulation and function of A15, B6 and D12 are the next steps in addressing this question (see “A Complex Locus in the Breakpoint Region of Chromosome 12:

HMGA2, A15, B6 and D12,” page 126).

The overexpression of a truncated form of HMGA2 in transgenic mice resulted in dysregulation and tumorigenesis of the adipocyte lineage [127,128]. The absence of leiomyoma formation in these animals may be explained by species-specific physiological differences, or it may indicate a more critical deficit in our understanding of UL pathogenesis. The transgenic mouse model of UL developed by Romagnolo and coworkers [30] demonstrates that mice can develop UL at high frequency.

Overexpression of HMGA2 in other model systems (such as rat or guinea pig) and/or using a smooth muscle-specific promoter could aid in clarifying this issue. The lack of evidence for tumorigenicity of full-length HMGA2 also must be addressed. There are no published reports of transgenic animal studies using wild-type HMGA2, and in cell- based assays full-length HMGA2 is non-transforming [126]. The existence of at least one alternative splice form of HMGA2 [110] may provide a key to understanding the relationship between HMGA2 overexpression and tumorigenesis. More sensitive assays capable of reliably detecting these rare transcripts are needed, as are methods for inducing their expression at physiological levels in experimental systems.

The involvement of other genes in the tumorigenesis of UL, and particularly in those cases in which the 12q15 or 6p21 transcripts are not overexpressed, may be best addressed throught he use of modern molecular profiling techniques. Comparative

- 136 - genomics and proteomics are powerful tools for the identification of tumor-associated alterations in the cellular milieu.

- 137 - References

1. Cotran, R.S., Kumar, V., and Robins, S.J. Pathologic Basis of Disease, W. B.

Saunders Company, Philadelphia, PA, 1994.

2. Greenberg, M.D. and Kazamel, T.I. (1995). Medical and socioeconomic impact

of uterine fibroids. Obstet Gynecol Clin North Am, 22:625-36.

3. Cramer, S.F. and Patel, A. (1990). The frequency of uterine leiomyomas. Am J

Clin Pathol, 94:435-8.

4. Curran, R.C. Colour Atlas of Histopathology, Oxford University Press, New

York, 1985.

5. Cramer, D. (1992). Epidemiology of myomas. Semin Reprod Endocrinol,

36:433-445.

6. Verkauf, B.S. (1993). Changing trends in treatment of leiomyomata uteri. Curr

Opin Obstet Gynecol, 5:301-10.

7. Friedman, A.J., Lobel, S.M., Rein, M.S., and Barbieri, R.L. (1990). Efficacy and

safety considerations in women with uterine leiomyomas treated with

gonadotropin-releasing hormone agonists: the estrogen threshold hypothesis. Am

J Obstet Gynecol, 163:1114-9.

8. Stovall, T.G., Ling, F.W., Henry, L.C., and Woodruff, M.R. (1991). A

randomized trial evaluating leuprolide acetate before hysterectomy as treatment

for leiomyomas. Am J Obstet Gynecol, 164:1420-3; discussion 1423-5.

- 138 - 9. Lemay, A., Surrey, E.S., and Friedman, A.J. (1994). Extending the use of

gonadotropin-releasing hormone agonists: the emerging role of steroidal and

nonsteroidal agents. Fertil Steril, 61:21-34.

10. Friedman, A.J., Daly, M., Juneau-Norcross, M., Gleason, R., Rein, M.S., and

LeBoff, M. (1994). Long-term medical therapy for leiomyomata uteri: a

prospective, randomized study of leuprolide acetate depot plus either oestrogen-

progestin or progestin 'add-back' for 2 years. Hum Reprod, 9:1618-25.

11. Carr, B.R., Marshburn, P.B., Weatherall, P.T., Bradshaw, K.D., Breslau, N.A.,

Byrd, W., Roark, M., and Steinkampf, M.P. (1993). An evaluation of the effect

of gonadotropin-releasing hormone analogs and medroxyprogesterone acetate

on uterine leiomyomata volume by magnetic resonance imaging: a prospective,

randomized, double blind, placebo-controlled, crossover trial. J Clin Endocrinol

Metab, 76:1217-23.

12. Brandon, D.D., Bethea, C.L., Strawn, E.Y., Novy, M.J., Burry, K.A.,

Harrington, M.S., Erickson, T.E., Warner, C., Keenan, E.J., and Clinton, G.M.

(1993). Progesterone receptor messenger ribonucleic acid and protein are

overexpressed in human uterine leiomyomas. Am J Obstet Gynecol, 169:78-85.

13. Andersen, J., DyReyes, V.M., Barbieri, R.L., Coachman, D.M., and Miksicek,

R.J. (1995). Leiomyoma primary cultures have elevated transcriptional response

to estrogen compared with autologous myometrial cultures. J Soc Gynecol

Investig, 2:542-51.

- 139 - 14. Brandon, D.D., Erickson, T.E., Keenan, E.J., Strawn, E.Y., Novy, M.J., Burry,

K.A., Warner, C., and Clinton, G.M. (1995). Estrogen receptor gene expression

in human uterine leiomyomata. J Clin Endocrinol Metab, 80:1876-81.

15. Andersen, J. and Barbieri, R.L. (1995). Abnormal gene expression in uterine

leiomyomas. J Soc Gynecol Investig, 2:663-72.

16. Andersen, J. (1996). Growth factors and cytokines in uterine leiomyomas. Semin

Reprod Endocrinol, 14:269-82.

17. Kawaguchi, K., Fujii, S., Konishi, I., Okamura, H., and Mori, T. (1985).

Ultrastructural study of cultured smooth muscle cells from uterine leiomyoma

and myometrium under the influence of sex steroids. Gynecol Oncol, 21:32-41.

18. Thorneycroft, I.H., Mishell, D.R., Jr., Stone, S.C., Kharma, K.M., and

Nakamura, R.M. (1971). The relation of serum 17-hydroxyprogesterone and

estradiol-17-beta levels during the human menstrual cycle. Am J Obstet

Gynecol, 111:947-51.

19. Matsuo, H., Maruo, T., and Samoto, T. (1997). Increased expression of Bcl-2

protein in human uterine leiomyoma and its up-regulation by progesterone. J

Clin Endocrinol Metab, 82:293-9.

20. Tiltman, A.J. (1985). The effect of progestins on the mitotic activity of uterine

fibromyomas. Int J Gynecol Pathol, 4:89-96.

21. Cesen-Cummings, K., Copland, J.A., Barrett, J.C., Walker, C.L., and Davis, B.J.

(2000). Pregnancy, parturition, and prostaglandins: defining uterine

leiomyomas. Environ Health Perspect, 108 Suppl 5:817-20.

- 140 - 22. Standop, J., Schneider, M.B., Ulrich, A., and Pour, P.M. (2001). Experimental

animal models in pancreatic carcinogenesis: lessons for human pancreatic

cancer. Dig Dis, 19:24-31.

23. Bosland, M.C. (1996). Hormonal factors in carcinogenesis of the prostate and

testis in humans and in animal models. Prog Clin Biol Res, 394:309-52.

24. Pories, S.E., Ramchurren, N., Summerhayes, I., and Steele, G. (1993). Animal

models for colon carcinogenesis. Arch Surg, 128:647-53.

25. Gopinath, C. and Gibson, W.A. (1987). Mesovarian leiomyomas in the rat.

Environ Health Perspect, 73:107-13.

26. Nelson, W.O. (1937). Endometrial and myometrial changes including

fibromatous nodules induced in the guinea pig by oestrogen. Anat Rec, 68:99-

102.

27. Lipschutz, A. (1942). Experimental fibroids and the antifibromatogenic action of

steroid hormones. JAMA, 120:171-175.

