US009924728B2 (12 ) United States Patent (10 ) Patent No. : US 9 , 924 , 728 B2 Pandya et al . (45 ) Date of Patent: Mar. 27, 2018 (54 ) FOOD COMPOSITIONS COMPRISING ONE FOREIGN PATENT DOCUMENTS OR BOTH OF RECOMBINANT BETA -LACTOGLOBULIN PROTEIN AND WOWO 2013 /009182 1 /2013 RECOMBINANT ALPHA - LACTALBUMIN PROTEIN OTHER PUBLICATIONS Arora et al. , “ Variations in the fat unsaponifiable matter and (71 ) Applicant: Perfect Day , Inc. , Berkeley , CA (US ) cholesterol contents of goat milk, ” Ind . J. Daily Sci. , Sep . 29 : 191, 1976 . (72 ) Inventors : Ryan Pandya , South San Francisco , Beare -Rogers et al. , “ Lexicon of lipid nutration (IUPAC Technical CA (US ) ; Perumal Gandhi, Santa Report ), ” Pure and Applied Chemistry 73 ( 4 ) :685 - 744 , 2001. Clara , CA (US ) ; Shaowen Ji, Ann Brignon et al . , “ Preparation and amino acid sequences of human Arbor, MI ( US) ; Derek Beauchamp, kappa -casein ,” FEBS Lett. 188 ( 1 ): 48 -54 , 1985 . Dexter , MI (US ) ; Louis Hom , San Singh et al. , “ Post - translational Modification of Caseins, ” In Milk Proteins from Expression to Food , Chapter 5 , Second Edition , Carlos, CA (US ) 141 - 162 , 2014 . Choi and Jimenez- Flores , “ Expression and purification of ( 73 ) Assignee : Perfect Day, Inc. , Berkeley , CA (US ) glycosylated bovine beta -casein (L70S / P71S ) in Pichia pastoris , ” J . Agric . Food Chem . 49 ( 4 ): 1761 - 1766 , 2001 . ( * ) Notice : Subject to any disclaimer , the term of this Deshpande et al . , “ Protein Glycosylation Pathways in Filamentus patent is extended or adjusted under 35 Fungi, ” Glycobiology 18 ( 8 ): 626 -637 , 2008 . U . S . C . 154 ( b ) by 0 days . Farrell Jr. , et al. , “ Casein Micelle Structure : What Can Be Learned from Milk Synthesis and Structural Biology ?” Curr. Opin . Colloid Interface Sci . 11 : 135 - 147 , 2006 . ( 21) Appl. No .: 15 /438 ,273 Greenberg et al. , “ Human beta -casein . Amino acid sequence and identification of phosphorylation sites ,” J. Biol. Chem . (22 ) Filed : Feb . 21, 2017 259 ( 8 ) :5132 -5138 , 1984 . Hansson et al. , “ Expression of human milk beta - casein in (65 ) Prior Publication Data Escherichia coli: comparison of recombinant protein with native isoforms, ” Protein Expr. Purif . 4 ( 5 ) :373 - 381 , 1993 . US 2017 /0164632 A1 Jun . 15 , 2017 Idiris et al . , “ Engineering of protein secretion in yeast : strategies and impact on protein production , ” Appl . Microbiol. Biotechnol . 86 ( 2 ) :403 -417 , 2010 . Related U . S . Application Data Imafidon et al ., “ Isolation , purification , and alteration of some (63 ) Continuation of application functional groups of major milk proteins: a review , ” Crit . Rev. Food . No . Sci. Nutr. 37 ( 7 ) :663 - 689 , 1997 . PCT/ US2015 / 046428 , filed on Aug . 21, 2015 . International Preliminary Report on Patentability in International Application No. PCT/US2015 /046428 , dated Feb . 21, 2017 , 12 (60 ) Provisional application No . 62/ 040 , 393 , filed on Aug . pages. 21, 2014 International Search Report for PCT /US2015 /046428 , dated Feb . 5 , 2016 , 8 pages. (51 ) Int . CI. Jenness, “ Composition and Characteristics of Goat Milk : Review CO7K 14 /00 (2006 . 01 ) 1968 - 1979 , " J . Dairy Sci . 63 ( 10 ) : 1605 - 1630 , 1980 . ( 2006 . 01) Jensen , “ Bovine milk lipids, ” in Handbook of Milk Composition , A23C 11/ 08 Academic Press , pp . 543 -575 , 1995 . A23C 9 / 123 ( 2006 .01 ) Juarez et al. , “ Physico -Chemical Characteristics of Goat ' s Milk as A23C 19 /055 ( 2006 . 01 ) Distinct From Those of Cow 's Milk ,” Int. Dairy Fed . Bulletin A23C 9 / 13 ( 2006 . 01 ) 202 :54 -67 , 1986 . A23 ) 3 / 10 ( 2006 . 01 ) Kawai et al. , “ Transformation of Saccharomyces cerevisiae and COZK 14 /47 ( 2006 .01 ) other fungi, ” Bioengineered Bugs 1 : 395 -403 , 2010 . U . S . CI. Kim et al. , “ High -Level Expression of Bovine B -Lactoglobulin in (52 ) Pichia pastoris and Characterization of Its Physicial Properties, ” CPC ...... A23C 11/ 08 ( 2013 .01 ); A23C 9/ 123 Protein Engineering 10 ( 11 ) :1339 - 1345 , 1997 . ( 2013 . 01 ) ; A23C 9 / 1315 ( 2013. 01 ) ; A23C Li et al ., “ Cell culture processes for monoclonal antibody produc 19 /055 (2013 .01 ) ; A23 ) 3 / 10 ( 2013 .01 ) ; COOK tion , ” Landes Bioscience 2 : 466 -477 , 2010 . 14 /00 ( 2013 . 01 ); CO7K 14 /4732 ( 2013 .01 ) Lonnerdal, “ Recombinant Human Milk Proteins — An Opportunity (58 ) Field of Classification Search and a Challenge ," Am . J . Clin . Nutr. 63( 4 ): 622S -6265 , 1996 , None Abstract only . See application file for complete search history. Lonnerdal, “ Recombinant Human Milk Proteins, ” Nestle Nutr. Workshop Ser . Pediatr . Program 58 : 207 - 217 , 2006 . ( 56 ) References Cited (Continued ) U . S . PATENT DOCUMENTS Primary Examiner - Anand U Desai 5 , 942, 274 A 8 / 1999 Slattery et al . (74 ) Attorney, Agent, or Firm — Fish & Richardson P. C . 6 , 181, 421 B11 / 2001 Aspnes et al . 6 , 270 , 827 B1 8 / 2001 Gaull et al. (57 ) ABSTRACT 9 , 591, 872 B2 * 3 /2017 Rosado Loria ...... A23L 33 /40 2010 /0119691 AL 5 / 2010 Huang et al. Disclosed herein are methods and compositions including 2014 /0065264 A1* 3/ 2014 Do .. . . . A61K 38 /018 casein , and methods for making these compositions . 426 / 73 2017/ 0273328 AL 9 / 2017 Pandya et al. 30 Claims, 9 Drawing Sheets US 9, 924 , 728 B2 Page 2

References Cited Rosmaninho et al . , “ The effect of citrate on calcium phosphate ( 56 ) deposition from simulated milk ultrafiltrate ( SMUF ) , " J . Food Engineering 77 (3 ): 379 - 387 , 2006 . Simons et al . , " Overproduction of bovine beta -casein in Escherichia OTHER PUBLICATIONS coli and engineering of its main chymosin cleavage site ,” Protein Eng. 6 ( 7 ) : 763- 770 , 1993 . MacGibbon et al. , “ Compositions and structure of bovine milk Smouse , “ A Laboratory Continuous Deodorizer, ” Inform . 8 : 1176 lipids, ” in Advanced Dairy Chemistry , vol. 2 Lipids, pp . 1 - 42 , 2006 . 1181, 1997 . Mansson , “ Fatty acids in bovine milk fat, ” Food & Nutrition Written Opinion of the International Searching Authority for PCT/ US2015 /046428 , dated Feb . 5 , 2016 , 10 pages . Research , 2008, 52 : 1, 2008 . Yu et al. , “ The Modification and Analysis of Vegetable Oil for Park , “ Bioreactive Components in Bovine Milk ,” in Bioactive Cheese Making, ” J. Am . Oil . Chem . Soc . 77 : 911- 915, 2000 . Components in Milk and Dairy Products , Wiley - Blackwell, pp . Zhang et al. , “ Fermentation Strategies for Recombinant Protein 15 - 42 , 2009 . Expression in the Methylotrophic Yeast Pichia pastoris , " Park , “ Rheological characteristics of goat and sheep milk ,” Small Biotechnol . Bioprocess Eng . 5 : 275 -287 , 2000 . Ruminant Res . 68 ( 1 - 2 ) : 73 - 87 , 2007 . Zhu , “Mammalian cell protein expression for biopharmaceutical Posati et al. , “ Composition of foods: dairy and egg products : raw , production ,” Biotechnol. Adv. 30 (5 ): 1158 -1170 , 2012 . processed , and prepared ,” Agricultural Handbook — U . S . Dept. of Agriculture (USA ), No . 8 - 1 , 158 pages , 1976 . * cited by examiner U . S . Patent Mar . 27, 2018 Sheet 1 of 9 US 9 ,924 , 728 B2

Fats Glycerol ( SCFAS Proteins

DNA cells Esterification HOSO

Fermentation Inter -esterification

2Purification = Deodorization

Carbohydrates Formulation

Ash

Milk

(downstream processing) FIG . 1 atent Mar . 27 , 2018 Sheet 2 of 9 US 9, 924, 728 B2

FIG . 2A

FIG . 2B U . S . Patent Mar . 27, 2018 Sheet 3 of 9 US 9 ,924 ,728 B2

precipitate supernatant

Mr (kDa )

250 130 8100

8

8

G

?

FIG . 3 U . S . Patent Mar. 27, 2018 Sheet 4 of 9 US 9 ,924 , 728 B2

?? 3 ? ? ? ?

?????????????????????? FIG.4

??????????????????????????????? Alpha-actalbumin U . S . Patent Mar. 27 , 2018 Sheet 5 of 9 US 9, 924 ,728 B2

0 .600

: : : : : : : : : : : : : : : : : : : :: : : :: : : : : : : : : :

: : : 0 .500 : : : : : : :: : : : : :: : : : :: : : : : : : : : 11 : :: : : : : : : : : : : : : : : : :: : :: : : : :: : :: : : : : : : : : : : : : : : : :: : : :: : : : : :: : : : : : : : :: : : :: : : : : : :: : :: : : : : : : : : : : :: : : : : 1 : 2 : : : : : : : : ELISAsignal(OD650) : : : : : : : :: : :

: .300 :: : : : : 39 : : : : : : : : : : : : :: : : : : : : : : :: : :: : : : : : : : :: : : : : : : : : : : :: : : : : : : : : : : : : : : : 0 . 200 : : : : : :: :: : : :: : :: : : : :: : : : : : : : : :: : : : : :: : :: : : : : : : : : : : : : : : :: : : : : : 01 : 2 : :

0 . 100 : : . i .. : : . : : : : : : : : : : : : : : : :: : : : : : : : : : : 1 : 1 : :: :: :: : :: : :: : : :: : : : : : : :: : : : : : : : : : : : : :: : : : : : 35331 0 .000 : : : :: : : : : : : : : 0 . 1 % ( W / V ) Yeast neg ctrl nat- LAA OST -LAA Dry Milk FIG . 5

: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :: : : :: .

: : : : : : . : . : . : . : . : : : : : : : : : : : :

. : : : : : : : :

1 : : : : : : : : : : : : : : : : : : : : : : : : : : : : . : : : : : : : :

: :

.:1.

: : : : : : ELISAsignal(OD650) : : : : : : : : ::

. : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : . : : : : : : : : : : : : :

é : : : : : :: : : : : : :: . : : : : : : :: . . : . : . : . : . : . : . : . : . : : : . : . : . : . : . : . : . : . : . : . : : . : . : . : . : . : . : . : . : . : . : : : : : : : : : : : : :: : : : : : : : : : : : : : :: . o 9999999999 999999999999 Yeast Neg Ctrl 0 .Dry 1 % Milk(w /v ) Blank LGB FIG . 6 U . S . Patent Mar . 27, 2018 Sheet 6 of 9 US 9 ,924 ,728 B2

WT Milk MW Yeast LGB

130 - 100 70

Beta - lactoglobulin

FIG . 7 U . S . Patent Mar . 27, 2018 Sheet 7 of 9 US 9 ,924 ,728 B2

? OD600

0 ZZZ ) alphaS1 beta

0

A NormalizedValue Activity** * W 7477 * A very*** * N AnyOetty ** ** * * - Ace *** * *e sving y * 7: Dorty***Foru : care *** 337 .. .. 076 *** * * **** * * * * * A *** * * *** * : : : **** * 37 2676*** * * * * * * viny *Ayie .:: . :. 331 krvineri** try o Art WT yeast SLH115 SLH116 SLH117 SLH118 SLH122 m FIG . 8 U . S . Patentatent MarMar . 27 , 2018 2018 Sheet 8 of 9 US 9 ,924 ,728 B2

- ws

-

-

-

- Maltose)

-

-

-

- - 13 FIG.9 - mixture1 - mixture2

-

- - Product Product -

-

-

- Mixing - ? ? ???????????????? - *

* ~ -

- - *

Mixing/ Y -

~ - *

calon ~ - *

- * -

- *

* ~ - Sonication Oilmixture2 D . a . . . » » » » » ~ * -

~ - ~ - * - -

* ~ ~

* - ~ - * - -

* ~ solution2 ~ * - ~ * - ~

* - - 11 - Protein ~

- ~

* - sourcereto - - - ~ imatoret.communeMixing * - ~ * ~ - ~

* B-carotenesolution - -

* - ~

~ - ~ CaCl2solution ~ * - KH2PO4+Naz - * ~

~ - ~

* ~ - citratesolution - ~- * - ~

* - ~ * ~ - Oilmixture1 ~

~ * - -

* - - ~ preparation ~ * solutioncaroteneB- - 1Mixing ~ *

-

- * - Mixing ~

-

* - -

• - ~

* - - ~ ~- * -

• ~ - ~

- - ~

~ - -

* - ~

~ lan • - (CaCl2solution ~ ~

- ~ - * - Y ~ ~

* - ~ Freefattyacids solution1 CaCl2solution, * Mono-&Diglycerides -

* Aromamixture - -

~ * - ~ Phospholipids Protein * - e 3{KH2PO4+Nascitratesolutionpreparation ~ Mixing - -

