IL-13 System by Β Regulation of the Monocyte IL-1 Transcriptional

Home , Biliverdin reductase A, Cathepsin, FGD1, FGD2, IGSF2, Interleukin 13

Transcriptional Profiling Reveals Complex Regulation of the Monocyte IL-1 β System by IL-13

This information is current as Chris J. Scotton, Fernando O. Martinez, Maaike J. Smelt, of September 29, 2021. Marina Sironi, Massimo Locati, Alberto Mantovani and Silvano Sozzani J Immunol 2005; 174:834-845; ; doi: 10.4049/jimmunol.174.2.834

http://www.jimmunol.org/content/174/2/834 Downloaded from

References This article cites 74 articles, 32 of which you can access for free at: http://www.jimmunol.org/content/174/2/834.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Transcriptional Proﬁling Reveals Complex Regulation of the Monocyte IL-1␤ System by IL-131

Chris J. Scotton,2* Fernando O. Martinez,*† Maaike J. Smelt,* Marina Sironi,* Massimo Locati,† Alberto Mantovani,*† and Silvano Sozzani3*‡

IL-4 and IL-13 are prototypic Th2 cytokines that generate an “alternatively activated” phenotype in macrophages. We used high-density oligonucleotide microarrays to investigate the transcriptional profile induced in human monocytes by IL-13. After 8-h stimulation with IL-13, 142 genes were regulated (85 increased and 57 decreased). The majority of these genes were related to the inflammatory response and innate immunity; a group of genes related to lipid metabolism was also identified, with clear implications for atherosclerosis. In addition to characteristic markers of alternatively activated macrophages, a number of novel IL-13-regulated genes were seen. These included various pattern recognition receptors, such as CD1b/c/e, TLR1, and C-type lectin

superfamily member 6. Several components of the IL-1 system were regulated. IL-1RI, IL-1RII, and IL-1Ra were all up-regulated, Downloaded from whereas the IL-1␤-converting enzyme, caspase 1, and IRAK-M were down-regulated. LPS-inducible caspase 1 enzyme activity was also reduced in IL-13-stimulated monocytes, with a consequent decrease in pro-IL-1␤ processing. These data reveal that IL-13 has a potent effect on the transcriptional profile in monocytes. The IL-13-induced modulation of genes related to IL-1 clearly highlights the tightly controlled and complex levels of regulation of the production and response to this potent proinflammatory cytokine. The Journal of Immunology, 2005, 174: 834–845. http://www.jimmunol.org/ onocytes and macrophages (M␾)4 play a central role TNF-␣, IL-12, IL-6, and CCL2; they up-regulate expression of Ϫ in both innate and adaptive immunity. They constitute MHC class II and CD86, and they produce NO and O2 (3, 5–7). M a nonspecific first line of defense by phagocytosing These cells are particularly important for killing and degrading opsonized or nonopsonized microorganisms; they can also act as intracellular pathogens. APCs, thereby stimulating a specific immune response. Monocytes Type 2-activated M␾ arise from Fc␥R ligation followed by ϩ are derived from CD34 myeloid progenitor cells in the bone mar- stimulation of TLR, CD40 or CD44. These cells produce many of row, and subsequently leave the bone marrow to circulate in the the cytokines seen in classically activated M␾ (e.g., TNF-␣ and bloodstream (1). Inflammation due to tissue damage or infection IL-6), but they switch off IL-12 production and secrete large quan- by guest on September 29, 2021 results in the production of cytokines, chemokines, and other in- tities of IL-10 (8–10). These cells therefore exert a potent anti- flammatory mediators, which can influence monocyte function, inflammatory effect, and because IL-10 can stimulate IL-4 produc- causing recruitment to the site of inflammation and differentiation tion by T cells, they also preferentially induce a Th2 response (11). ␾ ␾ into M . Different subpopulations of activated M exist, depend- In contrast, alternatively activated M␾ are induced by IL-4, IL- ␾ ing on the type of stimulus they receive. M are currently divided 13, or glucocorticoids. They secrete IL-10 and IL-1Ra and have into “classically activated,” “type 2-activated,” and “alternatively increased expression of scavenger receptor and mannose receptor, activated” populations (see Refs. 2–4 for recent review). but they are poor producers of reactive oxygen species or NO (3). ␾ ␥ In classical activation, exposure of M to IFN- primes the cells Thus, these cells are unable to efficiently kill intracellular patho- ␣ to respond to further stimulation by TNF- or an inducer of gens. The up-regulation of mannose receptor (12) may increase the ␣ TNF- , frequently LPS or other bacterially derived products. potential for alternatively activated M␾ to present Ag, as has been These cells secrete various cytokines and chemokines including shown for dendritic cells (DC) (13, 14), but these M␾ can also inhibit the proliferation of T cells under certain circumstances (15). *Istituto di Ricerche Farmacologiche Mario Negri, and †Section of General Pathol- Various cell types produce IL-4 and IL-13, including Th2 cells, ogy, University of Milan, Milan, Italy; and ‡Section of General Pathology and Im- mast cells, and basophils; they play an important role in Th2 in- munology, University of Brescia, Brescia, Italy flammation, particularly in the pathogenesis of allergy, asthma, Received for publication May 4, 2004. Accepted for publication October 14, 2004. atopic dermatitis, and also inhibition of certain forms of autoim- The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance munity (2). They have a similar three-dimensional structure and with 18 U.S.C. Section 1734 solely to indicate this fact. share receptor complexes (16). As a result, these two cytokines 1 C.J.S. was supported by a Marie Curie Fellowship from the European Community signal through common components; IL-13 binding causes activa- Human Potential Programme under Contract No. HPMF-CT-2001-01410. We also tion of JAK1 and Tyk2, which in turn causes phosphorylation of thank Associazione Italiana per la Ricerca sul Cancro and Ministero dell’Istruzione ␣ Universitaè Ricerca (cofin 2002) for financial support. cytoplasmic tyrosines in the IL-4R chain. Crucially, this allows 2 Current address: Centre for Respiratory Research, University College London, the recruitment of STAT6 to the receptor and subsequent phos- Rayne Institute, London, U.K. phorylation/activation; STAT6 can then dimerize, translocate to 3 Address correspondence and reprint requests to Dr. Silvano Sozzani, Section of the nucleus, and activate transcription of target genes (see Hershey General Pathology and Immunology, University of Brescia, viale Europa 11, 25123 (17) for comprehensive review). IL-4 and IL-13 therefore have Brescia, Italy. E-mail address: [email protected] overlapping but pleiotropic functions, which include enhancing B 4 Abbreviations used in this paper: M␾, macrophage; TF, transcription factor; Ct, cycle threshold; DC, dendritic cell; GO, Gene Ontology; EASE, Expression Analysis cell proliferation and isotype-switching, antagonizing the effects of Systematic Explorer; FLICA, fluorochrome inhibitor of caspases. IFN-␥, inducing the differentiation of DC (in combination with

GM-CSF), and affecting T cell proliferation and differentiation (for Efficiency RNA Transcript Labeling kit (Enzo Life Sciences), cleaned up IL-4, but not IL-13). They can also act on nonhemopoietic cells, using the Qiagen RNeasy Mini Kit and ethanol precipitation, and frag- including endothelial cells and smooth muscle cells where IL-13 mented, before microarray analysis. stimulation enhances the production of CXCL8, CCL2, and Affymetrix genechip analysis and data mining CCL5 (18, 19). To elucidate the effects of IL-13 in the early stages of the dif- Fragmented cRNA was hybridized to Affymetrix HG-U133A genechips ␾ (Affymetrix), and then washed and scanned, according to the manufactur- ferentiation pathway to an alternatively activated M phenotype, er’s guidelines. These genechips contain 22,283 probe sets, corresponding freshly isolated human monocytes were stimulated with IL-13, and to almost 15,000 genes. Monocytes from six individual donors were ana- their transcriptional profile was investigated using high-density lyzed after 8-h incubation in the presence or absence of IL-13 (20 ng/ml). oligonucleotide microarray analysis. Monocytes from three of these donors were also analyzed after 2-h stim- Validation of this analysis was provided by the identification of ulation with IL-13. To define the IL-13-dependent transcriptional profile, expression measures were computed using robust multiarray average genes such as mannose receptor (MRC1), CD23, and 15-lipoxy- (RMA) after quantiles normalization of the probe level data (22, 23). Dif- genase (ALOX15), which are known to be modulated by IL-13 in ferential expression was assessed by t test ( p Ͻ 0.05), and type II error was monocytes/M␾ (12, 20, 21). Microarray analysis highlighted the controlled by applying a false detection rate (FDR) function (24). All of the regulation of many new genes involved in Ag presentation, host- above computations were conducted using the R statistics programming environment available at ͗www.r-project.org͘. Genes were considered to be pathogen interactions, and also lipid metabolism, including CD1b/ differentially regulated in IL-13-stimulated cells compared with control c/e, TLR1, and DHCR24. The most striking results were those cells if they had a log intensity average difference of 1.0, corresponding to showing a very complex regulation of the components of the IL-1 a fold change of 2.0. Gene Ontology (GO) data mining (25) for biological