28. Porter, K.B., Tsibris, J.C., Nicosia, S.V., Murphy, J.M., O'Brien, W.F., Rao,

P.S., and Spellacy, W.N. (1995). Estrogen-induced guinea pig model for uterine

leiomyomas: do the ovaries protect? Biol Reprod, 52:824-32.

29. Buttram, V.C., Jr. and Reiter, R.C. (1981). Uterine leiomyomata: etiology,

symptomatology, and management. Fertil Steril, 36:433-45.

30. Romagnolo, B., Molina, T., Leroy, G., Blin, C., Porteux, A., Thomasset, M.,

Vandewalle, A., Kahn, A., and Perret, C. (1996). Estradiol-dependent uterine

leiomyomas in transgenic mice. J Clin Invest, 98:777-84.

- 141 - 31. Eker, R., Mossige, J., Johannessen, J.V., and Aars, H. (1981). Hereditary renal

adenomas and adenocarcinomas in rats. Diagn Histopathol, 4:99-110.

32. Everitt, J.I., Goldsworthy, T.L., Wolf, D.C., and Walker, C.L. (1992).

Hereditary renal cell carcinoma in the Eker rat: a rodent familial cancer

syndrome. J Urol, 148:1932-6.

33. Yeung, R.S., Xiao, G.H., Jin, F., Lee, W.C., Testa, J.R., and Knudson, A.G.

(1994). Predisposition to renal carcinoma in the Eker rat is determined by germ-

line mutation of the tuberous sclerosis 2 (TSC2) gene. Proc Natl Acad Sci U S

A, 91:11413-6.

34. Kim, K.K., Pajak, L., Wang, H., and Field, L.J. (1995). Cloning, developmental

expression, and evidence for alternative splicing of the murine tuberous sclerosis

(TSC2) gene product. Cell Mol Biol Res, 41:515-26.

35. Wienecke, R., Konig, A., and DeClue, J.E. (1995). Identification of tuberin, the

tuberous sclerosis-2 product. Tuberin possesses specific Rap1GAP activity. J

Biol Chem, 270:16409-14.

36. Cheadle, J.P., Reeve, M.P., Sampson, J.R., and Kwiatkowski, D.J. (2000).

Molecular genetic advances in tuberous sclerosis. Hum Genet, 107:97-114.

37. Everitt, J.I., Wolf, D.C., Howe, S.R., Goldsworthy, T.L., and Walker, C. (1995).

Rodent model of reproductive tract leiomyomata. Clinical and pathological

features. Am J Pathol, 146:1556-67.

38. Burroughs, K.D., Fuchs-Young, R., Davis, B., and Walker, C.L. (2000). Altered

hormonal responsiveness of proliferation and apoptosis during myometrial

- 142 - maturation and the development of uterine leiomyomas in the rat. Biol Reprod,

63:1322-30.

39. Sreekantaiah, C., Ladanyi, M., Rodriguez, E., and Chaganti, R.S. (1994).

Chromosomal aberrations in soft tissue tumors. Relevance to diagnosis,

classification, and molecular mechanisms. Am J Pathol, 144:1121-34.

40. Nilbert, M. and Heim, S. (1990). Uterine leiomyoma cytogenetics. Genes

Chromosomes Cancer, 2:3-13.

41. Hu, J. and Surti, U. (1991). Subgroups of uterine leiomyomas based on

cytogenetic analysis. Hum Pathol, 22:1009-16.

42. Meloni, A.M., Surti, U., Contento, A.M., Davare, J., and Sandberg, A.A. (1992).

Uterine leiomyomas: cytogenetic and histologic profile. Obstet Gynecol, 80:209-

17.

43. Mitelman, F. Catalog of Chromosome Aberrations in Cancer, Wiley-Liss, New

York, NY, 1994.

44. Pandis, N., Heim, S., Bardi, G., Mandahl, N., and Mitelman, F. (1990). High

resolution mapping of consistent leiomyoma breakpoints in chromosomes 12

and 14 to 12q15 and 14q24.1. Genes Chromosomes Cancer, 2:227-30.

45. Heim, S., Nilbert, M., Vanni, R., Floderus, U.M., Mandahl, N., Liedgren, S.,

Lecca, U., and Mitelman, F. (1988). A specific translocation, t(12;14)(q14-

15;q23-24), characterizes a subgroup of uterine leiomyomas. Cancer Genet

Cytogenet, 32:13-7.

- 143 - 46. Pandis, N., Heim, S., Bardi, G., Floderus, U.M., Willen, H., Mandahl, N., and

Mitelman, F. (1990). Parallel karyotypic evolution and tumor progression in

uterine leiomyoma. Genes Chromosomes Cancer, 2:311-7.

47. Nilbert, M., Heim, S., Mandahl, N., Floderus, U.M., Willen, H., Akerman, M.,

and Mitelman, F. (1988). Ring formation and structural rearrangements of

chromosome 1 as secondary changes in uterine leiomyomas with t(12;14)(q14-

15;q23-24). Cancer Genet Cytogenet, 36:183-90.

48. Pandis, N., Heim, S., Bardi, G., Floderus, U.M., Willen, H., Mandahl, N., and

Mitelman, F. (1991). Chromosome analysis of 96 uterine leiomyomas. Cancer

Genet Cytogenet, 55:11-8.

49. Wanschura, S., Hennig, Y., Deichert, U., Schoenmakers, E.F., Van de Ven,

W.J., Bartnitzke, S., and Bullerdiek, J. (1995). Molecular-cytogenetic

refinement of the 12q14-->q15 breakpoint region affected in uterine

leiomyomas. Cytogenet Cell Genet, 71:131-5.

50. Johansson, M., Dietrich, C., Mandahl, N., Hambraeus, G., Johansson, L.,

Clausen, P.P., Mitelman, F., and Heim, S. (1993). Recombinations of

chromosomal bands 6p21 and 14q24 characterise pulmonary hamartomas. Br J

Cancer, 67:1236-41.

51. Dos Santos, N.R. and Van Kessel, A.G. (1999). Chromosomal abnormalities:

detection and implications for cancer development. Anticancer Res, 19:4697-

714.

52. Rabbitts, T.H. (1994). Chromosomal translocations in human cancer. Nature,

372:143-9.

- 144 - 53. Pierotti, M.A., Bongarzone, I., Borello, M.G., Greco, A., Pilotti, S., and Sozzi,

G. (1996). Cytogenetics and molecular genetics of carcinomas arising from

thyroid epithelial follicular cells. Genes Chromosomes Cancer, 16:1-14.

54. Turc-Carel, C., Limon, J., Dal Cin, P., Rao, U., Karakousis, C., and Sandberg,

A.A. (1986). Cytogenetic studies of adipose tissue tumors. II. Recurrent

reciprocal translocation t(12;16)(q13;p11) in myxoid liposarcomas. Cancer

Genet Cytogenet, 23:291-9.

55. Zucman, J., Melot, T., Desmaze, C., Ghysdael, J., Plougastel, B., Peter, M.,

Zucker, J.M., Triche, T.J., Sheer, D., Turc-Carel, C., and et al. (1993).

Combinatorial generation of variable fusion proteins in the Ewing family of

tumours. EMBO J, 12:4481-7.

56. Stenman, G., Andersson, H., Mandahl, N., Meis-Kindblom, J.M., and

Kindblom, L.G. (1995). Translocation t(9;22)(q22;q12) is a primary cytogenetic

abnormality in extraskeletal myxoid chondrosarcoma. Int J Cancer, 62:398-402.

57. Van de Ven, W.J., Schoenmakers, E.F., Wanschura, S., Kazmierczak, B., Kools,

P.F., Geurts, J.M., Bartnitzke, S., Van den Berghe, H., and Bullerdiek, J. (1995).