* - ~ * -

- - ~

~ * - ~

* ~ - ~

* ~ - -

* - - DI ~

~ Mixing/ * - ~

* ~ -

water * -

- * - ~ * Aromamixture ~ - preparation * ~ - Sonication - * - ~

- ~

* - -

* ~ Coconutoil Sunfloweroil - - ~ Oilbase ~ - - Tributyrin ~ ~

-

~

~ - ~

* - - Wheyprotein - Caseinprotein ~ * - Protein mixture ~ *

p ~ ------

- ~

- -

- U . S . Patent Mar . 27, 2018 Sheet 9 of 9 US 9 ,924 ,728 B2

FIG . 10 US 9 , 924 , 728 B2 FOOD COMPOSITIONS COMPRISING ONE Existing dairy milk alternatives , such as soy , almond , or OR BOTH OF RECOMBINANT coconut milk fall short both in flavor and in functionality ; BETA -LACTOGLOBULIN PROTEIN AND moreover , a large part of the industrial and cultural signifi RECOMBINANT ALPHA -LACTALBUMIN cance of dairy milk stems from its usefulness in derivative PROTEIN 5 products , such as cheese , yogurt, cream , or butter . Non -dairy plant- based milks , while addressing environmental and CROSS -REFERENCE TO RELATED health concerns ( and while providing adequate flavor for a APPLICATION small segment of the population ), almost universally fail to form such derivative products when subjected to the same This application is a continuation of International Appli - 10 processes used for dairy milk . cation No. PCT /US2015 /046428 , filed Aug . 21 , 2015 , which What is needed , therefore , is a dairy substitute or com claims priority to U . S . Provisional Patent Application No . position that has desirable flavor and performance charac 62/ 040 , 393 , filed on Aug. 21, 2014 , the entire contents of teristics , e . g . , a composition that replicates dairy flavors, which are incorporated by reference . minimizes foodborne pathogens, and has a lower environ 15 mental impact in production , while retaining the ability to be FIELD OF THE INVENTION used for derivative or downstream applications of dairy milk and while providing a similar nutritional profile as a mam The invention is directed to dairy substitutes, methods of mal - or mammalian -produced milk . manufacturing the same, and compositions comprising ani mal- free milk fats and proteins for food applications, such as 20 SUMMARY OF THE INVENTION milk , butter , cheese , yogurt , and cream . The present invention is based on the discovery that only BACKGROUND OF THE INVENTION a subset of components in mammal- produced milk can be used to generate a composition that has a similar flavor, a The global dairy market is estimated at $ 500 billion with 25 similar appearance , a similar nutritional value , a similar an average annual growth rate of 4 % . Bovine milk attributes aroma, and a similar mouth feel of mammal- produced milk . to a significant portion of the market whereas plant- based Provided herein are compositions including : about 0 . 3 g / L alternatives account for $ 1 billion in the US and an estimated to about 1 . 1 g /L K -casein protein ; about 1 . 25 g/ L to about 4 . 9 $ 700 million is estimated for lactose - intolerantmilk . Bovine g / L B - casein protein ; a final total concentration of one or milk is known to have four specific caseins , a - sl - casein , 30 more lipids of about 0 weight % to about 45 weight % ; a a - s2 - casein , B - casein , and K - casein . Mammal- or mamma - final total concentration of one or more flavor compounds of lian - produced milk is a very complex fluid that includes about 0 .01 weight % to about 6 weight % ; a final total several thousand components ( e . g . , if all triglycerides are concentration of about 0 . 1 weight % to about 6 weight % of identified ) . Mammal - or mammalin -produced milk includes one or more sweetening agents ; and a final total concentra water, variety of different lipids, sugar , a variety of different 35 tion of ash of about 0 . 15 weight % to about 1 . 5 weight % , proteins , and a variety of different inorganic salts and where the composition does not include an animal - derived compounds (see , e . g ., Boland and Thompson (Eds ) , Milk component. Proteins from Expression to Food , Academic Press , 2014 ) . Also provided are compositions that include: about 0 . 3 Although mammal- produced milk , such as bovine milk , is g / L to about 1 . 1 g / L K - casein protein ; about 1 .25 g / L to about considered by many to be an ideal source of nutrition , 40 4 . 9 g / L ß - casein protein ; a final total concentration of one or various milk alternatives to mammal- or mammalian -pro - more lipids of about 0 weight % to about 45 weight % ; a duced milk ( e . g . , bovine milk ), such as plant- or nut- based final total concentration of one or more flavor compounds of milks, e . g . , soy , almond , or coconut milk , have been pursued about 0 .01 weight % to about 6 weight % ; a final total for reasons related to mammal- or mammalian -produced concentration of about 0 . 1 weight % to about 6 weight % of milk ' s allergenicity , lactose intolerance of certain compo - 45 one or more sweetening agents ; and a final total concentra nents , personal preference , and the perceived environmental tion of ash of about 0 . 15 weight % to about 1 . 5 weight % , benefits of a reduced dairy industry. where the composition : does not include at least one com For example , the environmental impact resulting from ponent found in a mammal - produced milk ; includes at least dairy effluent can result in significant levels of nitrate which one component not present in a mammal- produced milk ; has the potential to contaminate groundwater . Groundwater 50 and / or includes a higher or lower concentration of at least forms the main source of water supply for many towns and one component as compared to the concentration of the at farms where surface water supplies are limited . In the US , least one component in a mammal- produced milk . In some half the population relies completely or partially on ground - embodiments of these compositions, the composition water , and similar figures are available for Europe ( see , e . g ., includes a higher concentration of at least one component the Victoria State Government Department of Environment 55 selected from the group of: calcium , phosphate , B complex and Primary Industries website at www .depi . vic . gov. au / vitamins , vitamin A , vitamin D , vitamin E , and vitamin K , agriculture -and - food / dairy /managing - effluent/ dairy -efflu as compared to the concentration of the one or more com ent -protecting - groundwater ) . The presence of foodborne ponents in a mammal - produced milk . In some embodiments pathogens in milk is due to direct contact with contaminated of these compositions , the composition does not include at sources in the dairy farm environment and to excretion from 60 least one component found in a mammal - produced milk the udder of an infected animal. Outbreaks of disease in selected from the group of: lactose , bacteria , mycobacteria , humans have been traced to the consumption of unpasteur - allergens, viruses , prions , yeast , growth hormones , leuko ized milk and have also been traced back to pasteurized cytes , antibiotics , heavy metals , immunoglobulins, lactofer milk . The major contaminants usually encountered in milk rin , lactoperoxidase, and lipase . In some embodiments of and milk products include pesticide residues , heavy metals , 65 these compositions , wherein the composition includes at and aflatoxin M1 (Awasthi et al ., Indian J. Public Health least one component not present in a mammal- produced 56 : 95 - 99 , 2012 ) . milk selected from the group of an artificial sweetener , a US 9 , 924 ,728 B2 plant- derived lipid , a ß -casein protein that is non -glycosy - ides are plant- derived monoglycerides and diglycerides , or lated or has a non -mammalian glycosylation pattern , and a are bacteria -derived monoglycerides and diglycerides . K - casein protein that is non - glycosylated or has a non In some embodiments of any of the compositions mammalian glycosylation pattern . described herein , the flavor compounds include at least one Also provided are compositions including : about 0 . 3 g / L 5 flavor compound selected from the group consisting of: to about 1. 1 g /L K -casein protein that is unglycosylated or d - decalactone, ethyl butyrate , 2 - furyl methyl ketone, 2 , 3 pentanedione, y -undecalactone , and d -undecalactone . In has a non -mammalian glycosylation pattern , about 1 . 25 g / L some embodiments of any of the compositions described to about 4 . 9 g / L ß - casein protein that is unglycosylated or herein , the one or more sweetening agents is a saccharide . In has a non -mammalian glycosylation pattern ; a final total 10 some embodiments of any of the compositions described concentration of one or more lipids of about 0 weight % to herein , the saccharide is selected from the group consisting about 45 weight % ; a final total concentration of one or more of : glucose , mannose , maltose , fructose , galactose , lactose , flavor compounds of about 0 .01 weight % to about 6 weight sucrose , monatin , and tagatose . In some embodiments of any % ; a final total concentration of about 0 . 1 weight % to about of the compositions described herein , the one or more 6 weight % of one or more sweetening agents ; and a final 15 sweetening agents is an artificial sweetener. In some total concentration of ash of about 0 . 15 weight % to about embodiments of any of the compositions described herein , 1 . 5 weight % . the artificial sweetener is selected from the group of: stevia , Also provided are composition including a micelle includ - aspartame, cyclamate , saccharin , sucralose , mogrosides , ing a K - casein protein and a ß - casein protein , where the brazzein , curculin , erythritol, glycyrrhizin , inulin , isomalt , micelle has a diameter of about 50 nm to about 350 nm , and 20 lacititol, mabinlin , malititol, mannitol, miraculin , monatin , the K -casein protein and the B -casein protein are unglyco monelin , osladin , pentadin , sorbitol, thaumatin , xylitol, ace sylated or have a non -mammalian glycosylation pattern . In sulfame potassium , advantame, alitame, aspartame- acesul some embodiments of these methods , the compositions fame, sodium cyclamate , dulcin , glucin , neohesperidin include a final concentration of micelles of about 2 . 0 weight dihyrdochalcone, neotame, and P - 4000 . % to about 6 weight % . In some embodiments of these 25 In some embodiments of any of the compositions compositions , the ratio of the B -casein protein to the K - ca - described herein , the ash includes one or more of: calcium , sein protein in the micelle is about 3 . 5 : 1 to about 5 . 5 : 1 ( e . g ., phosphorus , potassium , sodium , citrate , and chloride . In about about 4 : 1 to about 5 : 1 ) . In some embodiments of these some embodiments of any of the compositions described methods , the composition further includes : a final total h erein , the ash comprises one or more ( e . g . , one, two , or concentration of one or more lipids of about 0 weight % to 30 three ) of CaC1, , KH , PO4, and Na, citrate . In some embodi about 45 weight % ; a final total concentration of one or more m ents of any of the compositions described herein , the flavor compounds of about 0 .01 weight % to about 6 weight CaCl, has a final concentration of about 0 .05 g / L to about 0 . 2 % ; a final total concentration of about 0 . 1 weight % to about g / L , the KH , PO , has a final concentration of about 0 . 2 g / L 6 weight % of one or more sweetening agents ; and a final to about 0 .4 g /L ; and the Naz citrate has a final concentration total concentration of ash of about 0 . 15 weight % to about 35 of about 0 . 1 g / L to about 0 . 3 g / L . 1. 5 weight % . In some embodiments of any of the compositions In some embodiments of any of the compositions described herein , the K -casein protein is a cow , human , described herein , the composition comprises about 0 . 27 sheep , goat, buffalo , camel, horse , donkey , lemur, panda , weight % to about 0 .75 weight % K -casein protein and about guinea pig , squirrel, bear, macaque, gorilla , chimpanzee, 1 . 23 weight % to about 3 .27 weight % ß -casein . In some 40 mountain goat, monkey , ape , cat, dog , wallaby , rat, mouse , embodiments of any of the compositions described herein , elephant, opossum , rabbit, whale , baboons, gibbons, orang the final total concentration of one or more lipids of about 0 utan , mandrill, pig , wolf , fox , lion , tiger, echidna , or woolly weight % to about 4 . 5 weight % . mammoth K -casein protein . In some embodiments of any of In some embodiments of any of the compositions the compositions described herein , the ß - casein protein is a described herein , the one or more lipids are selected from the 45 cow , human , sheep , goat, buffalo , camel, horse , donkey , group consisting of: sunflower oil , coconut oil , tributyrin , lemur, panda , guinea pig , squirrel , bear , macaque , gorilla , mono - and di- glycerides, free fatty acids , and phospholipids . chimpanzee , mountain goat, monkey , ape , cat , dog , wallaby , In some embodiments of any of the compositions described rat, mouse , elephant, opossum , rabbit , whale , baboons, herein , the composition includes one of more of: a final gibbons , orangutan , mandrill , pig , wolf , fox , lion , tiger, concentration of sunflower oil of about 1 weight % to about 50 echidna , or woolly mammoth ß - casein protein . 28 weight % ; a final concentration of coconut oil of about In some embodiments of any of the compositions 0 . 5 weight % to about 14 weight % ; a final concentration of described herein , the composition further includes : a final tributyrin of about 0 . 05 weight to about 1 . 0 weight % ; a final concentration of a -lactalbumin protein of about 0 . 4 g / L total concentration of monoglycerides and diglycerides of weight % to about 2 . 5 weight % ; and /or a final concentration about 0 .08 weight % to about 1 . 2 weight % ; a final total 55 of B - lactoglobulin protein of about 2 .5 weight % to about 4 . 5 concentration of free fatty acids of about 0 .02 weight % to weight % . In some embodiments of any of the methods about 0 . 28 weight % ; and a final total concentration of described herein , the a - lactalbumin protein is a cow , human , phospholipids of about 0 .02 weight % to about 0 . 3 weight sheep , goat, buffalo , camel, horse , donkey, lemur, panda , percent. In some embodiments of any of the compositions guinea pig , squirrel , bear, macaque , gorilla , chimpanzee , described herein , the free fatty acids comprise at least one 60 mountain goat, monkey , ape, cat , dog , wallaby , rat , mouse , fatty acid selected from the group of: butyric acid , caproic elephant, opossum , rabbit , whale , baboons, gibbons , orang acid , caprylic acid , and capric acid . In some embodiments of utan , mandrill, pig , wolf, fox , lion , tiger, echidna , or woolly any of the compositions described herein , the phospholipids mammoth a - lactalbumin protein . In some embodiments of are soy lecithin phospholipids, sunflower lecithin phospho any of the compositions described herein , the B - lactoglobu lipids, cotton lecithin phospholipids, or rapeseed lecithin 65 lin protein is a cow , human , sheep , goat , buffalo , camel, phospholipids. In some embodiments of any of the compo - horse , donkey , lemur, panda , guinea pig , squirrel, bear , sitions described herein , the monoglycerides and diglycer macaque, gorilla , chimpanzee , mountain goat , monkey, ape , US 9 ,924 ,728 B2 cat , dog , wallaby, rat , mouse , elephant, opossum , rabbit, the K -casein protein that is unglycosylated and /or has a whale , baboons, gibbons , orangutan , mandrill, pig , wolf , non -mammalian glycosylation pattern in the composition is fox , lion , tiger, echidna, or woolly mammoth B - lactoglobu about 0 . 02 weight % to about 0 .6 weight % ; and the final lin protein . concentration of the ß - casein that is unglycosylated and /or In some embodiments of any of the compositions 5 has a non -mammalian glycosylation pattern in the compo described herein , the composition further includes: a final sition is about 0 . 02 weight % to about 2 . 5 weight % . concentration of a - S1 -casein protein of about 11 weight % Also provided are powder compositions that include : a to about 16 weight % ; and /or a final concentration of final concentration of K - casein protein of about 3 .6 weight % a -S2 -casein protein of about 2 weight % to about 5 weight to about 5 . 4 weight % ; a final concentration of B - casein % . In some embodiments of any of the compositions 10 protein of about 16 . 3 weight % to about 24 . 5 weight % ; a described herein , the a -S1 - casein protein is a cow , human , final concentration of a sweetening agent of about 35 weight sheep , goat, buffalo , camel, horse , donkey, lemur, panda , % to about about 40 weight % ; a final concentration of one guinea pig , squirrel, bear, macaque , gorilla , chimpanzee , or more lipids of about 25 weight % to about 30 weight % ; mountain goat , monkey , ape , cat , dog , wallaby, rat, mouse , a final concentration of ash of about 5 weight % to about 7 elephant, opossum , rabbit , whale , baboons , gibbons, orang - 15 weight % ; and a final concentration of water of about 2 utan , mandrill , pig , wolf , fox , lion , tiger, echidna , or woolly weight % to about 5 weight % , where the K -casein protein mammoth a -S1 - casein protein ; and / or the a - S2 - casein pro is an unglycosylated and / or has a non -mammalian glycosy tein is a cow , human , sheep , goat , buffalo , camel, horse , lation pattern , and / or the B - casein protein is an unglycosy donkey, lemur, panda, guinea pig , squirrel , bear, macaque , lated and / or has a non -mammalian glycosylation pattern . gorilla , chimpanzee , mountain goat, monkey , ape, cat, dog, 20 Also provided are nucleic acids that include : a promoter ; wallaby, rat, mouse , elephant, opossum , rabbit, whale , a sequence encoding a signal sequence ; a sequence encoding baboons, gibbons , orangutan , mandrill , pig , wolf , fox , lion , a milk protein ; and a yeast termination sequence , where the tiger , echidna , or woolly mammoth a - S2 - casein protein . promoter is operably linked to the signal sequence , the In some embodiments of any of the compositions signal sequence is operably linked to the sequence encoding described herein , the composition further includes one or 25 the milk protein , and the terminal sequence is operably more of: serum albumin , lactoferrin , and transferrin . In some linked to the sequence encoding the milk protein . In some embodiments of any of the compositions described herein , embodiments of these nucleic acids, the promoter is a the serum albumin is a cow , human , sheep , goat, buffalo , constitutive promoter . In some embodiments of these camel, horse , donkey , lemur , panda , guinea pig , squirrel, nucleic acids, the promoter is an inducible promoter. In bear, macaque , gorilla , chimpanzee , mountain goat, monkey , 30 some embodiments of these nucleic acids, the signal ape, cat, dog , wallaby, rat, mouse, elephant, opossum , rabbit , sequence is a signal sequence from the encoded milk protein whale , baboons, gibbons , orangutan , mandrill , pig , wolf, or a different milk protein , or is a signal sequence from a fox , lion , tiger, echidna , or woolly mammoth serum albu - yeast mating factor . In some embodiments of these nucleic min ; the lactoferrin is a cow , human , sheep , goat, buffalo , acids, the encoded milk protein is selected from the group camel, horse , donkey , lemur, panda , guinea pig , squirrel, 35 consisting of: ß - casein , K - casein , a -S1 - casein , a - S2 -casein , bear , macaque , gorilla , chimpanzee, mountain goat ,monkey , a - lactalbumin , ß - lactoglobulin , lactoferrin , or transferrin . In ape , cat, dog , wallaby, rat , mouse , elephant, opossum , rabbit , some embodiments of these nucleic acids , the nucleic com whale , baboons , gibbons , orangutan , mandrill , pig , wolf , prises a bacterial origin of replication . In some embodiments fox , lion , tiger, echidna , or woolly mammoth lactoferrin ; of these nucleic acids, the nucleic acid further includes a and / or the transferrin is a cow , human , sheep , goat, buffalo , 40 selection marker . In some embodiments of these nucleic camel, horse , donkey , lemur, panda , guinea pig , squirrel, acids, the selection marker is an antibiotic resistance gene . bear, macaque , gorilla , chimpanzee , mountain goat, monkey, Some embodiments of these nucleic acids further include : ape , cat, dog , wallaby, rat, mouse , elephant, opossum , rabbit , an additional promoter sequence ; an additional sequence whale , baboons , gibbons, orangutan , mandrill , pig , wolf , encoding a signal sequence ; a sequence encoding an addi fox , lion , tiger, echidna , or woolly mammoth transferrin 45 tional milk protein ; and an additional yeast termination protein . sequence , where the additional promoter sequence is oper Some embodiments of any of the compositions described ably linked to the additional sequence encoding a signal herein , further include one or more color balancing agents. sequence , the sequence encoding the signal sequence is In some embodiments of any of the compositions described operably linked to the sequence encoding the additionalmilk herein , the one or more color balancing agents is ß - carotene 50 protein , and the sequence encoding the additional milk or annatto . In some embodiments of any of the compositions protein is operably linked to the additional yeast terminal described herein , the composition has a pH of about 6 . 2 to sequence . about 7 . 2 ( e . g . , about 6 . 2 to about 6 . 8 ) . Also provided are host cells that include any of the nucleic Also provided are compositions including : a mammalian - acids described herein . In some embodiments of these host produced milk or a processed mammal-produced milk ; and 55 cells , the host cell is a yeast strain ( e . g ., a Kluyveromyces sp ., one or both of a K - casein protein that is unglycosylated or Pichia sp ., Saccharomyces sp ., Tetrahymena sp ., Yarrowia has an non -mammalian glycosylation pattern , and a ß - casein sp . , Hansenula sp ., Blastobotrys sp ., Candida sp ., Zygosac protein that is unglycosylated or has an non -mammalian charomyces sp . , or Debaryomyces sp . ) . glycosylation pattern . In some embodiments of these meth - Also provided herein are methods of producing a recom ods , the final concentration of the K - casein protein that is 60 binant milk protein that is unglycosylated or has a non unglycosylated or has a non -mammalian glycosylation pat- mammalian glycosylation pattern , the method including : tern in the composition is 0 .02 weight % to about 3 . 0 weight culturing any of the host cells described herein in a culture % . In some embodiments of these methods, the final con - medium under conditions sufficient to allow for secretion of centration of the B - casein protein that is unglycosylated or the milk protein that is unglycosylated or has a non -mam has a non -mammalian glycosylation pattern in the compo - 65 malian glycosylation pattern ; and harvesting the milk pro sition is 0 . 02 weight % to about 3 . 0 weight % . In some tein that is unglycosylated or has a non -mammalian glyco embodiments of these methods, the final concentration of sylation pattern from the culture medium . US 9 , 924 , 728 B2 Also provided are methods of producing a micelle includ mabinlin , malititol, mannitol, miraculin , monatin , monelin , ing a ß - casein that is unglycosylated or has a non -mamma osladin , pentadin , sorbitol , thaumatin , xylitol, acesulfame lian glycosylation pattern and a K -casein that is unglycosy - potassium , advantame, alitame, aspartame - acesulfame, lated or has a non -mammalian glycosylation pattern , that sodium cyclamate , dulcin , glucin , neohesperidin dihyrdoch include : culturing any of the host cells provided herein in a 5 alcone , neotame , and P - 4000 . In some embodiments of these culture medium under conditions sufficient to allow for methods , the pH of the liquid is between about 6 . 2 and about release of the micelle from the host cell, where the host cell 7 . 4 ( e . g ., about 6 . 4 to about 6 . 8 ) . In some embodiments of includes nucleic acid including a sequence that encodes a these methods, the ß -casein protein is a cow , human , sheep , B -casein and a sequence that encodes a K - casein . goat, buffalo , camel, horse , donkey , lemur, panda , guinea Also provided are methods of supplementing a mammal - 10 pig , squirrel, bear , macaque , gorilla , chimpanzee , mountain produced milk that include : providing a mammalian -pro - goat, monkey , ape , cat, dog , wallaby , rat, mouse , elephant, duced milk or a processed mammalian -produced milk ; and opossum , rabbit , whale , baboons, gibbons, orangutan , man mixing into the milk at least one of: a ß - casein protein that drill, pig , wolf , fox , lion , tiger , echidna , or woolly mammoth is unglycosylated or has a non -mammalian glycosylation ß - casein protein ; and / or the K - casein protein is a cow , pattern ; a K - casein protein that is unglycosylated or has a 15 human , sheep , goat, buffalo , camel, horse , donkey , lemur, non -mammalian glycosylation pattern ; and a micelle includ - panda , guinea pig , squirrel, bear , macaque , gorilla , chim ing a ß - casein protein that is unglycosylated or has a panzee , mountain goat , monkey , ape , cat , dog , wallaby, rat , non -mammalian glycosylation pattern , and a K -casein pro - mouse , elephant, opossum , rabbit , whale , baboons , gibbons , tein that is unglycosylated or has a non -mammalian glyco - orangutan , mandrill , pig , wolf , fox , lion , tiger, echidna , or sylation pattern . 20 woolly mammoth K -casein protein . In some embodiments of Also provided are methods of producing a composition these methods , the protein mixture further includes one or that include: sonicating a liquid including a protein mixture more proteins selected from the group of: a - lactalbumin , comprising B - casein protein and casein k protein , or com - ß - lactoglobulin , a - S1 - casein , a - S2 -casein , lactoferrin , prising micelles comprising B - casein protein and K - casein transferrin , and serum albumin . protein ; mixing ash into the liquid ; adding to the liquid a 25 Also provided is a composition produced by any of the mixture of one or more lipids , one or more flavor com - methods described herein . pounds, and one or more color balancing agents , and soni - Also provided is a method of making butter , cheese , cating the liquid ; and adding to the liquid one or more caseinate , or yogurt that include: providing any of the sweetening agents , thereby producing the composition . In compositions described herein ; and producing the butter , some embodiments of these methods , the ß - casein protein is 30 cheese , caseinate , or yogurt using any of the compositions unglycosylated or has a non -mammalian glycosylation pat - described herein as a starting material. tern , and/ or the K - casein protein is unglycosylated or has a Also provided are kits that include : ( a ) a mixture of one non -mammalian glycosylation pattern . In some embodi- or more milk proteins, one or more fats , and one or flavor ments of these methods, the ash includes one or more of: compounds ; and ( b ) a mixture of ash and at least one calcium , phosphorus , potassium , sodium , citrate , and chlo - 35 sweetening agent. In some embodiments of these kits , the ride. In some embodiments of these methods, the ash added one or more milk proteins are selected from the group of: includes one or more ( e . g . , one , two , or three ) of CaCl2, B - casein , K - casein , a -lactalbumin , B - lactoglobulin , a -S1 KH , POA, and Naz citrate . In some embodiments of these casein , a - S2 - casein , lactoferrin , transferrin , and serum albu methods, the one or more lipids comprises at least one of : min . In some embodiments of these kits , the one or more sunflower oil, coconut oil, tributyrin , mono - and di- glycer - 40 milk proteins are cow , human , sheep , goat, buffalo , camel, ides, free fatty acids , and phospholipids. In some embodi- horse , donkey , lemur, panda , guinea pig , squirrel, bear, ments of these methods, the free fatty acids comprise at least macaque , gorilla , chimpanzee , mountain goat, monkey , ape , one fatty acid selected from the group of: butyric acid , cat , dog, wallaby, rat, mouse , elephant, opossum , rabbit , caproic acid , caprylic acid , and capric acid . In some embodi whale, baboons, gibbons , orangutan , mandrill, pig , wolf , ments of these methods , the phospholipids are soy lecithin 45 fox , lion , tiger , echidna , or woolly mammoth milk proteins . phospholipids , sunflower lecithin phospholipids, cotton leci- In some embodiments of these kits, the one or more fats are thin phospholipids, or rapeseed lecithin phospholipids. In selected from the group consisting of: sunflower oil, coconut some embodiments of these methods , the monoglycerides oil, tributyrin , mono - and di- glycerides, free fatty acids , and and diglycerides are plant - derived monoglycerides and phospholipids . In some embodiments of these kits , the free diglycerides , or are bacteria - derived monoglycerides and 50 fatty acids include at least one fatty acid selected from the diglycerides . In some embodiments of these methods, the group of: butyric acid , caproic acid , caprylic acid , and capric flavor compounds include at least one flavor compound acid . In some embodiments of these kits , the phospholipids selected from the group consisting of: d -decalactone , ethyl are soy lecithin phospholipids, sunflower lecithin phospho butyrate , 2 - furyl methyl ketone , 2, 3 -pentanedione , y -unde - lipids, cotton lecithin phospholipids, or rapeseed lecithin calactone, and d - undecalactone . In some embodiments of 55 phospholipids. In some embodiments of these kits , the these methods , the one or more coloring balancing agent is monoglycerides and diglycerides are plant - derived mono B -carotene or annatto . In some embodiments of these meth - glycerides and diglycerides , or are bacteria - derived mono ods, the one or more sweetening agents is a saccharide . In glycerides and diglycerides . In some embodiments of these some embodiments of these methods, the saccharide is kits , the flavor compounds comprise at least one flavor selected from the group consisting of: glucose , mannose , 60 compound selected from the group consisting of: O - deca maltose , fructose , galactose , lactose , sucrose , monatin , and lactone , ethyl butyrate , 2 - furyl methyl ketone , 2 , 3 -pen tagatose . In some embodiments of these methods , the one or tanedione , y -undecalactone , and d -undecalactone . In some more sweetening agents is an artificial sweetener . In some embodiments of these kits, the mixture in ( a ) further embodiments of these methods , the artificial sweetener is includes one or more color balancing agent. In some selected from the group consisting of: stevia , aspartame, 65 embodiments of these kits, the one or more color balancing cyclamate , saccharin , sucralose , mogrosides, brazzein , cur - agent is ß - carotene or annatto . In some embodiments of culin , erythritol, glycyrrhizin , inulin , isomalt , lacititol, these kits , the one ormore sweetening agents is a saccharide US 9 , 924 , 728 B2 10 ( e. g ., a saccharide selected from the group of: glucose , the fats comprise short chain fatty acids. In some embodi mannose , maltose , fructose , galactose , lactose , sucrose , ments of these dairy substitute food products, the short chain monatin , and tagatose ). In some embodiments of these kits , fatty acids include butanoic , hexanoic , octanoic , and the one or more sweetening agents is an artificial sweetener decanoic acids. In some embodiments of these dairy substi ( e . g . , an artificial sweetener selected from the group of : 5 tute food products , one or more of the fats comprised stevia , aspartame, cyclamate , saccharin , sucralose , mogro - trans -esterified fatty acids. In some embodiments of these sides , brazzein , curculin , erythritol , glycyrrhizin , inulin , dairy substitute food products , one or more of the fats are isomalt , lacititol, mabinlin , malititol, mannitol, miraculin , isolated from plants . In some embodiments of these dairy monatin , monelin , osladin , pentadin , sorbitol, thaumatin , substitute food products, the plant is selected from one or xylitol, acesulfame potassium , advantame , alitame, aspar - 10 more of the following : sunflower, corn , olive , soy , peanut , tame- acesulfame , sodium cyclamate , dulcin , glucin , neohes - walnut , almond , sesame, cottonseed , canola , safflower, flax peridin dihyrdochalcone , neotame, and P - 4000 ) . In some seed , palm , palm kernel, palm fruit , coconut, babassu , shea embodiments of any of these kits , the ash includes one or butter, mango butter, cocoa butter, wheat germ and rice bran more of: calcium , phosphorus, potassium , sodium , citrate , oil. In some embodiments of these dairy substitute food and chloride . In some embodiments of these kits , the ash 15 products , the sugars comprise of galactose , sucrose , glucose , includes one or more ( e . g . , one , two , or three ) of CaCl2 , fructose and maltose . In some embodiments of these dairy KH2PO4, and Naz citrate . Some embodiments of these kits substitute food products , the dairy substitute food product is further include instructions for making any of the compo essentially free of lactose. In some embodiments of these sitions described herein . dairy substitute food products , the ash includes minerals . In Also provided are kits that include at least one of the 20 some embodiments of these dairy substitute food products , nucleic acids described herein . the minerals further include one or more of the following : Also provided herein are dairy substitute food products sodium , potassium , calcium , magnesium , phosphorus , iron , including one or more isolated milk protein components , copper, zinc , chloride ,manganese , selenium , iodine , retinol, fats , carbohydrates, and ash . In some embodiments of these carotene, vitamins , vitamin D , vitamin E , vitamin B12 , dairy substitute food products , the food product is non - 25 thiamin and riboflavin . In some embodiments of these dairy animal derived . In some embodiments of these substitute substitute food products , the ash includes anions. In some food product, the food product includes milk , butter, cheese , embodiments of these dairy substitute food products , the caseinare , yogurt , and cream . In some embodiments of these minerals further include one or more of the following : dairy substitute food products , the isolated milk protein phosphate , citrate , sulfate , carbonate , and chloride . components include casein and whey proteins . In some 30 Also provided are methods of making a dairy substitute embodiments of these dairy substitute food products , the food product including the step of contacting one or more casein protein further includes alpha -s1 , alpha - s2 , beta , and isolated milk protein components , interesterified fats , car kappa - casein . In some embodiments of these dairy substitute bohydrates and ash . Some embodiments of these methods , food products, the casein protein further includes alpha - sl , further include the step of isolating one ormore milk protein beta , and kappa . In some embodiments of these dairy 35 components is from a lower eukaryote . substitute food products , the casein protein further includes Also provided are methods of altering a flavor profile of components for micelle formation . In some embodiments of a dairy substitute product that include modulating a combi these dairy substitute food products , the casein protein nation of fatty acids in a mixture including milk protein exhibits curdling properties at pH 4 . 0 - 6 . 0 . In some embodi - components , carbohydrates , and ash . In some embodiments ments of these dairy substitute food products , the casein 40 of these methods , the step of modulating includes triglyc protein is at least or equal to 2 .5 % ( w / v ) and less than or eride comprising three oleic acids and short -chain triglyc equal to 10 % ( w / v ). In some embodiments of these dairy eride comprising butyric , one hexanoic , and one octanoic substitute food products, the whey protein further includes acid . In some embodiments of these methods, the step of beta - lactoglobulin and alpha - lactalbumin . In some embodi modulating comprises increasing or decreasing one or more ments of these dairy substitute food products, the whey 45 fatty acids comprising butyric acid , caprioc acid , caprylic protein forms a polymer matrix gel. In some embodiments acid , and capric acid . In some embodiments of these meth of these dairy substitute food products , the whey protein is ods, the flavor profile of a dairy substitute product mimics at least 0 . 1 % ( w / v ) and less than or equal to 1 % ( w / v ) . In the flavor profile of one or more dairy product . In some some embodiments of these dairy substitute food products, embodiments of these methods , the flavor profile of one or the one or more milk protein components is isolated from 50 more dairy food product includes bovine milk , goat milk , microbes . In some embodiments of any of these dairy soy milk , almond milk and coconut milk . In some embodi substitute food products , the one or more milk protein ments of these methods, the flavor profile includes one or components is isolated from recombinantmicrobes . In some more sensory impressions selected from : buttery , nutty , embodiments of these dairy substitute food products, the one sweet, sour, fruity , floral, bitter, woody, earthy , beany , spicy , or more milk protein components is synthesized in eukary - 55 metallic , sweet, musty , oily and vinegary . otic microbes . In some embodiments of these dairy substi - Disclosed herein are methods and compositions to pro tute food products , the eukaryotic microbes include yeast . In duce dairy substitutes . In some embodiments , methods and some embodiments of these dairy substitute food products , compositions are provided for a dairy substitute food prod the yeast include Kleuyveromyces sp . , Pichia sp ., Saccha - uct comprising one or more isolated milk protein compo romyces sp . and Tetrahymena sp . 