system. At least six different genes involved in IL-1␤ production, process at level 3, and Expression Analysis Systematic Explorer (EASE) Downloaded from ͗ signal transduction, and biological activity were regulated, with biological theme analysis (26) were conducted online at http://david.niaid. nih.gov͘ using DAVID (27). Identification of potential transcription factor some of them not previously identified as genes associated with the (TF) binding sites was performed using Toucan (28). Briefly, for each alternative activated phenotype. gene, the genomic sequence comprising 2000 bp upstream of, and 200 bp within the first exon was obtained from Ensembl. These sequences were then examined using the MotifScanner function in Toucan, using the Materials and Methods Transfac 6.0 public Vertebrates TF matrix (29), with a stringent priority Cell purification and culture level of 0.1 and a Human Third Order background model. http://www.jimmunol.org/ Monocytes were isolated from buffy coats from healthy donors, obtained through the Centro Trasfusionale (Ospedale Sacco, Milan, Italy). Blood Real-time PCR was washed with pyrogen-free saline (SALF) and spun at 250 ϫ g for 10 RNA was purified as described above, and 2 ␮g were used to synthesize min to remove plasma and platelets, then loaded on Ficoll and spun at single-stranded cDNA using the Superscript First-Strand Synthesis System 600 ϫ g for 25 min. The PBMC layer was collected, the cells were washed for RT-PCR (Invitrogen Life Technologies), according to the manufactur- twice in saline and then resuspended in 285-mOsm RPMI 1640 (Biochrom) er’s instructions. Real-time quantitative RT-PCR was then performed using supplemented with 10% FCS (HyClone Laboratories). Monocytes were the SYBR Green PCR Master Mix (Applied Biosystems) with forward and then isolated by loading on 46% (v/v) iso-osmotic Percoll and spinning at reverse primers at a final concentration of 300 nM (GAPDH primers were 750 ϫ g for 25 min. The obtained monocyte population was ϳ65% pure used at 200 nM), in a sample volume of 25 ␮l. Primers for caspase 1 and according to flow cytometry; monocytes were further purified using a CX3CR1 were a kind gift from P. Perrier and F. Marchesi, respectively by guest on September 29, 2021 MACS monocyte isolation kit (Miltenyi Biotec), according to the manu- (both from Istituto Mario Negri, Milan, Italy). The remaining primers were facturer’s instructions. The cells obtained after MACS were Ͼ95% pure designed using Primer 3.0 software (30) from mRNA sequences submitted 5 according to flow cytometry; briefly, 1 ϫ 10 cells were washed in PBS to GenBank, and are listed in Table I. PCR was conducted using a Gene- supplemented with 1% BSA and 0.01% NaN3 (FACS buffer). Cells were Amp 5700 Sequence Detection System (Applied Biosystems) under the then resuspended in 100 ␮l of FACS buffer, and 10 ␮g of human IgG following cycling conditions: 2 min at 50°C (one cycle), 10 min at 95°C (Sigma-Aldrich) was added to block FcRs. After 15-min incubation at (one cycle), 15 s at 95°C, and 1 min at 60°C (40 cycles). For each gene room temperature, FITC-conjugated anti-CD14 Ab or IgG1 isotype control (performed in duplicate for each sample), cycle threshold (Ct) values were Ab (both from Serotec) was added to a concentration of 10 ␮g/ml, and the determined from the linear region of the amplification plot and normalized cells were incubated for 30 min on ice. Cells were then washed twice in by subtraction of the Ct value for GAPDH (generating a ⌬Ct value). The FACS buffer before analysis on a FACSCalibur flow cytometer (BD Bio- response to IL-13 was determined by subtraction of the ⌬Ct value for the sciences) using CellQuest software. time-matched control from the ⌬Ct value for the IL-13-stimulated sample Five milliliters of pure monocytes were seeded in nonadherent hydro- (⌬⌬Ct value). Fold change was subsequently calculated using the formula 6 phobic petriperm dishes (Sigma-Aldrich) at a concentration of 2 ϫ 10 2⌬⌬Ct (where ⌬⌬Ct was converted to an absolute value), and down-regu- cells/ml in RPMI 1640/10% FCS and incubated at 37°C for 1 h. The cells lated genes were arbitrarily assigned a negative fold change. For statistical were then stimulated with IL-13 at a concentration of 20 ng/ml for 2 or 8 h. analysis, a two-tailed paired t test was performed comparing the ⌬Ct values Human IL-13 was a kind gift from Dr. A. Minty (Sanofi Elf Bio Recher- for IL-13-stimulated and control samples. Between three and eight donors ches, Labe`ge, France). In some experiments, LPS from Escherichia coli were investigated. strain 055:B5 (Difco Laboratories) was added at a concentration of 100 ng/ml for the final4hofculture. ELISA RNA and cRNA synthesis The concentration of human IL-1␤ in cell culture supernatants was measured using a Human IL-1␤ colorimetric ELISA (Endogen) according to cRNA was generated according to the instructions provided by Affymetrix. the manufacturer’s instructions. Total RNA was extracted from 1 ϫ 107 monocytes using TRIzol (Invitro- gen Life Technologies), according to the manufacturer’s instructions, then Caspase 1 assays DNase-treated using the DNase I Amplification-Grade kit (Invitrogen Life Technologies). The volume of DNase-treated total RNA was adjusted to Relative levels of active caspase 1 activity were determined by flow cy- 100 ␮l, then further purified using the RNeasy Mini-kit (Qiagen), precip- tometry using FAM-fluorochrome inhibitor of caspases (FLICA) reagent itated using a standard ethanol precipitation, and resuspended in diethyl (Immunochemistry Technologies) according to the manufacturer’s instruc- ␮ pyrocarbonate-treated H2O. Six micrograms of total RNA were used to tions. Briefly, 300 l of monocytes were incubated with the FAM-YVAD- synthesize double-stranded cDNA using the Superscript Double-Stranded fluoromethylketone reagent for1hat37°C. The FAM-FLICA reagent is cDNA Synthesis kit (Invitrogen Life Technologies) according to the cell permeable and binds covalently to active intracellular caspase 1. Un- Ј manufacturer’s instructions, except that a T7-(dT)24 oligonucleotide (5 - bound reagent was removed by two washes in wash buffer. The cells were Ј ␮ GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGGT24-3 ; then resuspended in 300 l of wash buffer and propidium iodide was Genset) was used in place of the oligo provided with the kit. The cDNA added, to distinguish dead cells. The cells were then analyzed on a FAC- was purified using a standard phenol-chloroform extraction followed by SCalibur flow cytometer, gating on the live cells, and measuring the flu- ethanol precipitation. cRNA was then synthesized using the BioArray High orescence due to the presence of FAM-FLICA bound to caspase 1. 836 IL-13-DEPENDENT MONOCYTE TRANSCRIPTIONAL PROFILE

Table I. Primer pairs used for real-time quantitative RT-PCRa

Gene Primers Product (bp)

Caspase 1 (CASP1) For 5Ј-ggaatgtcaagctttgctccct-3Ј 103 Rev 5Ј-aagacgtgtgcggcttgactt-3Ј Catenin, ␣-like 1 (CTNNAL1) For 5Ј-atttcaggtgactggccaac-3Ј 114 Rev 5Ј-ggattcccaagcttcacaaa-3Ј CD163 For 5Ј-ttgccagcagcttaaatgtg-3Ј 111 Rev 5Ј-ctcagtcccagtgcagtgaa-3Ј CD1C For 5Ј-tctcttgggtctcctggatg-3Ј 118 Rev 5Ј-catgacaaaccagcaacagc-3Ј CX3CR1 For 5Ј-tgatttggctgaggcctgttat-3Ј 63 Rev 5Ј-ggacaggaacacagtcccaaag-3Ј CXCR1 For 5Ј-ctcctgttcatgcccatacc-3Ј 97 Rev 5Ј-cctcagggtgaagctgagac-3Ј CXCR2 For 5Ј-catggcttgatcagcaagga-3Ј 113 Rev 5Ј-gctgcacttaggcaggaggt-3Ј CXCR4 For 5Ј-gaagctgttggctgaaaagg-3Ј 96 Rev 5Ј-ctcactgacgttggcaaaga-3Ј Dual speciﬁcity phosphatase 10 (DUSP10) For 5Ј-atcttgcccttcctgttcct-3Ј 110 Rev 5Ј-gaggggaagatgagtggtga-3Ј Fatty acid desaturase 1 (FADS1) For 5Ј-gcacctcaaagtggaaccat-3Ј 148 Downloaded from Rev 5Ј-gggatgcatgttgatgtctg-3Ј Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) For 5Ј-gatcatcagcaatgcctcct-3Ј 99 Rev 5Ј-tgtggtcatgagtccttcca-3Ј Homer homolog 2 (HOMER2) For 5Ј-tctgccgtgatgagaatgac-3Ј 104 Rev 5Ј-tcttcagctgcgtgttcttc-3Ј IL-1R antagonist (IL1Ra) For 5Ј-tgggggttctttcttcctct-3Ј 99

Rev 5Ј-gaggcacagccatctttcat-3Ј http://www.jimmunol.org/ IL-1R type 1 (IL-1RI) For 5Ј-aagtgggtggatcaccagag-3Ј 103 Rev 5Ј-ccaccatgcctagctcattt-3Ј IL-1R type 2 (IL-1RII) For 5Ј-tttcactggccttcttggtt-3Ј 99 Rev 5Ј-tgaggccatagcacagtcag-3Ј Jagged 1 (JAG1) For 5Ј-aaggggtgcggtatatttcc-3Ј 106 Rev 5Ј-tcccgtgaagcctttgttac-3Ј Matrix metalloproteinase 9 (MMP9) For 5Ј-agtccacccttgtgctcttc-3Ј 105 Rev 5Ј-tctgccacccgagtgtaac-3Ј Peroxisome proliferative activated receptor␥ (PPAR␥) For 5Ј-gctggcctccttgatgaata-3Ј 116 Rev 5Ј-ttgggctccataaagtcacc-3Ј Ј Ј by guest on September 29, 2021 Putative lymphocyte G0/G1 switch gene (G0S2) For 5 -taccacaagcatccaccaaa-3 131 Rev 5Ј-tccttcctccctagtgcaaa-3Ј Wingless-type MMTV integration site family member 5A (WNT5A) For 5Ј-agcaacctcgtttctgagga-3Ј 136 Rev 5Ј-aatgccctctccacaaagtg-3Ј

a The expected PCR product size for each gene is also shown. For, Forward; Rev, reverse.