Molecular characterization of MAR, a multiple aberration region on human

chromosome segment 12q13-q15 implicated in various solid tumors. Genes

Chromosomes Cancer, 12:296-303.

58. Aman, P. (1999). Fusion genes in solid tumors. Semin Cancer Biol, 9:303-18.

59. Sanchez-Garcia, I. (1997). Consequences of chromosomal abnormalities in

tumor development. Annu Rev Genet, 31:429-53.

- 145 - 60. Nowell, P.C. and Hungerford, D.A. (1960). A minute chromosome in human

chronic granulocytic leukemia. Science, 132:1497-1500.

61. Rowley, J.D. (1973). Letter: A new consistent chromosomal abnormality in

chronic myelogenous leukaemia identified by quinacrine fluorescence and

Giemsa staining. Nature, 243:290-3.

62. de Klein, A., van Kessel, A.G., Grosveld, G., Bartram, C.R., Hagemeijer, A.,

Bootsma, D., Spurr, N.K., Heisterkamp, N., Groffen, J., and Stephenson, J.R.

(1982). A cellular oncogene is translocated to the Philadelphia chromosome in

chronic myelocytic leukaemia. Nature, 300:765-7.

63. Shtivelman, E., Lifshitz, B., Gale, R.P., and Canaani, E. (1985). Fused transcript

of abl and bcr genes in chronic myelogenous leukaemia. Nature, 315:550-4.

64. Clark, S.S., McLaughlin, J., Crist, W.M., Champlin, R., and Witte, O.N. (1987).

Unique forms of the abl tyrosine kinase distinguish Ph1-positive CML from

Ph1-positive ALL. Science, 235:85-8.

65. Hermans, A., Heisterkamp, N., von Linden, M., van Baal, S., Meijer, D., van der

Plas, D., Wiedemann, L.M., Groffen, J., Bootsma, D., and Grosveld, G. (1987).

Unique fusion of bcr and c-abl genes in Philadelphia chromosome positive acute

lymphoblastic leukemia. Cell, 51:33-40.

66. Bongarzone, I., Vigneri, P., Mariani, L., Collini, P., Pilotti, S., and Pierotti, M.A.

(1998). RET/NTRK1 rearrangements in thyroid gland tumors of the papillary

carcinoma family: correlation with clinicopathological features. Clin Cancer

Res, 4:223-8.

- 146 - 67. Cobaleda, C., Perez-Losada, J., and Sanchez-Garcia, I. (1998). Chromosomal

abnormalities and tumor development: from genes to therapeutic mechanisms.

Bioessays, 20:922-30.

68. Jacobson, S. and Pillus, L. (1999). Modifying chromatin and concepts of cancer.

Curr Opin Genet Dev, 9:175-84.

69. Saha, V., Young, B.D., and Freemont, P.S. (1998). Translocations, fusion genes,

and acute leukemia. J Cell Biochem Suppl, 31:264-76.

70. Chakraborty, S., Senyuk, V., and Nucifora, G. (2001). Genetic lesions and

perturbation of chromatin architecture: a road to cell transformation. J Cell

Biochem, 82:310-25.

71. Schoenmakers, E.F., Mols, R., Wanschura, S., Kools, P.F., Geurts, J.M.,

Bartnitzke, S., Bullerdiek, J., van den Berghe, H., and Van de Ven, W.J. (1994).

Identification, molecular cloning, and characterization of the chromosome 12

breakpoint cluster region of uterine leiomyomas. Genes Chromosomes Cancer,

11:106-18.

72. Bhugra, B., Smolarek, T.A., Lynch, R.A., Meloni, A.M., Sandberg, A.A.,

Deaven, L., and Menon, A.G. (1998). Cloning of a breakpoint cluster region on

chromosome 14 in uterine leiomyoma. Cancer Lett, 126:119-26.

73. Lynch, R.A., Piper, M., Bankier, A., Bhugra, B., Surti, U., Liu, J., Buckler, A.,

Dear, P.H., and Menon, A.G. (1998). Genomic and functional map of the

chromosome 14 t(12;14) breakpoint cluster region in uterine leiomyoma.

Genomics, 52:17-26.

- 147 - 74. Schoenmakers, E.F., Wanschura, S., Mols, R., Bullerdiek, J., Van den Berghe,

H., and Van de Ven, W.J. (1995). Recurrent rearrangements in the high mobility

group protein gene, HMGI- C, in benign mesenchymal tumours. Nat Genet,

10:436-44.

75. Wasylyk, B., Wasylyk, C., and Chambon, P. (1984). Short and long range

activation by the SV40 enhancer. Nucleic Acids Res, 12:5589-608.

76. Bulger, M., van Doorninck, J.H., Saitoh, N., Telling, A., Farrell, C., Bender,

M.A., Felsenfeld, G., Axel, R., Groudine, M., and von Doorninck, J.H. (1999).

Conservation of sequence and structure flanking the mouse and human beta-

globin loci: The beta-globin genes are embedded within an array of odorant

receptor genes. Proc Natl Acad Sci U S A, 96:5129-34.

77. Tuan, D., Solomon, W., Li, Q., and London, I.M. (1985). The beta-like-globin

gene domain in human erythroid cells. Proc Natl Acad Sci U S A, 82:6384-8.

78. Fleenor, D.E. and Kaufman, R.E. (1993). Characterization of the DNase I

hypersensitive site 3' of the human beta globin gene domain. Blood, 81:2781-90.

79. Grosveld, F., van Assendelft, G.B., Greaves, D.R., and Kollias, G. (1987).

Position-independent, high-level expression of the human beta-globin gene in

transgenic mice. Cell, 51:975-85.

80. Li, Q., Harju, S., and Peterson, K.R. (1999). Locus control regions: Coming of

age at a decade plus. Trends Genet, 15:403-8.

81. Chernov, I.P., Akopov, S.B., Nikolaev, L.G., and Sverdlov, E.D. (2002).

Identification and mapping of nuclear matrix-attachment regions in a one

- 148 - megabase locus of human chromosome 19q13.12: Long-range correlation of

S/MARs and gene positions. J Cell Biochem, 84:590-600.

82. Jackson, D.A., Dickinson, P., and Cook, P.R. (1990). The size of chromatin

loops in HeLa cells. EMBO J, 9:567-71.

83. Bulger, M. and Groudine, M. (1999). Looping versus linking: Toward a model

for long-distance gene activation. Genes Dev, 13:2465-77.

84. Dorsett, D. (1993). Distance-independent inactivation of an enhancer by the

suppressor of Hairy-wing DNA-binding protein of Drosophila. Genetics,

134:1135-44.

85. Constancia, M., Pickard, B., Kelsey, G., and Reik, W. (1998). Imprinting

mechanisms. Genome Res, 8:881-900.

86. Pikaard, C.S. (2000). Nucleolar dominance: Uniparental gene silencing on a

multi-megabase scale in genetic hybrids. Plant Mol Biol, 43:163-77.

87. Buiting, K., Saitoh, S., Gross, S., Dittrich, B., Schwartz, S., Nicholls, R.D., and

Horsthemke, B. (1995). Inherited microdeletions in the Angelman and Prader-

Willi syndromes define an imprinting centre on human chromosome 15. Nat

Genet, 9:395-400.

88. Avner, P. and Heard, E. (2001). X-chromosome inactivation: Counting, choice

and initiation. Nat Rev Genet, 2:59-67.

89. Brown, C.J., Ballabio, A., Rupert, J.L., Lafreniere, R.G., Grompe, M.,

Tonlorenzi, R., and Willard, H.F. (1991). A gene from the region of the human

X inactivation centre is expressed exclusively from the inactive X chromosome.