60 nents , fats , carbohydrates and ash . In certain embodiments , In some embodiments of these substitute food products, methods and compositions are provided for dairy substitute the fats include triglycerides . In some embodiments of these composition comprising casein protein and whey protein dairy substitute food products , the fats comprise high - oleic wherein the composition is essentially free of animal prod oil. In some embodiments of these dairy substitute food ucts and wherein the casein protein to whey protein are in a products , the high -oleic oil further includes one or more of 65 preferred ( w / v ) ratio . In certain other embodiments , methods monounsaturates , oleic , linoleic , linolenic and saturates. In are provided to modulate a flavor profile of a dairy substitute some embodiments of these dairy substitute food products , food product comprising modulating a fatty acid content in US 9 ,924 ,728 B2 a mixture comprising milk protein components , fats , carbo The terminology and description used herein is for the hydrates , and ash . Preferred steps of modulating comprises purpose of describing particular embodiments only and is increasing or decreasing one or more fatty acids comprising not intended to limit the invention . As used herein , the butyric acid , caproic acid , caprylic acid , and capric acid . In singular forms “ a ,” “ an ,” and “ the” can be intended to additional embodiments , methods and compositions of the 5 include the plural forms as well , unless the context clearly present invention provide milk protein components and fats indicates otherwise . The terms " including , ” “ includes , " in a desired ( w / v ) ratio . “ having ," " has, " " with ,” or variants thereof are intended to In various aspects , the methods and compositions of the be inclusive in a manner similar to the term “ comprising ” . present invention provide for dairy substitutes that still An " isolated ” RNA , DNA or a mixed polymer is one retain their functional characteristics and organoleptic prop - 10 which is substantially separated from other cellular compo erties . In some embodiments , the core functionalities can be , nents that naturally accompany the native polynucleotide in but are not limited to achieving a nutritional profile similar its natural host cell , e. g ., ribosomes, polymerases, and to a conventional dairy product, and replicates one or more , genomic sequences with which it is naturally associated . if not all, of the core functionalities thereof. As used herein , an “ isolated ” organic molecule ( e . g ., a In other embodiments , the core functionalities can be , but 15 fatty acid or a SCFA ) is one which is substantially separated are not limited to replicating sensory characteristics that are from the cellular components (membrane lipids , chromo identical or similar to the traditional dairy - based products, somes , proteins ) of the host cell from which it originated . As which include but are not limited to taste , appearance , used herein , the term “ isolated ” with respect to protein handling and mouthfeel, desired density , structure , texture, indicates that the preparation of protein is at least 60 % pure , elasticity , springiness, coagulation , binding, leavening , aera - 20 e . g . , greater than 65 % , 70 % , 75 % , 80 % , 85 % , 90 % , 95 % , or tion , foaming , creaminess, and emulsification . 99 % pure . The term does not require that the biomolecule Preferred methods and compositions provide dairy sub - has been separated from all other chemicals , although cer stitute products such as milk , butter, cheese , yogurt, and tain isolated biomolecules may be purified to near homoge cream . Provided herein are formulations for a non -dairy neity . milk substitute comprising ( 3 . 3 % ) one ormore isolated milk 25 The term “ polynucleotide” or “ nucleic acid molecule ” protein components , ( 4 . 0 % ) fats , ( 2 . 4 % ) carbohydrates and refers to a polymeric form ofnucleotides of at least 10 bases ( 0 . 7 % ) ash ( w / v ) . Varying the fat content through modulat - in length . The term includes DNA molecules ( e . g . , cDNA or ing triglyceride levels and the fatty acid composition of the genomic or synthetic DNA ) and RNA molecules ( e . g . , triglycerides enhances the flavor profile of the non -dairy mRNA or synthetic RNA ) , as well as analogs of DNA or milk substituteD ule . 30 RNA containing non -natural nucleotide analogs, non -native Advantages in the methods and dairy substitute compo - internucleoside bonds, or both . The nucleic acid can be in sitions include reduction or removal of antibiotic residues, any topological conformation . For instance , the nucleic acid heavy metals , bacteria and adulterations commonly found in can be single - stranded , or double -stranded , or circular. natural dairy products as well as reducing environmental The term “ SCFA ” is abbreviated for short -chain fatty impact . 35 acids , the term “ HOSO ” is abbreviated for high oleic sun Accordingly , certain aspects of the present invention flower oil , “ SCTG ” is abbreviated for short - chain triglycer provide animal- free dairy substitute that has desirable flavor ides . characteristics, e . g ., replicates dairy flavors , minimizes The term “milk protein component” refers to proteins or foodborne pathogens and has a lower environmental impact, protein equivalents and variants found in milk such as while retaining the downstream applications of dairy milk . 40 casein , whey or the combination of casein and whey , includ Unless otherwise defined herein , scientific and technical ing their subunits , which are derived from various sources terms used in connection with the present invention shall and as further defined herein . have the meanings that are commonly understood by those The term “ milk protein ” means a protein that is found in of ordinary skill in the art . Further, unless otherwise required a mammal- produced milk or a protein having a sequence by context, singular terms shall include the plural and plural 45 that is at least 80 % identical ( e . g . , at least 85 % , at least 90 % , terms shall include the singular . Generally , nomenclatures at least 95 % , at least 96 % , at least 97 % , at least 98 % , or at used in connection with , and techniques of, dairy process - least 99 % identical) to the sequence of a protein that is found ing , biochemistry , enzymology , molecular and cellular biol- in a mammal- produced milk . Non - limiting examples ofmilk ogy , microbiology , genetics and protein and nucleic acid proteins include : ß - casein , K -casein , a - S1 -casein , a - S2 chemistry and hybridization described herein are those well - 50 casein , a - lactalbumin , B - lactoglobulin , lactoferrin , transfer known and commonly used in the art . rin , and serum albumin . Additional milk proteins are known Methods and materials are described herein for use in the in the art . present invention ; other, suitable methods and materials The term " casein protein ” is art -known and represents a known in the art can also be used . The materials, methods, family of proteins that is present in mammal -produced milk and examples are illustrative only and not intended to be 55 and is capable of self -assembling with other proteins in the limiting . family to form micelles and/ or precipitate out of an aqueous All publications, patents , patent applications, sequences , solution at an acidic pH . Non - limiting examples of casein database entries , and other references mentioned herein are proteins include : ß - casein , K - casein , a - S1- casein , and a -S2 incorporated by reference to the same extent as if each casein . Non - limiting examples of sequences for casein pro individual publication , patent, patent application , sequence , 60 tein from different mammals are provided herein . Additional database entry , or other reference was specifically and sequences for other mammalian caseins are known in the art . individually indicated to be incorporated by reference . In The term “ mammal- produced milk ” is art known and case of conflict , the present specification , including defini - means a milk produced by a mammal. tions, will control. The term " processed mammal- produced milk ” means a Other features and advantages of the invention will be 65 mammal -produced milk that is processed using one or more apparent from the following detailed description and figures, steps known in the dairy industry ( e . g ., homogenization , and from the claims. pasteurization , irradiation , or supplementation ). US 9 ,924 ,728 B2 13 14 The term “mammal -derived component” means a mol sequence or a sequence controlling the transcription of a ecule or compound ( e . g ., a protein , a lipid , or a nucleic acid ) gene sequence, which reduces or inhibits production of the obtained from the body of a mammal or a molecule obtained gene product, or renders the gene product non - functional . In from a fluid or solid produced by a mammal . some instances a functional deletion is described as a The term “ component of milk ” or “ milk component” is a 5 knockout mutation . Attenuation also includes amino acid molecule, compound , element, or an ion present in a mam - sequence changes by altering the nucleic acid sequence , mal- produced milk . placing the gene under the control of a less active promoter , The term “ non -mammalian glycosylation pattern ” means down - regulation , expressing interfering RNA , ribozymes or one of a difference in one or more location ( s ) of glycosy - antisense sequences that target the gene of interest, or lation in a protein , and / or a difference in the amount of 10 through any other technique known in the art . In one and / or type of glycosylation at one or more location (s ) in a example , the sensitivity of a particular enzyme to feedback protein produced and post - translational modified in a non - inhibition or inhibition caused by a composition that is not mammalian cell ( e . g . , a yeast cell , an insect cell , or a a product or a reactant ( non - pathway specific feedback ) is bacterial cell ) as compared to a reference protein ( e . g ., the lessened such that the enzyme activity is not impacted by the same protein produced and post- translationally modified in 15 presence of a compound . In other instances , an enzyme that a mammalian cell, e . g . , a CHO cell , a MEK cell , or a has been altered to be less active can be referred to as mammalian udder cell ) . attenuated . The term “ lipids ” means one or more molecules ( e . g . , Deletion : The removal of one or more nucleotides from a biomolecules ) that include a fatty acyl group ( e . g ., saturated nucleic acid molecule or one or more amino acids from a or unsaturated acyl chains ) . For example , the term lipids 20 protein , the regions on either side being joined together. includes oils , phospholipids, free fatty acids , phospholipids, Knock - Out: A gene whose level of expression or activity monoglycerides, diglycerides, and triglycerides. Non - limit- has been reduced to zero . In some examples , a gene is ing examples of lipids are described herein . Additional knocked -out via deletion of some or all of its coding examples of lipids are known in the art . sequence . In other examples, a gene is knocked -out via The term “ plant -derived lipid ” means a lipid obtained 25 introduction of one or more nucleotides into its open reading from and / or produced by a plant ( e . g . , monocot or dicot) . frame, which results in translation of a non - sense or other The term " sweetening agent” means a saccharide ( e . g ., a wise non - functional protein product. monosaccharide , a disaccharide, or a polysaccharide ) or an The term " synthetic milk substitute ” refers to a compo artificial sweetener ( e . g ., a small molecule artificial sweet - sition that resembles , is similar to , is to equivalent to , or is ener or a protein artificial sweetener ) that , when added to a 30 nearly identical to a dairy milk . composition , makes the composition taste sweet when The term “ flavor” refers to the taste and /or the aroma of ingested by a mammal, such as a human . Non - limiting a food or drink . examples of sweetening agents are described herein . Addi- The term “ recombinant” is an art known - term . When tional examples of sweetening agents are known in the art . referring to a nucleic acid ( e . g ., a gene ) , the term “ recom The term “ ash ” is an art - known term and represents one 35 binant" can be used , e . g ., to describe a nucleic acid that has ormore ions, elements , minerals, and / or compounds that can been removed from its naturally occurring environment, a be found in a mammal- produced milk . Non - limiting ions, nucleic acid that is not associated with all or a portion of a elements, minerals, and compounds that are found in a nucleic acid abutting or proximal to the nucleic acid when it mammal- produced milk are described herein . Additional is found in nature , a nucleic acid that is operatively linked ions , elements , minerals , and compounds that are found in a 40 to a nucleic acid which it is not linked to in nature , or a mammal- produced milk are also known in the art . nucleic acid that does not occur in nature . The term “ recom The term " color balancing agent” or “ coloring agent” binant" can be used , e . g ., to describe cloned DNA isolates , means an agent added to a composition to modulate the color or a nucleic acid including a chemically -synthesized nucleo of the composition , e . g ., to make the color of the composi- tide analog. When “ recombinant” is used to describe a tion appear more similar to a mammalian - produced milk . 45 protein , it can refer to , e . g ., a protein that is produced in a Non - limiting examples of color balancing agents or coloring cell of a different species or type , as compared to the species agents include ß - carotene and annatto . Other examples of or type of cell that produces the protein in nature . coloring balancing agents are known in the art . A color As used herein , an endogenous nucleic acid sequence in balancing agent or a coloring agent can be produced by or the genome of an organism ( or the encoded protein product obtained from a plant. 50 of that sequence ) is deemed " recombinant" herein if a The term " micelle ” means is a generally (or roughly ) heterologous sequence is placed adjacent to the endogenous spherical supramolecular structure that exists as a dispersion nucleic acid sequence, such that the expression of this within a composition . A micelle can have , e . g . , a surface that endogenous nucleic acid sequence is altered . In this context , is composed of a charged outer layer. A micelle can encap a heterologous sequence is a sequence that is not naturally sulate one or more biomolecules. For example , a micelle can 55 adjacent to the endogenous nucleic acid sequence , whether encapsulate two or more proteins ( e . g ., a ß - casein protein or not the heterologous sequence is itself endogenous ( origi and a K - casein protein ) . A micelle can have diameter of nating from the same host cell or progeny thereof) or between about 10 nm and about 350 nm . Additional aspects exogenous ( originating from a different host cell or progeny and characteristics of micelles are known in the art. thereof ). By way of example , a promoter sequence can be The phrase " concentration of a component in a mammal- 60 substituted ( e . g ., by homologous recombination ) for the produced milk ” means the concentration of a component in native promoter of a gene in the genome of a host cell, such the milk produced by a mammal or the mean concentration that this gene has an altered expression pattern . This gene of a component in milk produced by a population of mam - would now become “ recombinant” because it is separated mals of the same species. from at least some of the sequences that naturally flank it . The term “ attenuate” as used herein generally refers to a 65 A nucleic acid is also considered “ recombinant” if it functional deletion , including a mutation , partial or complete contains any modifications that do not naturally occur to the deletion , insertion , or other variation made to a gene corresponding nucleic acid in a genome. For instance, an US 9 , 924 , 728 B2 15 16 endogenous coding sequence is considered “ recombinant” if than the Tm for the specific DNA hybrid under a particular it contains an insertion , deletion , or a point mutation intro set of conditions . The Tm is the temperature at which 50 % duced artificially , e. g ., by human intervention . A “ recombi of the target sequence hybridizes to a perfectly matched nant nucleic acid ” also includes a nucleic acid integrated probe. See Sambrook et al. , Molecular Cloning : A Labora into a host cell chromosome at a heterologous site and a 5 tory Manual, 2d ed . , Cold Spring Harbor Laboratory Press , nucleic acid construct present as an episome. Cold Spring Harbor, N . Y ., page 9. 51 , 1989 , hereby incor The term “ percent sequence identity ” or “ identical" in the porated by reference . For purposes herein , " stringent con context of nucleic acid sequences refers to the residues in the ditions ” are defined for solution phase hybridization as two sequences which are the same when aligned for maxi- aqueous hybridization ( i. e ., free of formamide ) in 6xSSC mum correspondence. The length of sequence identity com - 10 (where 20xSSC contains 3. 0 M NaCl and 0 .3 M sodium parison may be over a stretch of at least about nine nucleo - citrate ), 1 % SDS at 65° C . for 8 - 12 hours , followed by two tides , usually at least about 20 nucleotides , more usually at washes in 0 .2xSSC , 0 . 1 % SDS at 65° C . for 20 minutes. It least about 24 nucleotides, typically at least about 28 nucleowolen will be appreciated by the skilled worker that hybridization tides , more typically at least about 32 nucleotides , and at 65° C . will occur at different rates depending on a number preferably at least about 36 or more nucleotides . There are 15 of factors including the length and percent identity of the a number of different algorithms known in the art which can sequences which are hybridizing . be used to measure nucleotide sequence identity . For The nucleic acids (also referred to as polynucleotides ) of instance , polynucleotide sequences can be compared using this present invention may include both sense and antisense FASTA , Gap , or Bestfit , which are programs in Wisconsin strands of RNA , DNA , genomic DNA , and synthetic forms Package Version 10 . 0 , Genetics Computer Group (GCG ) , 20 and mixed polymers of the above. They may be modified Madison , Wis . FASTA provides alignments and percent chemically or biochemically or may contain non -natural or sequence identity of the regions of the best overlap between derivatized nucleotide bases, as will be readily appreciated the query and search sequences . See, e . g . , Pearson , Methods by those of skill in the art . Such modifications include , for Enzymol. 183 :63 - 98 , 1990 (hereby incorporated by refer - example , labels ,methylation , substitution of one or more of ence in its entirety ) . For instance , percent sequence identity 25 the naturally occurring nucleotides with an analog , inter between nucleic acid sequences can be determined using nucleotide modifications such as uncharged linkages ( e . g ., FASTA with its default parameters ( a word size of 6 and the methyl phosphonates, phosphotriesters , phosphoramidates, NOPAM factor for the scoring matrix ) or using Gap with its carbamates, etc . ) , charged linkages ( e . g . , phosphorothioates, default parameters as provided in GCG Version 6 . 1 , herein phosphorodithioates, etc .) , pendent moieties ( e . g . , polypep incorporated by reference . Alternatively , sequences can be 30 tides ), intercalators ( e . g . , acridine , psoralen , etc . ) , chelators, compared using the computer program , BLAST (Altschul et alkylators , and modified linkages ( e . g . , alpha anomeric al ., J . Mol. Biol. 215 : 403 - 410 , 1990 ; Gish and States, Nature nucleic acids , etc .) Examples of modified nucleotides are Genet. 3 : 266 - 272 , 1993 ; Madden et al ., Meth . Enzymol. described in Malyshev et al. , Nature 509 : 385 - 388 , 2014 ; and 266 : 131 - 141, 1996 ; Altschul et al. , Nucleic Acids Res. Li et al. , J. Am . Chem . Soc. 136 :826 - 829 , 2014 . Also 25 : 3389 -3402 , 1997 ; Zhang and Madden , Genome Res. 35 included are synthetic molecules that mimic polynucleotides 7 :649 - 656 , 1997 , especially blastp or tblastn (Altschul et al. , in their ability to bind to a designated sequence via hydrogen Nucleic Acids Res . 25 : 3389 - 3402 , 1997 . bonding and other chemical interactions . Such molecules are The term “ substantial homology ” or “ substantial similar - known in the art and include, for example , those in which ity, " when referring to a nucleic acid or fragment thereof , peptide linkages substitute for phosphate linkages in the indicates that , when optimally aligned with appropriate 40 backbone of the molecule . Other modifications can include , nucleotide insertions or deletions with another nucleic acid for example , analogs in which the ribose ring contains a ( or its complementary strand ) , there is nucleotide sequence bridging moiety or other structure such as the modifications identity in at least about 76 % , 80 % , 85 % , preferably at least found in “ locked ” nucleic acids. about 90 % , and more preferably at least about 95 % , 96 % , The term “ mutated ” when applied to nucleic acid 97 % , 98 % or 99 % of the nucleotide bases , as measured by 45 sequences means that nucleotides in a nucleic acid sequence any well -known algorithm of sequence identity , such as may be inserted , deleted , or changed compared to a refer FASTA , BLAST or Gap , as discussed above . ence nucleic acid sequence . A single alteration may be made Alternatively , substantial homology or similarity exists at a locus ( a point mutation ) or multiple nucleotides may be when a nucleic acid or fragment thereof hybridizes to inserted , deleted , or changed at a single locus . In addition , another nucleic acid , to a strand of another nucleic acid , or 50 one or more alterations may be made at any number of loci to the complementary strand thereof, under stringent hybrid within a nucleic acid sequence . A nucleic acid sequence may ization conditions. “ Stringent hybridization conditions ” and bemutated by any method known in the art including but not " stringent wash conditions” in the context of nucleic acid limited to mutagenesis techniques such as “ error -prone hybridization experiments depend upon a number of differ - PCR ” (a process for performing PCR under conditions ent physical parameters . Nucleic acid hybridization will be 55 where the copying fidelity of the DNA polymerase is low , affected by such conditions as salt concentration , tempera - such that a high rate of point mutations is obtained along the ture, solvents , the base composition of the hybridizing entire length of the PCR product; see , e . g . , Leung et al. , species, length of the complementary regions, and the num Technique 1 : 11 - 15 , 1989, and Caldwell and Joyce , PCR ber of nucleotide base mismatches between the hybridizing Methods Applic. 2 : 28 -33 , 1992 ); and “ oligonucleotide - di nucleic acids , as will be readily appreciated by those skilled 60 rected mutagenesis ” ( a process which enables the generation in the art. One having ordinary skill in the art knows how to of site -specific mutations in any cloned DNA segment of vary these parameters to achieve a particular stringency of interest ; see, e . g ., Reidhaar- Olson and Sauer , Science 241 : hybridization . 53 - 57 , 1988 ). In general , “ stringent hybridization ” is performed at about The term “ vector ” as used herein is intended to refer to a 25° C . below the thermalmelting point ( Tm ) for the specific 65 nucleic acid molecule capable of transporting another DNA hybrid under a particular set of conditions . “ Stringent nucleic acid to which it has been linked . One type of vector washing ” is performed at temperatures about 5° C . lower is a “ plasmid ,” which generally refers to a circular double US 9 ,924 ,728 B2 17 stranded DNA loop into which additional DNA segments which a recombinant vector has been introduced . It should may be ligated , but also includes linear double -stranded be understood that such terms are intended to refer not only molecules such as those resulting from amplification by the to the particular subject cell but to the progeny of such a cell . polymerase chain reaction (PCR ) or from treatment of a Because certain modifications may occur in succeeding circular plasmid with a restriction enzyme. Other vectors 5 generations due to either mutation or environmental influ include cosmids, bacterial artificial chromosomes (BAC ) ences , such progeny may not , in fact, be identical to the and yeast artificial chromosomes ( YAC ). Another type of parent cell , but are still included within the scope of the term vector is a viral vector, wherein additional DNA segments " host cell” as used herein . A recombinant host cell may be may be ligated into the viral genome (discussed in more an isolated cell or cell line grown in culture or may be a cell detail below ) . Certain vectors are capable of autonomous 10 which resides in a living tissue or organism . Preferred host replication in a host cell into which they are introduced ( e . g ., cells are yeasts and fungi. vectors having an origin of replication which functions in The term " yeast and filamentous fungi" include, but are the host cell ) . Other vectors can be integrated into the not limited to any Kluyveromyces sp ., such as Kluyveromy genome of a host cell upon introduction into the host cell ces lactis, Kluyveromyces marxianus, Saccharomyces sp ., and are thereby replicated along with the host genome. 15 such as Saccharomyces cerevisiae , Pichia sp . , such as Pichia Moreover , certain preferred vectors are capable of directing pastoris, Pichia finlandica , Pichia trehalophila , Pichia koc the expression of genes to which they are operatively linked . lamae , Pichia membranaefaciens, Pichia minuta (Ogataea Such vectors are referred to herein as “ recombinant expres minuta , Pichia lindneri ) , Pichia opuntiae , Pichia thermo sion vectors ” ( or simply " expression vectors ” ) . tolerans, Pichia salictaria , Pichia guercuum , Pichia pijperi , Promoters useful for expressing the recombinant genes 20 Pichia stiptis , Pichia methanolica, Hansenula polymorpha , described herein include both constitutive and inducible ! Candida albicans, any Aspergillus sp ., such as Aspergillus repressible promoters . Examples of inducible /repressible nidulans, Aspergillus niger, Aspergillus oryzae , promoters include galactose - inducible promoters ( e . g . , Trichoderma reesei , Chrysosporium lucknowense , Fusarium PLAC4- PBI ) . Where multiple recombinant genes are sp ., Fusarium gramineum , Fusarium venenatum , Physcomi expressed in an engineered yeast , the different genes can be 25 trella patens, and Neurospora crassa . controlled by different promoters or by identical promoters As used herein , the term “ predominantly ” or variations in separate operons, or the expression of two or more genes thereof will be understood to mean , for instance , a ) in the may be controlled by a single promoter as part of an operon context of fats the amount of a particular fatty acid compo The term “ operably linked ” expression control sequences sition relative to the total amount of fatty acid composition ; refers to a linkage in which the expression control sequence 30 b ) in the context of protein the amount of a particular protein is contiguous with the gene of interest to control the gene of composition (e .g . , B -casein ) relative to the total amount of interest, as well as expression control sequences that act in protein composition (e .g ., A -, B -, and K -casein ) . trans or at a distance to control the gene of interest . The term “ about, " " approximately , ” or “ similar to ” means The term " expression control sequence” or “ regulatory within an acceptable error range for the particular value as sequences ” are used interchangeably and as used herein 35 determined by one of ordinary skill in the art, which can refer to polynucleotide sequences which are necessary to depend in part on how the value is measured or determined , affect the expression of coding sequences to which they are or on the limitations of the measurement system . It should operably linked . Expression control sequences are be understood that all ranges and quantities described below sequences which control the transcription , post- transcrip - are approximations and are not intended to limit the inven tional events , and translation of nucleic acid sequences . 40 tion . Where ranges and numbers are used these can be Expression control sequences include appropriate transcrip - approximate to include statistical ranges or measurement tion initiation , termination , promoter and enhancer errors or variation . In some embodiments , for instance , sequences ; efficient RNA processing signals , such as splic measurements could be plus or minus 10 % . ing and polyadenylation signals ; sequences that stabilize The phrase " essentially free of" is used to indicate the cytoplasmic mRNA ; sequences that enhance translation 45 indicated component, if present, is present in an amount that efficiency ( e . g ., ribosome binding sites ) ; sequences that does not contribute, or contributes only in a de minimus enhance protein stability ; and when desired , sequences that fashion , to the properties of the composition . In various enhance protein secretion . The nature of such control embodiments , where a composition is essentially free of a sequences differs depending upon the host organism ; in particular component, the component is present in less than prokaryotes , such control sequences generally include pro - 50 a functional amount . In various embodiments , the compo moter , ribosomal binding site, and transcription termination nent may be present in trace amounts . Particular limits will sequence . The term " control sequences ” is intended to vary depending on the nature of the component, but may be , include , at a minimum , all components whose presence is for example , selected from less than 10 % by weight, less essential for expression , and can also include additional than 9 % by weight, less than 8 % by weight, less than 7 % by components whose presence is advantageous, for example , 55 weight, less than 6 % by weight, less than 5 % by weight, less leader sequences and fusion partner sequences. than 4 % by weight, less than 3 % by weight, less than 2 % by The term “ transfect” , “ transfection ” , “ transfecting, ” and weight, less than 1 % by weight, or less than 0 . 5 % by weight . the like refer to the introduction of a heterologous nucleic As used herein , the term " essentially free of a particular acid into eukaryote cells , both higher and lower eukaryote carbohydrate , such as lactose is used to indicate that the food cells . Historically , the term “ transformation ” has been used 60 composition is substantially devoid of carbohydrate resi to describe the introduction of a nucleic acid into a yeast or dues . Expressed in terms of purity , essentially free means fungal cell ; however, herein the term “ transfection ” is used that the amount of carbohydrate residues do not exceed 10 % , to refer to the introduction of a nucleic acid into any and preferably is below 5 % , more preferably below 1 % , eukaryote cell, including yeast and fungal cells . most preferably below 0 . 5 % , wherein the percentages are by The term “ recombinant host cell ” (“ expression host cell” , 65 weight or by mole percent. Thus, substantially all of the " expression host system " , " expression system ” or simply carbohydrate residues in a food composition according to " host cell” ) , as used herein , is intended to refer to a cell into the present invention are free of, for example , lactose . US 9 , 924 , 728 B2 19 20 Unless indicated otherwise , percentage ( % ) of ingredients to mammal -produced milk , and can have an improved refer to total % by weight. aroma profile as compared to a mammal- produced milk . Unless otherwise indicated , and as an example for all Also provided herein are methods and compositions for sequences described herein under the general format “ SEQ dairy substitute food product comprising one or more iso ID NO :” , “ nucleic acid comprising SEQ ID NO : 1 ” refers to 5 lated milk protein components , fats , carbohydrates and ash . a nucleic acid , at least a portion of which has either ( i) the In certain aspects the methods and compositions comprise sequence of SEQ ID NO : 1 , or ( ii ) a sequence complemen milk or milk - like protein equivalents . Preferably , the milk tary to SEQ ID NO : 1 . The choice between the two is dictated protein component is essentially free of impurities . In some by the context. For instance , if the nucleic acid is used as a embodiments , the milk protein component comprises micro probe , the choice between the two is dictated by the require - 10 bially derived or produced casein , whey or a combination ment that the probe be complementary to the desired target . thereof. More preferably , a method is provided to introduce an engineered nucleic acid sequence encoding one or more BRIEF DESCRIPTION OF THE FIGURES milk protein components. Even more preferably , the milk protein component is not animal derived . In other preferred FIG . 1 represents a flow diagram representative of an 15 embodiments, the recombinant milk protein component is exemplary process to produce synthetic milk substitute . modified to express the same phosphate groups or lack FIG . 2A represents a picture depicting precipitate of an phosphate groups and / or carbohydrate groups attached to the exemplary milk protein component. casein proteins . By having recombinant ß -casein and K -ca FIG . 2B represents a picture depicting a pellet of an sein having the same phosphate groups as the same proteins exemplary milk protein component . 20 present in a mammal -produced milk , the recombinant ß -ca FIG . 3 represents an image of a silver stain SDS - PAGE sein and the recombinant K - casein are able to form micelles . gel to visualize the milk protein components . The methods and techniques of the present invention are FIG . 4 is a SYPRO Ruby - stained SDS -PAGE gel showing generally performed according to conventional methods the levels of secretion of a - lactalbumin mediated by the well known in the art and as described in various general and OST signal sequence , the native a - lactalbumin signal 25 more specific references that are cited and discussed sequence, and the a mating factor signal sequence as throughout the present specification unless otherwise indi described in Example 6 . cated . See , e . g ., Sambrook et al. , Molecular Cloning : A FIG . 5 is shows the levels of secretion of a - lactalbumin Laboratory Manual, 2d ed ., Cold Spring Harbor Laboratory by wildtype yeast cells or yeast cells expressing a - lactal Press , Cold Spring Harbor, N . Y ., 1989 ; Ausubel et al . , bumin using the native a - lactalbumin signal peptide or a 30 Current Protocols in Molecular Biology , Greene Publishing OST1 signal peptide (as determined by an ELISA assay as Associates , 1992 , and Supplements to 2002 ) ; Harlow and described in Example 6 ) . Lane , Antibodies : A Laboratory Manual, Cold Spring Har FIG . 6 is shows the levels of secretion of B - lactoglobulin bor Laboratory Press , Cold Spring Harbor, N . Y ., 1990 ; by wildtype yeast cells and yeast cells including a vector as Taylor and Drickamer, Introduction to Glycobiology , described in Example 6 (using SDS - PAGE ) . 35 Oxford Univ . Press , 2003 ; Worthington Enzyme Manual, FIG . 7 is a Western blot showing the level of secretion of Worthington Biochemical Corp . , Freehold , N . J .; Handbook B - lactoglobulin from wildtype yeast and yeast cells includ of Biochemistry : Section A Proteins , Vol I, CRC Press , ing a vector as described in Example 6 . 1976 ; Handbook of Biochemistry : Section A Proteins , Vol II , FIG . 8 is a graph showing the level of secreted ß - casein CRC Press , 1976 ; Essentials of Glycobiology , Cold Spring and secreted a - S1 - casein produced by wildtype yeast and 40 Harbor Laboratory Press, 1999 . yeast cells including the vectors described in Example 6 . Exemplary materials and methods for use in any of the FIG . 9 is a schematic showing the steps in the process methods and compositions are described below , and can be described in Example 7 . used in any combination . Additionalmaterials and methods FIG . 10 is an image of a composition made by a method that can be used in any of the methods and compositions are described herein . 45 also known in the art . Casein Proteins DETAILED DESCRIPTION OF THE Casein proteins include a variety of different proteins INVENTION found in mammalian milk . Non -limiting examples of casein proteins include : ß - casein , K -casein , a - S2 - casein , and a - S1 The invention is based on the discovery that only a few 50 casein . components present in a mammal- produced milk provide for As an alternative to obtaining casein proteins from mam the texture and taste of a mammal- produced milk , and the mals or mammal- produced milk for us in dairy product development of compositions that have a similar taste , manufacture , the present invention provides methods and aroma, and mouth feel as compared to a mammal- produced composition for the production of recombinant casein pro milk . In view of this discovery , provided herein are such 55 teins . In various aspects of the present invention , methods compositions , methods ofmaking the compositions , and kits and compositions are provided for non - animal derived including these compositions and mixtures useful for mak - casein that has similar solubility and similar turbidity , and ing these compositions. heat stability suitable for incorporation into various food The compositions provided herein provide for composi - products . Preferably , the non -animal derived casein has tions that have a similar taste , mouth feel, aroma, and 60 excellent solubility similar turbidity and heat stability suit nutritional value as compared to a mammal- produced milk , able for incorporation into various dairy substitute products . but lack one or more of the components of a mammal- Additionally , further characterization of the protein includes produced milk that may be considered to be undesirable less or no aggregation or precipitation during such heat ( e . g ., allergens, lactose , antibiotics, hormones ( e . g . , stress treatment and is suitable for procedures such as pasteuriza hormones and / or growth hormones ) , heavy metals , bacteria 65 tion , concentration , etc . ( e . g . , E . coli ) , viruses , and prions ). The compositions pro - Difference in function of the non - animal derived casein in vided herein also have an improved shelf - life as compared milk can be characterized in terms of viscosity of the liquid ; US 9 , 924 , 728 B2 21 22 the ability of the proteins to withstand heat; the ability of the K -Casein proteins to form micelles ; and the ability of the proteins to Kappa -casein is both phosphorylated and glycosylated . hold different minerals & vitamins. The sequence of human K -casein was determined by Bri B - Casein gnon et al. (Fed . Eur. Biol. Soc . Lett . 