Western blotting Results Monocytes were cultured as described above. After8hofculture, 1-ml Monocyte transcriptional proﬁle after IL-13 stimulation aliquots were removed onto ice and centrifuged at 13,000 rpm for 10 s in Freshly isolated human monocytes (Ͼ95% pure by ﬂow cytom- a microfuge. The cell pellets were washed twice with 1 ml of ice-cold PBS etry) were stimulated with 20 ng/ml IL-13 for 2 or 8 h; this con- containing 20 mM NaF (0.5 M stock; Sigma-Aldrich), 1 mM Na3VO4 (0.2 M stock; Sigma-Aldrich), and ␤-glycerophosphate (0.5 M stock; Sigma- centration of IL-13 was previously shown to be optimal for stim- Aldrich). The cells were then lysed in lysis buffer, containing 50 mM ulating a variety of responses in human monocytes (31). The

Tris-HCl (pH 8.0), 1% Triton X-100, 100 mM NaCl, 1 mM MgCl2,1mM transcriptional profile was then determined by microarray analysis ␤ ␮ Na3VO4,20mMNaF,1mM -glycerophosphate, 25 g/ml aprotinin, 25 using Affymetrix HG-U133A genechips (consisting of 22,283 ␮g/ml pepstatin A, and 50 ␮g/ml leupeptin (all from Sigma-Aldrich). probe sets, corresponding to ϳ15,000 genes); three donors were Then, 100 ␮l of ice-cold lysis buffer was added to each aliquot of 2 ϫ 106 cells. Cells were lysed by pipetting up and down, and then genomic DNA analyzed at the 2-h time point, and six donors were analyzed at the was sheared by repeatedly passing the lysate through a 25-gauge needle 8-h time point, using 8-h unstimulated monocytes as the baseline connected to a 1-ml syringe. The protein concentration of each lysate was control. determined using a Micro BCA Protein Assay Reagent kit (Pierce) in mi- IL-13 had a potent effect on the monocyte transcriptional profile: croplate format, according to the manufacturer’s instructions. Lysates were ␮ ␮ Ϫ after 8-h stimulation, 442 regulated genes were identified follow- adjusted to 1 g/ l and stored at 70°C. ͗ A total of 15 ␮g of each lysate were run on 12% SDS-acrylamide gels, ing the initial RMA analysis (see additional information at www. and then the protein was transferred to nitrocellulose membrane (Amer- marionegri.it/profiles͘), and this was reduced to 142 regulated sham Biosciences) using the Mini Trans-Blot Electrophoretic Transfer Cell genes after restricting the profile to those genes with a fold change (Bio-Rad), according to the manufacturer’s instructions. The membrane of Ն2 (Table II). Of the 142 genes affected after 8-h IL-13 stim- ␤ ␤ was probed for IL-1 using an anti-human IL-1 Ab (Cell Signaling Tech- ulation, 85 were up-regulated (with a maximum fold change of nology) followed by an HRP-conjugated donkey anti-rabbit secondary Ab (Amersham Biosciences), according to the manufacturer’s instructions. 22.6) and 57 were down-regulated (with a maximum fold change Specific Ab binding was detected using ECL Western Blotting Detection of 11.3). The majority of these genes have been characterized; only 11 Reagents (Amersham Biosciences) followed by exposure to x-ray film. genes were unidentified or hypothetical. According to the microarray The Journal of Immunology 837

Table II. List of genes regulated in human monocytes after 8-h stimulation with IL-13 (20 ng/ml)a

Fold Change GenBank Accession No. Gene Symbol Gene Description 2h 8h Cluster

Cell cycle, cell proliferation, or differentiation NM_014479 ADAMDEC1 ADAM-like, decysin 1 Ϫ5.3 Ϫ11.3 3 D38553 BRRN1 Barren homolog (Drosophila) 1.7 2.0 2A AD000092 DNASE2 Deoxyribonuclease II, lysosomal NC Ϫ2.0 4 NM_005103 FEZ1 Fasciculation and elongation protein␨ 1 (zygin 1) Ϫ2.6 Ϫ2.6 3 NM_021731 FZR1 Fzr1 protein 2.8 3.5 2A

NM_015714 GOS2 Putative lymphocyte G0/G1 switch gene NC 4.6 1B NM_000820 GAS6 Growth arrest-speciﬁc 6 2.1 4.0 2A BC006454 GAS7 Growth arrest-speciﬁc 7 NC Ϫ3.0 3 NM_002430 MN1 Meningioma (disrupted in balanced translocation) 1 2.6 Ϫ4.0 4 NM_006197 PCM1 Pericentriolar material 1 NC 2.8 2A NM_016205 PDGFC Platelet-derived growth factor C 3.5 2.3 2A NM_002826 QSCN6 Quiescin Q6 4.3 2.6 2A NM_002615 SERPINF1 Serine (or cysteine) proteinase inhibitor, clade F, member 1 NC Ϫ2.6 3 NM_003710 SPINT1 Serine protease inhibitor, Kunitz type 1 NC 3.7 1B AF027205 SPINT2 Serine protease inhibitor, Kunitz type 2 4.3 5.3 2A NM_006520 TCTE1L T-complex-associated-testis-expressed 1-like Ϫ1.8 Ϫ2.3 3 Downloaded from NM_003392 WNT5A Wingless-type MMTV integration site family, member 5A 10.6 15.0 2A

Cytokines or complement NM_000064 C3 Complement component 3 Ϫ3.5 Ϫ2.3 3 NM_002990 CCL22 Chemokine (C-C motif) ligand 22 NC 2.3 1B AW083357 IL1RN IL-1R antagonist 9.2 7.0 2A http://www.jimmunol.org/ Membrane receptors or transporter molecules AF285167 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 NC Ϫ3.5 4 U62027 C3AR1 Complement component 3a receptor 1 NC Ϫ2.8 3 AF290886 CD209 CD209 Ag NC 3.3 1B NM_001774 CD37 CD37 Ag 2.5 Ϫ2.1 4 NM_001778 CD48 CD48 Ag (B cell membrane protein) NC Ϫ2.8 4 4867982 CDW52 CDW52 Ag (CAMPATH-1 Ag) NC 3.7 2A NM_001557 CXCR2 IL-8R ␤ NC 2.3 1B AF348491 CXCR4 Chemokine (C-X-C motif) receptor 4 NC Ϫ3.7 4 AF056979 IFNGR1 IFN-␥ receptor 1 NC Ϫ2.3 3

NM_004258 IGSF2 Ig superfamily member 2 NC Ϫ3.5 3 by guest on September 29, 2021 U62858 IL13RA1 IL-13R, ␣ 1 Ϫ2.5 Ϫ2.6 3 NM_000877 IL1R1 IL-1R, type I 8.0 3.5 2A U64094 IL1R2 IL-1R, type II NC 3.5 1B NM_002183 IL3RA IL-3R, ␣ (low afﬁnity) 3.5 2.6 2A U73191 KCNJ15 Potassium inwardly rectifying channel, subfamily J, member 15 NC Ϫ4.0 3 AF011565 LILRB2 Leukocyte Ig-like receptor, subfamily B, member 2 Ϫ1.4 Ϫ2.6 3 NM_024021 MS4A4A Membrane-spanning 4-domains, subfamily A, member 4 32.0 6.5 2B AF035307 PLXNC1 Plexin C1 NC Ϫ4.3 4 NM_002958 RYK RYK receptor-like tyrosine kinase NC 2.0 2A NM_004694 SLC16A6 Solute carrier family 16 (monocarboxylic acid transporters), member 6 NC Ϫ2.1 3 AF288410 SLC26A6 Solute carrier family 26, member 6 4.6 2.5 2B NM_003982 SLC7A7 Solute carrier family 7 (cationic amino acid transporter), member 7 2.3 Ϫ2.5 4

Pattern recognition receptors NM_000591 CD14 CD14 Ag Ϫ3.5 Ϫ2.6 3 NM_004244 CD163 CD163 Ag Ϫ3.3 Ϫ3.7 3 NM_001764 CD1B CD1B Ag, b polypeptide NC 2.6 1B NM_001765 CD1C CD1C Ag, c polypeptide NC 5.7 1B AA309511 CD1E CD1E Ag, e polypeptide NC 6.5 1B AF200738 CLECSF6 C-type lectin, superfamily member 6 4.3 2.8 2A NM_014358 CLECSF9 C-type lectin, superfamily member 9 NC Ϫ2.0 3 NM_002002 FCER2 Fc fragment of IgE, low afﬁnity II, receptor for CD23A NC 14.9 1B NM_002438 MRC1 Mannose receptor, C type 1 7.5 18.4 2A AL050262 TLR1 TLR NC Ϫ2.5 4

Cytoskeleton NM_003798 CTNNAL1 Catenin (cadherin-associated protein), ␣ like 1 9.2 13.0 2A NM_016337 EVL Enah/Vasp-like NC 5.3 1B NM_000177 GSN Gelsolin (amyloidosis, Finnish type) NC 2.1 1A 4872688_RC HOM-TES-103 HOM-TES-103 tumor Ag-like NC Ϫ2.5 4 NM_014751 MTSS1 Metastasis suppressor 1 NC Ϫ2.3 4 AL046979 TNS Tensin NC Ϫ3.5 4 (Table continues) 838 IL-13-DEPENDENT MONOCYTE TRANSCRIPTIONAL PROFILE

Table II. Continues

Fold Change GenBank Accession No. Gene Symbol Gene Description 2h 8h Cluster

Enzymes or metabolism NM_000018 ACADVL Acyl-coenzyme A dehydrogenase, very long chain NC 2.3 1B X02189 ADA Adenosine deaminase NC Ϫ4.0 4 AK000667 ADAM15 A disintegrin and metalloproteinase domain 15 (metargidin) NC 2.0 2A NM_021778 ADAM28 A disintegrin and metalloproteinase domain 28 NC Ϫ9.2 4 AB015228 ALDH1A2 Aldehyde dehydrogenase 1 family, member A2 NC 4.3 1B NM_001140 ALOX15 Arachidonate 15-lipoxygenase NC 9.8 1B AI916249 AMPD2 Adenosine monophosphate deaminase 2 (isoform L) 2.8 2.1 2A U34877 BLVRA Biliverdin reductase A 2.1 2.6 2A U13699 CASP1 Caspase 1 (IL-1 ␤, convertase) Ϫ3.3 Ϫ4.6 3 NM_004267 CHST2 Carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 Ϫ2.3 Ϫ2.0 3 NM_001814 CTSC Cathepsin C 5.7 7.5 2A AI308863 CYBB Cytochrome b-245, ␤ polypeptide (chronic granulomatous disease) Ϫ3.5 Ϫ2.6 3 NM_014762 DHCR24 24-dehydrocholesterol reductase NC 2.0 1A L35594 ENPP2 Ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 3.5 6.5 2A NM_000129 F13A1 Coagulation factor XIII, A1 polypeptide NC 10.6 2A NM_001442 FABP4 Fatty acid binding protein 4, adipocyte NC 22.6 1B AL512760 FADS1 Fatty acid desaturase 1 Ϫ9.2 2.1 1A Downloaded from NM_004265 FADS2 Fatty acid desaturase 2 NC 2.3 1A NM_000402 G6PD Glucose-6-phosphate dehydrogenase Ϫ2.3 2.0 1A NM_002084 GPX3 Glutathione peroxidase 3 (plasma) NC 2.6 1B AF155510 HPSE Heparanase 2.5 Ϫ4.3 4 NM_005525 HSD11B1 Hydroxysteroid (11 ␤) dehydrogenase 1 NC 7.0 1B NM_013417 IARS Isoleucine-tRNA synthetase 2.5 2.1 2A NM_000235 LIPA Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) NC 5.3 1A http://www.jimmunol.org/ J02959 LTA4H Leukotriene A4 hydrolase NC Ϫ2.5 4 AA923354 MAOA Monoamine oxidase A 7.5 21.1 2A NM_002450 MT1X Metallothionein 1X NC Ϫ2.0 3 L13974 NFE2 Nuclear factor (erythroid-derived 2), 45 kDa 18.3 2.8 2B AF033026 PAPSS1 3Ј-phosphoadenosine 5Ј-phosphosulfate synthase 1 NC Ϫ2.1 4 NM_002627 PFKP Phosphofructokinase, platelet 2.6 2.5 2A NM_014968 PITRM1 Pitrilysin metalloproteinase 1 3.2 2.3 2A NM_002775 PRSS11 Protease, serine, 11 (IGF binding) NC Ϫ4.3 4 U93162 SC4MOL Sterol-C4-methyl oxidase-like Ϫ9.9 2.0 1A NM_005668 SIAT8D Sialyltransferase 8D (␣-2,8-polysialyltransferase) NC Ϫ2.5 3 BE742268 SORT1 Sortilin 1 NC 2.1 2A AB022918 ST3GALVI ␣2,3-sialyltransferase Ϫ4.6 Ϫ2.6 3 by guest on September 29, 2021 NM_004613 TGM2 Transglutaminase 2 21.1 5.3 2B