Nature, 349:38-44.

- 149 - 90. Davie, J.R. and Spencer, V.A. (1999). Control of histone modifications. J Cell

Biochem, Suppl 32/33:141-8.

91. Robertson, K.D. and Jones, P.A. (2000). DNA methylation: Past, present and

future directions. Carcinogenesis, 21:461-7.

92. Nan, X., Ng, H.H., Johnson, C.A., Laherty, C.D., Turner, B.M., Eisenman, R.N.,

and Bird, A. (1998). Transcriptional repression by the methyl-CpG-binding

protein MeCP2 involves a histone deacetylase complex. Nature, 393:386-9.

93. Jones, P.L., Veenstra, G.J., Wade, P.A., Vermaak, D., Kass, S.U., Landsberger,

N., Strouboulis, J., and Wolffe, A.P. (1998). Methylated DNA and MeCP2

recruit histone deacetylase to repress transcription. Nat Genet, 19:187-91.

94. Ng, H.H., Zhang, Y., Hendrich, B., Johnson, C.A., Turner, B.M., Erdjument-

Bromage, H., Tempst, P., Reinberg, D., and Bird, A. (1999). MBD2 is a

transcriptional repressor belonging to the MeCP1 histone deacetylase complex.

Nat Genet, 23:58-61.

95. Wade, P.A., Gegonne, A., Jones, P.L., Ballestar, E., Aubry, F., and Wolffe, A.P.

(1999). Mi-2 complex couples DNA methylation to chromatin remodelling and

histone deacetylation. Nat Genet, 23:62-6.

96. Zhang, Y., Ng, H.H., Erdjument-Bromage, H., Tempst, P., Bird, A., and

Reinberg, D. (1999). Analysis of the NuRD subunits reveals a histone

deacetylase core complex and a connection with DNA methylation. Genes Dev,

13:1924-35.

97. Schubeler, D., Lorincz, M.C., Cimbora, D.M., Telling, A., Feng, Y.Q.,

Bouhassira, E.E., and Groudine, M. (2000). Genomic targeting of methylated

- 150 - DNA: Influence of methylation on transcription, replication, chromatin

structure, and histone acetylation. Mol Cell Biol, 20:9103-12.

98. Cairns, B.R. (2001). Emerging roles for chromatin remodeling in cancer

biology. Trends Cell Biol, 11:S15-21.

99. Lavau, C., Du, C., Thirman, M., and Zeleznik-Le, N. (2000). Chromatin-related

properties of CBP fused to MLL generate a myelodysplastic-like syndrome that

evolves into myeloid leukemia. EMBO J, 19:4655-64.

100. Grignani, F., De Matteis, S., Nervi, C., Tomassoni, L., Gelmetti, V., Cioce, M.,

Fanelli, M., Ruthardt, M., Ferrara, F.F., Zamir, I., Seiser, C., Lazar, M.A.,

Minucci, S., and Pelicci, P.G. (1998). Fusion proteins of the retinoic acid

receptor-alpha recruit histone deacetylase in promyelocytic leukaemia. Nature,

391:815-8.

101. Ashar, H.R., Fejzo, M.S., Tkachenko, A., Zhou, X., Fletcher, J.A.,

Weremowicz, S., Morton, C.C., and Chada, K. (1995). Disruption of the

architectural factor HMGI-C: DNA-binding AT hook motifs fused in lipomas to

distinct transcriptional regulatory domains. Cell, 82:57-65.

102. Patel, U.A., Bandiera, A., Manfioletti, G., Giancotti, V., Chau, K.Y., and Crane-

Robinson, C. (1994). Expression and cDNA cloning of human HMGI-C

phosphoprotein. Biochem Biophys Res Commun, 201:63-70.

103. Manfioletti, G., Rustighi, A., Mantovani, F., Goodwin, G.H., and Giancotti, V.

(1995). Isolation and characterization of the gene coding for murine high-

mobility-group protein HMGI-C. Gene, 167:249-53.

- 151 - 104. Aravind, L. and Landsman, D. (1998). AT-hook motifs identified in a wide

variety of DNA-binding proteins. Nucleic Acids Res, 26:4413-21.

105. Li, D., Lin, H.H., McMahon, M., Ma, H., and Ann, D.K. (1997). Oncogenic raf-

1 induces the expression of non-histone chromosomal architectural protein

HMGI-C via a p44/p42 mitogen-activated protein kinase-dependent pathway in

salivary epithelial cells. J Biol Chem, 272:25062-70.

106. Ruyter-Spira, C.P., Herbergs, J., Limpens, E., Marsh, J.A., van der Poel, J.J.,

Ayoubi, T.A., and Groenen, M.A. (1998). Nucleotide sequence of the chicken

HMGI-C cDNA and expression of the HMGI-C and IGF1 genes in autosomal

dwarf chicken embryos. Biochim Biophys Acta, 1399:83-7.

107. Hirning-Folz, U., Wilda, M., Rippe, V., Bullerdiek, J., and Hameister, H.

(1998). The expression pattern of the Hmgic gene during development. Genes

Chromosomes Cancer, 23:350-7.

108. Gattas, G.J., Quade, B.J., Nowak, R.A., and Morton, C.C. (1999). HMGIC

expression in human adult and fetal tissues and in uterine leiomyomata. Genes

Chromosomes Cancer, 25:316-22.

109. Broberg, K., Tallini, G., Hoglund, M., Lindstrand, A., Toksvig-Larsen, S., and

Mertens, F. (2001). The tumor-associated gene HMGIC is expressed in normal

and osteoarthritis-affected synovia. Mod Pathol, 14:311-7.

110. Hauke, S., Flohr, A.M., Rogalla, P., and Bullerdiek, J. (2002). Sequencing of

intron 3 of HMGA2 uncovers the existence of a novel exon. Genes

Chromosomes Cancer, 34:17-23.

- 152 - 111. Rogalla, P., Drechsler, K., Frey, G., Hennig, Y., Helmke, B., Bonk, U., and

Bullerdiek, J. (1996). HMGI-C expression patterns in human tissues.

Implications for the genesis of frequent mesenchymal tumors. Am J Pathol,

149:775-9.

112. Chin, M.T., Pellacani, A., Hsieh, C.M., Lin, S.S., Jain, M.K., Patel, A., Huggins,

G.S., Reeves, R., Perrella, M.A., and Lee, M.E. (1999). Induction of high

mobility group I architectural transcription factors in proliferating vascular

smooth muscle in vivo and in vitro. J Mol Cell Cardiol, 31:2199-205.

113. Ayoubi, T.A., Jansen, E., Meulemans, S.M., and Van de Ven, W.J. (1999).

Regulation of HMGIC expression: an architectural transcription factor involved

in growth control and development. Oncogene, 18:5076-87.

114. Chau, K., Arlotta, P., Patel, U.A., Crane-Robinson, C., Manfioletti, G., and Ono,

S.J. (1999). A novel downstream positive regulatory element mediating

transcription of the human high mobility group (HMG) I-C gene. FEBS Lett,

457:429-36.

115. Rustighi, A., Mantovani, F., Fusco, A., Giancotti, V., and Manfioletti, G. (1999).

Sp1 and CTF/NF-1 transcription factors are involved in the basal expression of

the Hmgi-c proximal promoter. Biochem Biophys Res Commun, 265:439-47.

116. Borrmann, L., Wilkening, S., and Bullerdiek, J. (2001). The expression of

HMGA genes is regulated by their 3' UTR. Oncogene, 20:4537-41.

117. Klotzbucher, M., Wasserfall, A., and Fuhrmann, U. (1999). Misexpression of

wild-type and truncated isoforms of the high-mobility group I proteins HMGI-C

and HMGI(Y) in uterine leiomyomas. Am J Pathol, 155:1535-42.