188 :48 - 54 , 1985 ) . See , The primary structure of human ß - casein as determined 5 e . g . , U . S . Pat. No . 5 ,710 ,044 . by Greenberg et al . ( J. Biol. Chem . 259 :5132 -5138 , 1984 ) Non - limiting examples of K - casein proteins are SEQ ID was shown to be a phosphorylated protein with phosphory - Nos: 1 , 3 , 5, 7, 9, 11, 13 , 15 , 17 , 19 , 21, and 23. Non -limiting lation sites at specific seryl and threonyl residues located examples of nucleic acid sequences encoding a K - casein near the amino terminus . A comparison of human and bovine protein are SEQ ID NOs: 2 , 4 , 6 , 8 , 10 , 12 , 14 , 16 , 18 , 20 , B - caseins showed 47 % identity . 10 22 , 24 , and 148 . AK - casein protein can be a K - casein protein Non - limiting examples of ß - casein proteins are SEQ ID from any mammalian species , e . g ., a cow , human , sheep , Nos: 25 , 27 , 29 , 31 , 33 , 35 , 36 , 38 , 40 , 42 , 44 , and 46 . goat, buffalo , camel, horse, donkey , lemur, panda, guinea Non - limiting examples of nucleic acid sequences encoding pig , squirrel , bear, macaque, gorilla , chimpanzee, mountain a ß - casein protein are SEQ ID NOs: 26 , 28 , 30 , 32 , 34 , 37 , goat, monkey, ape , cat, dog , wallaby , rat, mouse , elephant, 39 , 41 , 43 , 45 , 47 , and 144 . A ß - casein protein can be a 15 opossum , rabbit , whale , baboons , gibbons, orangutan , man B -casein protein from any mammalian species , e . g . , a cow , drill, pig , wolf, fox , lion , tiger, echidna , or woolly mammoth human , sheep , goat, buffalo , camel, horse, donkey , lemur, K -casein protein . Additional sequences for different K - casein panda , guinea pig , squirrel, bear, macaque , gorilla , chim - proteins and nucleic acids encoding different K -casein pro panzee, mountain goat, monkey, ape , cat, dog , wallaby, rat, teins are known in the art . mouse , elephant, opossum , rabbit , whale , baboons , gibbons , 20 A K - casein protein can also be a proteins that is at least orangutan , mandrill, pig , wolf , fox , lion , tiger , echidna , or 50 % ( e . g ., at least 55 % , at least 60 % , at least 65 % , at least woolly mammoth ß - casein protein . Additional sequences for 70 % , at least 75 % , at least 80 % , at least 85 % , at least 90 % , different ß - casein proteins and nucleic acids encoding dif at least 91 % , at least 92 % , at least 93 % , at least 94 % , at least ferent ß - casein proteins are known in the art. 95 % , at least 96 % , at least 97 % , at least 98 % , at least 99 % , Aß- casein protein can also be a proteins that is at least 25 or at least 99 . 5 % ) identical to a wildtype K - casein protein 50 % ( e . g . , at least 55 % , at least 60 % , at least 65 % , at least ( e . g . , SEQ ID Nos: 1 , 3 , 5 , 7 , 9 , 11, 13 , 15 , 17 , 19 , 21 , or 23 ) . 70 % , at least 75 % , at least 80 % , at least 85 % , at least 90 % , A nucleic acid encoding a K -casein protein can encode a at least 91 % , at least 92 % , at least 93 % , at least 94 % , at least protein that is at least 50 % ( e. g ., at least 55 % , at least 60 % , 95 % , at least 96 % , at least 97 % , at least 98 % , at least 99 % , at least 65 % , at least 70 % , at least 75 % , at least 80 % , at least or at least 99 . 5 % ) identical to a wildtype B - casein protein 30 85 % , at least 90 % , at least 91 % , at least 92 % , at least 93 % , ( e . g . , SEQ ID Nos : 25 , 27 , 29 , 31 , 33 , 35 , 36 , 38 , 40 , 42 , 44 , at least 94 % , at least 95 % , at least 96 % , at least 97 % , at least or 46 ) . A nucleic acid encoding a B - casein protein can 98 % , at least 99 % , or at least 99 . 5 % ) identical to a wildtype encode a protein that is at least 50 % ( e . g . , at least 55 % , at K - casein protein ( e . g ., SEQ ID Nos : 1 , 3 , 5 , 7 , 9 , 11 , 13 , 15 , least 60 % , at least 65 % , at least 70 % , at least 75 % , at least 17 , 19 , 21, or 23 ) . 80 % , at least 85 % , at least 90 % , at least 91 % , at least 92 % , 35 a - S1- Casein at least 93 % , at least 94 % , at least 95 % , at least 96 % , at least Non - limiting examples of a - S1 - casein proteins are SEQ 97 % , at least 98 % , at least 99 % , or at least 99 . 5 % ) identical ID Nos : 48 , 50 , 52 , 54 , 56 , 57 , 59 , 61 , 63 , 64 , 66 , 68 , 70 , 72 , to a wildtype ß - casein protein ( e . g . , SEQ ID Nos: 25 , 27 , 29 , 74 , and 76 . Non - limiting examples of nucleic acid sequences 31 , 33 , 35 , 36 , 38 , 40 , 42 , 44 , or 46 ) . encoding an a - S1- casein protein are SEQ ID NOs: 49, 51 , Methods known for isolating B - casein from genetically 40 53, 55 , 58 , 60 , 62 , 65 , 67, 69 , 71 , 73 , 75 , 77 , and 147 . A engineered bacterial cells typically involve precipitating the -S1 -casein protein can be an a -S1 - casein protein from any B -casein from a supernatant derived from lysed or fraction - mammalian species, e . g . , a cow , human , sheep , goat, buffalo , ated cells . For example, Simons, et al ., Protein Eng . 6 : camel, horse , donkey, lemur, panda , guinea pig , squirrel, 763- 770 ( 1993 ), used genetically engineered E . coli to bear, macaque , gorilla , chimpanzee, mountain goat, monkey, express bovine ß - casein . The protein , which accumulated in 45 ape , cat, dog , wallaby , rat ,mouse , elephant, opossum , rabbit , the periplasmic spaces of the bacteria , was released into a whale , baboons, gibbons, orangutan , mandrill , pig , wolf , cell suspension by osmotic shock . After centrifugation of the fox , lion , tiger, echidna , or woolly mammoth a - S1 - casein suspension , the ß - casein in the pellet was resuspended in a protein . Additional sequences for different a -Si - casein pro cold water wash and centrifuged again . The ß -casein , pres - teins and nucleic acids encoding different a - S1 - casein pro ent in the supernatant, was precipitated by acidification with 50 teins are known in the art . acetic acid , filtered , and further purified by HPLC . Similarly , An a - S1 - casein protein can also be a proteins that is at Hansson , et al. , Protein Express. Purif. 4 :373 - 381 , 1993 , least 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at used genetically engineered E . coli to express B - casein . The least 92 % , at least 93 % , at least 94 % , at least 95 % , at least B -casein , present in a cell lysate , was precipitated with 96 % , at least 97 % , at least 98 % , at least 99 % , or at least ammonium sulfate , dissolved in ethanolamine and 6M urea , 55 99 . 5 % ) identical to a wildtype a - S1 - casein protein ( e . g . , and further purified by ion - exchange chromatography . See , SEQ ID Nos: 48 , 50 , 52 , 54 , 56 , 57 , 59 , 61 , 63, 64 , 66 , 68 , e .g . , U . S . Pat . No . 6 , 121, 421 . 70 , 72 , 74 , or 76 ) . A nucleic acid encoding an a - Si- casein Additionally , methods for isolating recombinantly pro - protein can encode a protein that is at least 80 % ( e . g ., at least duced ß - casein in yeast that are simpler and more effective 85 % , at least 90 % , at least 91 % , at least 92 % , at least 93 % , than known techniques are also known. Choi et al. , J . Agric . 60 at least 94 % , at least 95 % , at least 96 % , at least 97 % , at least Food Chem . 49 ( 4 ): 1761 - 1766 , 2001 . Expression and puri - 98 % , at least 99 % , or at least 99. 5 % ) identical to a wildtype fication of glycosylated bovine B - casein (L70S / P71S ) in a - S1 -casein protein ( e . g . , SEQ ID Nos : 48 , 50 , 52 , 54 , 56 , Pichia pastoris , resulted in the observation that themajority 57 , 59 , 61, 63 , 64 , 66 , 68 , 70 , 72 , 74 , or 76 ) . of bovine ß - casein was not being hyperglycosylated in P . a -S2 -Casein pastoris , and its molecular weight was estimated to be 33 . 6 65 Non - limiting examples of a - S2 - casein proteins are SEQ kDa . Glycosylated bovine ß -casein was normally phospho - ID Nos : 78 , 80 , 82 , 84 , 86 , 88 , and 90 . Non -limiting rylated to the same degree as native bovine ß - casein . examples of nucleic acid sequences encoding an a - S2 US 9 ,924 ,728 B2 23 24 casein protein are SEQ ID NOs: 79 , 81, 83, 85 , 87 , 89 , 91, nm ; about 100 nm to about 350 nm , about 340 nm , about 320 145 , and 146 . A a - S2 - casein protein can be an a - S2 - casein nm , about 300 nm , about 280 nm , about 260 nm , about 240 protein from any mammalian species, e . g ., a cow , human , nm , about 220 nm , about 200 nm , about 180 nm , about 160 sheep , goat , buffalo , camel, horse , donkey , lemur, panda , nm , about 140 nm , or about 120 nm ; about 120 nm to about guinea pig , squirrel, bear, macaque , gorilla , chimpanzee , 5 350 nm , about 340 nm , about 320 nm , about 300 nm , about mountain goat , monkey, ape , cat, dog , wallaby, rat, mouse , 280 nm , about 260 nm , about 240 nm , about 220 nm , about elephant, opossum , rabbit , whale , baboons, gibbons , orang utan , mandrill , pig , wolf, fox , lion , tiger , echidna , or woolly 200 nm , about 180 nm , about 160 nm , or about 140 nm ; mammoth a - S2 - casein protein . Additional sequences for about 140 nm to about 350 nm , about 340 nm , about 320 nm , different a - S2 - casein proteins and nucleic acids encoding 10 about 300 nm , about 280 nm , about 260 nm , about 240 nm , different a - S2 -casein proteins are known in the art . about 220 nm , about 200 nm , about 180 nm , or about 160 An a - S2 - casein protein can also be a proteins that is at nm ; about 160 nm to about 350 nm , about 340 nm , about 320 least 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at nm , about 300 nm , about 280 nm , about 260 nm , about 240 least 92 % , at least 93 % , at least 94 % , at least 95 % , at least nm , about 220 nm , about 200 nm , or about 180 nm ; about 96 % , at least 97 % , at least 98 % , at least 99 % , or at least 15 180 nm to about 350 nm , about 340 nm , about 320 nm , about 99 . 5 % ) identical to a wildtype a - S2 - casein protein ( e . g ., 300 nm , about 280 nm , about 260 nm , about 240 nm , about SEO ID Nos : 78 , 80 , 82 , 84 . 86 . 88 . or 90 ) . A nucleic acid 220 nm , or about 200 nm ; about 200 nm to about 350 nm , encoding an a - S2 - casein protein can encode a protein that is about 340 nm , about 320 nm , about 300 nm , about 280 nm , at least 80 % ( e . g ., at least 85 % , at least 90 % , at least 91 % , about 260 nm , about 240 nm , or about 220 nm ; about 220 at least 92 % , at least 93 % , at least 94 % , at least 95 % , at least 20 nm to about 350 nm , about 340 nm , about 320 nm , about 300 96 % , at least 97 % , at least 98 % , at least 99 % , or at least nm , about 280 nm , about 260 nm , or about 240 nm ; about 99 .5 % ) identical to a wildtype a - S2 - casein protein ( e . g ., 240 nm to about 350 nm , about 340 nm , about 320 nm , about SEQ ID Nos : 78 , 80 , 82 , 84 , 86 , 88 , or 90 ) . 300 nm , about 280 nm , or about 260 nm ; about 260 nm to Micelles Including Casein Proteins about 350 nm , about 340 nm , about 320 nm , about 300 nm , In bovine milk , casein or casein micelles usually makes 25 or about 280 nm ; about 280 nm to about 350 nm , about 340 up 2 . 5 % of the entire mixture in suspension . If sufficient nm , about 320 nm , or about 300 nm ; about 300 nm to about casein is not present the micelles , which are very important 350 nm or about 325 nm ; or about 325 nm to about 350 nm . for the optimum behavior of milk , will not form . Too much Whey Proteins protein does not go into solution properly resulting in an Whey is commonly known as the by- product of cheese undesirable mixture . The casein micelle can include water 30 and is also known to be one cause for milk allergies . A and salts — mainly calcium and phosphorous . Casein typical whey composition comprises a mixture of B - lacto micelles are easily separated and removed by centrifugation . globulin , a - lactalbumin , serum albumin , immunoglobulins, Separation from whey is easily done by precipitating casein lactoferrin , and transferrin . Whey proteins do not contain with an acid to lower the pH to around 4 .6 . phosphorus, and remain in solution at low pH whereas In some embodiments , a micelle can include a ß - casein 35 casein proteins do not. In one embodiment, a select combi protein ( e. g ., any of the ß -casein proteins described herein ) nation of whey proteins comprising B -lactoglobulin and and K - casein protein ( e . g ., any of the K - casein proteins a - lactalbumin are used as the primary component or at least described herein ) . In some examples , the ratio of B - casein a part of the milk protein component or composition . Non protein to K - casein protein in the micelle is about 2 . 0 : 1 to limiting examples of different whey proteins are provided about 5 . 5 : 1 , 2 . 0 : 1 to about 5 . 0 : 1 , 2 . 0 : 1 to about 4 . 5 : 1 , about 40 below . 2 . 0 : 1 to about 4 .0 : 1 , about 2 . 0 : 1 to about 3 . 5 : 1 , about 2 . 0 : 1 a - Lactalbumin to about 3 . 0 : 1 , about 2 . 0 : 1 to about 2 . 5 : 1 , about 2 . 5 : 1 to Non -limiting examples of a - lactalbumin proteins are about 5 .0 : 1, about 2 .5 : 1 to about 4 .5 :1 , about 2 .5 : 1 to about SEQ ID Nos : 92 , 94 , 96 , and 98 . Non - limiting examples of 4 . 0 : 1 , about 2 . 5 : 1 to about 3 . 5 : 1 , about 2 . 5 : 1 to about 3 . 0 : 1 , nucleic acid sequences encoding an a - lactalbumin protein 3 .0 : 1 to about 5 . 0 : 1 , about 3 . 0 : 1 to about 4 .5 : 1 , about 3 . 0 : 1 45 are SEQ ID NOs: 93 , 95 , 97 , 99 , and 157 . An a - lactalbumin to about 4 . 0 : 1 , about 3 . 0 : 1 to about 3 . 5 : 1 , about 3 . 5 : 1 to protein can be an a - lactalbumin protein from any mamma about 5 . 0 : 1 , about 3 . 5 : 1 to about 4 . 5 : 1 , about 3 . 5 : 1 to about lian species , e . g . , a cow , human , sheep , goat , buffalo , camel , 4 . 0 : 1 , about 4 .0 : 1 to about 5 . 0 : 1 , about 4 . 0 : 1 to about 4 . 5 : 1 , horse , donkey, lemur, panda , guinea pig , squirrel, bear, or about 4 . 5 : 1 to about 5 . 0 : 1 . macaque , gorilla , chimpanzee , mountain goat, monkey, ape, In some examples, the micelle has a diameter ( or a 50 cat, dog , wallaby , rat , mouse , elephant , opossum , rabbit , population of micelles have an average diameter ) of about whale , baboons , gibbons, orangutan , mandrill , pig , wolf , 20 nm to about 350 nm , about 320 nm , about 300 nm , about fox , lion , tiger , echidna , or woolly mammoth a - lactalbumin 280 nm , about 260 nm , about 240 nm , about 220 nm , about protein . Additional sequences for different a - lactalbumin 200 nm , about 180 nm , about 160 nm , about 140 nm , about proteins and nucleic acids encoding different a -lactalbumin 120 nm , about 100 nm , about 80 nm , about 60 nm , or about 55 proteins are known in the art . 40 nm ; about 40 nm to about 350 nm , about 340 nm , about An a - lactalbumin protein can also be a proteins that is at 320 nm , about 300 nm , about 280 nm , about 260 nm , about least 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at 240 nm , about 220 nm , about 200 nm , about 180 nm , about least 92 % , at least 93 % , at least 94 % , at least 95 % , at least 160 nm , about 140 nm , about 120 nm , about 100 nm , about 96 % , at least 97 % , at least 98 % , at least 99 % , or at least 80 nm , or about 60 nm ; about 60 nm to about 350 nm , about 60 99 . 5 % ) identical to a wildtype a - lactalbumin protein ( e . g . , 340 nm , about 320 nm , about 300 nm , about 280 nm , about SEQ ID Nos : 92 , 94 , 96 , or 98 ) . A nucleic acid encoding an 260 nm , about 240 nm , about 220 nm , about 200 nm , about a - lactalbumin protein can encode a protein that is at least 180 nm , about 160 nm , about 140 nm , about 120 nm , or 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at least about 100 nm ; about 80 nm to about 350 nm , about 340 nm , 92 % , at least 93 % , at least 94 % , at least 95 % , at least 96 % , about 320 nm , about 300 nm , about 280 nm , about 260 nm , 65 at least 97 % , at least 98 % , at least 99 % , or at least 99 . 5 % ) about 240 nm , about 220 nm , about 200 nm , about 180 nm , identical to a wildtype a - lactalbumin protein ( e . g ., SEQ ID about 160 nm , about 140 nm , about 120 nm , or about 100 Nos : 92 , 94 , 96 , or 98 ) . US 9 , 924 , 728 B2 25 26 B - Lactoglobulin A transferrin protein can also be a proteins that is at least Non - limiting examples of B - lactoglobulin proteins are 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at least SEQ ID Nos: 100 , 102 , 104 , and 106 . Non - limiting 92 % , at least 93 % , at least 94 % , at least 95 % , at least 96 % , examples of nucleic acid sequences encoding a B - lacto at least 97 % , at least 98 % , at least 99 % , or at least 99. 5 % ) globulin protein are SEQ ID NOs: 101 , 103 , 105 , 107, and 5 identical to a wildtype transferrin protein ( e . g . , SEQ ID Nos : 143 . A B -lactoglobulin protein can be a B -lactoglobulin 116 or 118 ). A nucleic acid encoding a transferrin protein can protein from any mammalian species, e .g . , a cow , human , encode a protein that is at least 80 % ( e . g ., at least 85 % , at sheep , goat, buffalo , camel, horse , donkey, lemur, panda , least 90 % , at least 91 % , at least 92 % , at least 93 % , at least guinea pig , squirrel, bear, macaque , gorilla , chimpanzee , 94 % , at least 95 % , at least 96 % , at least 97 % , at least 98 % , mountain goat, monkey, ape, cat , dog , wallaby, rat , mouse , 10 at least 99 % , or at least 99 .5 % ) identical to a wildtype elephant, opossum , rabbit , whale , baboons , gibbons, orang transferrin protein ( e . g . , SEQ ID Nos: 116 or 118 ) . utan , mandrill , pig , wolf , fox , lion , tiger , echidna , or woolly Serum Albumin mammoth B - lactoglobulin protein . Additional sequences for Non - limiting examples of serum albumin proteins are different B - lactoglobulin proteins and nucleic acids encod - SEQ ID Nos : 120 , 122 , 124 , and 126 . Non - limiting ing different B - lactoglobulin proteins are known in the art. 15 examples of nucleic acid sequences encoding a serum albu A B - lactoglobulin protein can also be a proteins that is at min protein are SEQ ID NOs: 121 , 123 , 125 , and 127 . A least 80 % ( e . g ., at least 85 % , at least 90 % , at least 91 % , at serum albumin protein can be a serum albumin protein from least 92 % , at least 93 % , at least 94 % , at least 95 % , at least any mammalian species , e . g. , a cow , human , sheep , goat , 96 % , at least 97 % , at least 98 % , at least 99 % , or at least buffalo , camel, horse, donkey , lemur , panda, guinea pig , 99 .5 % ) identical to a wildtype B - lactoglobulin protein ( e . g ., 20 squirrel, bear ,macaque , gorilla , chimpanzee, mountain goat, SEQ ID Nos : 100 , 102 , 104 , or 106 ) . A nucleic acid monkey , ape , cat, dog , wallaby , rat , mouse , elephant, opos encoding a B - lactoglobulin protein can encode a protein that sum , rabbit, whale, baboons, gibbons , orangutan , mandrill, is at least 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , pig, wolf, fox , lion , tiger , echidna , or woolly mammoth at least 92 % , at least 93 % , at least 94 % , at least 95 % , at least serum albumin protein . Additional sequences for different 96 % , at least 97 % , at least 98 % , at least 99 % , or at least 25 serum albumin proteins and nucleic acids encoding different 99 . 5 % ) identical to a wildtype B - lactoglobulin protein ( e . g ., serum albumin proteins are known in the art . SEQ ID Nos : 100 , 102 , 104 , or 106 ) . A serum albumin protein can also be a proteins that is at Lactoferrin least 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at Non - limiting examples of lactoferrin proteins are SEQ ID least 92 % , at least 93 % , at least 94 % , at least 95 % , at least Nos: 108 , 110 , 112 , and 114 . Non - limiting examples of 30 96 % , at least 97 % , at least 98 % , at least 99 % , or at least nucleic acid sequences encoding a lactoferrin protein are 99 . 5 % ) identical to a wildtype serum albumin protein ( e . g . , SEO ID NOs: 109 , 111 , 113 , and 115 . A lactoferrin protein SEQ ID Nos : 20 , 122 , 124 , or 126 ) . A nucleic acid encoding can be a lactoferrin protein from any mammalian species, a serum albumin protein can encode a protein that is at least e . g ., a cow , human , sheep , goat, buffalo , camel , horse , 80 % ( e . g ., at least 85 % , at least 90 % , at least 91 % , at least donkey, lemur, panda , guinea pig , squirrel, bear, macaque , 35 92 % , at least 93 % , at least 94 % , at least 95 % , at least 96 % , gorilla , chimpanzee , mountain goat ,monkey , ape , cat , dog , at least 97 % , at least 98 % , at least 99 % , or at least 99 . 5 % ) wallaby, rat , mouse , elephant, opossum , rabbit , whale , identical to a wildtype serum albumin protein ( e . g . , SEQ ID baboons, gibbons , orangutan , mandrill , pig , wolf , fox , lion , Nos : 20 , 122 , 124 , or 126 ) . tiger , echidna , or woolly mammoth lactoferrin protein . Addi - Lipids in Mammal -Produced Milk tional sequences for different lactoferrin proteins and nucleic 40 Milk fat contains approximately 400 different fatty acids, acids encoding different lactoferrin proteins are known in which makes it the most complex of all natural fats . The the art . milk fatty acids are derived almost equally from two A lactoferrin protein can also be a proteins that is at least sources , the feed and the microbial activity in the rumen of 80 % ( e . g . , at least 85 % , at least 90 % , at least 91 % , at least the cow and the lipids in bovine milk are mainly present in 92 % , at least 93 % , at least 94 % , at least 95 % , at least 96 % , 45 globules as an oil- in -water emulsion . Fat is present in all at least 97 % , at least 98 % , at least 99 % , or at least 99 . 5 % ) natural dairy products and is critical for sensory character identical to a wildtype lactoferrin protein ( e . g ., SEQ ID Nos : istics such as flavor, mouthfeel and consistency . In addition , 108 , 110 , 112 , or 114 ) . A nucleic acid encoding a lactoferrin fats provide nutrition and health benefits . The milk fat protein can encode a protein that is at least 80 % ( e . g ., at least consists mainly of triglycerides, approximately 98 % , while 85 % , at least 90 % , at least 91 % , at least 92 % , at least 93 % , 50 other milk lipids are diacylglycerol ( about 2 % of the lipid at least 94 % , at least 95 % , at least 96 % , at least 97 % , at least fraction ) , cholesterol ( less than 0 . 5 % ) , phospholipids ( about 98 % , at least 99 % , or at least 99 . 5 % ) identical to a wildtype 1 % ) and free fatty acids ( FFA ) (about 0 . 1 % ) Jensen RG , lactoferrin protein ( e. g ., SEQ ID Nos: 108 , 110 , 112 , or 114 ). Newburg D S . Bovine milk lipids, Handbook of milk Transferrin composition . Jensen R G London : Academic Press; 1995 . Non - limiting examples of transferrin proteins are SEQ ID 55 543 - 75 . In addition , there are trace amounts of ether lipids , Nos : 116 and 118 . Non - limiting examples of nucleic acid hydrocarbons, fat- soluble vitamins, flavor compounds and sequences encoding a transferrin protein are SEQ ID NOs: compounds introduced by the feed ( Lindmark Mansson H . , 117 and 119 . A transferrin protein can be a transferrin protein Food & Nutrition Research 2008 . DOI: 10 . 3402 / from any mammalian species, e. g ., a cow , human , sheep , fnr. v5210 .1821 ) goat, buffalo , camel, horse , donkey , lemur, panda , guinea 60 Milk fat triglycerides are synthesized from more than 400 pig , squirrel, bear ,macaque , gorilla , chimpanzee , mountain different fatty acids, which makes milk fat themost complex goat , monkey, ape, cat , dog , wallaby, rat , mouse , elephant, of all natural fats . Nearly all fatty acids in milk are present opossum , rabbit , whale , baboons , gibbons, orangutan , man - in trace quantities and only about 15 acids at the 1 % level or drill , pig , wolf , fox , lion , tiger, echidna , or woolly mammoth higher . Many factors are associated with the variations in the transferrin protein . Additional sequences for different trans - 65 amount and fatty acid composition of bovine milk lipids . ferrin proteins and nucleic acids encoding different trans - They may be of animal origin , i . e . related to genetics (breed ferrin proteins are known in the art. and selection ), stage of lactation , mastitis and ruminal US 9 , 924 , 728 B2 27 28 fermentation , or they may be feed - related factors , i . e . related oil , corn oil , cottonseed oil , olive oil , palm oil , rapeseed oil , to fibre and energy intake , dietary fats , and seasonal and safflower oil , sesame oil , soybean oil , almond oil , beech nut regional effects . The fatty acids in the milk fat are arranged oil, brazil nut oil , cashew oil , hazelnut oil , macadamia nut in the triglycerides in accordance with a pattern that appears oil, mongongo nut oil, pecan oil , pine nut oil, pistachio nut to be universal among ruminants . The percent unsaturated 5 oil, walnut oil, and avocado oil . fatty acids ( e . g . , oleic and linolenic ) in goats do not differ M onoglycerides and Diglycerides from the average found for cow ' s milk . A major difference Monoglycerides and diglycerides that can be used in the between the milk fat of the goat and the cow is the present invention can be plant- derived monoglycerides and percentage distribution among specific short chain fatty d iglycerides. For example ,monoglycerides and diglycerides acids . Goats have an appreciably higher proportion of 10 can be derived from sunflowers , coconuts , peanuts , cotton capric , caprylic and caproic acids. The high amounts of these seed , olives , palm , rapeseed , safflowers, sesame seed , soy specific fatty acids are responsible for the characteristic beans, almonds, beech nuts , brazil nuts , cashews , hazelnuts , flavor and odor associated with goat ' s milk . John C . Bruhn , macadameia nuts , mongongo nuts, pecans, pine nuts , pista FST, UC Davis , Davis , Calif . 95616 - 8598 ; Seewww .drin - chios , walnuts , and avocados . The monoglycerides and c .ucdavis . edu / goat1 .htm ; www . ncbi. nlm .nih .gov /pmc / ar - 15 diglycerides can include the acyl chain of any of the free ticles/ PMC2596709 / # _ ffn _ sectitle ; Food Nutr Res. 2008 ; fatty acids listed herein . Additional examples of monoglyc 52 : 10 .3402 /fnr . v5210 . 1821 . Published online Jun . 11 , 2008 . erides and diglycerides are known in the art . doi: 10 .3402 / fnr. v5210 . 1821 . Free Fatty Acids The milk fatty acids are derived almost equally from two The compositions described herein can include and the sources , the feed and the microbial activity in the rumen of 20 methods described herein can include the use of one or more the cow . The fatty acid synthesizing system in the mammary free fatty acids. Non - limiting examples of free fatty acids gland of the cow produces fatty acids with even number of include butyric acid , caproic acid , caprylic acid , and capric carbons of 4 - 16 carbons in length and accounts for approxi acid . Additional examples of fatty acids include lauric acid , mately 60 and 45 % of the fatty acids on a molar and weight myristic acid , palmitic acid , stearic acid , arachidic acid , basis , respectively. This de novo synthesis in the mammary 25 behenic acid , lignoceric acid , cerotic acid , myristoleic acid , gland is of the 4 : 0 - 14 : 0 acids together with about half of the pamitoleic acid , sapienic acid , oleic acid , elaidic acid , vac 16 : 0 from acetate and B -hydroxybutyrate . Acetate and cenic acid , linoleic acid , linoelaidic acid , a - linolenic acid , butyric acid are generated in the rumen by fermentation of arachidonic acid , eicosapentaenoic acid , erucic acid , doco feed components . The butyric acid is converted to B -hy - sahexaenoic acid , omega - 3 fatty acids , and omega - 6 fatty droxybutyrate during absorption through the rumen epithe - 30 acids . In some examples, the free fatty acid is saturated . In lium . some examples , the free fatty acid is unsaturated . In some Medium - and long -chain fatty acids , butmainly 18 : 0 , may embodiments , the free fatty acids are not derived from or be desaturated in the mammary gland to form the corre produced by a mammal. Additional examples of free fatty sponding monosaturated acids. acids are known in the art . Fatty acids are not randomly esterified at the three posi - 35 Phospholipids tions of the triacylglycerol molecule (MacGibbon A HK , The compositions described herein and the methods Taylor M W . Composition and structure of bovine milk described herein can include the use of one or more phos lipidsAdvanced dairy chemistry. Fox PFMcSweeney PLH - pholipids. Non - limiting examples of phospholipids include New York : Springer ; 2006 . 1 -42 . ) . The short- chain acids lecithin phospholipids ( e . g ., soy lecithin phospholipids, sun butyric ( 4 :0 ) and caproic (6 : 0 ) are esterified almost entirely 40 flower lecithin phospholipids, cotton lecithin phospholipids, at sn - 3 . Medium - chain fatty acids ( 8 : 0 - 14 : 0 ) as well as 16 : 0 rapeseed lecithin phospholipids . rice bran lecithin phospho are preferentially esterified at positions sn - 1 and sn - 2 . lipids, and corn lecithin phospholipids ) . In some embodi Stearic acid ( 18 : 0 ) is selectively placed at position sn - 1 , ments , the phospholipids are not derived from or produced whereas oleic acid ( 18 : 1 ) shows preference for positions by a mammal . Additional aspects of phospholipids are sn - 1 and sn -3 (Lindmark 2008 ). 45 known in the art . Milk replacers with a fat component formulated to Flavor Compounds selected fatty acid profiles exist, however, such triglycerides Any of the compositions or methods described herein can are not interesterified into long - chain monounsaturated fatty include or include the use of one or more different flavor acid triglycerides such as found in vegetable oils . U . S . compounds . Non - limiting examples of flavor compounds Patent Appl. No. 20140147548 discloses milk replacers for 50 include d -decalactone , ethyl butyrate , 2 - furyl methyl ketone , young animals with by adding medium chain triglyceride , 2 , 3 - pentanedione , y -undecalactone , and d - undecalactone . specifically caproic , caprylic , capric and lauric fatty acid or Additional examples of flavor compounds include artificial a combination thereof . flavors , e . g . , chocolate, coffee, strawberry , almond , hazelnut, Lipids in the Present Compositions vanilla , green tea , Irish cream , and coconut flavoring . Addi The lipids in any of the compositions or used in any of the 55 tional examples of flavor compounds are known in the art . methods described herein can include : one ormore fats , one Ash or more oils , one or more monoglycerides , diglycerides , Any of the compositions or methods described herein can and / or triglycerides , one or more free fatty acids, and one or include or include the use of ash . Ash can , e . g ., include one more phospholipids. Exemplary oils , monoglycerides , or more (two , three, four, five , six , seven , eight, nine , ten , diglycerides, free fatty acids, and phospholipids are 60 eleven , twelve , thirteen , fourteen fifteen , sixteen , seventeen , described below . Additional examples of fats , oils, mono - eighteen , nineteen , or twenty ) of: calcium , phosphorous , glycerides , diglycerides, triglycerides , free fatty acids, and potassium , sodium , citrate , chloride, phosphate , magnesium , phospholipids are known in the art . iron , molybdenum , manganese , copper, thiamin ( vitamin Oils B1 ), riboflavin ( vitamin B2) , niacin ( vitamin B3) , pantoth Oils used in the present compositions or methods can 65 enic acid (vitamin B5 ), vitamin B6 (pyridoxine ), vitamin include , e . g . , plant - derived oils . Non -limiting examples of B12 ( cobalamin ) , vitamin C , folate , vitamins A , vitamin D , plant- based oils include sunflower oil, coconut oil, peanut vitamin E , and vitamin K . In some examples , the ash US 9 ,924 ,728 B2 29 30 includes one or more ( two or three ) of CaCl2 , KH2PO4, and about 1 . 4 g /L , about 1 . 4 g / L to about 4 . 9 g /L , about 1 . 4 g / L Na , citrate . Ash can be provided as a powder or as a solution . to about 4 . 6 g / L , about 1 . 4 g / L to about 4 . 4 g /L , about 1 . 4 Additional components in and aspects of ash are known in g / L to about 4 . 2 g / L , about 1 . 4 g / L to about 4 . 0 g / L , about the art . In some embodiments, the ash is not derived from or 1 . 4 g / L to about 3 . 8 g /L , about 1. 4 g /L to about 3 .6 g / L , produced by mammal. 5 about 1 . 4 g / L to about 3 . 4 g / L , about 1 . 4 g /L to about 3 . 2 Color Balancing Agents g /L , about 1 .4 g /L to about 3 .0 g / L , about 1 . 4 g / L to about A variety of different color balancing agents are known in 2 . 8 g / L , 1 . 4 g / L to about 2 . 6 g / L , about 1 . 4 g / L to about 2 . 4 the art. For example , a color balancing agent can be a g /L , about 1 .4 g/ L to about 2 .2 g / L , about 1 .4 g/ L to about compound from obtained from a plant ( e . g . , a monocot or a 2 . 0 g / L , about 1 . 4 g / L to about 1 . 8 g / L , about 1 . 4 g / L to dicot) . In some examples , the color balancing agent is a 10 about 1. 6 g/ L , about 1. 6 g /L to about 4. 9 g /L , about 1. 6 g / L synthetic compound . In some examples , the color balancing to about 4 . 6 g / L , about 1 . 6 g / L to about 4 . 4 g / L , about 1 . 6 agent is not obtained from or produced by a mammal or a g / L to about 4 . 2 g / L , about 1. 6 g /L to about 4 .0 g / L , about mammalian cell. Non - limiting examples of color balancing 1 .6 g / L to about 3 .8 g /L , about 1 .6 g / L to about 3 .6 g / L , agents include ß - carotene and annatto . about 1 . 6 g /L to about 3 . 4 g / L , about 1 .6 g / L to about 3 . 2 Sweetening Agents 15 g / L , about 1 . 6 g / L to about 3 . 0 g / L , about 1 . 6 g / L to about A sweetening agent can be a saccharide ( e . g . , a mono - 2 . 8 g / L , 1 .6 g / L to about 2 . 6 g / L , about 1 .6 g / L to about 2 . 4 saccharide , a disaccharide , or a polysaccharide ) or an arti - g / L , about 1 .6 g / L to about 2 . 2 g / L , about 1 .6 g / L to about ficial sweetener . Non - limiting examples of sweetening 2. 0 g/ L , about 1. 6 g /L to about 1. 8 g / L , about 1 .8 g/ L to agents that are saccharides include glucose , mannose , malt - about 4 . 9 g / L , about 1 . 8 g / L to about 4 .6 g / L , about 1 . 8 g /L ose , fructose , galactose, lactose, sucrose, monatin , and taga - 20 to about 4 .4 g / L , about 1 .8 g/ L to about 4 .2 g/ L , about 1. 8 tose . Additional examples of saccharides that can be used as g / L to about 4 . 0 g / L , about 1 . 8 g / L to about 3 . 8 g / L , about a sweetening agent in any of the compositions or methods 1 . 8 g / L to about 3 .6 g / L , about 1 . 8 g / L to about 3 . 4 g / L , described herein are known in the art . about 1 . 8 g / L to about 3 . 2 g / L , about 1 . 8 g / L to about 3 . 0 Non - limiting examples of sweetening agents that are g / L , about 1 . 8 g / L to about 2 . 8 g / L , 1 . 8 g / L to about 2 . 6 g / L , artificial sweeteners include stevia , aspartame, cyclamate , 25 about 1 . 8 g / L to about 2 . 4 g /L , about 1 . 8 g / L to about 2 . 2 saccharin , sucralose , mogrosides , brazzein , curculin , eryth - g / L , about 1 .8 g / L to about 2 . 0 g / L , about 2 . 0 g / L to about ritol, glycyrrhizin , inulin , isomalt, lacititol, mabinlin ,mali - 4 . 9 g/ L , about 2 . 0 g /L to about 4 .6 g / L , about 2 .0 g/ L to titol, mannitol, miraculin , monatin , monelin , osladin , pen - about 4 . 4 g / L , about 2 . 0 g / L to about 4 . 2 g / L , about 2 . 0 g / L tadin , sorbitol, thaumatin , xylitol, acesulfame potassium , to about 4 . 0 g / L , about 2 . 0 g / L to about 3 . 8 g / L , about 2 . 0 advantame, alitame, aspartame- acesulfame, sodium cycla - 30 g/ L to about 3 .6 g/ L , about 2 .0 g /L to about 3 . 4 g /L , about mate , dulcin , glucin , neohesperidin dihyrdochalcone, 2 . 0 g / L to about 3 . 2 g /L , about 2 . 0 g / L to about 3 . 0 g / L , neotame , and P -4000 . Additional artificial sweeteners that about 2 . 0 g/ L to about 2 . 8 g / L , 2 . 0 g / L to about 2 . 6 g / L , can be used as sweetening agents in any of the compositions about 2 . 0 g /L to about 2 .4 g /L , about 2 .0 g /L to about 2 .2 or methods described herein are known in the art . g / L , about 2 . 2 g / L to about 4 . 9 g / L , about 2 . 2 g / L to about Compositions 35 4 . 6 g / L , about 2 . 2 g /L to about 4 . 4 g /L , about 2 . 2 g / L to Provided herein are compositions including : about 0 . 3 g / L about 4 . 2 g / L , about 2 . 2 g / L to about 4 . 0 g / L , about 2 . 2 g /L to about 1 . 1 g / L ( e . g ., about 0 . 3 g / L to about 1 . 0 g / L , about to about 3 . 8 g / L , about 2 . 2 g / L to about 3 .6 g / L , about 2 . 2 0 . 3 g / L to about 0 . 9 g / L , about 0 . 3 g / L to about 0 . 8 g / L , g /L to about 3 . 4 g / L , about 2 . 2 g /L to about 3 . 2 g / L , about about 0 . 3 g / L to about 0 . 7 g /L , about 0 . 3 g / L to about 0 .6 2 . 2 g /L to about 3 . 0 g / L , about 2 . 2 g / L to about 2 .8 g / L , 2 . 2 g / L , about 0 . 3 g / L to about 0 . 5 g / L , about 0 . 3 g / L to about 40 g / L to about 2 . 6 g / L , about 2 . 2 g / L to about 2 . 4 g / L , about 0 . 4 g / L , about 0 . 4 g / L to about 1 . 1 g / L , about 0 .4 g / L to 2 . 4 g / L to about 4 . 9 g / L , about 2 .4 g / L to about 4 .6 g / L , about 1 . 0 g / L , about 0 . 