Signaling AK026415 CHN2 Chimerin (chimaerin) 2 3.7 4.0 2A NM_013324 CISH Cytokine inducible SH2-containing protein 8.0 4.9 2A N36770 DUSP10 Dual speciﬁcity phosphatase 10 Ϫ2.6 Ϫ3.2 3 AK024456 FGD2 FGD1 family, member 2 2.1 3.0 2A BC005147 FKBP1A FK506 binding protein 1A, 12 kDa 2.3 2.6 2A Y19026 HOMER2 Homer homolog 2 (Drosophila) 2.8 3.2 2A NM_007199 IRAK3 IL-1R-associated kinase 3 Ϫ1.6 Ϫ2.3 3 U77914 JAG1 Jagged 1 (Alagille syndrome) 16.0 4.9 2B NM_021630 PDLIM2 PDZ and LIM domain 2 (mystique) NC 2.0 1B NM_015869 PPARG Peroxisome proliferative-activated receptor ␥ 10.6 3.5 2A AF027706 RIPK2 Receptor-interacting serine-threonine kinase 2 7.5 2.5 2B AI992251 RPS6KA2 Ribosomal protein S6 kinase, 90 kDa, polypeptide 2 NC Ϫ2.5 4 U44403 SLA Src-like-adaptor 2.6 2.6 2A AB005043 SOCS1 Suppressor of cytokine signaling 1 22.6 9.1 2A BC000616 SWAP70 SWAP-70 protein Ϫ2.6 Ϫ2.6 3 NM_021732 VIP32 Vasopressin-induced transcript NC 2.0 2A

Membrane trafﬁcking NM_004794 RAB33A RAB33A, member RAS oncogene family 8.6 2.0 2B D42043 RAFTLIN Raft-linking protein NC 2.1 1B AB020663 RC3 Rabconnectin-3 Ϫ2.8 Ϫ2.1 3 AL136924 RIN2 Ras and Rab interactor 2 NC Ϫ2.1 3 NM_000345 SNCA Synuclein, ␣ (non-A4 component of amyloid precursor) Ϫ2.8 Ϫ2.6 3 NM_003165 STXBP1 Syntaxin binding protein 1 Ϫ1.7 2.5 1B NM_004710 SYNGR2 Synaptogyrin 2 1.9 2.3 2A

Transcription factors NM_020183 ARNTL2 Aryl hydrocarbon receptor nuclear translocator-like 2 3.5 3.2 2A NM_014038 BZW2 Basic leucine zipper and W2 domains 2 3.5 2.3 2A AF052094 EPAS1 Endothelial PAS domain protein 1 2.8 3.7 2A NM_005360 MAF V-maf musculoaponeurotic ﬁbrosarcoma oncogene homolog (avian) 12.1 14.9 2A NM_014112 TRPS1 Trichorhinophalangeal syndrome 1 NC Ϫ3.2 4 (Table continues) The Journal of Immunology 839

Table II. Continues

Fold Change GenBank Accession No. Gene Symbol Gene Description 2h 8h Cluster

Related to extracellular matrix NM_007267 EVER1 Epidermodysplasia verruciformis 1 2.3 2.5 2A BF940043 NID Nidogen (enactin) NC Ϫ5.0 4 NM_003246 THBS1 Thrombospondin 1 Ϫ10.6 Ϫ5.0 3 NM_003256 TIMP4 Tissue inhibitor of metalloproteinase 4 4.3 2.3 2A

Unknown NM_020152 C21orf7 Chromosome 21 open reading frame 7 NC Ϫ2.6 3 NM_022102 C6orf79 Chromosome 6 open reading frame 79 2.6 2.3 2A NM_014367 E2IG5 Growth and transformation-dependent protein 2.3 2.1 2A BC003163 EEG1 Likely ortholog of mouse embryonic epithelial gene 1 NC Ϫ2.5 4 NM_018243 FLJ10849 Hypothetical protein FLJ10849 NC 2.5 1B NM_018390 FLJ11323 Hypothetical protein FLJ11323 NC 2.5 1B NM_017933 FLJ20701 Hypothetical protein FLJ20701 Ϫ3.3 Ϫ3.2 3 AF117234 FLOT1 Flotillin 1 NC Ϫ2.3 4 NM_002510 GPNMB Glycoprotein (transmembrane) nmb Ϫ4.6 Ϫ3.0 3 NM_014745 KIAA0233 KIAA0233 gene product NC 2.0 1B Downloaded from AI962693 KIAA0555 KIAA0555 gene product NC Ϫ2.1 3 AA781143 LOC56926 Hypothetical protein from EUROIMAGE 2021883 NC 2.5 1B NM_024300 MGC2217 Hypothetical protein MGC2217 3.7 2.8 2A AL049435 Homo sapiens mRNA; cDNA DKFZp586B0220 Ϫ4.6 Ϫ4.0 3 U40053 Ϫ2.6 2.1 1A

a Analyzed using Affymetrix HG-U133A arrays as described in Materials and Methods. Each gene is given a representative GenBank accession number, common gene symbol, brief description, fold change at 8 h (relative to unstimulated cells; negative values indicate down regulation) plus the respective fold change at 2 h (NC, no change), http://www.jimmunol.org/ and a cluster number which refers to the hierarchical clustering shown in Fig. 1. analysis, the maximally regulated genes were fatty acid binding pro- tabolism (Fig. 2). However, using the online version of the EASE tein 4 (FABP4; increased expression) and ADAM-like Decysin 1 (available at ͗http://david.niaid.nih.gov/david͘), which performs a (ADAMDEC1; decreased expression). statistical analysis of gene categories in the gene list to find those Many of the genes regulated after 8-h IL-13 stimulation have categories that are the most overrepresented (and can therefore be been previously identified as being regulated by IL-13 or IL-4 in described as “themes” of the gene list), reveals a trend toward monocytes/M␾, demonstrating the validity of our experimental immunity (e.g., inflammatory response, innate immune response, by guest on September 29, 2021 protocol. These genes include mannose receptor (MRC1), CD23 response to pest/pathogen/parasite, etc.), as might be expected of (FCER2; FcR for IgE), CCL22 (also known as MDC), arachidonate IL-13-regulated genes (Table III). 15-lipoxygenase (ALOX15), IL-1RII, and IL-1Ra (12, 20, 21, 31–33). It is clear from the gene list in Table II that there are several Two hours of IL-13 stimulation had a greater effect on the tran- genes involved with the cell cycle or cell differentiation. These scriptional profile, with 638 genes regulated with a fold change of include ADAM-like decysin 1 (ADAMDEC1) whose expression is Ͼ2 (435 genes up-regulated; 203 genes down-regulated). For the increased during the in vitro differentiation of monocytes into M␾, purposes of clarity, these genes are not described in detail in this and further increased after classical LPS activation of these M␾, paper, but the full list is freely available at ͗www.marionegri.it/ but which is not expressed in immature DC (34). IL-13 decreases profiles͘. However, 70 of the genes regulated at 2 h (with a fold the expression of this molecule in monocytes, which could pro- change Ͼ2) were also regulated at 8 h, as shown in Table II; an mote differentiation toward a DC phenotype rather than a M␾ phe- additional six genes had a fold change Ͻ2, whereas the remainder notype. In contrast, Wnt5A is highly up-regulated by IL-13; this were unchanged at 2 h but regulated at 8 h. gene is important during hemopoiesis for controlling the pheno- Hierarchical clustering of the genes regulated at 8 h (including typic specialization of blood cells. Overexpression of Wnt5A in their observed expression at 2 h) using Euclidean distances after hemopoietic progenitor cells increases the proportion of erythro- median centering of their eisen expression values, revealed six cytes and monocytes, while reducing the number of M␾ (35). In major clusters (Fig. 1). Genes in cluster 1 had high expression (mature) monocytes, induction of this gene by IL-13 could there- levels after 8-h IL-13 stimulation, compared with the global me- fore play an important role in driving the differentiation of mono- dian expression; this cluster was further divided according to cytes toward a DC phenotype. whether genes had low expression at 2 h (cluster 1A) or not (clus- Many of the IL-13-regulated genes are enzymes or other mol- ter 1B). Genes in cluster 2 had relatively low expression in the ecules involved with metabolism, such as phosphofructokinase unstimulated cells, but higher expression after 2- and 8-h IL-13 (PFKP) and adenosine deaminase (ADA). Of interest, “lipid me- stimulation; again, this cluster was further subdivided depending tabolism” had a significant EASE score (Table III), and several of on the expression levels at 2 h. Genes in cluster 3 had high ex- the enzymes in Table II appear to have a role in regulation of fatty pression in unstimulated cells and low expression after 2- and 8-h acids and/or cholesterol biosynthesis (according to their GO), such IL-13 stimulation. Finally, cluster 4 genes had high expression in as fatty acid desaturase 1 and 2 (FADS1/2), acyl-coenzyme A de- unstimulated cells and after 2-h IL-13 stimulation, followed by low hydrogenase (ACADVL), 24-dehydrocholesterol reductase expression after 8-h IL-13 stimulation. (DHCR24), and sterol-C4-methyloxidase-like (SC4MOL). Also, GO data mining for biological process (at level 3) suggests that the transporter molecule ABCA1 has a role in cholesterol transport the transcriptional profile induced by IL-13 is principally related to (36); regulation of these genes may have implications for the signal transduction, response to a biotic stimulus, and protein me- pathogenesis of atherosclerosis and foam cell formation, where a 840 IL-13-DEPENDENT MONOCYTE TRANSCRIPTIONAL PROFILE