- 153 - 118. Williams, A.J., Powell, W.L., Collins, T., and Morton, C.C. (1997). HMGI(Y)

expression in human uterine leiomyomata. Involvement of another high-

mobility group architectural factor in a benign neoplasm. Am J Pathol, 150:911-

8.

119. Chiappetta, G., Bandiera, A., Berlingieri, M.T., Visconti, R., Manfioletti, G.,

Battista, S., Martinez-Tello, F.J., Santoro, M., Giancotti, V., and Fusco, A.

(1995). The expression of the high mobility group HMGI (Y) proteins correlates

with the malignant phenotype of human thyroid neoplasias. Oncogene, 10:1307-

14.

120. Liu, F., Chau, K.Y., Arlotta, P., and Ono, S.J. (2001). The HMG I proteins:

Dynamic roles in gene activation, development, and tumorigenesis. Immunol

Res, 24:13-29.

121. Zhou, X., Benson, K.F., Ashar, H.R., and Chada, K. (1995). Mutation

responsible for the mouse pygmy phenotype in the developmentally regulated

factor HMGI-C. Nature, 376:771-4.

122. Anand, A. and Chada, K. (2000). In vivo modulation of Hmgic reduces obesity.

Nat Genet, 24:377-80.

123. Hunter, D.S., Klotzbucher, M., Kugoh, H., Cai, S.L., Mullen, J.P., Manfioletti,

G., Fuhrman, U., and Walker, C.L. (2002). Aberrant Expression of HMGA2 in

Uterine Leiomyoma Associated with Loss of TSC2 Tumor Suppressor Gene

Function. Cancer Res, 62:3766-72.

- 154 - 124. Schoenmakers, E.F., Huysmans, C., and Van de Ven, W.J. (1999). Allelic

knockout of novel splice variants of human recombination repair gene RAD51B

in t(12;14) uterine leiomyomas. Cancer Res, 59:19-23.

125. Schoenberg Fejzo, M., Ashar, H.R., Krauter, K.S., Powell, W.L., Rein, M.S.,

Weremowicz, S., Yoon, S.J., Kucherlapati, R.S., Chada, K., and Morton, C.C.

(1996). Translocation breakpoints upstream of the HMGIC gene in uterine

leiomyomata suggest dysregulation of this gene by a mechanism different from

that in lipomas. Genes Chromosomes Cancer, 17:1-6.

126. Fedele, M., Berlingieri, M.T., Scala, S., Chiariotti, L., Viglietto, G., Rippel, V.,

Bullerdiek, J., Santoro, M., and Fusco, A. (1998). Truncated and chimeric

HMGI-C genes induce neoplastic transformation of NIH3T3 murine fibroblasts.

Oncogene, 17:413-8.

127. Arlotta, P., Tai, A.K., Manfioletti, G., Clifford, C., Jay, G., and Ono, S.J. (2000).

Transgenic Mice Expressing a Truncated Form of the High Mobility Group I-C

Protein Develop Adiposity and an Abnormally High Prevalence of Lipomas. J

Biol Chem, 275:14394-400.

128. Battista, S., Fidanza, V., Fedele, M., Klein-Szanto, A.J., Outwater, E., Brunner,

H., Santoro, M., Croce, C.M., and Fusco, A. (1999). The expression of a

truncated HMGI-C gene induces gigantism associated with lipomatosis. Cancer

Res, 59:4793-7.

129. Baldassarre, G., Fedele, M., Battista, S., Vecchione, A., Klein-Szanto, A.J.,

Santoro, M., Waldmann, T.A., Azimi, N., Croce, C.M., and Fusco, A. (2001).

Onset of natural killer cell lymphomas in transgenic mice carrying a truncated

- 155 - HMGI-C gene by the chronic stimulation of the IL-2 and IL-15 pathway. Proc

Natl Acad Sci U S A, 98:7970-5.

130. Rice, M.C., Smith, S.T., Bullrich, F., Havre, P., and Kmiec, E.B. (1997).

Isolation of human and mouse genes based on homology to REC2, a

recombinational repair gene from the fungus Ustilago maydis. Proc Natl Acad

Sci U S A, 94:7417-22.

131. Albala, J.S., Thelen, M.P., Prange, C., Fan, W., Christensen, M., Thompson,

L.H., and Lennon, G.G. (1997). Identification of a novel human RAD51

homolog, RAD51B. Genomics, 46:476-9.

132. Cartwright, R., Dunn, A.M., Simpson, P.J., Tambini, C.E., and Thacker, J.

(1998). Isolation of novel human and mouse genes of the recA/RAD51

recombination-repair gene family. Nucleic Acids Res, 26:1653-9.

133. Ingraham, S.E., Lynch, R.A., Kathiresan, S., Buckler, A.J., and Menon, A.G.

(1999). hREC2, a RAD51-like gene, is disrupted by t(12;14) (q15;q24.1) in a

uterine leiomyoma. Cancer Genet Cytogenet, 115:56-61.

134. Thacker, J. (1999). The role of homologous recombination processes in the

repair of severe forms of DNA damage in mammalian cells. Biochimie, 81:77-

85.

135. Vamvakas, S., Vock, E.H., and Lutz, W.K. (1997). On the role of DNA double-

strand breaks in toxicity and carcinogenesis. Crit Rev Toxicol, 27:155-74.

136. Petrini, J.H., Bressan, D.A., and Yao, M.S. (1997). The RAD52 epistasis group

in mammalian double strand break repair. Semin Immunol, 9:181-8.

- 156 - 137. Masson, J.Y., Tarsounas, M.C., Stasiak, A.Z., Stasiak, A., Shah, R., McIlwraith,

M.J., Benson, F.E., and West, S.C. (2001). Identification and purification of two

distinct complexes containing the five RAD51 paralogs. Genes Dev, 15:3296-

307.

138. Schild, D., Lio, Y., Collins, D.W., Tsomondo, T., and Chen, D.J. (2000).

Evidence for simultaneous protein interactions between human Rad51 paralogs.

J Biol Chem, 275:16443-9.

139. Sigurdsson, S., Van Komen, S., Bussen, W., Schild, D., Albala, J.S., and Sung,

P. (2001). Mediator function of the human Rad51B-Rad51C complex in

Rad51/RPA- catalyzed DNA strand exchange. Genes Dev, 15:3308-18.

140. Shu, Z., Smith, S., Wang, L., Rice, M.C., and Kmiec, E.B. (1999). Disruption of

muREC2/RAD51L1 in mice results in early embryonic lethality which can Be

partially rescued in a p53(-/-) background. Mol Cell Biol, 19:8686-93.

141. Takata, M., Sasaki, M.S., Sonoda, E., Fukushima, T., Morrison, C., Albala, J.S.,

Swagemakers, S.M., Kanaar, R., Thompson, L.H., and Takeda, S. (2000). The

Rad51 paralog Rad51B promotes homologous recombinational repair. Mol Cell

Biol, 20:6476-82.

142. Takata, M., Sasaki, M.S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D.,

Thompson, L.H., and Takeda, S. (2001). Chromosome instability and defective

recombinational repair in knockout mutants of the five Rad51 paralogs. Mol Cell

Biol, 21:2858-66.

143. Boulikas, T. (1996). Xeroderma pigmentosum and molecular cloning of DNA

repair genes. Anticancer Res, 16:693-708.

- 157 - 144. Carreau, M. and Buchwald, M. (1998). The Fanconi anemia genes. Curr Opin

Pediatr, 10:65-9.