4 g / L to about 0 . 9 g / L , about 0 . 4 g /L about 2 . 4 g / L to about 4 . 4 g / L , about 2 . 4 g / L to about 4 . 2 to about 0 . 8 g /L , about 0 . 4 g / L to about 0 . 7 g / L , about 0 . 4 g / L , about 2 . 4 g / L to about 4 . 0 g / L , about 2 . 4 g / L to about g / L to about 0 . 6 g / L , about 0 . 4 g / L to about 0 . 5 g / L , about 3 . 8 g/ L , about 2 . 4 g / L to about 3 . 6 g / L , about 2 . 4 g / L to 0 .5 g / L to about 1 . 1 g / L , about 0 .5 g / L to about 1 .0 g / L , 45 about 3 . 4 g / L , about 2 . 4 g / L to about 3 . 2 g / L , about 2 . 4 g / L about 0 . 5 g / L to about 0 . 9 g / L , about 0 . 5 g / L to about 0 . 8 to about 3 . 0 g / L , about 2 . 4 g / L to about 2 . 8 g / L , 2 . 4 g / L to g /L , about 0 . 5 g / L to about 0 . 7 g / L , about 0 . 5 g / L to about about 2 . 6 g / L , about 2 . 6 g / L to about 4 . 9 g / L , about 2 . 6 g / L 0 .6 g / L , about 0 . 6 g / L to about 1 . 1 g / L , about 0 . 6 g / L to to about 4 . 6 g / L , about 2 . 6 g / L to about 4 . 4 g / L , about 2 .6 about 1 . 0 g / L , about 0 . 6 g / L to about 0 . 9 g / L , about 0 .6 g / L g / L to about 4 . 2 g / L , about 2 . 6 g / L to about 4 . 0 g / L , about to about 0 . 8 g / L , about 0 .6 g / L to about 0 . 7 g / L , about 0 . 7 50 2 .6 g / L to about 3 . 8 g / L , about 2 . 6 g / L to about 3 . 6 g / L , g / L to about 1 . 1 g / L , about 0 . 7 g / L to about 1 . 0 g / L , about about 2 . 6 g / L to about 3 . 4 g / L , about 2 . 6 g / L to about 3 . 2 0 .7 g / L to about 0 . 9 g / L , about 0 .7 g / L to about 0 .8 g / L , g / L , about 2 . 6 g / L to about 3 . 0 g /L , about 2 . 6 g / L to about about 0 . 8 g /L to about 1 .1 g/ L , about 0 .8 g /L to about 1 .0 2 .8 g /L , about 2. 8 g /L to about 4 .9 g/ L , about 2 .8 g / L to g / L , about 0 . 8 g / L to about 0 . 9 g / L , about 0 . 9 g / L to about about 4 .6 g / L , about 2 . 8 g / L to about 4 . 4 g / L , about 2 . 8 g / L 1 . 1 g / L , about 0 . 9 g / L to about 1 . 0 g / L , about 1 . 0 g / L to 55 to about 4 . 2 g / L , about 2 . 8 g / L to about 4 .0 g / L , about 2 . 8 about 1 . 1 g /L , or about 0 . 27 weight % to about 0 . 75 weight g / L to about 3 . 8 g /L , about 2 . 8 g / L to about 3 .6 g / L , about % ) K -casein protein ( e . g . , any of the K -casein proteins 2 . 8 g / L to about 3 .4 g / L , about 2 . 8 g / L to about 3 . 2 g / L , described herein ) ; about 1 . 25 g / L to about 4 . 9 g / L ( e . g . , about 2 . 8 g / L to about 3 . 0 g / L , about 3 . 0 g / L to about 4 . 9 about 1 . 25 g / L to about 4 . 6 g / L , about 1 . 25 g / L to about 4 . 4 g / L , about 3 . 0 g / L to about 4 . 6 g / L , about 3 . 0 g / L to about g /L , about 1 .25 g / L to about 4 . 2 g / L , about 1. 25 g / L to about 60 4 . 4 g / L , about 3 . 0 g / L to about 4 . 2 g / L , about 3 . 0 g / L to 4 . 0 g / L , about 1 .25 g / L to about 3 . 8 g / L , about 1 . 25 g / L to about 4 . 0 g / L , about 3 . 0 g / L to about 3 . 8 g / L , about 3 . 0 g / L about 3 .6 g / L , about 1 .25 g / L to about 3 . 4 g / L , about 1 . 25 to about 3 . 6 g/ L , about 3 . 0 g / L to about 3 . 4 g / L , about 3 . 0 g / L to about 3 . 2 g / L , about 1 .25 g / L to about 3 . 0 g /L , about g /L to about 3 . 2 g / L , about 3 . 2 g / L to about 4 . 9 g / L , about 1 .25 g /L to about 2 . 8 g/ L , about 1. 25 g/ L to about 2 .6 g /L , 3. 2 g/ L to about 4 .6 g /L , about 3 .2 g / L to about 4 . 4 g/ L , about 1 .25 g / L to about 2 . 4 g / L , about 1 . 25 g / L to about 2 . 2 65 about 3 . 2 g / L to about 4 . 2 g / L , about 3 . 2 g / L to about 4 . 0 g / L , about 1 .25 g / L to about 2 . 0 g / L , about 1 . 25 g / L to about g /L , about 3 . 2 g / L to about 3 . 8 g /L , about 3 . 2 g / L to about 1 . 8 g / L , about 1 . 25 g / L to about 1 . 6 g / L , about 1 .25 g / L to 3 . 6 g / L , about 3 . 2 g / L to about 3 . 4 g / L , about 3 . 4 g / L to US 9 , 924 , 728 B2 32 about 4 . 9 g / L , about 3 . 4 g / L to about 4 .6 g / L , about 3 . 4 g / L % , about 1 . 5 weight % , about 1 . 0 weight % , or about 0 . 5 to about 4 . 4 g / L , about 3 . 4 g / L to about 4 . 2 g / L , about 3 . 4 weight % ; about 0 . 5 weight % to about 6 weight % , about g / L to about 4 . 0 g /L , about 3 . 4 g /L to about 3 .8 g / L , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight % , 3 .4 g / L to about 3 . 6 g / L , about 3 .6 g / L to about 4 . 9 g / L , about 4 . 0 weight % , about 3 . 5 weight % , about 3 .0 weight about 3 . 6 g / L to about 4 . 6 g / L , about 3 . 6 g /L to about 4 . 4 5 % , about 2 .5 weight % , about 2 . 0 weight % , about 1 . 5 g / L , about 3 .6 g / L to about 4 . 2 g / L , about 3 . 6 g / L to about weight % , or about 1 . 0 weight % ; about 1 . 0 weight % to 4 . 0 g / L , about 3 . 6 g / L to about 3 . 8 g / L , about 3 . 8 g / L to about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight about 4 .9 g/ L , about 3 . 8 g /L to about 4 .6 g /L , about 3. 8 g/ L % , about 4 . 5 weight % , about 4 .0 weight % , about 3 . 5 to about 4 . 4 g / L , about 3 . 8 g / L to about 4 . 2 g / L , about 3 . 8 weight % , about 3 . 0 weight % , about 2 . 5 weight % , about g / L to about 4 . 0 g / L , about 4 . 0 g / L to about 4 . 9 g / L , about 10 2 . 0 weight % , or about 1 . 5 weight % ; about 1 . 5 weight % to 4 . 0 g / L to about 4 . 6 g / L , about 4 . 0 g / L to about 4 . 4 g / L , about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight about 4 . 0 g / L to about 4 . 2 g / L , about 4 . 2 g /L to about 4 . 9 % , about 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 g /L , about 4 .2 g / L to about 4 .6 g /L , about 4 . 2 g /L to about weight % , about 3 .0 weight % , about 2 .5 weight % , or about 4 . 4 g / L , about 4 . 4 g / L to about 4 . 9 g / L , about 4 . 4 g / L to 2 . 0 weight % ; about 2 . 0 weight % to about 6 . 0 weight % , about 4 . 6 g / L , about 4 . 6 g / L to about 4 . 9 g / L , or about 1 .23 15 about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight weight % to about 3 .27 weight % ) ß - casein protein ( e . g ., any % , about 4 . 0 weight % , about 3 . 5 weight % , about 3 . 0 of the B - casein proteins described herein ); a final total weight % , or about 2 . 5 weight % ; about 2 . 5 weight % to concentration of one ormore lipids ( e . g ., any one or more of about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight the lipids described herein ) of about 0 weight % to about 45 % , about 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 weight % ( e . g . , 0 weight % ; about 0 weight % to about 4 . 5 20 weight % , or about 3 . 0 weight % ; about 3 . 0 weight % to weight % ; about 0 . 5 weight % to about 40 weight % , about about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight 35 weight % , about 30 weight % , about 25 weight % , about % , about 4 . 5 weight % , about 4 . 0 weight % , or about 3 . 5 20 weight % , about 15 weight % , about 10 weight % , about weight % ; about 3 . 5 weight % to about 6 . 0 weight % , about 8 weight % , about 6 weight % , about 5 weight % , about 4 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight % , or weight % , about 3 weight % , about 2 weight % , or about 1 25 about 4 . 0 weight % ; about 4 . 0 weight % to about 6 . 0 weight weight % ; about 1 . 0 weight % to about 40 weight % , about % , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 35 weight % , about 30 weight % , about 25 weight % , about weight % ; about 4 . 5 weight % to about 6 . 0 weight % , about 20 weight % , about 15 weight % , about 10 weight % , about 5 . 5 weight % , or about 5 . 0 weight % ; about 5 . 0 weight % to 8 weight % , about 6 weight % , about 5 weight % , about 4 about 6 . 0 weight % or about 5 . 5 weight % ; or about 5 . 5 weight % , about 3 weight % , or about 2 weight % ; about 2 30 weight % to about 6 . 0 weight % ) ; a final total concentration weight % to about 40 weight % , about 35 weight % , about of about 0 . 1 weight % to about 6 weight % ( e . g . , about 0 . 1 30 weight % , about 25 weight % , about 20 weight % , about weight % to about 5 . 5 weight % , about 5 . 0 weight % , about 15 weight % , about 10 weight % , about 8 weight % , about 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 weight % , 6 weight % , about 5 weight % , about 4 weight % , or about about 3 . 0 weight % , about 2 . 5 weight % , about 2 . 0 weight 3 weight % ; about 3 weight % to about 40 weight % , about 35 % , about 1 . 5 weight % , about 1. 0 weight % , or about 0 . 5 35 weight % , about 30 weight % , about 25 weight % , about weight % ; about 0 . 5 weight % to about 6 . 0 weight % , about 20 weight % , about 15 weight % , about 10 weight % , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight % , 8 weight % , about 6 weight % , about 5 weight % , or about about 4 .0 weight % , about 3 .5 weight % , about 3 .0 weight 4 weight % , about 4 weight % to about 40 weight % , about % , about 2 . 5 weight % , about 2 . 0 weight % , about 1 . 5 35 weight % , about 30 weight % , about 25 weight % , about 40 weight % , or about 1 . 0 weight % ; about 1. 0 weight % to 20 weight % , about 15 weight % , about 10 weight % , about about 6 .0 weight % , about 5 . 5 weight % , about 5 . 0 weight 8 weight % , about 6 weight % , or about 5 weight % ; about % , about 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 5 weight % to about 40 weight % , about 35 weight % , about weight % , about 3 . 0 weight % , about 2 . 5 weight % , about 30 weight % , about 25 weight % , about 20 weight % , about 2 . 0 weight % , or about 1 . 5 weight % ; about 1 . 5 weight % to 15 weight % , about 10 weight % , about 8 weight % , or about 45 about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight 6 weight % ; about 6 weight % to about 40 weight % , about % , about 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 35 weight % , about 30 weight % , about 25 weight % , about weight % , about 3 . 0 weight % , about 2 . 5 weight % , or about 20 weight % , about 15 weight % , about 10 weight % , or 2. 0 weight % ; about 2 .0 weight % to about 6 . 0 weight % , about 8 weight % ; about 8 weight % to about 40 weight % , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight about 35 weight % , about 30 weight % , about 25 weight % , 50 % , about 4 . 0 weight % , about 3 . 5 weight % , about 3 .0 about 20 weight % , about 15 weight % , or about 10 weight weight % , or about 2 . 5 weight % ; about 2 . 5 weight % to % ; about 10 weight % to about 40 weight % , about 35 about 6 . 0 weight % , about 5 . 5 weight % , about 5 .0 weight weight % , about 30 weight % , about 25 weight % , about 20 % , about 4 .5 weight % , about 4 .0 weight % , about 3. 5 weight % , or about 15 weight % ; about 15 weight % to about weight % , or about 3 . 0 weight % ; about 3 . 0 weight % to 40 weight % , about 35 weight % , about 30 weight % , about 55 about 6 . 0 weight % , about 5 . 5 weight % , about 5 .0 weight 25 weight % , or about 20 weight % ; about 20 weight % to % , about 4 . 5 weight % , about 4 . 0 weight % , or about 3 . 5 about 40 weight % , about 35 weight % , about 30 weight % , weight % ; about 3 .5 weight % to about 6 .0 weight % , about or about 25 weight % ; about 25 weight % to about 40 weight 5 . 5 weight % , about 5 . 0 weight % , about 4 .5 weight % , or % , about 35 weight % , or about 30 weight % ; about 30 about 4 . 0 weight % ; about 4 . 0 weight % to about 6 . 0 weight weight % to about 40 weight % , or about 35 weight % ; or 60 % , about 5 . 5 weight % , about 5 . 0 weight % , or about 4 . 5 about 35 weight % to about 40 weight % ); a final total weight % ; about 4 . 5 weight % to about 6 . 0 weight % , about concentration of one or more flavor compounds ( e . g . , any of 5 . 5 weight % , or about 5 . 0 weight % ; about 5 . 0 weight % to one or more of the flavor compounds described herein ) of about 6 .0 weight % , or about 5. 5 weight % ; or about 5 . 5 about 0 .01 weight % to about 6 weight % ( e . g ., about 0 . 1 weight % to about 6 .0 weight % ) of one ormore sweetening weight % to about 5 . 5 weight % , about 5 . 0 weight % , about 65 agents ( e . g ., any one or more of the sweetening agents 4 . 5 weight % , about 4 . 0 weight % , about 3 . 5 weight % , described herein ) ; and a final total concentration of ash of about 3 .0 weight % , about 2 .5 weight % , about 2 .0 weight about 0 .15 weight % to about 1 .5 weight % (e .g ., about 0 . 15 US 9 , 924 , 728 B2 33 34 weight % to about 1 . 4 weight % , about 1 . 3 weight % , about includes a higher or lower concentration of at least one 1 .2 weight % , about 1. 1 weight % , about 1 . 0 weight % , component as compared to the concentration of the at least about 0 . 9 weight % , about 0 . 8 weight % , about 0 .6 weight one component in a mammal- produced milk . In some % , about 0 .5 weight % , about 0 .4 weight % , about 0 .3 examples of these compositions , the composition includes a weight % , or about 0 . 2 weight % ; about 0 . 2 weight % to 5 higher concentration of at least one component selected about 1 . 5 weight % , about 1 . 4 weight % , about 1 . 3 weight from the group of: calcium , phosphate , B complex vitamins , % , about 1 . 2 weight % , about 1 . 1 weight % , about 1 . 0 vitamin A , vitamin D , vitamin E , and vitamin K , as com weight % , about 0 . 9 weight % , about 0 . 8 weight % , about pared to the concentration of the one or more components in 0 .6 weight % , about 0 . 5 weight % , about 0 . 4 weight % , or a mammal- produced milk . In some embodiments of these about 0 .3 weight % ; about 0 .3 weight % to about 1 .5 weight 10 compositions , the composition does not include at least one % , about 1 . 4 weight % , about 1 . 3 weight % , about 1 .2 component found in a mammal- produced milk selected from weight % , about 1 . 1 weight % , about 1 . 0 weight % , about the group of : lactose , bacteria , mycobacteria , allergens , 0 . 9 weight % , about 0 . 8 weight % , about 0 .6 weight % , viruses , prions , yeast , growth hormones, leukocytes, antibi about 0 . 5 weight % , or about 0 .4 weight % ; about 0 .4 weight otics , heavy metals , immunoglobulins, lactoferrin , lactoper % to about 1. 5 weight % , about 1. 4 weight % , about 1 .3 15 oxidase, and lipase . In some examples of these composi weight % , about 1 . 2 weight % , about 1 . 1 weight % , about tions , the composition includes at least one component not 1 . 0 weight % , about 0 . 9 weight % , about 0 . 8 weight % , present in a mammal- produced milk selected from the group about 0 . 6 weight % , or about 0 . 5 weight % ; about 0 . 5 weight of an artificial sweetener , a plant- derived lipid , a ß - casein % to about 1 . 5 weight % , about 1 . 4 weight % , about 1 . 3 protein that is non - glycosylated or has a non -mammalian weight % , about 1 . 2 weight % , about 1. 1 weight % , about 20 glycosylation pattern , and a K -casein protein that is non 1 . 0 weight % , about 0 . 9 weight % , about 0 . 8 weight % , or glycosylated or has a non -mammalian glycosylation pattern . about 0 .6 weight % ; about 0 . 6 weight % to about 1 . 5 weight Also provided are compositions including : about 0 . 3 g / L % , about 1 . 4 weight % , about 1. 3 weight % , about 1 . 2 to about 1 . 1 g / L ( e . g . , any of the subranges of about 0 . 3 g / L weight % , about 1 . 1 weight % , about 1 . 0 weight % , about to about 1 . 1 g / L described in this section ) K -casein protein 0 . 9 weight % , or about 0 . 8 weight % ; about 0 . 8 weight % to 25 ( e . g ., any of the K - casein proteins described herein ) that is about 1 . 4 weight % , about 1 . 3 weight % , about 1 . 2 weight unglycosylated or has a non -mammalian glycosylation pat % , about 1 . 1 weight % , about 1 . 0 weight % , or about 0 . 9 tern ; about 1 . 25 g / L to about 4 . 9 g / L ( e . g . , any of the weight % ; about 0 . 9 weight % to about 1 . 5 weight % , about subranges of about 1 .25 g / L to about 4 . 9 g / L described in 1 . 4 weight % , about 1 . 3 weight % , about 1 . 2 weight % , this section ) B -casein protein ( e . g ., any of the B - casein about 1. 1 weight % , or about 1. 0 weight % ; about 1 . 0 weight 30 proteins described herein ) that is unglycosylated or has a % to about 1 . 5 weight % , about 1 . 4 weight % , about 1. 3 non -mammalian glycosylation pattern ; a final total concen weight % , about 1 . 2 weight % , or about 1 . 1 weight % ; about tration of one or more lipids ( e . g . , any of the one or more 1 . 1 weight % to about 1 . 5 weight % , about 1 . 4 weight % , lipids described herein ) of about 0 weight % to about 45 about 1 . 3 weight % , or about 1 . 2 weight % ; about 1 . 2 weight weight % ( e . g . , any of the subranges of about 0 weight % to % to about 1. 5 weight % , about 1 .4 weight % , or about 1. 3 35 about 45 weight % described in this section ); a final total weight % ; about 1 . 3 weight % to about 1 . 5 weight % or concentration of one or more flavor compounds ( e . g ., any of about 1 . 4 weight % ; or about 1 . 4 weight % to about 1 . 5 the one or more flavor compounds described herein ) of weight % ) , where the composition does not comprise an about 0 .01 weight % to about 6 weight % ( e . g ., any of the animal- derived component. subranges of about 0 .01 weight % to about 6 weight % Also provided are compositions including : about 0 . 3 g / L 40 described in this section ) ; a final total concentration of about to about 1 . 1 g / L ( e . g . , any of the subranges of about 0 . 3 g / L 0 . 1 weight % to about 6 weight % ( e . g . , any of the subranges to about 1 . 1 g / L described in the above paragraph ) K - casein of about 0 . 1 weight % to about 6 weight % described in this protein ( e . g . , any of the K - casein proteins described herein ) ; section ) of one or more sweetening agents ( e . g . , any of the about 1 . 25 g / L to about 4 . 9 g / L ( e . g ., any of the subranges one ormore sweetening agents described herein ) ; and a final of about 1 . 25 g /L to about 4 . 9 g / L described in the above 45 total concentration of ash ( e . g ., any of the ash described paragraph ) B - casein protein ( e . g . , any of the B - casein pro - herein ) of about 0 . 15 weight % to about 1 . 5 weight % ( e . g . , teins described herein ) ; a final total concentration of one or any of the subranges of about 0 . 15 weight % to about 1. 5 more lipids ( e . g ., any of the one or more lipids described weight % described in this section ) . herein ) of about 0 weight % to about 45 weight % (e . g ., any Also provided are compositions including a micelle of the subranges of about 0 weight % to about 45 weight % 50 including a K - casein protein ( e . g ., any of the K - casein described in the above paragraph ); a final total concentration proteins described herein ) and a ß - casein protein (e . g ., any of one or more flavor compounds ( e . g . , any of the one or of the ß - casein proteins described herein ), where the micelle more flavor compounds described herein ) of about 0 .01 has a diameter of about 50 nm to about 350 nm ( e . g . , any of weight % to about 6 weight % ( e . g ., any of the subranges of the subranges of the diameter of a micelle described herein ) , about 0 .01 weight % to about 6 weight % described in the 55 and the K - casein protein and the B - casein protein are ungly above paragraph ) ; a final total concentration of about 0 . 1 cosylated or have a non -mammalian glycosylation pattern . weight % to about 6 weight % ( e . g ., any of the subranges of In some embodiments, the composition includes a final about 0 .1 weight % to about 6 weight % described herein ) concentration of micelles of about 2 .0 weight % to about 6 of one or more sweetening agents ( e . g . , any one or more weight % ( e . g . , about 2 . 0 weight % to about 5 . 5 weight % , sweetening agents described herein ); and a final total con - 60 about 5 .0 weight % , about 4 .5 weight % , about 4 .0 weight centration of ash ( e . g . , any of the exemplary ash described % , about 3 . 5 weight % , about 3 . 0 weight % , or about 2 . 5 herein ) of about 0 . 15 weight % to about 1 . 5 weight % ( e . g ., weight % ; about 2 . 5 weight % to about 6 . 0 weight % , about any of the subranges of about 0 . 15 weight % to about 1 .5 5 .5 weight % , about 5 .0 weight % , about 4 .5 weight % , weight % described in the above paragraph ) , where : the about 4 . 0 weight % , about 3 . 5 weight % , or about 3 . 0 weight composition : does not include at least one component found 65 % ; about 3 . 0 weight % to about 6 . 0 weight % , about 5 . 5 in a mammal- produced milk ; includes at least one compo - weight % , about 5 . 0 weight % , about 4 . 5 weight % , about nent not present in a mammal- produced milk ; and / or 4 . 0 weight % , or about 3 . 5 weight % ; about 3 . 5 weight % to US 9 , 924 , 728 B2 35 36 about 6 . 0 weight % , about 5 . 5 weight % , about 5 . 0 weight weight % , about 24 weight % , about 22 weight % , about 20 % , about 4 . 5 weight % , about 4 . 0 weight % , or about 3 . 5 weight % , about 18 weight % , about 16 weight % , or about weight % ; about 3 .5 weight % to about 6 . 0 weight % , about 14 weight % ; about 14 weight to about 28 weight % , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 weight % , or 26 weight % , about 24 weight % , about 22 weight % , about about 4 . 0 weight % ; about 4 . 5 weight % to about 6 . 0 weight 5 20 weight % , about 18 weight % , or about 16 weight % ; % , about 5 . 5 weight % , about 5 . 0 weight % , about 4 . 5 about 16 weight % to about 28 weight % , about 26 weight weight % , or about 4 . 0 weight % ; about 4 . 0 weight % to % , about 24 weight % , about 22 weight % , about 20 weight about 6 .0 weight % , about 5 .5 weight % , about 5 .0 weight % , about 18 weight % ; about 18 weight % to about 28 % , or about 4 . 5 weight % ; about 4 . 5 weight % to about 5 . 5 weight % , about 26 weight % , about 24 weight % , about 22 weight % , or about 5 . 0 weight % ; about 5 . 0 weight % to 10 weight % , or about 20 weight % ; about 20 weight % to about about 6 . 0 weight % or 5 . 5 weight % ; or about 5 . 5 weight % 28 weight % , about 26 weight % , about 24 weight % , about to about 6 . 0 weight % ) . In some embodiments of these 22 weight % ; about 22 weight % to about 28 weight % , compositions, the ratio of the ß -casein protein to the K - ca about 26 weight % , about 24 weight % ; about 24 weight % sein protein in the micelle is about 2 . 0 : 1 to about 5 . 5 : 1 ( e . g . , to about 28 weight % or about 26 weight % ; or about 28 any of the subranges of the ratios about 2 . 0 : 1 to about 5 . 5 : 1 15 weight % to about 30 weight % ; a final concentration of described for the micelle herein ) . In some embodiments , coconut oil of about 0 . 5 weight % to about 14 weight % these compositions further include : a final total concentra - ( e . g ., about 0 .5 weight % to about 12 weight % , about 10 tion of one or more lipids ( e . g . , any of the one ormore lipids weight % , about 8 weight % , about 6 weight % , about 4 described herein ) of about 0 weight % to about 45 weight % weight % , about 2 weight % , or about 1 weight % ; about 1 ( e . g ., any of the subranges of about 0 weight % to about 45 20 weight % to about 14 weight % , about 12 weight % , about weight percent described in this section ) ; a final total con - 10 weight % , about 8 weight % , about 6 weight % , about 4 centration of one or more flavor compounds ( e . g ., any of the weight % , or about 2 weight % ; about 2 weight % to about one or more flavor compounds described herein ) of about 12 weight % , about 10 weight % , about 8 weight % , about 0 .01 weight % to about 6 weight % ( e . g . , any of the 6 weight % , or about 4 weight % ; about 4 weight % to about subranges of 0 .01 weight % to about 6 weight % described 25 14 weight % , about 12 weight % , about 10 weight % , about in this section ) ; a final total concentration of about 0 . 1 8 weight % , or about 6 weight % ; about 6 weight % to about weight % to about 6 weight % ( e. g. , any of the subranges of 14 weight % , about 12 weight % , about 10 weight % , or about 0 . 1 weight % to about 6 weight % described in this about 8 weight % ; about 8 weight % to about 14 weight % , section ) of one or more sweetening agents ( e . g ., any one or about 12 weight % , or about 10 weight % ; about 10 weight more of the sweetening agents described herein ) ; and a final 30 % to about 14 weight % or 12 weight % ; or about 12 weight total concentration of ash ( e . g . , any of the ash described % to about 14 weight % ; a final concentration of tributyrin herein ) of about 0 . 15 weight % to about 1 . 5 weight % ( e . g ., of about 0 .05 weight to about 1 . 0 weight % ( e. g . , between any of the subranges of about 0 . 15 weight % to about 1 . 5 about 0 . 05 weight % to about 0 . 9 weight % , about 0 . 8 weight weight % described in this section ) . % , about 0 . 7 weight % , about 0 . 6 weight % , about 0 . 5 In some embodiments of any of the compositions 35 weight % , about 0 . 4 weight % , about 0 . 3 weight % , or about described herein , the one or more lipids are selected from the 0 . 2 weight % ; 0 . 1 weight % to about 1 . 0 weight % , about 0 . 9 group consisting of: sunflower oil, coconut oil, tributyrin , weight % , about 0 . 8 weight % , about 0 . 7 weight % , about mono- and di- glycerides , free fatty acids , and phospholipids . 0 . 6 weight % , about 0 . 5 weight % , about 0 . 4 weight % , Some examples of any of the compositions described herein about 0 . 3 weight % , or about 0 . 2 weight % ; about 0 . 2 weight further include one or more of : a final concentration of 40 % to about 1 . 0 weight % , about 0 . 9 weight % , about 0 . 8 sunflower oil of about 1 weight % to about 28 weight % weight % , about 0 . 7 weight % , about 0 . 6 weight % , about ( e . g . , about 1 weight % to about 26 weight % , about 24 0 . 5 weight % , or about 0 . 4 weight % ; about 0 . 4 weight % to weight % , about 22 weight % , about 20 weight % , about 18 about 1 . 0 weight % , about 0 . 9 weight % , about 0 . 8 weight weight % , about 16 weight % , about 14 weight % , about 12 % , about 0 . 7 weight % , about 0 . 6 weight % , or about 0 . 5 weight % , about 10 weight % , about 8 weight % , about 6 45 weight % ; about 0 . 5 weight % to about 1 . 0 weight % , about weight % , about 4 weight % , or about 2 weight % ; about 2 0 . 9 weight % , about 0 . 8 weight % , about 0 . 7 weight % , or weight % to about 28 weight % , about 26 weight % , about about 0 .6 weight % ; about 0 .6 weight % to about 1 . 0 weight 24 weight % , about 22 weight % , about 20 weight % , about % , about 0 . 9 weight % , about 0 . 8 weight % , or about 0 . 7 18 weight % , about 16 weight % , about 14 weight % , about weight % ; about 0 . 7 weight % to about 1 . 0 weight % , about 12 weight % , about 10 weight % , about 8 weight % , about 50 0 . 9 weight % , or about 0 . 8 weight % ; about 0 . 8 weight % to 6 weight % , or about 4 weight % ; about 4 weight % to about about 1 . 0 weight % or about 0 .9 weight % ; or about 0 . 9 28 weight % , about 26 weight % , about 24 weight % , about weight % to about 1 . 0 weight % ); a final total concentration 22 weight % , about 20 weight % , about 18 weight % , about of monoglycerides and diglycerides ( e . g ., any one or more 16 weight % , about 14 weight % , about 12 weight % , about of the monoglycerides or diglycerides described herein ) of 10 weight % , about 8 weight % , or about 6 weight % ; about 55 about 0 .08 weight % to about 1 . 2 weight % ( e . g . , 0 .08 6 weight % to about 28 weight % , about 26 weight % , about weight % to about 1 . 0 weight % , about 0 . 8 weight % , about 24 weight % , about 22 weight % , about 20 weight % , about 0 . 6 weight % , about 0 . 4 weight % , or about 0 . 2 weight % ; 18 weight % , about 16 weight % , about 14 weight % , about about 0 . 2 weight % to about 1 . 2 weight % , about 1 . 0 weight 12 weight % , about 10 weight % , or about 8 weight % ; about % , about 0 . 8 weight % , about 0 . 6 weight % , or about 0 . 4 8 weight % to about 28 weight % , about 26 weight % , about 60 weight % ; about 0 . 4 weight % to about 1 . 2 weight % , about 24 weight % , about 22 weight % , about 20 weight % , about 1 . 0 weight % , about 0 . 8 weight % , or about 0 . 6 weight % ; 18 weight % , about 16 weight % , about 14 weight % , about about 0 .6 weight % to about 1. 2 weight % , about 1 . 0 weight 12 weight % , or about 10 weight % ; about 10 weight % to % , or about 0 . 8 weight % ; about 0 . 8 weight % to about 1. 2 about 28 weight % , about 26 weight % , about 24 weight % , weight % or about 1 . 0 weight % ; or about 1 . 0 weight % to about 22 weight % , about 20 weight % , about 18 weight % , 65 about 1 . 2 weight % ) ; and a final total concentration of free about 16 weight % , about 14 weight % , or about 12 weight fatty acids of about 0 . 02 weight % to about 0 . 28 weight % ; % ; about 12 weight % to about 28 weight % , about 26 and a final total concentration of phospholipids ( e . g . , any US 9 , 924 , 728 B2 37 38 one or more of the phospholipids described herein ) of about protein . In any of the compositions described herein , the 0 .02 weight % to about 0 .3 weight % (e .g . , about 0 .02 B -casein protein can be a cow , human , sheep , goat , buffalo , weight % to about 0 .25 weight % , about 0 .20 weight % , camel, horse , donkey, lemur, panda , guinea pig , squirrel, about 0 . 15 weight % , or about 0 . 10 weight % ; about 0 .05 bear, macaque , gorilla , chimpanzee ,mountain goat, monkey , weight % to about 0 .3 weight % , about 0 . 25 weight % , about 5 ape , cat , dog , wallaby, rat ,mouse , elephant , opossum , rabbit, 0 .20 weight % , about 0 .15 weight % , or about 0 . 10 weight whale , baboons, gibbons, orangutan , mandrill, pig , wolf, % ; about 0 .10 weight % to about 0 .30 weight % , about 0 . 25 fox , lion , tiger, echidna , or woolly mammoth ß -casein weight % , about 0 . 20 weight % , or about 0 . 15 weight % ; protein . about 0 .15 weight % to about 0. 30 weight % , about 0 .25 In some examples of any of the compositions described weight % , or about 0 . 20 weight % ; about 0 . 20 weight % to 10 herein can further include : a final concentration of a - lactal about 0 .30 weight % or about 0 . 25 weight % ; or about 0 . 25 bumin protein ( e . g . , any of the a - lactalbumin proteins weight % to about 0 . 30 weight % ) . described herein ) of about 0 . 4 weight % to about 2 . 5 weight In some embodiments of any of the compositions , the free % ( e . g ., about 0 . 4 weight % to about 2 . 0 weight % , about 1 . 5 fatty acids include at least one ( e . g . , two , three , or four ) fatty weight % , or about 1 . 0 weight % ; about 1 . 0 weight % to acid selected from the group of: butyric acid , caproic acid , 15 about 2 . 5 weight % , about 2 . 0 weight % , or about 1 . 5 weight caprylic acid , and capric acid . In some embodiments of any % , about 1 . 5 weight % to about 2 . 5 weight % or 2 . 0 weight of the compositions, the phospholipids are soy lecithin % ; or about 2 . 0 weight % to about 2 . 5 weight % ), and / or a phospholipids, sunflower lecithin phospholipids, cotton leci - final concentration of B -lactoglobulin protein (e . g ., any of thin phospholipids, or rapeseed lecithin phospholipids. In the B - lactoglobulin proteins described herein ) of about 2 . 5 some examples of any of the compositions described herein , 20 weight % to about 4 .5 weight % . In some embodiments of the flavor compounds include at least one flavor compound any of the compositions described herein , the a - lactalbumin selected from the group of : d - decalactone, ethyl butyrate , protein can be a cow , human , sheep , goat, buffalo , camel, 2 - furyl methyl ketone, 2 ,3 -pentanedione , y -undecalactone , horse , donkey , lemur, panda , guinea pig , squirrel , bear , and d - undecalactone . In some embodiments of any of the macaque, gorilla , chimpanzee , mountain goat, monkey , ape , compositions described herein , the one or more sweetening 25 cat, dog , wallaby , rat, mouse , elephant, opossum , rabbit , agents is a saccharide ( e . g ., glucose , mannose , maltose , whale , baboons, gibbons, orangutan , mandrill, pig , wolf , fructose , galactose , lactose , sucrose , monatin , or tagatose ). fox , lion , tiger, echidna , or woolly mammoth a - lactalbumin In some examples of any of the compositions described protein . In some embodiments of any of the compositions herein , the one or more sweetening agents is an artificial described herein , the B - lactoglobulin protein can be a cow , sweetener ( e . g . , stevia , aspartame, cyclamate , saccharin , 30 human , sheep , goat , buffalo , camel, horse , donkey , lemur, sucralose ,mogrosides , brazzein , curculin , erythritol, glycyr - panda , guinea pig , squirrel , bear , macaque , gorilla , chim rhizin , inulin , isomalt, lacititol, mabinlin , malititol, manni panzee , mountain goat, monkey , ape, cat, dog, wallaby, rat, tol, miraculin , monatin , monelin , osladin , pentadin , sorbitol, mouse , elephant, opossum , rabbit , whale , baboons , gibbons , thaumatin , xylitol, acesulfame potassium , advantame, alit orangutan , mandrill , pig , wolf, fox , lion , tiger, echidna, or ame, aspartame- acesulfame , sodium cyclamate , dulcin , glu - 35 woolly mammoth B - lactoglobulin protein . cin , neohesperidin dihyrdochalcone, neotame, or P -4000 ) . Some embodiments of any of the compositions described In some examples of any of the compositions described herein further include : a final concentration of a - S1- casein herein , the ash includes one or more ( e . g ., two , three , four, protein ( e . g . , any of the a - Si - casein proteins described five , or six ) of: calcium , phosphorus, potassium , sodium , herein ) of about 11 weight % to about 16 weight % ( e . g ., citrate , and chloride . In some embodiments of any of the 40 about 11 weight % to about 15 weight % , about 14 weight compositions described herein , the ash comprises one or % , about 13 weight % , or about 12 weight % ; about 12 more (e . g. , two or three) of CaCl2 , KH PO4, and Naz citrate . weight % to about 16 weight % , about 15 weight % , about Some embodiments of the compositions described herein 14 weight % , or about 13 weight % ; about 13 weight % to include : a final concentration of CaCl , of about 0 .05 g / L to about 16 weight % , about 15 weight % , or about 14 weight about 0 . 2 g / L ( e . g ., about 0 .05 g / L to about 0 . 15 g / L , about 45 % ; about 14 weight % to about 16 weight % or 15 weight % ; 0 .05 g / L to about 0 . 10 g / L , about 0 . 10 g / L to about 0 . 20 g / L , or about 15 weight % to about 16 weight % ) ; and /or a final about 0 . 10 g/ L to about 0 . 15 g / L , or about 0 .15 g / L to about concentration of a - S2 -casein protein ( e. g ., any of the a -S2 0 .2 g /L ); a final concentration of KH2PO4 of about 0 .2 g / L casein proteins described herein ) of about 2 weight % to to about 0 . 4 g / L ( e . g . , about 0 . 2 g / L to about 0 . 35 g / L , about about 5 weight % ( e . g . , about 2 weight % to about 4 . 5 weight 0 . 2 g / L to about 0 . 30 g / L , about 0 . 2 g / L to about 0 . 25 g / L , 50 % , about 4 . 0 weight % , about 3 . 5 weight % , about 3 . 0 about 0 . 25 g / L to about 0 . 4 g / L , about 0 . 25 g / L to about 0 . 30 weight % , or about 2 . 5 weight % ; about 2 . 5 weight % to g / L , about 0 . 30 g / L to about 0 . 40 g / L , or about 0 . 30 g / L to about 5 . 0 weight % , about 4 .5 weight % , about 4 . 0 weight about 0 .35 g/ L , or about 0 . 35 g /L to about 0 .40 g /L ); and /or % , about 3 . 5 weight % , or about 3. 0 weight % ; about 3 .0 a final concentration of Naz citrate of about 0 . 1 g / L to about weight % to about 5 . 0 weight % , about 4 . 5 weight % , about 0 . 3 g / L ( e . g . , 0 . 1 g / L to about 0 .25 g / L , about 0 . 1 g / L to 55 4 . 0 weight % , or about 3 . 5 weight % ; about 3 . 5 weight % to about 0 .20 g / L , about 0 . 1 g / L to about 0 . 15 g / L , about 0 . 15 about 5 weight % , about 4 . 5 weight % , or about 4 . 0 weight g / L to about 0 .30 g / L , about 0 . 15 g / L to about 0 .25 g / L , % ; about 4 . 0 weight % to about 5 . 0 weight % or 4 . 5 weight about 0 .15 g / L to about 0 .20 g / L , about 0 .20 g / L to about % ; or about 4 . 5 weight % to about 5 . 0 weight % ) . 0 .30 g / L , about 0 . 20 g /L to about 0 .25 g / L , or about 0 . 25 g / L In some examples of any of the compositions described to about 0 . 30 g / L ) . 60 herein , the a -S1 - casein protein can be a cow , human , sheep , In any of the composition described herein , the K - casein goat , buffalo , camel, horse, donkey, lemur, panda, guinea protein can be a cow , human , sheep , goat, buffalo , camel , pig , squirrel, bear, macaque, gorilla , chimpanzee, mountain horse , donkey, lemur, panda , guinea pig , squirrel, bear, goat, monkey, ape , cat , dog , wallaby , rat , mouse , elephant, macaque, gorilla , chimpanzee , mountain goat , monkey, ape , opossum , rabbit , whale , baboons, gibbons, orangutan , man cat, dog , wallaby , rat, mouse , elephant, opossum , rabbit, 65 drill, pig , wolf , fox , lion , tiger, echidna , or woolly mammoth whale , baboons, gibbons, orangutan , mandrill , pig , wolf, a - S1 -casein protein ; and /or the a -S2 - casein protein can be fox , lion , tiger , echidna, or woolly mammoth K - casein a cow , human , sheep , goat, buffalo , camel, horse , donkey, US 9 ,924 ,728 B2 39 40 lemur, panda, guinea pig , squirrel, bear , macaque , gorilla , about 5 . 0 weight % , about 4 .8 weight % , about 4 . 6 weight chimpanzee, mountain goat, monkey , ape, cat, dog , wallaby, % , about 4 . 4 weight % , or about 4 . 2 weight % ; about 4 . 2 rat, mouse, elephant, opossum , rabbit, whale , baboons , weight % to about 5 .2 weight % , about 5 .2 weight % , about gibbons, orangutan , mandrill , pig , wolf, fox , lion , tiger , 5 . 0 weight % , about 4 .8 weight % , about 4 .6 weight % , or echidna , or woolly mammoth a - S2 - casein protein . 5 about 4 . 4 weight % ; about 4 . 8 weight % to about 5 . 4 weight Some examples of any of the compositions described % , about 5 . 2 weight % , or about 5 .0 weight % ; about 5 . 0 herein further include one or more ( e . g . , two or three ) of weight % to about 5 . 4 weight % or about 5 . 2 weight % ; or serum albumin ( e . g ., any of the serum albumin proteins described herein ), lactoferrin ( e . g ., any of the lactoferrin about 5 . 