IL-13 is very similar, and may therefore be under the control of a common signaling pathway downstream of IL-13. Analysis of TF binding sites using Toucan (see Materials and Methods) reveals the signiﬁcant overrepresentation of potential binding sites for the TF NF-Y in cluster 1A (data not shown); this molecule has been implicated in the regulation of other genes in cholesterol biosynthesis (37, 38). As suggested by the EASE results, a signiﬁcant proportion of the IL-13-regulated genes have immunological relevance, including complement component 3 (C3), CCL22 (31), CXCR2 (39), CXCR4, IL13R␣1, IFNGR1, and IL3R␣ (40). This analysis did not reveal any regulation of cytokines such as TNF-␣, TGF-␤, IL-1␤, or IL-6 (2). Of particular interest are the large number of pattern recognition receptors: some of these genes, including MRC1, CD14, and CD23 (FcER2), are known to be regulated by IL-13 (12, 21, 41); however, IL-13 also up-regulates three members of the CD1 family (CD1b, -c, and -e) and a C-type lectin (CLECSF6), while down-regulating another C-type lectin (CLECSF9) and

TLR1. CLECSF6 has previously been shown to be up-regulated by Downloaded from IL-13 in neutrophils (42). CD1b, -c, -e, and CD23 are located very closely together in cluster 1B (Fig. 1), suggesting a similar pattern of up-regulation by IL-13. The increased expression of CD1 could be of considerable interest in terms of lipid and glycolipid Ag presentation to T cells. Moreover, ligands that are bound by MRC1

could be internalized to late endosomes for subsequent presenta- http://www.jimmunol.org/ tion by CD1b (13), as has been shown in DC. This will be the subject of further investigation in our laboratory. Clearly therefore, the transcriptional profile has a range of genes including TF, cytokine and chemokines and/or their receptors, other cell surface molecules, enzymes, and signal transduction components. Several of these genes (distributed throughout the different clusters shown in Fig. 1) were chosen for analysis by real-time quantitative RT-PCR, to confirm the results of the microarray analysis. by guest on September 29, 2021 Real-time PCR analysis of IL-13-regulated genes Real-time PCR was used to verify the up- or down-regulation of selected genes, using the primer pairs shown in Table I. In addition, three genes of interest to our laboratory were included that were not revealed by the microarray analysis: CXCR1, CX3CR1, and MMP9. There was a good agreement between the real-time PCR data and the Affymetrix data (Fig. 3), with confirmation of the up- or down-regulation of each gene; these data also had a similar pattern to the clustering seen in Fig. 1. For many of the genes, the fold change was also of a comparable magnitude, although CD1c, Wnt5A, and CTNNAL1 showed a massive up-regulation according to real-time PCR. The regulation of either mRNA or protein for CXCR2, IL-1RI, IL-1RII, IL-1Ra, and PPAR␥ has previously been demonstrated after IL-4 or IL-13 stimulation of human monocytes or M␾ (32, 33, 39, 43). Of interest, CXCR1 and CX3CR1 showed significant up- and down-regulation respectively, although these genes were not identified by microarray analysis. MMP9 expression was also reduced, FIGURE 1. Hierarchical clustering (using Euclidean distances) of the me- ϭ dian-centered eisen expression values. The 142 genes that were regulated after although this was not quite statistically significant ( p 0.073). 8-h IL-13 stimulation were hierarchically clustered, including their observed These data demonstrate that microarrays may not always identify expression at 2 h. Six major clusters were observed, with a similar pattern of genes that are known to be regulated. The most likely explanation regulation. Cluster 1A principally contained genes involved with lipid metab- for this discrepancy is due to interindividual variability—human olism, whereas the remaining clusters were a mix of genes. Expression is blood donors can have marked differences in their gene expression, indicated by a color scale from low (green) to high (red). which obviously makes it more beneficial to have larger sample sizes. There could also be a problem with either the probe sets on the genechip (lack of sensitivity or specificity) or the subsequent role for IL-13 has been suggested (20). Moreover, the majority of analysis, although an alternative approach to the analysis (using the lipid metabolism-related genes are closely associated in cluster the proprietary Affymetrix Microarray Suite 5.0 software) did not 1A (Fig. 1); this shows that their expression pattern in response to identify these genes either. Real-time PCR for other genes that are The Journal of Immunology 841

FIGURE 2. GO data mining. The 142 regulated genes were characterized according to their biological process classiﬁcation (at level 3) in the GO database (25). Thirty-three percent of the genes did not have a GO classiﬁcation. The majority of the remaining genes were involved with signal transduction and response to

a biotic stimulus. Downloaded from http://www.jimmunol.org/

not listed in Table II, such as CCR2 and p75 TNFR, validated that into an active heterodimer composed of a 10- and 20-kDa chain, by guest on September 29, 2021 these genes are not regulated (data not shown). before it can act on IL-1␤ (see Ref. 46 for review). Monocytes The increased expression of CXCR1/2 by IL-13 has previously were stimulated for 4 h with IL-13, and then a further 4 h with the been demonstrated in our laboratory (39) and has implications for addition of LPS to induce active caspase 1; the cells were then the control of monocyte migration in a variety of inflammatory stained with the FAM-FLICA reagent, and the level of active situations. The IL-13-dependent down-regulation of the chemo- caspase 1 was determined by flow cytometry. As shown in Fig. 4, kine receptors CXCR4 and CX3CR1 in human monocytes is 100 ng/ml LPS alone caused an increase in caspase 1 activity com- novel, and again may have important implications in pathology. pared with unstimulated control cells, as evaluated by an increase Work by Fraticelli et al. (76) showed that CX3CL1 (fractalkine, in mean channel fluorescence. Pretreatment of the cells with as the ligand for CX3CR1) is important in polarized Th1/Th2 re- little as 2 ng/ml IL-13 was sufficient to prevent the LPS-dependent sponses. IL-4/IL-13 blocked the induction of this chemokine by increase in caspase 1 activity, suggesting that a reduction in endothelial cells, and Th2 cells were shown to have lower expres- mRNA levels has a subsequent effect on the capacity for generat- sion of CX3CR1 than Th1 cells. The reduction in CX3CR1 ex- ing active caspase 1. pression in monocytes by IL-13 may also contribute to Th1/Th2 ␤ polarization; the functional significance of this regulation is the Reduced cleavage of pro-IL-1 in IL-13-stimulated monocytes topic of current investigations in our laboratory. Cell lysates from the above stimulated monocytes (4 h with or A reduction in the expression of caspase 1 after8hofIL-13 stim- without IL-13 followed by 4 h with or without LPS) were probed ulation was also confirmed by real-time PCR. Caspase 1 is also for IL-1␤ by Western blotting, while supernatants were collected known as the IL-1␤-converting enzyme (ICE), and is responsible for for subsequent ELISA. As has been shown previously for IL-4/ the proteolytic cleavage of pro-IL-1␤ to its mature form (44, 45). IL-13 (41, 47), we found that stimulation of monocytes with IL-13 Because regulation of caspase 1 could therefore modulate IL-1␤ pro- caused a dose-dependent and significant reduction in LPS-induced duction in monocytes, we focused our attention on this gene. IL-1␤ concentration in cell culture supernatants (data not shown). Western analysis of 20 ␮g of cell lysate showed that at least part Caspase 1 assay of the reduction is due to decreased processing of pro-IL-1␤ (Fig. According to the microarray analysis and real-time PCR, there was 5). In unstimulated control cells, no IL-1␤ was detectable. But a ϳ3-fold down-regulation of caspase 1 mRNA after 2-h stimu- after LPS stimulation, there was detectable 31-kDa pro-IL-1␤ and lation with IL-13 and a 5-fold down-regulation after 8 h. There- also mature 17-kDa IL-1␤, indicating that the proteolytic cleavage fore, we investigated whether the reduction in mRNA levels cor- of IL-1␤ was occurring. However, pretreatment of the cells with responded to a reduction in the level of active caspase 1, using a IL-13 reduced the ratio of mature IL-1␤ to pro-IL-1␤, which cor- FAM-FLICA assay (see Materials and Methods). Caspase 1 exists responds with the deficiency in active caspase 1 and hence the as a 45-kDa precursor and must itself be proteolytically cleaved capacity for proteolytic cleavage of pro-IL-1␤. Because IL-13 842 IL-13-DEPENDENT MONOCYTE TRANSCRIPTIONAL PROFILE

Table III. EASE overrepresentation analysis of the genes listed in Table IIa

EASE System Category Score

Biological process Inﬂammatory response 5.4 ϫ 10Ϫ9 Biological process Innate immune response 7.0 ϫ 10Ϫ9 Biological process Response to pest/pathogen/parasite 2.6 ϫ 10Ϫ8 Biological process Immune response 2.7 ϫ 10Ϫ7 Biological process Response to wounding 4.6 ϫ 10Ϫ7 Biological process Defense response 1.2 ϫ 10Ϫ6 Biological process Response to biotic stimulus 1.6 ϫ 10Ϫ6 Biological process Response to stress 8.8 ϫ 10Ϫ6 Biological process Response to external stimulus 6.6 ϫ 10Ϫ5 Molecular function Hemopoietin/IFN-class cytokine 0.00028 receptor activity Molecular function Cytokine binding 0.00033 Biological process Antimicrobial humoral response 0.00041 Biological process Humoral defense mechanism 0.00041 Biological process Antimicrobial humoral response 0.00079 Cellular component Integral to membrane 0.00082 Cellular component Plasma membrane 0.0022 Molecular function Defense/immunity protein activity 0.0024 Biological process Humoral immune response 0.0026 Downloaded from Molecular function Signal transducer activity 0.0027 Molecular function Endopeptidase inhibitor activity 0.0027 Molecular function Protease inhibitor activity 0.0029 Molecular function IL binding 0.0035 Molecular function IL receptor activity 0.0035 Biological process Response to chemical substance 0.0037 Molecular function Growth factor binding 0.0062