145. de Winter, J.P., Waisfisz, Q., Rooimans, M.A., van Berkel, C.G., Bosnoyan-

Collins, L., Alon, N., Carreau, M., Bender, O., Demuth, I., Schindler, D., Pronk,

J.C., Arwert, F., Hoehn, H., Digweed, M., Buchwald, M., and Joenje, H. (1998).

The Fanconi anaemia group G gene FANCG is identical with XRCC9. Nat

Genet, 20:281-3.

146. Savitsky, K., Bar-Shira, A., Gilad, S., Rotman, G., Ziv, Y., Vanagaite, L., Tagle,

D.A., Smith, S., Uziel, T., Sfez, S., and et al. (1995). A single ataxia

telangiectasia gene with a product similar to PI-3 kinase. Science, 268:1749-53.

147. Ellis, N.A., Groden, J., Ye, T.Z., Straughen, J., Lennon, D.J., Ciocci, S.,

Proytcheva, M., and German, J. (1995). The Bloom's syndrome gene product is

homologous to RecQ helicases. Cell, 83:655-66.

148. Sturzbecher, H.W., Donzelmann, B., Henning, W., Knippschild, U., and

Buchhop, S. (1996). p53 is linked directly to homologous recombination

processes via RAD51/RecA protein interaction. EMBO J, 15:1992-2002.

149. Buchhop, S., Gibson, M.K., Wang, X.W., Wagner, P., Sturzbecher, H.W., and

Harris, C.C. (1997). Interaction of p53 with the human Rad51 protein. Nucleic

Acids Res, 25:3868-74.

150. Wang, X.W., Vermeulen, W., Coursen, J.D., Gibson, M., Lupold, S.E.,

Forrester, K., Xu, G., Elmore, L., Yeh, H., Hoeijmakers, J.H., and Harris, C.C.

(1996). The XPB and XPD DNA helicases are components of the p53-mediated

apoptosis pathway. Genes Dev, 10:1219-32.

- 158 - 151. Chen, Y., Lee, W.H., and Chew, H.K. (1999). Emerging roles of BRCA1 in

transcriptional regulation and DNA repair. J Cell Physiol, 181:385-92.

152. Chen, J.J., Silver, D., Cantor, S., Livingston, D.M., and Scully, R. (1999).

BRCA1, BRCA2, and Rad51 operate in a common DNA damage response

pathway. Cancer Res, 59:1752s-1756s.

153. Sambrook, J., Fritsch, E.F., and Maniatis, T. Molecular Cloning: A Laboratory

Manual, Cold Spring Harbor Laboroatory Press, Cold Spring Harbor, NY, 1989.

154. Lynch, R.A. Genomic and Transcriptional Mapping of the t(12;14)(q15;q24.1)

Breakpoint in Uterine Leiomyoma. Doctoral Dissertation, University of

Cincinnati, 1998.

155. Buckler, A.J., Chang, D.D., Graw, S.L., Brook, J.D., Haber, D.A., Sharp, P.A.,

and Housman, D.E. (1991). Exon amplification: A strategy to isolate

mammalian genes based on RNA splicing. Proc Natl Acad Sci U S A, 88:4005-

9.

156. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990).

Basic local alignment search tool. J Mol Biol, 215:403-10.

157. Hug, K., Doney, M.K., Tyler, M.J., Grundy, D.A., Soukup, S., Houseal, T.W.,

and Menon, A.G. (1994). Physical mapping of the uterine leiomyoma

t(12;14)(q13-15;q24.1) breakpoint on chromosome 14 between SPTB and

D14S77. Genes Chromosomes Cancer, 11:263-6.

158. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W.,

and Lipman, D.J. (1997). Gapped BLAST and PSI-BLAST: A new generation

of protein database search programs. Nucleic Acids Res, 25:3389-402.

- 159 - 159. Robbins, J., Dilworth, S.M., Laskey, R.A., and Dingwall, C. (1991). Two

interdependent basic domains in nucleoplasmin nuclear targeting sequence:

identification of a class of bipartite nuclear targeting sequence. Cell, 64:615-23.

160. Brendel, V., Brocchieri, L., Sandler, S.J., Clark, A.J., and Karlin, S. (1997).

Evolutionary comparisons of RecA-like proteins across all major kingdoms of

living organisms. J Mol Evol, 44:528-41.

161. Roca, A.I. and Cox, M.M. (1997). RecA protein: structure, function, and role in

recombinational DNA repair. Prog Nucleic Acid Res Mol Biol, 56:129-223.

162. Osman, F. and Subramani, S. (1998). Double-strand break-induced

recombination in eukaryotes. Prog Nucleic Acid Res Mol Biol, 58:263-99.

163. Nilbert, M., Heim, S., Mandahl, N., Floderus, U.M., Willen, H., and Mitelman,

F. (1988). Karyotypic rearrangements in 20 uterine leiomyomas. Cytogenet Cell

Genet, 49:300-4.

164. Takahashi, T., Nagai, N., Oda, H., Ohama, K., Kamada, N., and Miyagawa, K.

(2001). Evidence for RAD51L1/HMGIC fusion in the pathogenesis of uterine

leiomyoma. Genes Chromosomes Cancer, 30:196-201.

165. Kazmierczak, B., Pohnke, Y., and Bullerdiek, J. (1996). Fusion transcripts

between the HMGIC gene and RTVL-H-related sequences in mesenchymal

tumors without cytogenetic aberrations. Genomics, 38:223-6.

166. Mount, S.M. (1982). A catalogue of splice junction sequences. Nucleic Acids

Res, 10:459-72.

- 160 - 167. Kurose, K., Mine, N., Iida, A., Nagai, H., Harada, H., Araki, T., and Emi, M.

(2001). Three aberrant splicing variants of the HMGIC gene transcribed in

uterine leiomyomas. Genes Chromosomes Cancer, 30:212-7.

168. Hauke, S., Rippe, V., and Bullerdiek, J. (2001). Chromosomal rearrangements

leading to abnormal splicing within intron 4 of HMGIC? Genes Chromosomes

Cancer, 30:302-4.

169. Mine, N., Kurose, K., Nagai, H., Doi, D., Ota, Y., Yoneyama, K., Konishi, H.,

Araki, T., and Emi, M. (2001). Gene fusion involving HMGIC is a frequent

aberration in uterine leiomyomas. J Hum Genet, 46:408-12.

170. Huret, J., Dessen, P., and Bernheim, A. (2001). Atlas of Genetics and

Cytogenetics in Oncology and Haematology. (online;

http://www.infobiogen.fr/services/chromcancer).

171. Kazmierczak, B., Bullerdiek, J., Pham, K.H., Bartnitzke, S., and Wiesner, H.

(1998). Intron 3 of HMGIC is the most frequent target of chromosomal

aberrations in human tumors and has been conserved basically for at least 30

million years. Cancer Genet Cytogenet, 103:175-7.

172. Eddy, S.R. (1999). Noncoding RNA genes. Curr Opin Genet Dev, 9:695-9.

173. Mattick, J.S. and Gagen, M.J. (2001). The evolution of controlled multitasked

gene networks: the role of introns and other noncoding RNAs in the

development of complex organisms. Mol Biol Evol, 18:1611-30.

174. Penny, G.D., Kay, G.F., Sheardown, S.A., Rastan, S., and Brockdorff, N.

(1996). Requirement for Xist in X chromosome inactivation. Nature, 379:131-7.

- 161 - 175. Lee, J.T., Davidow, L.S., and Warshawsky, D. (1999). Tsix, a gene antisense to

Xist at the X-inactivation centre. Nat Genet, 21:400-4.

176. Amrein, H. and Axel, R. (1997). Genes expressed in neurons of adult male

Drosophila. Cell, 88:459-69.