2 weight % to about 5 .4 weight % ) ; a final concen proteins described herein ), and transferrin ( e. g ., any of the 10 tration of ß -casein protein (e . g. , any of the B -casein proteins transferrin proteins described herein ) . In some examples of described herein ) of about 16 .3 weight % to about 24 .5 any of the compositions described herein , the serum albumin weight % ; 16 . 3 weight % to about 22 weight % , about 20 can be a cow , human , sheep , goat , buffalo , camel, horse , weight % , or about 18 weight % ; about 18 weight % to about donkey, lemur, panda, guinea pig , squirrel , bear, macaque , 24 . 5 weight % , about 22 weight % , or about 20 weight % ; gorilla , chimpanzee, mountain goat, monkey, ape , cat , dog, 15 abouta 20 weight % to about 24 . 5 weight % to about 22 wallaby, rat , mouse , elephant, opossum , rabbit, whale , weight % ; or about 22 weight % to about 24 . 5 weight % ) ; baboons , gibbons, orangutangutan ,, mandrill mandrill , pigpig , wolf, , fox ,, lion ,. a final concentration of a sweetening agent ( e. g. , any one or tiger , echidna , or woolly mammoth serum albumin ; the more of the sweetening agents described herein ) of about 35 lactoferrin can be a cow , human , sheep , goat , buffalo , camel, weight % to about 40 weight % (e . g , about 35 weight % to horse , donkey , lemur , panda , guinea pig , squirrel, bear, 20 about 39 weight % , about 38 weight % , about 37 weight % , macaque , gorilla , chimpanzee, mountain goat , monkey , ape , or about 36 weight % ; about 36 weight % to about 40 weight cat , dog , wallaby, rat, mouse , elephant, opossum , rabbit, % , about 39 weight % , about 38 weight % , or about 37 whale , baboons, gibbons , orangutan , mandrill, pig , wolf , weight % ; about 37 weight % to about 40 weight % , about fox , lion , tiger , echidna , or woolly mammoth lactoferrin ; 39 weight % , or about 38 weight % ; about 38 weight % to and / or the transferrin can be a cow , human , sheep , goat, 25 about 40 weight % or 39 weight % ; or about 39 weight % buffalo , camel, horse , donkey , lemur , panda , guinea pig , to about 40 weight % ) ; a final concentration of one or more squirrel , bear, macaque , gorilla , chimpanzee, mountain goat, lipids ( e . g ., any of the one or more lipids described herein ) monkey , ape , cat, dog , wallaby, rat, mouse , elephant, opos of about 25 weight % to about 30 weight % ( e . g ., about 25 sum , rabbit , whale , baboons , gibbons, orangutan , mandrill , weight % to about 29 weight % , about 28 weight % , about pig , wolf, fox , lion , tiger, echidna, or woolly mammoth 30 27 transferrin protein . 27 weight % , or about 26 weight % ; about 26 weight % to In some examples of any of the compositions described about 30 weight % , about 29 weight % , about 28 weight % , herein , the composition further includes one or more color or about 27 weight % ; about 27 weight % to about 30 weight balancing agents ( e . g ., any of the coloring agents described % , about 29 weight % , or about 28 weight % ; about 28 herein , e .g ., B -carotene or annatto ). weight % to about 30 weight % or about 29 weight % ; or Any of the compositions described herein can have a pH about 29 weight % to about 30 weight % ) ; a final concen of about 6 . 2 to about 7 . 2 (e . g ., about 6 . 2 to about 7 . 0 , about tration of ash ( e . g . , any of the ash described herein ) of about 6 . 2 to about 6 . 8 , about 6 . 2 to about 6 . 6 , about 6 . 2 to about 5 weight % to about 7 weight % ( e . g ., about 5 weight % to 6 . 4 , about 6 . 4 to about 7 . 2 , about 6 . 4 to about 7 . 0 , about 6 . 4 about 6 . 5 weight % , about 6 . 0 weight % , or about 5 . 5 weight to about 6 . 8 , about 6 . 4 to about 6 .6 , about 6 .6 to about 7 . 2 , 40 % ; about 5 . 5 weight % to about 7 .0 weight % , about 6 . 5 about 6 . 6 to about 7 . 0 , about 6 .6 to about 6 . 8 , about 6 .8 to weight % , or about 6 . 0 weight % ; about 6 .0 weight % to about 7 . 2 , about 6 . 8 to about 7 . 0 , or about 7 . 0 to about 7 . 2 ) . about 7 . 0 weight % or about 6 . 5 weight % ; or about 6 . 5 In various embodiments, the milk protein components weight % to about 7 . 0 weight % ) ; and a final concentration comprise about 0 . 5 % about 1 % , about 1 . 5 % , about 2 % , of water of about 2 weight % to about 5 weight % ( e . g ., about 2 . 5 % , about 3 % , about 3 . 5 % , about 4 % , about 4 . 5 % , 45 about 2 weight % to about 4 weight % or about 3 weight % ; about 5 % , about 6 % milk protein by dry weight or total about 3 weight % to about 5 weight % or about 4 weight % ; weight . In some embodiments , the compositions can com - or about 4 weight % to about 5 weight % ) , where the prise about 0 . 5 - 2 . 5 % , about 1 - 2 % , about 2 - 3 % , or about K - casein protein is an unglycosylated and /or has a non 4 - 10 % protein by dry weight or total weight . In particular mammalian glycosylation pattern , and /or the B - casein pro embodiments , the compositions can comprise about 10 - 15 % 50 tein is an unglycosylated and / or has a non -mammalian protein by dry weight or total weight. glycosylation pattern . A wide range of caseins including casein with substantial Any of the powder compositions can contain any of the homology to the wildtype casein , variants , mutants of casein components described in any of the compositions described are expressed and incorporated as a component of milk herein ( e . g . , one or more of any of the color matching agents , protein . 55 a - S1 - casein proteins, a - S2 - casein proteins, a - lactalbumin Dry Compositions proteins , B -lactoglobulin proteins , lactoferrin proteins , Also provided are powder compositions including : a final transferrin proteins, and serum albumin protein described concentration of K - casein protein ( e . g ., any of the -casein herein at any of the concentrations described herein for each proteins described herein ) of about 3 . 6 weight % to about 5 . 4 . component, respectively ) . weight % ( e .g . , about 3 . 6 weight % to about 5 . 2 weight % , 60 Supplemented Milk Compositions about 5 .0 weight % , about 4 .8 weight % , about 4 .6 weight Also provided herein are compositions including : a mam % , about 4 . 4 weight % , about 4 . 2 weight % , about 4 .0 malian -produced milk or a processed mammal- produced weight % , or about 3 . 8 weight % ; about 3 .8 weight % to milk ; and one or more ( e . g . , two or three ) of a K -casein about 5 . 4 weight % , about 5 . 2 weight % , about 5 . 0 weight protein that is unglycosylated or has an non -mammalian % , about 4 .8 weight % , about 4 .6 weight % , about 4 . 4 65 glycosylation pattern ; a ß -casein protein that is unglycosy weight % , about 4 .2 weight % , or about 4 . 0 weight % ; about lated or has an non -mammalian glycosylation pattern ; or a 4 .0 weight % to about 5 .4 weight % , about 5 . 2 weight % , micelle including a K - casein protein that is unglycosylated US 9 ,924 ,728 B2 47 42 or has an non -mammalian glycosylation pattern and a ß - ca In some compositions , the final concentration of the sein protein that is unglycosylated or has an non -mammalian K - casein protein that is unglycosylated and / or has a non glycosylation pattern . mammalian glycosylation pattern in the composition is In some examples, the composition includes a mammal - about 0 .02 weight % to about 0 . 6 weight % ( e . g ., about 0 . 02 produced milk or a processed mammalian - produced milk 5 weight % to about 0 .5 weight % , about 0 .02 weight % to and a K - casein protein that is unglycosylated or has a about 0 . 4 weight % , about 0 . 02 weight % to about 0 . 3 weight non -mammalian glycosylation pattern . In some examples , % , about 0 .02 weight % to about 0 . 2 weight % , about 0 .02 the composition includes a mammal - produced milk or a weight % to about 0 . 1 weight % , about 0 . 1 weight % to processed mammalian -produced milk and a ß - casein protein about 0 . 5 weight % , about 0 . 1 weight % , to about 0 . 4 weight that is unglycosylated or has a non -mammalian glycosy - 10 % , about 0 . 1 weight % to about 0 . 3 weight % , about 0 . 1 lation pattern . In other examples , the composition includes weight % to about 0 . 2 weight % , about 0 . 2 weight % to a mammal -produced milk or a processed mammalian -pro - about 0 . 5 weight % , about 0 . 2 weight % to about 0 .4 weight duced milk and a micelle including a K -casein protein that is % , about 0 . 2 weight % to about 0 . 3 weight % , about 0 . 3 unglycosylated or has a non -mammalian glycosylation pat- weight % to about 0 . 5 weight % , about 0 . 3 weight % to tern and a ß - casein protein that is unglycosylated or has a 15 about 0 . 4 weight % , or about 0 . 4 weight % to about 0 . 5 non -mammalian glycosylation pattern . weight % ) ; and the final concentration of ß - casein that is In some examples, the final concentration of the K - casein unglycosylated and / or has a non -mammalian glycosylation protein that is unglycosylated or has a non -mammalian pattern in the composition is about 0 .02 weight % to about glycosylation pattern or the final concentration of the ß -ca 4 . 0 weight % , about 3 . 8 weight % , about 3 . 6 weight % , sein protein that is unglycosylated or has a non -mammalian 20 about 3 .4 weight % , about 3 .2 weight % , about 3 .0 weight glycosylation pattern in the composition is : 0 . 02 weight % % , about 2 . 8 weight % , about 2 .6 weight % , about 2 . 4 to about 3 . 0 weight % , about 2 . 8 weight % , about 2 .6 weight weight % , about 2 . 2 weight % , about 2 .0 weight % , about % , about 2 .4 weight % , about 2 .2 weight % , about 2 .0 1 .8 weight % , about 1. 6 weight % , about 1 . 4 weight % , weight % , about 1 . 8 weight % , about 1 . 6 weight % , about about 1 . 2 weight % , about 1 .0 weight % , about 0 . 8 weight 1 . 4 weight % , about 1 .2 weight % , about 1. 0 weight % , 25 % , about 0 . 6 weight % , about 0 . 4 weight % , or about 0 . 2 about 0 . 8 weight % , about 0 .6 weight % , about 0 . 4 weight weight % ; about 0 . 2 weight % to about 4 . 0 weight % , about % , about 0 . 2 weight % , or about 0 . 1 weight % ; about 0 . 1 3 . 8 weight % , about 3 . 6 weight % , about 3 . 4 weight % , weight % to about 3 . 0 weight % , about 2 . 8 weight % , about about 3 . 2 weight % , about 3 . 0 weight % , about 2 . 8 weight 2 .6 weight % , about 2 . 4 weight % , about 2 . 2 weight % , % , about 2 . 6 weight % , about 2 . 4 weight % , about 2 . 2 about 2 .0 weight % , about 1 . 8 weight % , about 1. 6 weight 30 weight % , about 2 . 0 weight % , about 1 . 8 weight % , about % , about 1 . 4 weight % , about 1 . 2 weight % , about 1 . 0 1 .6 weight % , about 1 . 4 weight % , about 1 . 2 weight % , weight % , about 0 . 8 weight % , about 0 .6 weight % , about about 1 . 0 weight % , about 0 . 8 weight % , about 0 .6 weight 0 . 4 weight % , or about 0 . 2 weight % ; about 0 . 2 weight % to % , or about 0 . 4 weight % ; about 0 . 4 weight % to about 4 . 0 about 3 . 0 weight % , about 2 . 8 weight % , about 2 .6 weight weight % , about 3 . 8 weight % , about 3 .6 weight % , about % , about 2 .4 weight % , about 2 .2 weight % , about 2. 0 35 3. 4 weight % , about 3 .2 weight % , about 3. 0 weight % , weight % , about 1 . 8 weight % , about 1 . 6 weight % , about about 2 . 8 weight % , about 2 . 6 weight % , about 2 . 4 weight 1 . 4 weight % , about 1 . 2 weight % , about 1 . 0 weight % , % , about 2 . 2 weight % , about 2 . 0 weight % , about 1 . 8 about 0 . 8 weight % , about 0 .6 weight % , or about 0 . 4 weight weight % , about 1 .6 weight % , about 1 . 4 weight % , about % ; about 0 . 8 weight % to about 3 . 0 weight % , about 2 . 8 1 . 2 weight % , about 1 . 0 weight % , about 0 . 8 weight % , or weight % , about 2 . 6 weight % , about 2 . 4 weight % , about 40 about 0 .6 weight % ; about 0 .6 weight % to about 4 .0 weight 2 . 2 weight % , about 2 .0 weight % , about 1 . 8 weight % , % , about 3 . 8 weight % , about 3 . 6 weight % , about 3 . 4 about 1 . 6 weight % , about 1 .4 weight % , about 1 . 2 weight weight % , about 3 . 2 weight % , about 3 . 0 weight % , about % , or about 1. 0 weight % ; about 1. 0 weight % to about 3 .0 2 .8 weight % , about 2. 6 weight % , about 2 .4 weight % , weight % , about 2 . 8 weight % , about 2 .6 weight % , about about 2 . 2 weight % , about 2 . 0 weight % , about 1 . 8 weight 2 .4 weight % , about 2 .2 weight % , about 2 . 0 weight % , 45 % , about 1 .6 weight % , about 1. 4 weight % , about 1. 2 about 1 . 8 weight % , about 1 . 6 weight % , about 1 . 4 weight weight % , about 1 . 0 weight % , or about 0 . 8 weight % ; about % , or about 1 . 2 weight % ; about 1 . 2 weight % to about 3 . 0 0 . 8 weight % to about 4 . 0 weight % , about 3 . 8 weight % , weight % , about 2 . 8 weight % , about 2 . 6 weight % , about about 3 .6 weight % , about 3 . 4 weight % , about 3 . 2 weight 2 .4 weight % , about 2 .2 weight % , about 2 .0 weight % % , about 3 .0 weight % , about 2 . 8 weight % , about 2 .6 about 1 . 8 weight % , about 1 .6 weight % , or about 1 . 4 weight 50 weight % , about 2 . 4 weight % , about 2 . 2 weight % , about % ; about 1 . 4 weight % to about 3 . 0 weight % , about 2 . 8 2 . 0 weight % , about 1 . 8 weight % , about 1 . 6 weight % , weight % , about 2 . 6 weight % , about 2 . 4 weight % , about about 1 . 4 weight % , about 1 . 2 weight % , or about 1 .0 weight 2 .2 weight % , about 2 .0 weight % , about 1. 8 weight % , or % ; about 1. 0 weight % to about 4 . 0 weight % , about 3. 8 about 1 . 6 weight % ; about 1 .6 weight % to about 3 . 0 weight weight % , about 3 . 6 weight % , about 3 . 4 weight % , about % , about 2 . 8 weight % , about 2 .6 weight % , about 2 . 4 55 3 . 2 weight % , about 3 . 0 weight % , about 2 . 8 weight % , weight % , about 2 . 2 weight % , about 2 . 0 weight % , or about about 2 . 6 weight % , about 2 . 4 weight % , about 2 . 2 weight 1 . 8 weight % ; about 1 . 8 weight % to about 3 . 0 weight % , % , about 2 . 0 weight % , about 1 . 8 weight % , about 1 . 6 about 2 . 8 weight % , about 2 . 6 weight % , about 2 . 4 weight weight % , about 1 . 4 weight % , or about 1 . 2 weight % ; about % , about 2 .2 weight % , or about 2 . 0 weight % ; about 2 . 0 1 . 2 weight % to about 4 . 0 weight % , about 3 . 8 weight % , weight % to about 3 . 0 weight % , about 2 . 8 weight % , about 60 about 3 .6 weight % , about 3 .4 weight % , about 3 . 2 weight 2 . 6 weight % , about 2 . 4 weight % , or about 2 . 2 weight % ; % , about 3 . 0 weight % , about 2 . 8 weight % , about 2 .6 about 2 . 2 weight % to about 3 . 0 weight % , about 2 . 8 weight weight % , about 2 . 4 weight % , about 2 . 2 weight % , about % , about 2 .6 weight % , or about 2 . 4 weight % ; about 2 . 4 2 .0 weight % , about 1 . 8 weight % , about 1 .6 weight % , or weight % to about 3 . 0 weight % , about 2 . 8 weight % , or about 1 . 4 weight % ; about 1 . 4 weight % to about 4 . 0 weight about 2 . 6 weight % ; about 2 .6 weight % to about 3 . 0 weight 65 % , about 3 . 8 weight % , about 3 . 6 weight % , about 3 . 4 % or about 2 . 8 weight % ; or about 2 . 8 weight % to about 3 . 0 weight % , about 3 . 2 weight % , about 3 . 0 weight % , about weight % ( of the final composition ) . 2 .8 weight % , about 2 .6 weight % , about 2 . 4 weight % , US 9 , 924 , 728 B2 43 44 about 2 . 2 weight % , about 2 . 0 weight % , about 1 . 8 weight 2 . 4 weight % , about 2 . 2 weight % , about 2 . 0 weight % , % , or about 1. 6 weight % ; about 1 . 6 weight % to about 4 . 0 about 1 . 8 weight % , about 1 . 6 weight % , about 1 . 4 weight weight % , about 3 . 8 weight % , about 3 . 6 weight % , about % , or about 1 . 2 weight % ; about 1 . 2 weight % to about 3 . 0 3 .4 weight % , about 3 . 2 weight % , about 3 . 0 weight % , weight % , about 2 .8 weight % , about 2 .6 weight % , about about 2 . 8 weight % , about 2 .6 weight % , about 2 . 4 weight 5 2 . 4 weight % , about 2 . 2 weight % , about 2 . 0 weight % , % , about 2 . 2 weight % , about 2 . 0 weight % , or about 1 . 8 about 1 . 8 weight % , about 1 . 6 weight % , or about 1 . 4 weight weight % ; about 1 . 8 weight % to about 4 . 0 weight % , about 3 .8 weight % , about 3 .6 weight % , about 3. 4 weight % , % ; about 1 . 4 weight % to about 3 . 0 weight % , about 2 . 8 about 3. 2 weight % , about 3 .0 weight % , about 2 .8 weight weight % , about 2 .6 weight % , about 2. 4 weight % , about % , about 2 .6 weight % , about 2 .4 weight % , about 2. 2 10 2 .2 weight % , about 2 .0 weight % , about 1 . 8 weight % , or weight % , or about 2 . 0 weight % ; about 1 . 8 weight % to about 1 .6 weight % ; about 1 . 6 weight % to about 3 . 0 weight about 4 . 0 weight % , about 3 . 8 weight % , about 3 . 6 weight % , about 2 . 8 weight % , about 2 . 6 weight % , about 2 .4 % , about 3 .4 weight % , about 3. 2 weight % , about 3 .0 weight % , about 2 . 2 weight % , about 2 . 0 weight % , or about weight % , about 2 . 8 weight % , about 2 .6 weight % , about 1 . 8 weight % ; about 1 . 8 weight % to about 3 . 0 weight % , 2 .4 weight % , about 2 .2 weight % , or about 2 . 0 weight % ; 15 about 2 . 8 weight % , about 2 .6 weight % , about 2 . 4 weight about 2 . 0 weight % to about 4 . 0 weight % , about 3 . 8 weight % , about 2 . 2 weight % , or about 2 . 0 weight % ; about 2 . 0 % , about 3 . 6 weight % , about 3 . 4 weight % , about 3 . 2 weight % to about 3 . 0 weight % , about 2 . 8 weight % , about weight % , about 3 . 0 weight % , about 2 . 8 weight % , about 2 .6 weight % , about 2 .4 weight % , or about 2 . 2 weight % ; 2 .6 weight % , about 2 . 4 weight % , or about 2 . 2 weight % ; about 2 . 2 weight % to about 3 . 0 weight % , about 2 . 8 weight about 2 .2 weight % to about 4 . 0 weight % , about 3. 8 weight 20 % , about 2 .6 weight % , or about 2 . 4 weight % ; about 2 . 4 % , about 3 .6 weight % , about 3. 4 weight % , about 3 .2 weight % to about 3 . 0 weight % , about 2 .8 weight % , or weight % , about 3 . 0 weight % , about 2 . 8 weight % , about about 2 .6 weight % ; about 2 .6 weight % to about 3 . 0 weight 2 . 6 weight % , or about 2 .4 weight % ; about 2 . 4 weight % to % or about 2 . 8 weight % ; or about 2 . 8 weight % to about 3 .0 about 4 . 0 weight % , about 3 . 8 weight % , about 3 . 6 weight weight % ( of the final composition ) . % , about 3 .4 weight % , about 3 . 2 weight % , about 3 . 0 25 Nucleic Acids and Vectors weight % , about 2 . 8 weight % , or about 2 . 6 weight % ; about Also provided are nucleic acids ( e . g . , vectors ) that 2 .6 weight % to about 4 . 0 weight % , about 3 . 8 weight % , include : a promoter ( e . g . , a yeast , bacterial, or a mammalian about 3 . 6 weight % , about 3 . 4 weight % , about 3 . 2 weight promoter ) ; a sequence encoding a signal sequence ; a % , about 3 . 0 weight % , or about 2 . 8 weight % ; about 2 . 8 sequence encoding a milk protein ( e . g . , any of the exemplary weight % to about 4 . 0 weight % , about 3 . 8 weight % , about 30 sequences described herein ) ; and a yeast termination 3 .6 weight % , about 3 . 4 weight % , about 3 . 2 weight % , or sequence , where the promoter is operably linked to the about 3 .0 weight % ; about 3 .0 weight % to about 4 .0 weight signal sequence , the signal sequence is operably linked to % , about 3 . 8 weight % , about 3 .6 weight % , about 3 . 4 the sequence encoding the milk protein , and the terminal weight % , or about 3 . 2 weight % ; about 3 . 2 weight % to sequence is operably linked to the sequence encoding the about 4 . 0 weight % , about 3 . 8 weight % , about 3 . 6 weight 35 milk protein . In some examples of these nucleic acids , the % , or about 3 . 4 weight % ; about 3 . 4 weight % to about 4 . 0 promoter is a constitutive promoter or an inducible pro weight % , about 3 . 8 weight % , or about 3 .6 weight % ; about moter. Non - limiting examples of promoters are described 3 .6 weight % to about 4 .0 weight % or about 3 . 8 weight % ; herein . Additional promoters that can be used in these or about 3 . 8 weight % to about 4 . 0 weight % . nucleic acids are known in the art. In some examples , the final concentration of micelles 40 The signal sequence in any of the vectors described herein including a K -casein protein that is unglycosylated or has an can be a signal sequence from the encoded milk protein or non -mammalian glycosylation pattern and a ß - casein pro - a differentmilk protein , or is a signal sequence from a yeast tein that is unglycosylated or has an non -mammalian gly - mating factor ( e . g . , any alpha mating factor ) . In some cosylation pattern in the composition is : 0 .02 weight % to examples, the encoded milk protein is selected from the about 3 . 0 weight % , about 2 . 8 weight % , about 2 .6 weight 45 group of: ß - casein ( e . g . , any of the B -casein proteins % , about 2 .4 weight % , about 2 . 2 weight % , about 2 . 0 described herein ), K - casein ( e . g . , any of the K - casein pro weight % , about 1 . 8 weight % , about 1 . 6 weight % , about teins described herein ) , a - S1- casein ( e . g . , any of the a -Si 1 . 4 weight % , about 1 . 2 weight % , about 1 . 0 weight % , casein proteins described herein ) , a - S2 - casein ( e . g ., any of about 0 . 8 weight % , about 0 . 6 weight % , about 0 . 4 weight the a - S2 - casein proteins described herein ) , a - lactalbumin % , about 0 . 2 weight % , or about 0 . 1 weight % ; about 0 . 1 50 ( e . g ., any of the a - lactalbumin proteins described herein ) , weight % to about 3 .0 weight % , about 2 .8 weight % , about B - lactoglobulin ( e. g ., any of the B - lactoglobulin proteins 2 .6 weight % , about 2 . 4 weight % , about 2 . 2 weight % , described herein ) , lactoferrin ( e . g ., any of the lactoferrin about 2 .0 weight % , about 1 .8 weight % , about 1 .6 weight proteins described herein ), or transferrin (e .g . , any of the % , about 1 . 4 weight % , about 1 . 2 weight % , about 1 . 0 transferrin proteins described herein ) . Additional signal weight % , about 0 . 8 weight % , about 0 . 6 weight % , about 55 sequences that can be used in the present vectors are known 0 . 4 weight % , or about 0 . 2 weight % ; about 0 . 2 weight % to in the art. about 3 . 0 weight % , about 2 . 8 weight % , about 2 . 6 weight Any of the nucleic acids described herein can further % , about 2 . 4 weight % , about 2 . 2 weight % , about 2 . 0 include a bacterial origin of replication . Any of the nucleic weight % , about 1. 8 weight % , about 1 .6 weight % , about acids described herein can further include a selection marker 1 . 4 weight % , about 1 .2 weight % , about 1. 0 weight % , 60 ( e . g ., an antibiotic resistance gene ). The sequences of bac about 0 . 8 weight % , about 0 . 6 weight % , or about 0 .4 weight terial origin of replication are known in the art. Non - limiting % ; about 0 . 8 weight % to about 3 . 0 weight % , about 2 .8 examples of antibiotic resistance genes are described herein . weight % , about 2 . 6 weight % , about 2 .4 weight % , about Additional examples of resistance genes are known in the 2 . 2 weight % , about 2 .0 weight % , about 1 . 8 weight % , art . about 1 . 6 weight % , about 1 . 4 weight % , about 1 . 2 weight 65 Non - limiting examples of termination sequences are % , or about 1 . 0 weight % ; about 1 . 0 weight % to about 3 . 0 described herein . Additional examples of termination weight % , about 2 .8 weight % , about 2 .6 weight % , about sequences are known in the art . US 9 ,924 ,728 B2 45 46 Some embodiments of the nucleic acids provided herein Host Cells further include : an additional promoter sequence ( e . g . , any Also provided herein a host cells including any of the of the exemplary promoters described herein ); an additional nucleic acids ( e .g ., vectors ) described herein . In some sequence encoding a signal sequence ( e . g . , any of the examples , the nucleic acid described herein is stably inte exemplary signal sequences described herein ) ; a sequence 5 grated within the genome (e .g ., a chromosome) of the host encoding an additional milk protein ( e . g . , any of the exem cell. In other examples , the nucleic acid described herein is not stably integrated within the genome of the host cell . plary sequences encoding a milk protein described herein ) ; In some embodiments , the host cell is a yeast strain or a and an additional yeast termination sequence ( e . g . any of the bacterial strain . In some embodiments , the host cell can be , exemplary yeast termination sequences described hereinb ) , 10 e . g ., a yeast strain selected from the group of : a Kluyvero where the additional promoter sequence is operably linked myces sp ., Pichia sp . , Saccharomyces sp . , Tetrahymena sp . , to the additional sequence encoding a signal sequence, the Yarrowia sp . , Hansenula sp . , Blastobotrys sp . , Candida sp ., sequence encoding the signal sequence is operably linked to Zygosaccharomyces sp . , and Debaryomyces sp . Additional the sequence encoding the additional milk protein , and the non - limiting examples of yeast strains that can be used as the sequence encoding the additionaltional milikmilk protein is operablyoperably 15 host cell are Kluyveromyces lactis , Kluyveromyces marxi linked to the additional yeast terminal sequence . The addi anus, Saccharomyces cerevisiae , and Pichia pastoris . Addi tional milk protein can be, e . g. , ß -casein ( e. g ., any of the tional species of yeast strains that can be used as host cells B -casein proteins described herein ), K -casein ( e . g ., any of are known in the art . the K - casein proteins described herein ) , a -S1 - casein ( e . g . In some examples, the host cell can be a protozoa , such as , any of the a - S1 -casein proteins described herein ), a -S2 - 20 e . g . , Tetrahymena thermophile , T . hegewischi, T. hyperan casein (e .g ., any of the a -S2 -casein proteins described gularis , T. malaccensis , T. pigmentosa , T pyriformis , and T. herein ) , a - lactalbumin ( e . g . , any of the a - lactalbumin pro vorax . teins described herein ), B -lactoglobulin ( e . g ., any of the It is an object of the invention to isolate milk protein B -lactoglobulin proteins described herein ) , lactoferrin ( e . g ., components by recombinantly expressing them in any of the any of the lactoferrin proteins described herein ) , or trans - 25 host cells provided herein . ferrin ( e . g ., any of the transferrin proteins described herein ). Methods of Producing a Recombinant Milk Protein and In some embodiments , the nucleic acid includes a sequence Methods of Making a Micelle encoding a ß - casein and a sequence encoding a K -casein . Also provided are methods of producing a recombinant milk protein ( e . g . , one or more of any of the milk proteins The promoter and the additional promoter can be the sameIdi 30 described herein ) that is unglycosylated or has a non or different. The yeast termination sequence and the addi mammalian glycosylation pattern that include : culturing any tional yeast terminal sequence can be the same or different. of the host cells described herein in a culture medium under The signal sequence and the additional signal sequence can conditions sufficient to allow for secretion of the milk be the same or different. protein that is unglycosylated or has a non -mammalian The present invention also encompasses a vector contain - 3526 glycosylation pattern ; and harvesting the milk protein that is ing the isolated DNA sequence encoding casein or whey unglycosylated or has a non -mammalian glycosylation pat polypeptide and host cells comprising the vector . The vector tern from the culture medium . Suitable culture medium for may further comprise an isolated DNA sequence comprising use in these methods are known in the art . Culture conditions a nucleotide sequence encoding a casein , wherein the sufficient to allow for secretion of a milk protein are also nucleotide sequence is operably linked to a promoter, a 40 known in the art . The host cells used in these methods can nucleotide sequence encoding an alpha mating factor, or a be any of the host cells described herein . The host cells can variant thereof, a nucleotide sequence encoding a bacterial include any of the nucleic acids described herein . The resistance marker and a transcription terminator. One or recombinant milk protein produced can be one or more of: more of suitable promoters are utilized for expression of the B - casein ( e . g ., any of the B - casein proteins described genes encoding casein or whey proteins may be any pro - 45 herein ) , K -casein ( e . g . , any of the K - casein proteins moter which is functional in the host cell and is able to elicit described herein ), a - S1 - casein ( e . g . , any of the a - S1 caseins expression of the product encoded by the gene. Suitable described herein ), a - S2 -casein ( e . g ., any of the a - S2 -caseins promoters include, for example , PLAC4 - PBI, T7, Ptac , Pgal, described herein ), a - lactalbumin ( e. g. , any of the a - lactal PL , NPR , bla , spa , Adh , CYC , TDH3, ADH1 and CLB1. bumin proteins described herein ), B - lactoglobulin ( e . g . , any Introducing Nucleic Acids into a Cell 50 of the B -lactoglobulin proteins described herein ) , lactoferrin Methods of introducing nucleic acids ( e . g . , any of the (e . g ., any of the lactoferrin proteins described herein ) , nucleic acids described herein ) into a cell to generate a host transferrin ( e . g. , any of the transferrin proteins described cell are well - known in the art. Non - limiting examples of herein ) , and serum albumin ( e . g . , any of the serum albumin techniques that can be used to introduce a nucleic acid into proteins described herein ) . Some of these methods further a cell include : calcium phosphate transfection , dendrimer 55 include isolating ( e . g . , purifying ) the recombinant milk transfection , liposome transfection ( e . g . , cationic liposome protein from the culture medium . Methods of isolating ( e . g . , transfection ) , cationic polymer transfection , electroporation , purifying ) a recombinant milk protein from a liquid are cell squeezing, sonoporation , optical transfection , protoplast well -known in the art . Exemplary methods for isolating fusion , impalefection , hyrodynamic delivery , gene gun , (e . g . , purifying ) recombinant milk proteins are described in magnetofection , and viral transduction . 60 Imafidon et al. , Crit. Rev. Food Sci. Nutrition 37 :663 -669 , One skilled in the art would be able to select one or more 1997 ). suitable techniques for introducing the nucleic acids into a Also provided are methods of producing a micelle includ cell based on the knowledge in the art that certain techniques ing a ß - casein ( e . g . , any of the ß - casein proteins described for introducing a nucleic acid into a cell work better for herein ) that is unglycosylated or has a non -mammalian different types of host cells. Exemplary methods for intro - 65 glycosylation pattern and a K - casein ( e . g . , any of the K -ca ducing a nucleic acid into a yeast cell are described in Kawai sein proteins described herein ) that is unglycosylated or has et al. , Bioeng. Bugs 1: 395 -403 , 2010 . a non -mammalian glycosylation pattern , that include: cul US 9 ,924 ,728 B2 47 48 turing any of the host cells described herein in a culture can differ in terms of its phosphate groups and sugar groups . medium under conditions sufficient to allow for release of Other methods for protein purification include membrane the micelle from the host cell, where the host cell comprises filtration to remove any potential bacteria or contaminants , nucleic acid including a sequence that encodes a ß - casein followed by lyophilization for protein isolation . and a sequence that encodes a K - casein ; and harvesting the 5 Preferably , the methods and compositions provide for a micelle from the culture medium . Suitable culture medium production cost that is competitive at or below $ 1 , 000 /kg , for use in these methods are known in the art . The host cells $ 500 /kg , $ 10 /kg , $ 1. 0 /kg , $ 0 . 10 /kg , $ 0 .010 /kg or $ 0 .0010 / used in these methods can be any of the host cells described kg of milk protein component. In more preferred embodi herein . The host cells can include any of the nucleic acids m ents , the cost is below $ 0 .009 , $ 0 . 007 , $ 0 .006 , $ 0 .005 /kg described herein . The micelles produced can be any of the 10 of milk protein component. micelles described herein (and can have any of the physical Methods of Supplementing a Mammal- Produced Milk characteristics of micelles described herein ) . Some of these Also provided herein are methods of supplementing a methods further include isolating ( e . g ., purifying the mammal- produced milk that include providing a mamma micelle from the culture medium . Methods of isolating ( e . g ., lian -produced milk or a processed mammalian -produced purifying ) a micelle from a liquid are well -known in the art 15 milk ; and mixing into the milk at least one of: a ß -casein ( e . g . , ultracentrifigation ). protein ( e . g . , any of the B -casein proteins described herein ) Exemplary details of culturing yeast host cells are that is unglycosylated or has a non -mammalian glycosy described in Idiris et al ., Appl. Microbiol. Biotechnol. lation pattern ; a K - casein protein ( e . g . , any of the K - casein 86 :403 -417 , 2010 ; Zhang et al ., Biotechnol. Bioprocess. proteins described herein ) that is unglycosylated or has a Eng. 5 : 275 - 287 , 2000 ; Zhu , Biotechnol. Adv. 30 : 1158 - 1170 , 20 non -mammalian glycosylation pattern ; and a micelle ( e . g . , 2012 ; Li et al ., MAbs 2 :466 -477 , 2010 . any of the micelles described herein ) comprising a ß - casein It is an object of the invention to express one or more protein ( e . g ., any of the ß -casein proteins described herein ) differentforms of casein for application into various types of that is unglycosylated or has a non -mammalian glycosy dairy substitute products . Casein subunits such as a -sl - lation pattern , and a K - casein protein ( e . g . , any of the casein casein , a - s2 - casein , ß - casein and K - casein differ by one or 25 proteins described herein ) that is unglycosylated or has a more amino acid changes. In certain embodiments , the non -mammalian glycosylation pattern . methods and compositions comprise incorporation of bovine One or more of the B - casein protein , the K -casein protein , casein such as a -sl - casein , a - s2 - casein , ß - casein and K - ca - and the micelles can be mixed into the milk to achieve any sein . In other embodiments , the methods and compositions of the exemplary final concentrations of the ß -casein protein , comprise incorporation of human casein such as B - casein 30 the K - casein protein , and the micelles in a composition and K - casein . See U . S . Pat. No . 5 , 942 ,274 . In alternative described in the section called “ Supplemented Milk Com embodiments , casein is selected from one or more following positions " herein . Methods of mixing are well known in the sources including but not limited to : bovine , human , buffalo , art . As one of skill in the art can appreciate , additional camel, goat , sheep , horse , dolphin , whale , mountain goat components described herein can also be mixed into the and pig . 35 milk ( e . g ., any component described herein without limita Also provided are methods for producing the milk protein tion ). components that can include , e . g . , using a plasmid or Methods of Making a Composition construct of the invention as described in Example 1 . This Also provided are methods of producing a composition method comprises preparing the plasmid of interest, insert that include : sonicating a liquid including a protein mixture ing the plasmid into an appropriate host cell , culturing the 40 comprising ß - casein protein ( e . g ., any of the B - casein pro host cell for a suitable time and under suitable conditions teins described herein ) and casein k protein ( e . g . , any of the such that the protein of interest is expressed , and then K - casein proteins described herein ) , or including micelles purifying the protein . comprising B -casein protein ( e . g ., any of the B - casein pro Proteins can be separated on the basis of their molecular teins described herein ) and K -casein protein ( e . g . , any of the weight , for example , by size exclusion chromatography, 45 K - casein proteins described herein ) ; mixing ash ( e . g ., any of ultrafiltration through membranes, or density centrifugation . the ash described herein ) into the liquid , adding to the liquid In some embodiments , the proteins can be separated based a mixture of one or more lipids ( e . g . , any of the one or more on their surface charge , for example , by isoelectric precipi- liquids described herein ) , one or more flavor compounds tation , anion exchange chromatography, or cation exchange ( e . g ., any of the one or more flavor compounds described chromatography. Proteins also can be separated on the basis 50 herein ) , and one or more color balancing agents ( e . g . , any of of their solubility , for example , by ammonium sulfate pre - the one or more color balancing agents described herein ) , cipitation , isoelectric precipitation , surfactants , detergents or and sonicating the liquid ; and adding to the liquid one or solvent extraction . Proteins also can be separated by their more sweetening agents ( e . g . , one or more of any of the affinity to another molecule , using , for example , hydropho sweetening agents described herein ), thereby producing the bic interaction chromatography, reactive dyes , or hydroxy - 55 composition . apatite . Affinity chromatography also can include using In some examples of these methods, the ß - casein protein antibodies having specific binding affinity for the protein , is unglycosylated or has a non -mammalian glycosylation nickel NTA for His - tagged recombinant proteins , lectins to pattern , and /or the K -casein protein is unglycosylated or has bind to sugar moieties on a glycoprotein , or other molecules a non -mammalian glycosylation pattern . In some examples which specifically binds the protein . 60 of these methods , the ash includes one or more of : calcium , Generally , centrifugation at an optimum pH yields puri- phosphorus, potassium , sodium , citrate , and chloride. In fication efficiency > 95 % . Isoelectric point for the native some examples of any of these methods, the ash added caseins and whey proteins are known . In nature, the pH is includes one or more (e . g. , two or three ) of CaCl2 , KH2PO4, 4 .91 for bovine a -sl - casein , pH 4 . 