Cellular component Membrane 0.0075 http://www.jimmunol.org/ Molecular function Enzyme inhibitor activity 0.0087 Molecular function Receptor activity 0.0093 Molecular function Oxidoreductase activity 0.012 Biological process Lipid metabolism 0.016 FIGURE 3. Real-time quantitative RT-PCR for genes selected from the Molecular function Enzyme regulator activity 0.018 profile. Sixteen genes from the list in Table II (plus three additional genes Biological process Cell communication 0.020 Molecular function Catalytic activity 0.022 that were not identified by microarray analysis) were analyzed by real-time Biological process Fatty acid metabolism 0.027 PCR to confirm the genechip results (u,2h;f, 8 h). Down-regulated Molecular function Receptor signaling protein activity 0.029 genes were arbitrarily assigned a negative value. For the genes marked with .p Ͻ 0.05 ,ء .Biological process Chemotaxis 0.032 a number sign (#), the expression at 2 h was not determined Biological process Taxis 0.032

Cellular component Integral to plasma membrane 0.033 by guest on September 29, 2021 Molecular function Metallopeptidase activity 0.038 Molecular function Metalloendopeptidase activity 0.043 paper by Jinnin et al. (49) investigated the transcriptional profile Biological process Alcohol metabolism 0.043 induced by IL-13 in fibroblasts. They saw significant regulation of Biological process N-linked glycosylation 0.045 Molecular function Metal ion binding 0.045 genes such as ␣2(I) collagen, IL-16, and proteinase-activated receptor 1, but their analysis did not identify any of the genes de- a Categories with the lowest EASE score are significantly overrepresented in the list. Also shown is the GO system to which each category belongs. scribed in our study. We have also conducted real-time PCR analysis of several of the genes listed in Table I in HUVECs. The majority of the genes were either absent, or expressed at several stimulation did not cause an accumulation of pro-IL-1␤ (the levels orders of magnitude lower than in monocytes. However, expres- of pro-IL-1␤ were comparable regardless of IL-13 stimulation), it sion of CXCR4, IL1R1, and IL1R2 was detectable at significant is possible that IL-13 also caused a decrease in IL-1␤ translation levels, and IL-13 stimulation resulted in up-regulation of all three (we did not see down-regulation of IL-1␤ mRNA by microarray genes (data not shown). IL-13 will likely regulate its target genes analysis), or that pro-IL-1␤ was being secreted (48). in a cell type-specific manner, although control of some genes such as IL1R1/2 may be comparable in different cell populations. Be- Discussion cause STAT6 is important for downstream signaling in both he- IL-13 is a prototypic Th2 cytokine mainly produced during the cel- mopoietic and nonhemopoietic cells in response to IL-13 or IL-4, lular or humoral immune response to parasitic and extracellular patho- other signaling events must contribute to the observed differences gens, and also during allergic reactions. In M␾, IL-13 and IL-4 can both between IL-13 and IL-4, and between cell types. For example, induce an alternative activated phenotype characterized by the up- previous studies have investigated the transcriptional profile in- regulation of various molecules including mannose receptor (MRC1) duced by IL-4 in murine M␾ (50, 51). Welch et al. (50) and Loke and MHC class II (see Refs. 2 and 3 for recent review). et al. (51) found IL-4 regulation of genes including MRC1 and In this study, we investigated the effects of IL-13 on monocytes Fc␥RIII, but there are distinct differences from our profile. Both using Affymetrix microarray technology. To our knowledge, this is groups demonstrated up-regulation of Ym1 and arginase, yet nei- the first transcriptome analysis performed on this cell population ther of these genes was found in our study. Such differences reflect after stimulation with this Th2 cytokine. After 8-h stimulation with the fact that IL-4 and IL-13 are highly similar yet different mole- IL-13, 142 genes were identified with a statistically significant cules. difference in expression, and a fold change of Ͼ2. Our microarray Comparison with a recent paper by Jung et al. (52) on the IL- analysis included many of the known genes that are up- or down- 10-induced gene expression profile in monocytes is also interest- regulated by IL-13. ing. Their results show that IL-10 regulates some of the genes IL-13Rs can also be expressed by other cell types including identified in our profile. IL-10 and IL-13 have a comparable effect endothelial cells, smooth muscle cells, and fibroblasts. A recent on the expression of IL-1Ra and IL13R␣1, but contrasting effects The Journal of Immunology 843 Downloaded from

FIGURE 5. A, Western blot analysis of intracellular IL-1␤ protein. Monocytes were cultured as in Fig. 4, and cell lysates were prepared. Twenty micrograms of total protein were analyzed by Western blot for the presence of pro-IL-1␤ and its proteolytically cleaved mature form. LPS alone resulted in the expression of pro-IL-1␤ protein, and a signiﬁcant

proportion of this was processed to the mature form. Pretreatment with http://www.jimmunol.org/ IL-13 did not prevent the expression of IL-1␤ but did reduce the proportion of mature IL-1␤, suggesting a deﬁciency in proteolytic processing. B, Den- sitometric analysis of the bands shown in A, showing the clear reduction in the ratio of mature IL-1␤ to pro-IL-1␤. Results are representative of two independent experiments.