177. Meller, V.H., Wu, K.H., Roman, G., Kuroda, M.I., and Davis, R.L. (1997). roX1

RNA paints the X chromosome of male Drosophila and is regulated by the

dosage compensation system. Cell, 88:445-57.

178. Askew, D.S., Li, J., and Ihle, J.N. (1994). Retroviral insertions in the murine

His-1 locus activate the expression of a novel RNA that lacks an extensive open

reading frame. Mol Cell Biol, 14:1743-51.

179. Lakhotia, S.C. and Sharma, A. (1996). The 93D (hsr-omega) locus of

Drosophila: Non-coding gene with house-keeping functions. Genetica, 97:339-

48.

180. Nemes, J.P., Benzow, K.A., Moseley, M.L., Ranum, L.P., and Koob, M.D.

(2000). The SCA8 transcript is an antisense RNA to a brain-specific transcript

encoding a novel actin-binding protein (KLHL1). Hum Mol Genet, 9:1543-51.

181. Brannan, C.I., Dees, E.C., Ingram, R.S., and Tilghman, S.M. (1990). The

product of the H19 gene may function as an RNA. Mol Cell Biol, 10:28-36.

182. Hao, Y., Crenshaw, T., Moulton, T., Newcomb, E., and Tycko, B. (1993).

Tumour-suppressor activity of H19 RNA. Nature, 365:764-7.

183. Mlynarczyk, S.K. and Panning, B. (2000). X inactivation: Tsix and Xist as yin

and yang. Curr Biol, 10:R899-903.

- 162 - 184. Carthew, R.W. (2001). Gene silencing by double-stranded RNA. Curr Opin Cell

Biol, 13:244-8.

185. Hammond, S.M., Caudy, A.A., and Hannon, G.J. (2001). Post-transcriptional

gene silencing by double-stranded RNA. Nat Rev Genet, 2:110-9.

186. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C.

(1998). Potent and specific genetic interference by double-stranded RNA in

Caenorhabditis elegans. Nature, 391:806-11.

187. Mendell, J.T. and Dietz, H.C. (2001). When the message goes awry: Disease-

producing mutations that influence mRNA content and performance. Cell,

107:411-4.

188. Eddy, S.R. (2002). Computational genomics of noncoding RNA genes. Cell,

109:137-40.

189. Elliott, B. and Jasin, M. (2002). Double-strand breaks and translocations in

cancer. Cell Mol Life Sci, 59:373-85.

190. Amant, F., Debiec-Rychter, M., Schoenmakers, E.F., Hagemeijer-Hausman, A.,

and Vergote, I. (2001). Cumulative dosage effect of a RAD51L1/HMGA2

fusion and RAD51L1 loss in a case of pseudo-Meigs' syndrome. Genes

Chromosomes Cancer, 32:324-9.

191. Hess, J.L. (1998). Chromosomal translocations in benign tumors: the HMGI

proteins. Am J Clin Pathol, 109:251-61.

192. Van de Ven, W.J. (1998). Genetic basis of uterine leiomyoma: involvement of

high mobility group protein genes. Eur J Obstet Gynecol Reprod Biol, 81:289-

93.

- 163 - 193. Tallini, G. and Dal Cin, P. (1999). HMGI(Y) and HMGI-C dysregulation: a

common occurrence in human tumors. Adv Anat Pathol, 6:237-46.

194. Gross, K.L. and Morton, C.C. (2001). Genetics and the development of fibroids.

Clin Obstet Gynecol, 44:335-49.

195. Domer, P.H., Head, D.R., Renganathan, N., Raimondi, S.C., Yang, E., and

Atlas, M. (1995). Molecular analysis of 13 cases of MLL/11q23 secondary acute

leukemia and identification of topoisomerase II consensus-binding sequences

near the chromosomal breakpoint of a secondary leukemia with the t(4;11).

Leukemia, 9:1305-12.

196. Felix, C.A., Lange, B.J., Hosler, M.R., Fertala, J., and Bjornsti, M.A. (1995).

Chromosome band 11q23 translocation breakpoints are DNA topoisomerase II

cleavage sites. Cancer Res, 55:4287-92.

197. Ligon, A.H. and Morton, C.C. (2000). Genetics of uterine leiomyomata. Genes

Chromosomes Cancer, 28:235-45.

198. Haaf, T., Raderschall, E., Reddy, G., Ward, D.C., Radding, C.M., and Golub,

E.I. (1999). Sequestration of mammalian Rad51-recombination protein into

micronuclei. J Cell Biol, 144:11-20.

199. Christodoulopoulos, G., Malapetsa, A., Schipper, H., Golub, E., Radding, C.,

and Panasci, L.C. (1999). Chlorambucil induction of HsRad51 in B-cell chronic

lymphocytic leukemia. Clin Cancer Res, 5:2178-84.

200. Fornace, A.J., Jr., Jackman, J., Hollander, M.C., Hoffman-Liebermann, B., and

Liebermann, D.A. (1992). Genotoxic-stress-response genes and growth-arrest

- 164 - genes. gadd, MyD, and other genes induced by treatments eliciting growth

arrest. Ann N Y Acad Sci, 663:139-53.

201. Grombacher, T., Mitra, S., and Kaina, B. (1996). Induction of the

alkyltransferase (MGMT) gene by DNA damaging agents and the glucocorticoid

dexamethasone and comparison with the response of base excision repair genes.

Carcinogenesis, 17:2329-36.

202. Peng, L., Rice, M.C., and Kmiec, E.B. (1998). Analysis of the human RAD51L1

promoter region and its activation by UV light. Genomics, 54:529-41.

203. Havre, P.A., Rice, M.C., Noe, M., and Kmiec, E.B. (1998). The human

REC2/RAD51B gene acts as a DNA damage sensor by inducing G1 delay and

hypersensitivity to ultraviolet irradiation. Cancer Res, 58:4733-9.

204. Havre, P.A., Rice, M., Ramos, R., and Kmiec, E.B. (2000). HsRec2/Rad51L1, a

protein influencing cell cycle progression, has protein kinase activity. Exp Cell

Res, 254:33-44.

- 165 - Appendix I: Analysis of Rad51L1 Expression in Response to

DNA-Damaging Agents

RAD51L1 is classified as a DNA repair and recombination gene on the basis of its sequence similarity to the RAD51 family of genes and its biochemical and physiological characteristics. Sequence analysis of Rad51L1 reveals domains characteristic of RecA homologs, including a nuclear localization signal and Walker A and B motifs for nucleotide binding [130,131]. Physiological and biochemical functional assays also suggest a role for Rad51L1 in repairing DNA damage and maintaining genome integrity [137,139,141].

Expression levels of many of the genes involved in DNA repair pathways are increased following DNA damage; for example, Rad51 is induced by γ-irradiation [198] or chlorambucil [199], and a family of genes known as growth arrest- and DNA damage-inducible (GADD) are induced by various genotoxic and non-genotoxic stresses including serum starvation, ultraviolet irradiation and treatment with alkylating agents. These genes play a protective role in that their coordinated expression signals a growth arrest to allow DNA repair to occur before cell division [200]. Furthermore, genotoxic agents can induce expression of genes specific for repairing the type of DNA damage the agent causes. An example is the alkyltransferase 06-methylguanine-DNA methyltransferase (MGMT), which is involved in the repair of alkylated bases and is induced in rat hepatoma cells up to 4.5-fold after exposure to methylating agents [201].

- 166 - Upregulation of RAD51L1 occurs following exposure of cells to γ-irradiation

[130], and its promoter contains a UV-activated element [202]. The induction of the gene by these genotoxic agents, considered in the context of its functional and sequence similarity to genes implicated in recombinational repair, suggests that RAD51L1 is likely to be involved in the repair of DNA damage by recombinational mechanisms.