1 for bovine a -s2 - casein , and Naz citrate . pH 4 . 5 for bovine ß - casein , pH 4 . 1 for bovine K - casein , pH 65 In some examples of these methods, the one or more 4 . 2 for bovine a - lactalbumin , and pH 5 . 2 for bovine B - lac - lipids comprises at least one ( e . g ., two , three , four, five, six , toglobulin . The recombinantly produced casein and whey or seven ) of: sunflower oil, coconut oil , tributyrin , mono US 9 ,924 ,728 B2 49 and di - glycerides , free fatty acids, and phospholipids . In Methods for making butter, cheese, caseinate , or yogurt some examples of these methods, the free fatty acids com - are well -known in the art. See , e . g ., Scott , Cheesemaking prise at least one fatty acid selected from the group of: Practice, Kluwer Academic /Plenum Publishers, New York , butyric acid , caproic acid , caprylic acid , and capric acid . In N . Y ., 1998 ; U . S . Pat . No. 4 ,360 ,535 (which describes meth some examples of these methods , the phospholipids are soy 5 ods of making creams) ; U . S . Pat. No. 285 , 878 (which lecithin phospholipids, sunflower lecithin phospholipids, described methods of making butter) ; cotton lecithin phospholipids, or rapeseed lecithin phospho Kits lipids . In some embodiments of these methods , the flavor compounds include at least one ( e . g ., two, three , four, five , Also provided are kits that include: (a ) a mixture of one or six ) flavor compound selected from the group of: d - de - 10 or more milk proteins ( e . g . , any of the milk proteins calactone, ethyl butyrate , 2 - furyl methyl ketone , 2 , 3 - pen described herein , including any one or more of the B - casein tanedione , y -undecalactone , and d - undecalactone . proteins , K -casein proteins , a -S1 -proteins , a - S2 -proteins , In some examples of these methods, the one or more a -lactalbumin proteins, B - lactoglobulin proteins, lactoferrin coloring balancing agent is ß - carotene or annatto . In some proteins , transferrin proteins , and serum albumin proteins embodiments of these methods , the one or more sweetening 15 described herein ), one or more lipids (e . g . , any of one or agents is a saccharide ( e . g ., glucose, mannose , maltose , more of the lipids described herein ) , and one or flavor fructose, galactose, lactose , sucrose , monatin , or tagatose ) or compounds ( e . g . , any one or more of the flavor compounds an artificial sweetener ( e . g ., stevia , aspartame, cyclamate , described herein ) ; and (b ) a mixture of ash (e . g ., any of the saccharin , sucralose , mogrosides , brazzein , curculin , eryth ash described herein ) and at least one sweetening agent (e .g ., ritol, glycyrrhizin , inulin , isomalt, lacititol, mabinlin , mali - 20 any one or more of the sweetening agents described herein ) . titol, mannitol, miraculin , monatin , monelin , osladin , pen - In some examples of these kits , the one or more milk tadin , sorbitol, thaumatin , xylitol , acesulfame potassium , proteins are cow , human , sheep , goat, buffalo , camel, horse , advantame, alitame, aspartame - acesulfame, sodium cycla - donkey , lemur, panda , guinea pig , squirrel, bear , macaque , mate , dulcin , glucin , neohesperidin dihyrdochalcone, gorilla , chimpanzee, mountain goat, monkey, ape , cat, dog , neotame, or P - 4000 ) . 25 wallaby , rat, mouse , elephant, opossum , rabbit, whale , The pH of the resulting composition can be between about baboons , gibbons, orangutan , mandrill , pig , wolf, fox , lion , pH 6 . 2 and about pH 7 .4 ( e. g . , about 6 . 2 to about 7 . 2 ; about tiger, echidna , or woolly mammoth milk proteins. 6 . 2 to about 7 .0 , about 6 . 2 to about 6 . 8 , about 6 . 2 to about In some examples of these kits , the one or more fats are 6 . 6 , about 6 . 2 to about 6 . 4 , about 6 . 4 to about 7 . 2 , about 6 . 4 selected from the group of: sunflower oil, coconut oil, to about 7 .0 , about 6 .4 to about 6 .8 , about 6 .4 to about 6 .6 , 30 tributyrin , mono - and di- glycerides , free fatty acids, and about 6 . 6 to about 7 . 2 , about 6 . 6 to about 7 . 0 , about 6 . 6 to phospholipids . The fatty acids present in the kit can include about 6 . 8 , about 6 . 8 to about 7 . 2 , about 6 . 8 to about 7 . 0 , or at least one fatty acid selected from the group of: butyric about 7 . 0 to about 7 . 2 ) . acid , caproic acid , caprylic acid , and capric acid . The In any of these methods, the ß - casein protein can be a phospholipids in the kit can be soy lecithin phospholipids , cow , human , sheep , goat , buffalo , camel, horse , donkey , 35 sunflower lecithin phospholipids , cotton lecithin phospho lemur, panda , guinea pig , squirrel , bear , macaque, gorilla , lipids, or rapeseed lecithin phospholipids. chimpanzee , mountain goat, monkey , ape , cat, dog, wallaby, The flavor compounds in the kit can include at least one rat, mouse , elephant , opossum , rabbit, whale , baboons, flavor compound selected from the group of: 8 - decalactone , gibbons, orangutan , mandrill , pig , wolf, fox , lion , tiger, ethyl butyrate , 2 - furyl methyl ketone , 2 , 3 -pentanedione , echidna , or woolly mammoth B - casein protein ; and / or the 40 y - undecalactone, and d - undecalactone . K -casein protein can be a cow , human , sheep , goat, buffalo , In some embodiments of the kit , the mixture in ( a ) further camel, horse , donkey , lemur, panda, guinea pig , squirrel , includes one or more color balancing agent ( e . g . , any of the bear, macaque , gorilla , chimpanzee , mountain goat, monkey, color balancing agents described herein , e . g . , ß - carotene or ape , cat , dog , wallaby, rat ,mouse , elephant, opossum , rabbit, annatto ). whale , baboons, gibbons , orangutan , mandrill, pig , wolf , 45 In some examples of the kits, the one or more sweetening fox , lion , tiger, echidna , or woolly mammoth K - casein agents is a saccharide ( e . g . , glucose , mannose , maltose , protein . fructose , galactose , lactose , sucrose , monatin , or tagatose ) or In some embodiments of these methods , the protein an artificial sweetener ( e . g . , stevia , aspartame , cyclamate , mixture further comprises one or more proteins selected saccharin , sucralose , mogrosides , brazzein , curculin , eryth from the group of : a - lactalbumin ( e . g . , any of the a - lactal - 50 ritol, glycyrrhizin , inulin , isomalt , lacititol, mabinlin , mali bumin proteins described herein ), ß - lactoglobulin ( e . g . , any titol, mannitol, miraculin , monatin , monelin , osladin , pen of the B - lactoglobulin proteins described herein ) , a -S1 - tadin , sorbitol, thaumatin , xylitol, acesulfame potassium , casein ( e . g . , any of the a - S1 -casein proteins described advantame, alitame, aspartame- acesulfame, sodium cycla herein ) , a - S2 - casein ( e . g ., any of the a - S2 -casein proteins mate , dulcin , glucin , neohesperidin dihyrdochalcone , described herein ) , lactoferrin ( e . g . , any of the lactoferrin 55 neotame, or P -4000 ) . proteins described herein ) , transferrin ( e . g . , any of the The kits can include an ash including one or more of: transferrin proteins described herein ) , and serum albumin calcium , phosphorus , potassium , sodium , citrate, and chlo ( e . g . , any of the serum albumin proteins described herein ) . ride . In some examples , the ash in the kit includes one or As one of skill in the art can appreciate , the amount of more ( e . g ., two or three ) of CaCl2 , KH ,PO4 , and Naz citrate . each component used in these methods can be calculated in 60 In some embodiments of the kits , the mixture in ( a ) is order to produce any of the compositions described herein . provided in a light - sealed and airtight package ( e . g . , a metal Methods of Making Butter, Cheese , Caseinate , or Yogurt foil, e. g ., an aluminum foil ), and /or the mixture in (b ) is Also provided herein are methods of making butter , provided in an airtight package ( e . g . , a sealed plastic bag ) . cheese , caseinate , or yogurt that include providing any of the Some examples of the kits further include instructions for compositions provided herein ; and producing the butter , 65 making any of the compositions described herein . cheese , caseinate , or yogurt using any of the composition Also provided herein are kits including at least one provided herein as a starting material. nucleic acid described herein . US 9 , 924 , 728 B2 51 Modulating Flavor Profiles In certain aspects, the methods and compositions of the Sensory impressions such as “ feed ,” “ barny, " or dairy substitute products are essentially free of one or more " unclean ,” are described as flavor descriptions that are serum proteins. Serum proteins typically comprise , among absorbed from the food ingested by the cow and from the other proteins , enzymes, hormones , growth factors, nutrient odours in its surroundings . Others develop through micro - 5 transporters and disease resistance factors . In additional embodiments , the methods and compositions of the dairy bial action due to growth of bacteria in large numbers . substitute products are essentially free of one or more Chemical changes can also take place through enzyme immunoglobulins, which may induce an undesirable action , contact with metals (such as copper ), or exposure to immune response . sunlight or strong fluorescent light. Quality - control directors 10 In some embodiments , whey compositions can comprise are constantly striving to avoid off - flavors in milk and other about 0 . 001 % , about 0 .05 % , about 0 . 1 % , about 0 . 5 % , about dairy foods. It is , therefore , an object of the invention to 1 % , about 1 . 5 % , about 2 % , about 2 . 5 % , about 3 % , about reduce , eliminate or even mask the undesirable flavors and 3 . 5 % , about 4 % whey protein by dry weight or totalweight . odor of various dairy products . In some embodiments , the compositions can comprise about In certain preferred aspects of the present invention , 15 0 . 1 - 1 % , about 1 - 2 % , about 2 - 3 % , or about 0 . 1 - 2 . 3 % protein varying the fat content can alter the flavors and odor of various dairy substitute products . For example , increasing compositions can comprise about 10 - 15 % protein by dry the butyric acid content can change a flavor profile of a weight or total weight . non -dairy cheese to a flavor profile similar to parmesan In various embodiments , carbohydrates are incorporated cheese . In other embodiments , modulating the triglycerides 20 into the dairy substitute products . These carbohydrates pro such caproic , capric , and /or caprylic acid results in a flavor v ide a bland sweetness to the flavor profile of the product profile similar to goat cheese . Accordingly , modulating the and additionally serve as a fast -acting energy and nutrition triglycerides with the ratios of fatty acid components pro - source . Carbohydrates include but are not limited to sugars vides different flavor profiles that can be fine - tuned to such as galactose , sucrose , glucose , fructose and maltose . resemble those of various desirable dairy - food products . 25 Dairy - free sources of sugars include but are not limited to Similarly , the methods and compositions provide for sugar beet and other plants such as celery , basil , honey , minimizing one or more undesirable aromas by modulating cherries , corn , spinach , plums, kiwis and peas . various triglycerides incorporated into the dairy substitute Lactose intolerance is common for many milk consumers . products . Accordingly , in preferred embodiments , carbohydrates such In certain aspects flavor profile is modulated by incorpo - 30 as lactose are omitted from the dairy substitute composition . rating synthetic short -chain triglycerides combined with In preferred embodiments , methods and compositions of the plant- based oils e . g . , sunflower oil , in desired combinations. dairy substitute composition essentially free of lactose . For example a mixture of [C18 C18 C6 ] and [C18 C6 C18 ] In some embodiments , the carbohydrate compositions can provides a different flavor profile than a mixture of [C18 C4 comprise about 1 % , about 1. 5 % , about 2 % , about 2 . 5 % , C4 ] and [ C18 C10 C10 ] . 35 about 3 % , about 3 . 5 % , about 4 % , about 4 . 5 % , about 5 % Dairy Substitute Products carbohydrate by dry weight or total weight. In some embodi A wide variety of dairy substitute products can be made ments , the compositions can comprise about 1 - 3 % , about using the methods and compositions of the present inven - 2 - 4 % , or about 10 - 30 % carbohydrate by dry weight or total tion . Such products include without limitation , milk , whole weight. In particular embodiments , the compositions can milk , buttermilk , skim milk , infant formula , condensed milk , 40 comprise about 2 -5 % carbohydrate by dry weight or total dried milk , evaporated milk , butter, clarified butter, cream weight. and various types of cheese . Ash attributes to the structure and stability of casein The dairy substitute products can also be incorporated micelles. Ash is important for holding the emulsion that is into various food applications as a replacement for dairy milk or cream together. The calcium and phosphate present products , which include the following ice cream , frozen 45 in the ash interact with the fat globules and the casein custard , frozen yogurt , cookies, cakes, cottage cheese , cream micelles to maintain an emulsified mixture . cheese , crème fraiche , curds and yogurt . The ash also affects the sensory characteristics such as In certain aspects , the present invention provides one or mouthfeel, consistency , and to a certain extent, the flavor of more subunits of casein selected from a - sl - casein , a - s2 - the milk . casein , ß - casein and K - casein for the milk protein compo - 50 In some embodiments , the ash compositions can comprise nent in a dairy substitute product. A select combination of about 0 . 1 % , about 0 . 2 % , about 0 . 3 % , about 0 . 4 % , about casein subunits are used as the primary or at least a part of 0 .5 % , about 0 .6 % , about 0 .7 % , about 0 . 8 % , about 0 . 9 % , the milk protein component. In preferred embodiments , the about 1 % , about 2 % or about 3 % ash by dry weight or total casein composition comprises the following amounts of weight. In some embodiments , the compositions can com casein subunits such that about 12 - 15 g / L a - sl - casein , about 55 prise about 0 . 1 - 0 . 3 % , about 0 . 5 - 0 .7 % , about 0 . 7 - 1 % , or 3 - 4 g / L a - s2 -casein , about 9 - 11 g / L B - casein and about 2 - 4 about 1 - 2 % ash by dry weight or total weight. In particular g / L K - casein represent the total casein in a synthetic milk embodiments , the compositions can comprise about 0 .6 product . 0 . 8 % protein by dry weight or total weight. In various embodiments , the casein compositions can Additional ingredients for various animal- free dairy prod comprise about 0 . 5 % about 1 % , about 1 . 5 % , about 2 % , 60 ucts include vitamins, flavoring agents , natural or artificial about 2 . 5 % , about 3 % , about 3 . 5 % , about 4 % , about 4 . 5 % , sweeteners , coloring agents , salt, pH adjustment agents , about 5 % , about 6 % , protein by dry weight or total weight. binders, buffers , stabilizers, essential amino acids , anti In some embodiments , the casein compositions can com - caking agents , anti - foaming agents , and mixtures thereof . prise about 0 . 5 - 2 . 5 % , about 1 - 2 % , about 2 - 3 % , or about In some embodiments , the remaining ingredient compo 4 - 10 % casein protein by dry weight or total weight. In 65 sitions can comprise about 0 % , about 0 .01 % , about 0 . 1 % , particular embodiments , the casein compositions can com - about 0 . 5 % , about 1 % , about 2 % , about 3 % , about 4 % or prise about 1 . 5 - 10 % protein by dry weight or total weight. about 5 % additives by dry weight or total weight. In some US 9 , 924 , 728 B2 53 54 embodiments , the compositions can comprise about 0 .001 - present formulation incorporates all four subunits of bovine 0 .01 % , about 0 .01 - 1 % , about 0 .01 - 2 % , or about 1 - 5 % casein : a - sl - casein , a - s2 - casein , ß - casein and K - casein and additives by dry weight or total weight. In particular two whey proteins a - lactalbumin and ß - lactoglobulin as the embodiments , the compositions can comprise about 0 - 10 % predominant milk protein components in the formulation . additives by dry weight or total weight . 5 The exemplary synthetic milk formulation further comprises In some aspects , the present invention provides methods plant -based interesterified fats as shown in FIG . 1 . Addi and compositions for dairy substitutes with fat comprising tional components include carbohydrates and ash . The varying levels of triglyceride content. In preferred embodi - resulting milk substitute exhibits characteristics that looks , ments , isolated triglycerides from various plant sources are functions , tastes, smells , and feels like natural milk . As one incorporated with milk protein components , carbohydrates 10 of key facets of the present invention , modifying the for and ash . It is an object of the present invention to modulate mulations for synthetic milk can exhibit different sensory the fatty acids isolated in plants and transesterified in a dairy impressions such as flavoring by modulating the oil content, substitute to resemble the percentage of fatty acids found in namely the types of triglycerides added to mimic milk of natural dairy products , and /or to develop novel flavor pro - different flavors . files with improved flavor not found in nature . In some 15 As described in Young W . Park , Bioactive Components in embodiments, modulating specific short -to -medium chain Milk and Dairy Products , Technology & Engineering, pp 60 , fatty acids including but not limited to s butyric , capric , 2009 , sterols are a minor fraction of total lipids in milk , the caprylic , caproic and lauric acids provides the desired flavor main sterol being cholesterol ( 300 mg/ 100 g fat, equivalent profile in a dairy substitute . to 10 mg/ 100 mL bovine milk ) ( Park et al. , Small Rumin . In some embodiments , the fat compositions in synthetic 20 Res . 68 : 88 - 113 , 2007 ) . Goat milk has been shown to contain milk comprises about 0 % , about 1 % , about 2 % , about 3 % , less cholesterol than other milk but generally contains higher about 3. 5 % , about 4 % fat by dry weight or total weight. In total fat than cow milk . See, Posati et al. , 1976 . Composition some embodiments , the compositions can comprise about of Foods. Agric . Handbook No. 8 - 1 . ARS , USDA , Wash 1 - 2 % , about 2 - 3 % , about 3 - 4 % fat by dry weight or total ington , D . C ., 1976 ; Jenness, J . Dairy Sci. 63 : 1605 - 1630 , weight. In particular embodiments, the compositions can 25 1980 ; and Juarez et al. , Intl. Dairy Fed . Bull . No . 202 . pp . comprise about 3 - 4 % fat by dry weight or total weight. In 54 -67 , 1986 , have shown that goat milk has greater palmitic alternative embodiments , fat compositions in cream can and oleic acid fractions than cows. Cholesterol content was comprise about 10 % , about 20 % , about 30 % , about 40 % , significantly varied among different breeds and most cho about 50 % or even 60 % . Preferably , fat compositions in lesterol in goat milk was in free state , with only a small cream is typically about 40 to about 50 % . 30 fraction in ester form 52 mg/ 100 g fat. See , e . g . , Arora et al. , In some aspects , the short- chain triglycerides are com - Ind. J . Dairy Sci. 29 : 191 . bined with longer chain oil to produce transesterified fatty In certain embodiments , the methods and composition of acid esters . Preferably , the longer chain oils are selected the present invention provide synthetic milk product that has from : sunflower, corn , olive , soy, peanut, walnut, almond , less cholesterol, or is cholesterol free or has the same sesame, cottonseed , canola , safflower , flax seed , palm , palm 35 cholesterol content in comparison to the dairy milk by kernel, palm fruit , coconut, babassu , shea butter, mango modulating the oil content, namely the types of triglycerides . butter , cocoa butter, wheat germ and rice bran oil. More In other embodiments , the amount of saturated and unsatu preferably , the longer chain oils comprise engineered sun - rated fats is also modulated in dairy substitutes to at least flower varieties , which overexpress oleic acid by 400 % . less or the same amount of fats in comparison to the dairy Longer chain oil can also provide to the flavor profile , for 40 milk . In preferred embodiments the synthetic milk product example , reduce or even remove sharpness and mellow out of the present invention is very low in saturated fat but the overall flavor profile of the desired end product . smells and tastes like dairy milk . The long chain fatty acids, In some embodiments , the fat component of the dairy which are typically saturated fatty acids in milk , are instead substitute comprises select triglycerides that are transesteri - monounsaturated acids such as oleic acid , in the preferred fied into longer chain oil such as high - oleic sunflower oil 45 embodiments of the invention . ( Example 2 ) . It is contemplated that the same four short The present invention may not require or at least mini chain fatty acids give milk and derivative products such as mizes pasteurization , as each component can be rendered cheese their particular flavors such as robustness and rich sterile separately , before combining through the formulation ness. Various combinations of triglycerides and longer chain process . In other embodiments of the invention , synthetic oils are incorporated to create a number of different flavor 50 milk product of the present invention can undergo pasteuri profiles. In one embodiment, triglyceride with three oleic zation . acids and synthetic short - chain triglyceride with , in this Homogenization is optional for the methods and compo case , one butyric , one hexanoic , and one octanoic acid , sitions of the present invention as is the case for natural milk . yields a desired synthetic “ milk fat ” triglyceride . Additional When sold as a standalone liquid beverage , the synthetic embodiments include incorporating various short- chain tri- 55 milk product of the present invention can be sold in homog glycerides to tune slightly different flavor profiles, for e nized form . instance , short - chain triglyceride comprising hexanoic acid ; Differences between the milk substitute of the present short- chain triglyceride comprising hexanoic acid and invention with dairy milk include flavor, nutritional value butyric acid ; short - chain triglyceride comprising hexanoic and storage stability . Flavorings can be adjusted to a desired acid and decanoic acid . Accordingly , methods and compo - 60 sensory impression based on triglycerides as well as other sitions provide for various combinations of synthetic short- natural or artificial flavors that can impart in blandness or chain triglycerides with the sunflower oil triglycerides sharpness or a different aroma such as cow , goat, coconut, resulting in different flavor profiles. almond or soy . Synthetic Milk Synthetic Cheese An exemplary embodiment of synthetic milk formulation 65 In other aspects of the present invention , methods and comprising microbially derived proteins of the present compositions comprising one or more isolated milk protein invention is illustrated in Example 4 . For example , the components , fats , carbohydrates and ash are provided to US 9 ,924 ,728 B2 55 56 produce various types of cheese products . Generally , the weeks and preferably longer) for production and distribu cheese is made from the milk protein components of the tion . Even more preferably , the dairy substitute products has present invention . One or more sensory impressions are a lower environmental impact . incorporated into the cheese product through modulating the Several aspects of the invention are described below with triglycerides . Accordingly , cheese with desired organoleptic 5 reference to example applications for illustration . It should be understood that numerous specific details , relationships, characteristics with distinct appearance , aroma, taste and and methods are set forth to provide a full understanding of texture can be produced . For some cheese varieties , in the invention . One having ordinary skill in the relevant art , addition to modulating the triglycerides , one or more bac however , will readily recognize that the invention can be teria is employed in the cheese making process for fermen 10 practiced without one or more of the specific details or with tation where fermentative products and by -products such as other methods. lactic acid , carbon dioxide, alcohols , aldehydes and ketones are produced . Types of cheese include whey cheese such as EXAMPLES ricotta and mozzarella , semi- soft cheese include Havarti and Munster, medium -hard cheese such as Swiss and Jarlsberg , 1 Example 1 hard cheese such as Cheddar and soft ripened cheese such as 15 Brie and Camembert . Vectors Synthetic Cream Protein sequences bovine a - S1 casein (UniProt accession Directly usable cream substitutes should preferably com - # P02662 ), bovine a -2 casein (UniProt accession # P02663) , prise from about 50 to 90 % by weight water , and more bovine ß - casein (UniProt accession # P02666 ) , bovine K -ca preferably from about 65 to 80 % by weight water, with the 20 sein (UniProt accession # P02668 ) , bovine a - lactalbumin base being dispersed within the water. The base for a (UniProt accession # B6V315 ) and bovine B - lactoglobulin substitute cream should advantageously contain ( all percent - (UniProt accession # P02754 ) were obtained on Uniprot .org ages computed using the total weight of the base taken as and altered with the following changes: removed 15 or 100 % ) from about 22 to 87 % by weight carbohydrate (more 21 - residue signal peptide from N -terminal end ; added Xhol preferably from about 30 to 64 % ), from about 12 to 70 % by 25 (CTC GAG ) endonuclease recognition sequence and KEX weight of particulate fat (most preferably from about 28 to endopeptidase recognition sequence (AAA AGA) to 5 ' end 60 % ) , and from about 0 . 4 to 8 % by weight of a selected of DNA ; and added Sall (GTC GAC ) endonuclease recog emulsifier or group thereof (most preferably from about 1 to nition sequence to 3 ' end of DNA . An additional combina 4 % ) . tion sequence was made by combining the sequences for the In preferred embodiments , the products of the invention 30 four caseins in the order shown above , separating each are stable in aqueous emulsion . As used herein , a dried , sequence with the following DNA phrase : liquid fat- containing non - dairy food product is said to be " stable” when the following minimum criteria are met : reconstituted emulsion stability , whitening capability , oiling ( SEQ ID NO : 128 ) or oil separation , feathering - precipitation . See U . S . Pat . No . 35| GGCG TCA GGA TCA GGG TCG AAA AGA GGC TCA GGA TCA 4 , 310 , 561. Synthetic Butter GGG TCG Commercial butter is 80 - 82 % milk fat , 16 - 17 % water, and Here the non - underlined segments encode a (GS ) , linker 1 - 2 % milk solids other than fat (sometimes referred to as sequence for adequate posttranslational spacing and acces curd ) . sibility to the KEX protease , and the underlined segment Advantages of Dairy Substitute Products or the Composi - 40 encodes the KEX endopeptidase sequence which cleaves the tions Provided Herein proteins apart post - translation . As above , the entire cassette Desirable advantages of the present invention are envi is flanked on the 5 ' end by Xhol and on the 3 ' end by Sali ronmental in nature such as 8 times more energy efficient, for ligation into pKLAC2 (New England Biolabs , Beverly , 260 times more water efficient than conventional milk Mass. ) . DNA was synthesized by either Gen9, Inc . (Cam product . Other environmental advantages include less water 45 bridge , Mass . ) or IDT (Coralville , Iowa ) . The plasmid used usage than conventionalmilk production , which is estimated had , among other things , a multiple cloning site , a Lac to be about 1000 L / L and reduced land usage for conven - promoter, an Acetamide based reporter gene and the alpha tional milk production typically requires grazing , crop land , mating factor gene , used as a fusion protein for secretion of ability to reduce the 600 billion kg of carbon dioxide per exogenous proteins . year that is emitted from conventional milk production . The 50 Yeast Transfection present invention also provides reduction or elimination of Transfection of the yeast was accomplished by thawing a costs of feed , operations , labor, animal and marketing . tube of 0 .5 mL competent cells containing 25 % glycerol on Preferably , substantially reduce feed cost by a factor of 8 . ice and adding 0 .62 mL yeast transfection reagent. The Advantages in food safety include reduction or removal of mixture was then warmed at 30° C . for 30 minutes, heat antibiotic residues, heavy metals , bacteria , adulterations. ss shocked at 37° C . for 1 hour. The cells were then pelleted at Accordingly , certain aspects of the present invention provide 7000 rpm & washed twice with 1 . 0 mL of YPGal medium . animal- free milk that is bacteria - free , requires no pasteuri The cell mixture was then transferred to a sterile culture tube zation or cold shipping yet has an increased shelf - life and and incubated at 30° C . for 3 hours , with constant shaking exhibit a number of characteristics such as taste , appearance , at 300 rpm . The cell mixture was then transferred to a sterile handling and mouth feel properties which are identical or at 1 . 5 mL microcentrifuge tube and pelleted the cells at 7000 least closely similar to their traditional dairy counterparts. 60 rpm for 2 minutes, and resuspended in 1 mL sterile 1xPBS . Preferably , the dairy substitute products are essentially free 10 , 50 and 100 uL of the cell suspension was placed into ofbacteria such as Brucella , Camplyobacter, Listeria , Myco - separate fresh sterile 1 . 5 mL microcentrifuge tubes each bacterium , Salmonella , Shigella , Yersinia , Giardia and containing 50 uL of sterile deionized water. Tubes were noroviruses , and , thus are safer for consumption . Further mixed briefly and spread onto separate yeast carbon base advantage include minimal or no pasteurization and /or 65 agar ( YCB Agar ) plates containing 5 mM acetamide for homogenization . More preferably, the dairy substitute is selection . Plates were then incubated , inverted , at 30° C . for shelf stable for relatively long periods ( e . g . , at least three 4 days until colonies form . 15 individual colonies were then US 9 , 924 , 728 B2 57 58 streaked onto fresh YCB Agar plates containing 5 mM out when secreted from the yeast and come into contact with acetamide and incubated at 30° C . for 2 days . water . Purification from the reactor media involves collec DNA encoding alpha - lactalbumin and beta - lactoglobulin , tion of the protein from the surface of the media , followed two key whey proteins, was designed in -house and ordered by drying to isolate pure protein . Kappa - casein is inherently for synthesis from IDT and was transfected into competent 5 hydrophilic and purification of the K -caseins involves the K . lactis cells from the New England Biolabs kit ( Catalog # E1000S ) according to the vendor - supplied protocol. change in pH of the solution to 4 .6 , followed by centrifu High - Throughput Transfectant Selection gation at 10 ,000 rcf. Combined casein cassette works the From each YCB Agar plate , once the colonies had grown same way as K - casein . sufficiently , each of the 30 plates was tested for successful 10 Whey Protein Purification integration of the vector plasmid . This was followed by PCR Alpha - lactalbumin : The isoelectric point of alpha - lactal analysis of each plate to test for special cells with multiple bumin is 4 . 2 . When the pH of the bioreactor media solution integrants of the vector. Once isolated , the highest producing is lowered to 4 . 2 , the solubility of the protein is at its lowest . individual culture was used for scale up . This process can be This knocks the protein out of solution and allows for iterated with successively higher concentrations of selective 15 collection by centrifugation . Beta -lactoglobulin : Similar to pressure in order to force colonies to develop higher copy the purification of the alpha -lactalbumin , the pH of the numbers of our engineered plasmid . solution is lowered to 5. 2 the isoelectric point of beta Five transfection events were performed and plated on 5 lactoglobulin . This neutralizes the charge of the protein and separate plates consisting of nitrogen - free yeast carbon base allows its collection by centrifugation at 14 ,000 rcf. medium . ( Any observed growth on these plates therefore 20 Protein Purification implied successful uptake of the plasmid , if not uptake of the The 2 L of culture media was spun at 3 , 000 g in a floor exogenous DNA itself ). Of these 5 plates, 100 % showed centrifuge to pellet out the yeast cells . The pellet was positive growth . 30 individual colonies from the 5 plates discarded , and the supernatant was transferred into a new were chosen for scale -up , and each was grown in a separate vessel & the pH of the solution was lowered to 4 . 2 for the YCB agar plate to create a homozygous culture plate to 25 alpha - lactalbumin and 5 . 2 for the beta - lactoglobulin ( FIG . allow for easy characterization and management. After a 3 2A ). This was followed by incubation of the supernatant at day growth period , a single colony from each plate was 35° C . for 30 mins in a shaker flask , centrifugation at 14 ,000 initially added to a 10 ml glass culture tube, containing 2 ml g in a floor centrifuge to pellet out the protein mixture (FIG . YPGal media , to test for protein expression . After a growth 2B ). period of two days , the cells were pelleted out and the 30 Protein Characterization supernatant was run on an SDS PAGE gel to check for After separation of the protein by centrifugation , the solid protein expression . The strains which provided the best pellet and the supernatant solution were run on a 14 % protein expression were scaled up to a 10 ml, 100 ml, 500 SDA - PAGE gel to check for protein expression . A positive ml, and ultimately 1 L culture vessel . From each whey band was observed at 14 kDa and at 18 kDa ( FIG . 3 ) , which protein , two liters of culture were grown . Approximately one 35 correlates to the size of alpha - lactalbumin and beta - lacto gram of protein was harvested from the total, suggesting a globulin of bovine origin , respectively . Further character non - optimized yield /productivity of 0 . 5 g /L . ization is done to confirm equivalence in terms of primary Scale - Up in 1 L Shake Flask Culture sequence , glycosylation and phosphorylation . Cultures are scaled up and seeded in a 1 L shake flask at split ratios of at least 1: 10 . Prior to seeding , inoculation 40 Example 2 flasks are grown for 24 hours in production media without Triglyceride Synthesis acetamide supplementation . On the starting day of a fed batch production run , the reactor is charged with 90 % of the Milk fat triglycerides were made by transesterifying target starting volume and heated to the run temperature . For short -chain triglycerides into high oleic sunflower oil , the oil now , the temperature is set at 30° C . in order to save on 45 from a custom engineered variant of sunflowers which energy costs associated with heating the reactor. Additional express the following ratios of fatty acid esters as described parameters can be explored in the process optimization in Table 1 : phase . When the reactor reaches 30° C . , the inoculation flask is added to the reaction vessel dropwise using a peristaltic TABLE 1 pump . The reactor is maintained using vendor supplied 50 Fatty NuSun Mid - Oleic High - Oleic software at a target pH . Twice daily samples are taken of the Acids Sunflower Sunflower ): Sunflower reactor broth in order to quantify the amount of glucose and C8 : 0 ND ND ND electrolyte usage by the cells , and as a doublecheck for the C8: 0 ND ND ND reactor ' s pH and dissolved gas measurements. After each C10 : 0 ND ND ND measurement, bolus glucose is added to maintain a target 55 C12 : 0 ND -0 . 1 ND ND C14 : 0 ND - 0 . 2 0 . 4 - 0 . 8 ND - 0 . 1 glucose concentration 10 % to start, although this may also C16 : 0 2 . 0 - 7 . 6 4 . 0 - 5 . 5 2 . 6 - 5 . 0 be altered in process development. When cells reach maxi C16 : 1 ND - 0 . 3 ND - 0 . 06 ND - 0 . 1 mum density , protein production is triggered by the addition C17 :0 ND - 0 . 2 ND - 0 . 06 ND - 0 . 1 of galactose , which triggers the promoter on our PKLAC2 C17 : 1 ND - 0 . 1 ND - 0 .06 ND - 0 . 1 C18 : 0 1 . 0 - 6 . 5 2 . 1 - 5 . 0 2 . 9 - 6 . 2 plasmid . Galactose is supplemented until the end of the run . 60 C18 : 1 14 - 29 . 4 43. 1 - 71 . 8 75 - 90 . 7 Optimum run length can be determined in process develop C18 : 2 46 . 3 - 74 . 0 18 . 7 -45 . 3 2 . 1 - 17 . 0 ment as well , but is set as a 5 - day fedbatch . After a full run , C18 : 3 ND - 0 . 3 ND - 0 . 1 ND - 0 . 3 yeast cells are removed from the reactor and the proteins are C20 : 0 0 . 1 - 0 . 5 0 . 2 - 0 . 4 0 . 2 - 0 . 5 C20 : 1 ND - 0 . 3 0 . 2 - 0 . 3 0 . 1 - 0 . 5 purified as discussed below . C20 : 2 ND ND ND Casein Protein Purification 65 C22 : 0 0 . 3 - 1 . 5 0 .6 - 1 . 1 0 . 5 - 1 . 6 The following casein proteins a -slcasein , a -s2casein , C22 : 1 ND - 0 . 3 ND ND - 0 . 3 and ß - casein are inherently hydrophobic , which precipitate US 9 , 924 ,728 B2 59 60 TABLE 1 - continued www .ncbi . nlm . nih . gov /pmc / articles /PMC2596709 / pdf/ FNR -52 - 1821 .pdf Fatty NuSun Mid - Oleic High - Oleic Acids Sunflower Sunfloweri Sunflowert TABLE 3 C22 : 2 ND - 0 . 3 ND -0 .09 ND 5 C24 : 0 ND - 0 . 5 0 . 3 - 0 . 4 ND - 0 . 5 Chain Mass Fraction in C24 : 1 ND ND ND Length Names Mixture ( % ) Butanoic /butyric acid 40 ND = not detectable (ND defined as < 0 .05 % ) Hexanoic /caproic acid 26 * From Codex Alimentarius ( 2001 ) Octanoic /caprylic acid From Table 3 10 Decanoic /capric acid 22