on CX3CR1, LILRB2, CD1e, and CD163. IL-10 bears some similarities to a Th2 cytokine and often has a similar expression pat- by guest on September 29, 2021 tern during an immune response, but these results demonstrate that, despite the apparent similarities, IL-10 and IL-13 have many opposing effects on monocytes. GO data mining, and particularly EASE analysis, logically characterized the regulated genes as being involved with an inflammatory response. However, hierarchical clustering revealed a group of genes related to lipid metabolism and cholesterol biosynthesis. Combined with the observed up-regulation of MRC1, ALOX15, and PPAR␥, plus the down-regulation of ABCA1, these genes may be of interest with respect to atherosclerosis and foam cell formation, where a role for IL-13 has been suggested but not categori- cally proven. Toucan analysis of TF binding sites suggests that the TF NF-Y may be involved with the regulation of these lipid metabolism genes; as well as regulating genes in the cholesterol biosynthesis pathway, this TF can also bind to the promoter for myeloperoxidase (MPO), another gene which has recently been implicated in atherosclerosis (53, 54). FIGURE 4. A, Caspase 1 activity in monocytes stimulated with LPS Work by Huang et al. (43) has shown that IL-4 can up-regulate and/or IL-13. Monocytes were cultured for 8 h, in the presence or absence both PPAR␥ and ALOX15 in monocytes, and that ALOX15 can of IL-13 (at 2, 20, or 200 ng/ml). Caspase 1 activity was induced by the then generate ligands for PPAR␥ and hence coordinately mediate addition of LPS (100 ng/ml) for the final4hofculture, and the level of the induction of PPAR␥-dependent genes. PPAR␥ induces the ex- caspase 1 activity was measured by flow cytometry using FAM-FLICA pression of MRC1 (55), and although there is currently no pub- reagent. LPS stimulation alone (gray shading) increased the level of ␥ caspase 1 activity relative to control cells or cells pretreated with IL-13 lished data, it has been suggested that PPAR may decrease the before LPS stimulation (black lines), as indicated. Results from one ex- expression of CD163, another scavenger receptor that may be im- periment are shown, representative of three independent experiments. B, portant in atherosclerosis (56, 57). Our results indicate that IL-13 Graphical representation of the mean results from the three independent may stimulate similar regulatory loops in monocytes, again with experiments, showing the increase in caspase 1 activity relative to control implications for disease (58). cells and the abrogation of LPS-stimulated caspase 1 activation due to As well as the effects on MRC1 and CD163, we also observed pretreatment with different concentrations of IL-13. IL-13-dependent regulation of a number of other pattern recognition receptors. The up-regulation of CD1b/c/e may be of particular 844 IL-13-DEPENDENT MONOCYTE TRANSCRIPTIONAL PROFILE interest, because these molecules are involved with DC presenta- In conclusion, we have provided the first transcriptome analysis tion of lipid and glycoprotein Ag to T cells (see Refs. 59 and 60 for of human monocytes after stimulation with IL-13. Many charac- review). The early up-regulation of these genes in monocytes sug- teristic markers of alternatively activated M␾ were seen in these gests that these cells may also be able to use CD1 for Ag presen- cells, plus a variety of highly interesting novel IL-13-regulated tation. Support for this suggestion is provided by the concomitant genes. These included CD1, TLR1, and SOCS1, plus various com- up-regulation of MRC1, which can endocytose Ag for eventual ponents of the IL-1 system. Taken together, our microarray data presentation by CD1b (13); maybe the other IL-13-regulated scav- outline the complex biological system required for the tight control enger receptors can perform a similar function. Interestingly, TLR1 of IL-1␤ production and response. IL-13 stimulation leads to a appears to be down-regulated by IL-13; this is a member of the decrease in caspase 1 activity, which consequently limits the pro- TLR family, whose function is to recognize pathogens or their duction of mature IL-1␤. Meanwhile, increased expression of IL- products and hence initiate innate immune responses (61, 62). A 1RII and IL-1Ra can negatively regulate the response to extracel- ligand for TLR1 alone has not been identified, but on heterodimer- lular IL-1␤. Clearly, IL-1␤ response and production is rigidly ization with TLR2, the receptor complex can respond to microbial controlled in monocytes, and this will have a significant impact in lipoproteins (63). IL-4 has been shown to down-regulate TLR2 in the surrounding microenvironment; IL-13 will drive the alternative monocytes (64); this suggests that there may be functional signif- activation of monocyte/M␾ and the reduced response to IL-1␤ will icance for the decreased expression of TLR1 or TLR2 in response potentiate this effect. to Th2 cytokines. Regulation of these various pattern recognition receptors is currently being investigated in our laboratory. References The microarray analysis also revealed the up-regulation of 1. Grage-Griebenow, E., H. D. Flad, and M. Ernst. 2001. Heterogeneity of human Downloaded from peripheral blood monocyte subsets. J. Leukocyte Biol. 69:11. SOCS1 and CISH; these molecules are members of the suppressors 2. Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. of cytokine signaling (SOCS) family, and are important for regu- 3:23. lating the cellular response to cytokines. SOCS1 is induced by LPS 3. Mosser, D. M. 2003. The many faces of macrophage activation. J. Leukocyte ␾ ␥ Biol. 73:209. and CpG in M and can inhibit IFN- and IL-12 signaling (65). 4. Mantovani, A., S. Sozzani, M. Locati, P. Allavena, and A. Sica. 2002. Macro- IL-4 and/or IL-13 up-regulate SOCS1 mRNA in a lung epithelial phage polarization: tumor-associated macrophages as a paradigm for polarized cell line and human keratinocytes, and SOCS1 can inhibit IL-4 M2 mononuclear phagocytes. Trends Immunol. 23:549. http://www.jimmunol.org/ 5. Dalton, D. K., S. Pitts-Meek, S. Keshav, I. S. Figari, A. Bradley, and signaling through the inhibition of JAKs (66–69). CISH has been T. A. Stewart. 1993. Multiple defects of immune cell function in mice with shown to negatively regulate IL-2 signaling in T cells, and it may disrupted interferon-␥ genes. Science 259:1739. 6. MacMicking, J., Q. W. Xie, and C. Nathan. 1997. Nitric oxide and macrophage also favor their differentiation into Th2 cells (65). Therefore, IL-13 function. Annu. Rev. Immunol. 15:323. up-regulation of SOCS1 could constitute a negative feedback loop, 7. Nathan, C. F., H. W. Murray, M. E. Wiebe, and B. Y. Rubin. 1983. Identification where SOCS1 expression inhibits further IL-13 signaling. In ad- of interferon-␥ as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. J. Exp. Med. 158:670. dition, SOCS1 or CISH could regulate the response to a variety of 8. Gerber, J. S., and D. M. Mosser. 2001. Reversing lipopolysaccharide toxicity by other cytokines and/or TLR ligands. ligating the macrophage Fc␥ receptors. J. Immunol. 166:6861. 9. Sutterwala, F. S., G. J. Noel, R. Clynes, and D. M. Mosser. 1997. Selective One of the most striking results from the microarray analysis suppression of interleukin-12 induction after macrophage receptor ligation. by guest on September 29, 2021 was the regulation of genes involved with IL-1 signal transduction J. Exp. Med. 185:1977. and biological activity. IL-1␤ is a fundamentally important proin- 10. Sutterwala, F. S., G. J. Noel, P. Salgame, D. M. Mosser, and R. Clynes. 1998. Reversal of proinflammatory responses by ligating the macrophage Fc␥ receptor flammatory cytokine that is produced during infection, injury, and type I. J. Exp. Med. 188:217. other pathological situations, and that can act on almost every type 11. Anderson, C. F., and D. M. Mosser. 2002. A novel phenotype for an activated of cell (70). Because IL-1 is such a potent inflammatory mediator, macrophage: the type 2 activated macrophage. J. Leukocyte Biol. 72:101. 12. Stein, M., S. Keshav, N. Harris, and S. Gordon. 1992. Interleukin 4 potently its effects must be tightly regulated to avoid toxicity. The up-reg- enhances murine macrophage mannose receptor activity: a marker of alternative ulation of IL-1RI, IL-1RII, and IL-1Ra is one of the hallmarks of immunologic macrophage activation. J. Exp. Med. 176:287. ␾ 13. Prigozy, T. I., P. A. Sieling, D. Clemens, P. L. Stewart, S. M. Behar, the alternatively activated M phenotype (2) and the increased S. A. Porcelli, M. B. Brenner, R. L. Modlin, and M. Kronenberg. 1997. The expression of the IL-1 decoy receptor (IL-RII) and the receptor mannose receptor delivers lipoglycan antigens to endosomes for presentation to antagonist synergize to interfere with the effects of IL-1␤ on these T cells by CD1b molecules. Immunity 6:187. 14. Sallusto, F., M. Cella, C. Danieli, and A. Lanzavecchia. 1995. Dendritic cells use cells (71). In this study, we observed the down-regulation of macropinocytosis and the mannose receptor to concentrate macromolecules in the caspase 1 mRNA. This enzyme is responsible for the proteolytic major histocompatibility complex class II compartment: downregulation by cy- cleavage of pro-IL-1␤ into its active mature form (44, 45). Our tokines and bacterial products. J. Exp. Med. 182:389. 15. Schebesch, C., V. Kodelja, C. Muller, N. Hakij, S. Bisson, C. E. Orfanos, and results show that pretreatment with IL-13 causes a reduction in S. Goerdt. 1997. Alternatively activated macrophages actively inhibit prolifera- ϩ caspase 1 activity and reduced processing of pro-IL-1␤ after LPS tion of peripheral blood lymphocytes and CD4 T cells in vitro. Immunology 92:478. stimulation; this may contribute to the lower concentration of 16. Mueller, T. D., J. L. Zhang, W. Sebald, and A. Duschl. 2002. Structure, binding, IL-1␤ seen in cell culture supernatants. The reduction in caspase 1 and antagonists in the IL-4/IL-13 receptor system. Biochim. Biophys. Acta activity is expected to have similar effects on the processing of 1592:237. 17. Hershey, G. K. 2003. IL-13 receptors and signaling pathways: an evolving web. IL-18 (72). Of interest, real-time PCR analysis of MMP-9 showed J. Allergy Clin. Immunol. 111:677. a decrease in mRNA levels of this enzyme (although this was not 18. Jordan, N. J., M. L. Watson, R. J. Williams, A. G. Roach, T. Yoshimura, and J. Westwick. 1997. Chemokine production by human vascular smooth muscle seen by microarray analysis), which will be confirmed in future cells: modulation by IL-13. Br. J. Pharmacol. 122:749. work. MMP-9 can also process pro-IL-1␤ to mature IL-1␤ in a 19. Sironi, M., F. L. Sciacca, C. Matteucci, M. Conni, A. Vecchi, S. Bernasconi, caspase-independent pathway (73), suggesting a potential role for A. Minty, D. Caput, P. Ferrara, F. Colotta, et al. 1994. Regulation of endothelial ␤ ␥ and mesothelial cell function by interleukin-13: selective induction of vascular this enzyme in IL-1 regulation by IL-13. PPAR has been shown cell adhesion molecule-1 and amplification of interleukin-6 production. Blood to negatively regulate MMP-9 activity in M␾ (74). Moreover, 84:1913. PPAR␥ can inhibit the production of IL-1␤ as well (75). We also 20. Folcik, V. A., R. Aamir, and M. K. Cathcart. 1997. Cytokine modulation of LDL oxidation by activated human monocytes. Arterioscler. Thromb. Vasc. Biol. have some preliminary data that IL-13 can decrease the expression 17:1954. of Pellino 1. This protein is required for IL-1␤-mediated signaling 21. McKenzie, A. N., J. A. Culpepper, R. de Waal Malefyt, F. Briere, J. Punnonen, G. Aversa, A. Sato, W. Dang, B. G. Cocks, S. Menon, et al. 1993. Interleukin 13, through IRAK1, IRAK4, and TRAF6; its down-regulation could a T-cell-derived cytokine that regulates human monocyte and B-cell function. therefore impede IL-1␤ signaling. Proc. Natl. Acad. Sci. USA 90:3735. The Journal of Immunology 845

22. Bolstad, B. M., R. A. Irizarry, M. Astrand, and T. P. Speed. 2003. A comparison 48. Chin, J., and M. J. Kostura. 1993. Dissociation of IL-1␤ synthesis and secretion of normalization methods for high density oligonucleotide array data based on in human blood monocytes stimulated with bacterial cell wall products. J. Im- variance and bias. Bioinformatics 19:185. munol. 151:5574. 23. Irizarry, R. A., B. M. Bolstad, F. Collin, L. M. Cope, B. Hobbs, and T. P. 2003. 49. Jinnin, M., H. Ihn, K. Yamane, and K. Tamaki. 2004. Interleukin-13 stimulates Speed: summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. the transcription of the human ␣2(I) collagen gene in human dermal fibroblasts. 31:e15. J. Biol. Chem. 279:41783. 24. Reiner, A., D. Yekutieli, and Y. Benjamini. 2003. Identifying differentially ex- 50. Welch, J. S., L. Escoubet-Lozach, D. B. Sykes, K. Liddiard, D. R. Greaves, and pressed genes using false discovery rate controlling procedures. Bioinformatics C. K. Glass. 2002. TH2 cytokines and allergic challenge induce Ym1 expression 19:368. in macrophages by a STAT6-dependent mechanism. J. Biol. Chem. 277:42821. 25. Ashburner, M., C. A. Ball, J. A. Blake, D. Botstein, H. Butler, J. M. Cherry, 51. Loke, P., M. G. Nair, J. Parkinson, D. Guiliano, M. Blaxter, and J. E. Allen. 2002. A. P. Davis, K. Dolinski, S. S. Dwight, J. T. Eppig, et al. 2000. Gene ontology: IL-4 dependent alternatively-activated macrophages have a distinctive in vivo tool for the unification of biology: The Gene Ontology Consortium. Nat. Genet. gene expression phenotype. BMC Immunol. 3:7. 25:25. 52. Jung, M., R. Sabat, J. Kratzschmar, H. Seidel, K. Wolk, C. Schonbein, S. Schutt, 26. Hosack, D. A., G. Dennis, Jr., B. T. Sherman, H. C. Lane, and R. A. Lempicki. M. Friedrich, W. D. Docke, K. Asadullah, et al. 2004. Expression profiling of 2003. Identifying biological themes within lists of genes with EASE. Genome IL-10-regulated genes in human monocytes and peripheral blood mononuclear Biol. 4:R70. cells from psoriatic patients during IL-10 therapy. Eur. J. Immunol. 34:481. 27. Dennis, G., Jr., B. T. Sherman, D. A. Hosack, J. Yang, W. Gao, H. C. Lane, and 53. Orita, T., K. Shimozaki, H. Murakami, and S. Nagata. 1997. Binding of NF-Y tran- R. A. Lempicki. 2003. DAVID: Database for Annotation, Visualization, and In- scription factor to one of the cis-elements in the myeloperoxidase gene promoter that tegrated Discovery. Genome Biol. 4:3. responds to granulocyte colony-stimulating factor. J. Biol. Chem. 272:23216. 28. Aerts, S., G. Thijs, B. Coessens, M. Staes, Y. Moreau, and B. De Moor. 2003. 54. Thukkani, A. K., C. J. Albert, K. R. Wildsmith, M. C. Messner, B. D. Martinson, Toucan: deciphering the cis-regulatory logic of coregulated genes. Nucleic Acids F. F. Hsu, and D. A. Ford. 2003. Myeloperoxidase-derived reactive chlorinating Res. 31:1753. species from human monocytes target plasmalogens in low density lipoprotein. 29. Wingender, E., X. Chen, E. Fricke, R. Geffers, R. Hehl, I. Liebich, M. Krull, J. Biol. Chem. 278:36365. V. Matys, H. Michael, R. Ohnhauser, et al. 2001. The TRANSFAC system on 55. Coste, A., M. Dubourdeau, M. D. Linas, S. Cassaing, J. C. Lepert, P. Balard, gene expression regulation. Nucleic Acids Res. 29:281. S. Chalmeton, J. Bernad, C. Orfila, J. P. Seguela, and B. Pipy. 2003. PPAR␥ Downloaded from 30. Rozen, R., and H. J. Skaletsky. 2000. Primer 3 on the WWW for general users promotes mannose receptor gene expression in murine macrophages and contrib- and for biologist programmers. In Bioinformatics Methods and Protocols: Meth- utes to the induction of this receptor by IL-13. Immunity 19:329. ods in Molecular Biology. S. Krawetz and S. Misener, eds. Humana, Totowa, NJ, 56. Ratcliffe, N. R., S. M. Kennedy, and P. M. Morganelli. 2001. Immunocytochem- p. 365. ical detection of Fc␥ receptors in human atherosclerotic lesions. Immunol. Lett. 31. Bonecchi, R., S. Sozzani, J. T. Stine, W. Luini, G. D’Amico, P. Allavena, 77:169. D. Chantry, and A. Mantovani. 1998. Divergent effects of interleukin-4 and in- 57. Ritter, M., C. Buechler, M. Kapinsky, and G. Schmitz. 2001. Interaction of ␥ terferon- on macrophage-derived chemokine production: an amplification cir- CD163 with the regulatory subunit of casein kinase II (CKII) and dependence of cuit of polarized T helper 2 responses. Blood 92:2668. CD163 signaling on CKII and protein kinase C. Eur. J. Immunol. 31:999.