Rad51L1 also may play a role in a phosphorylation signal transduction cascade.

It contains a putative src phosphorylation target site which is critical for at least some of its functions [203]. His-tagged Rad51L1 purified from bacterial or baculoviral expression systems phosphorylates an artificial heptapeptide serine phosphorylation substrate as well as p53, myelin basic protein, cyclin E, and cdk2 [204]. Although the in vivo relevance of this observation is yet to be determined, it both suggests an unexpected role for Rad51L1 and points to a possible functional interaction between

Rad51L1 and the p53 tumor suppressor gene product. Furthermore, p53 may influence the expression of RAD51L1, indicating a potential feedback pathway [202]. The UV- responsiveness of the RAD51L1 promoter (discussed above) was not detectable in a p53-null cell line, a finding consistent with the identification of a consensus p53 binding sequence within the promoter [202]. Consistent with these reports, we found that

Rad51L1 expression is absent in the p53-null cell line Hep3B (Figure 27).

EFFECT OF GENOTOXIC AGENTS ON RAD51L1 EXPRESSION

To understand the potential role of RAD51L1 in DNA repair, we tested for induction of Rad51L1 in cultured cells following treatment with a variety of DNA damaging agents. Of six DNA-damaging agents tested, only cisplatin was found to

- 167 - Figure 27: Expression of Rad51L1 is p53-Dependent

Rad51L1 protein is readily detectable by Western blot in p53+/+ cell lines 87MG and Hepa1-6 (left and center). Rad51L1 is

undetectable in the p53-null cell line Hep3B (right). Position of β-actin loading control is also indicated.

87MG human Hepa1-6 mouse Hep3B human

-168- glioma cells hepatoma cells hepatocarcinoma cells (p53+/+) (p53+/+) (p53-/-)

β-actin (42kDa)

RAD51L1 (39kDa)

increase expression of Rad51L1 in 87MG human glioma cells. The level of Rad51L1 protein increased approximately 1.4-fold 24 hours after treatment with cisplatin, a DNA alkylating and cross-linking agent (Figure 28).

Rad51L1 protein levels decreased by 30% 24 hours after exposure to low doses of UV irradiation (p<0.049; Figure 29); decreases in Rad51L1 protein levels were also seen at higher doses, although the changes did not reach statistical significance.

RAD51L1 mRNA levels (Figure 30) also decreased following exposure of cells to UV irradiation (p<0.048 at 10 J/m2; p<0.037 at 20 J/m2). The observation that expression of

RAD51L1 mRNA and protein decrease in response to UV irradiation, which induces a variety of DNA lesions including thymine dimers, acutely contrasts with a previous report that the RAD51L1 promoter is activated by UV irradiation in a luciferase assay utilizing HCT116 colon carcinoma cells [202].

Treatment of 87MG cells with etoposide, a topoisomerase IIα inhibitor, decreased Rad51L1 expression approximately 50% at the lowest concentration tested

(10 µM), although no statistically significant alterations were seen with higher doses

(Figure 31). Treatment of 87MG cells with methyl methanesulfonate (a DNA alkylating agent), mitomycin C (a DNA crosslinking agent), or camptothecin (a topoisomerase I inhibitor) did not alter Rad51L1 expression levels (Figure 31).

The relative lack of induction of RAD51L1 by DNA damage contrasts with the previously reported responses of DNA damage response genes such as RAD51 and the

GADD genes [198-200], suggesting that Rad51L1 may play a role distinct from these other DNA repair proteins. It is not known whether the results obtained can be

- 169 - Figure 28: Alterations in Rad51L1 Expression in Response to Cisplatin

(A) Western blot showing Rad51L1 protein expression increases in 87MG human glioma cells 24 hours after exposure to cisplatin.

(B) Quantitation of data shown in (A) indicates that expression of the Rad51L1 protein is increased approximately 1.4-fold over untreated controls 24 hours after exposure of

87MG human glioma cells to cisplatin. Stars indicate statistical significance.

A

β-actin (42kDa) RAD51L1 (39kDa) 10 30 untreated 20 µ µ µ M M M

cisplatin B

1.800 p < 0.015 p < 0.07 p < 0.007 1.600 1.400 1.200

-actin protein)-actin 1.000 0.800 0.600 0.400 0.200 (normalized to(normalized

Fold from Untreated Change Fold 0.000 0102030 Cisplatin (µM)

- 170 - Figure 29: Rad51L1 Expression Decreases in Response to Low-Dose UV

Irradiation

(A) Western blot showing Rad51L1 protein expression in 87MG human glioma cells 24 hours after exposure to UV irradiation.

(B) Quantitation of data shown in (A) indicates that expression of the Rad51L1 protein is decreased compared to untreated controls 24 hours after exposure of 87MG human glioma cells to low doses of UV irradiation. Stars indicate statistical significance.

A β-actin (42kDa) Rad51L1 (39kDa) 10 J/m 30 J/m 30 20 J/m untreated 2 2 2

UV Dose B 1.200

1.000 p < 0.15 p < 0.13 0.800 p < 0.049 -actin protein) 0.600

0.400

0.200 (normalized to

RAD51L1 Protein Expression Protein RAD51L1 0.000 0 102030 UV Dos e (J/ m2)

- 171 - Figure 30: RAD51L1 mRNA Decreases in Response to UV Irradiation

(A) Quantitative RT-PCR showing RAD51L1 mRNA expression in 87MG human

glioma cells 24 hours after exposure to UV irradiation

(B) Quantitation of data shown in (A) indicates that expression of the RAD51L1 mRNA

is decreased to approximately 40% compared to untreated controls 24 hours after

exposure of 87MG human glioma cells to low doses of UV irradiation. Stars indicate

statistical significance.

A

18S rRNA RAD51L1 10 J/m 30 J/m 20 J/m untreated 2 2 2

UV Dose B 1.2

1 p < 0.26 0.8

0.6 p < 0.048 p < 0.037

0.4 (normalized to 18S rRNA) (normalized 0.2 RAD51L1 mRNAExpression RAD51L1

0 0102030 UV Dose(J/m2)

- 172 - Figure 31: Effects of Camptothecin, Etoposide, Methyl Methanesulfonate and

Mitomycin C on RAD51L1 Expression

Quantitative RT-PCR and Western blots indicate that RAD51L1 mRNA and protein expression are not consistently altered 24 hours after exposure of 87MG human glioma cells to camptothecin, etoposide, methyl methanesulfonate (MMS), or mitomycin C.

RT-PCR and Western blot raw data are not shown. Stars indicate statistical significance.

- 173 - Figure 31

3

2.5

2

1.5

1

RAD51L1 mRNA ExpressionRAD51L1 mRNA 0.5 (Normalized to 18S rRNA,arbitrary units)

0 1.5 1.0 0.5 0.2 2 1 0 0 MMS Mitomycin C µ (mM) ( M)

1.4

1.2

1 p<0.023

0.8 -actin, arbitrary units) arbitrary -actin,

β 0.6

0.4 Rad51L1 Protein Expression

(Normalized to 0.2

0 1.5 10 30 1.0 0.5 0.2 20 30 10 20 2 1 0 0 0 0 Camptothecin Etoposide MMS Mitomycin C (µM) (µM) (mM) (µM)

- 174 - generalized or are specific to the cell type used. In particular, the response of endogenous RAD51L1 to UV irradiation in the HCT116 cells used by Peng and coworkers [202] should be investigated in order to resolve the apparent contradiction between their RAD51L1 promoter deletion analyses and the above-reported results.

Additional investigations could also determine whether the subcellular localization or compartmentalization of Rad51L1 changes in response to DNA damaging agents without significantly altering its total expression level in the cell.

- 175 -