32. Colotta, F., S. Saccani, J. G. Giri, S. K. Dower, J. E. Sims, M. Introna, and 58. Ricote, M., J. T. Huang, J. S. Welch, and C. K. Glass. 1999. The peroxisome http://www.jimmunol.org/ A. Mantovani. 1996. Regulated expression and release of the IL-1 decoy receptor proliferator-activated receptor (PPAR␥) as a regulator of monocyte/macrophage in human mononuclear phagocytes. J. Immunol. 156:2534. function. J. Leukocyte Biol. 66:733. 33. Muzio, M., F. Re, M. Sironi, N. Polentarutti, A. Minty, D. Caput, P. Ferrara, 59. Dutronc, Y., and S. A. Porcelli. 2002. The CD1 family and T cell recognition of A. Mantovani, and F. Colotta. 1994. Interleukin-13 induces the production of lipid antigens. Tissue Antigens 60:337. interleukin-1 receptor antagonist (IL-1ra) and the expression of the mRNA for the 60. Moody, D. B., and S. A. Porcelli. 2003. Intracellular pathways of CD1 antigen intracellular (keratinocyte) form of IL-1ra in human myelomonocytic cells. Blood presentation. Nat. Rev. Immunol. 3:11. 83:1738. 61. Pasare, C., and R. Medzhitov. 2003. Toll-like receptors: balancing host resistance 34. Fritsche, J., A. Muller, M. Hausmann, G. Rogler, R. Andreesen, and M. Kreutz. with immune tolerance. Curr. Opin. Immunol. 15:677. 2003. Inverse regulation of the ADAM-family members, decysin and 62. Takeuchi, O., and S. Akira. 2002. Genetic approaches to the study of Toll-like MADDAM/ADAM19 during monocyte differentiation. Immunology 110:450. receptor function. Microbes Infect. 4:887. 35. Brandon, C., L. M. Eisenberg, and C. A. Eisenberg. 2000. WNT signaling mod- 63. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, ulates the diversification of hematopoietic cells. Blood 96:4132. by guest on September 29, 2021 R. L. Modlin, and S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in 36. Vainio, S., and E. Ikonen. 2003. Macrophage cholesterol transport: a critical mediating immune response to microbial lipoproteins. J. Immunol. 169:10. player in foam cell formation. Ann. Med. 35:146. 37. Jackson, S. M., J. Ericsson, T. F. Osborne, and P. A. Edwards. 1995. NF-Y has 64. Flo, T. H., O. Halaas, S. Torp, L. Ryan, E. Lien, B. Dybdahl, A. Sundan, and a novel role in sterol-dependent transcription of two cholesterogenic genes. T. Espevik. 2001. Differential expression of Toll-like receptor 2 in human cells. J. Leukocyte Biol. 69:474 J. Biol. Chem. 270:21445. . 38. Kim, J. H., J. N. Lee, and Y. K. Paik. 2001. Cholesterol biosynthesis from lanos- 65. Kubo, M., T. Hanada, and A. Yoshimura. 2003. Suppressors of cytokine signal- terol: a concerted role for Sp1 and NF-Y-binding sites for sterol-mediated reg- ing and immunity. Nat. Immunol. 4:1169. ulation of rat 7-dehydrocholesterol reductase gene expression. J. Biol. Chem. 66. Federici, M., M. L. Giustizieri, C. Scarponi, G. Girolomoni, and C. Albanesi. ␥ 276:18153. 2002. Impaired IFN- -dependent inflammatory responses in human keratinocytes 39. Bonecchi, R., F. Facchetti, S. Dusi, W. Luini, D. Lissandrini, M. Simmelink, overexpressing the suppressor of cytokine signaling 1. J. Immunol. 169:434. M. Locati, S. Bernasconi, P. Allavena, E. Brandt, et al. 2000. Induction of func- 67. Haque, S. J., P. C. Harbor, and B. R. Williams. 2000. Identification of critical tional IL-8 receptors by IL-4 and IL-13 in human monocytes. J. Immunol. residues required for suppressor of cytokine signaling-specific regulation of in- 164:3862. terleukin-4 signaling. J. Biol. Chem. 275:26500. 40. Leveque, C., S. Grafte, J. Paysant, A. Soutif, B. Lenormand, M. Vasse, C. Soria, 68. Hebenstreit, D., P. Luft, A. Schmiedlechner, G. Regl, A. M. Frischauf, and J. P. Vannier. 1998. Regulation of interleukin 3 receptor ␣ chain (IL-3R␣)on F. Aberger, A. Duschl, and J. Horejs-Hoeck. 2003. IL-4 and IL-13 induce human monocytes by interleukin (IL)-4, IL-10, IL-13, and transforming growth SOCS-1 gene expression in A549 cells by three functional STAT6-binding motifs factor ␤ (TGF-␤). Cytokine 10:487. located upstream of the transcription initiation site. J. Immunol. 171:5901. 41. de Waal Malefyt, R., C. G. Figdor, R. Huijbens, S. Mohan-Peterson, B. Bennett, 69. Jiang, H., M. B. Harris, and P. Rothman. 2000. IL-4/IL-13 signaling beyond J. Culpepper, W. Dang, G. Zurawski, and J. E. de Vries. 1993. Effects of IL-13 JAK/STAT. J. Allergy Clin. Immunol. 105:1063. on phenotype, cytokine production, and cytotoxic function of human monocytes: 70. Dinarello, C. A. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095. comparison with IL-4 and modulation by IFN-␥ or IL-10. J. Immunol. 151:6370. 71. Mantovani, A., M. Locati, A. Vecchi, S. Sozzani, and P. Allavena. 2001. Decoy 42. Richard, M., P. Veilleux, M. Rouleau, R. Paquin, and A. D. Beaulieu. 2002. The receptors: a strategy to regulate inflammatory cytokines and chemokines. Trends expression pattern of the ITIM-bearing lectin CLECSF6 in neutrophils suggests Immunol. 22:328. a key role in the control of inflammation. J. Leukocyte Biol. 71:871. 72. Akita, K., T. Ohtsuki, Y. Nukada, T. Tanimoto, M. Namba, T. Okura, 43. Huang, J. T., J. S. Welch, M. Ricote, C. J. Binder, T. M. Willson, C. Kelly, R. Takakura-Yamamoto, K. Torigoe, Y. Gu, M. S. Su, et al. 1997. Involvement J. L. Witztum, C. D. Funk, D. Conrad, and C. K. Glass. 1999. Interleukin-4- of caspase-1 and caspase-3 in the production and processing of mature human dependent production of PPAR-␥ ligands in macrophages by 12/15-lipoxygenase. interleukin 18 in monocytic THP.1 cells. J. Biol. Chem. 272:26595. Nature 400:378. 73. Schonbeck, U., F. Mach, and P. Libby. 1998. Generation of biologically active 44. Cerretti, D. P., C. J. Kozlosky, B. Mosley, N. Nelson, K. Van Ness, T. A. Greenstreet, IL-1␤ by matrix metalloproteinases: a novel caspase-1-independent pathway of C. J. March, S. R. Kronheim, T. Druck, L. A. Cannizzaro, et al. 1992. Molecular IL-1␤ processing. J. Immunol. 161:3340. cloning of the interleukin-1␤ converting enzyme. Science 256:97. 74. Marx, N., G. Sukhova, C. Murphy, P. Libby, and J. Plutzky. 1998. Macrophages 45. Thornberry, N. A., H. G. Bull, J. R. Calaycay, K. T. Chapman, A. D. Howard, in human atheroma contain PPAR␥: differentiation-dependent peroxisomal pro- M. J. Kostura, D. K. Miller, S. M. Molineaux, J. R. Weidner, J. Aunins, et al. liferator-activated receptor ␥ (PPAR␥) expression and reduction of MMP-9 ac- 1992. A novel heterodimeric cysteine protease is required for interleukin-1␤ pro- tivity through PPAR␥ activation in mononuclear phagocytes in vitro. cessing in monocytes. Nature 356:768. Am. J. Pathol. 153:17. 46. Burns, K., F. Martinon, and J. Tschopp. 2003. New insights into the mechanism 75. Jiang, C., A. T. Ting, and B. Seed. 1998. PPAR-␥ agonists inhibit production of of IL-1␤ maturation. Curr. Opin. Immunol. 15:26. monocyte inflammatory cytokines. Nature 391:82. 47. Vannier, E., L. C. Miller, and C. A. Dinarello. 1992. Coordinated antiinflamma- 76. Fraticelli, P., M. Sironi, G. Bianchi, D. D’Ambrosio, C. Albanesi, A. Stoppac- tory effects of interleukin 4: interleukin 4 suppresses interleukin 1 production but ciaro, M. Chieppa, P. Allavena, L. Ruco, G. Girolomoni, et al. 2001. Fractalkine up-regulates gene expression and synthesis of interleukin 1 receptor antagonist. (CX3CL1) as an amplification circuit of polarized Th1 responses. J. Clin. Invest. Proc. Natl. Acad. Sci. USA 89:4076. 107:1173.