www .sunflowernsa . com / uploads/ resources /51 / warner _ .pdf The fractions in Table 3 are based upon the relative Short- Chain Triglyceride Preparation prevalence of these species in cow 's milk , but can be altered during process development both in order to design a better The short- chain fatty acids which are principally respon - 15 tasting product and in order to design milks of other species , sible for rich flavor in milk and cream are the molecules with such as buffalo or goat. Short- chain fatty acids in the mass even numbers of carbons between 4 and 10 , and are mixed ratios shown above are combined with toluene , paratoluene in the following ratios as described in Table 2 : sulfonic acid , and glycerol in a Dean - Stark water trap , commonly used for esterification reactions in order to TABLE 2 20 remove water produced in the condensation reaction . The reaction is carried out in a fume hood for several hours , until TABLE 1 . Fatty acid composition expressed as percent by weight of the level of water entering the water trap is observed as total fatty acids in Swedish dairy milk in 2001 , given as weighted unchanging for more than 30 minutes. The vessel is allowed means with standard deviations (SD ) and as the minimum and to cool and the mixture is removed from the reaction flask . maximum weighted means. The mixture is washed twice with a 5 % sodium carbonate Lowest Highest solution and five times with plain water . Brine ( a 10 % Fatty Weighted value value Seasonal solution of NaCl in water ) is added periodically in order to acid mean 2001 SD observed observed variation disrupt an emulsion which forms in the separating funnel . The washed mixture of short - chain triglycerides , water, 4 : 0 0 .1 4 . 0 5 .1 n . s . toluene , and impurities is dried in a rotary evaporator at 90° 6 : 0 0 . 1 2 . 1 2 . 9 n . s . 8 :0 0 . 1 1 .2 1. 9 n . s . 30 C . and under a 54 mbar atmosphere for one hour, until it has * proceeded well past excess in order to minimize the chance 10 : 0 NAN 2. 4 3 . 5 12 : 0 3. 0 4 . 1 * ** of food contamination . tytma * * * 14 : 0 10 . 9 ?????? 10 .0 12 . 1 Transesterification 15 : 0 0 . 9 0 . 8 1 . 1 n . s . The short - chain triglyceride mixture is combined with 16 : 0 30 . 6 28 . 7 34 . 1 * high - oleic sunflower oil at a volumetric ratio of 1: 8 . A mass 17 : 0 0 . 4 0 . 0 0 . 4 0 . 5 * 35 of sodium methoxide equal to 1 % of the oil mixture mass is 18 : 0 12 . 2 OOOOOOOO0 . 4 10 . 3 13 . 3 n . s. added in order to catalyze the transesterification , and the 20 : 0 0 . 2 0 .0 0 . 2 0 . 2 n . s . reaction vessel is heated to 65° C . , stirring continuously , Saturated 69. 4 1 . 7 67. 1 74 . 4 * * * under an inert Argon atmosphere, for six hours . A 5 % acetic fatty acids acid mixture is added to quench the reaction , then the oil is total 40 washed five times with deionized water and dried in a rotary 10 : 1 0 . 3 0 . 0 0 . 2 0 . 4 n . s . 14 : 1 0 . 8 0 .4 0 . 4 1 . 3 * * evaporator for one hour at > 90° C . The finished milk fat is 16 : 1 1 . 0 0 . 0 0 . 9 1 . 8 n . s . autoclaved to ensure sterility and is thence suitable for use 17 : 1 0 . 1 0 . 0 < 0 . 1 0 . 3 n . s . in milk or cream as described above . 18 : 1 22. . 8 1 .0 19 . 7 24 . 7 * * * 454 Example 3 Mono 25. 0 1 . 0 22222 .2 26 . 7 * ** unsaturated fatty acids, Milk Formulation cis , total One non -limiting milk composition formulation is 18 : 2 1 . 6 0 . 1 1 . 4 1 . 8 n . s . described below . 18 : 3 0 . 7 0 . 0 0 . 6 0 . 9 * * 50 Poly 2 . 3 0 . 1 2 . 0 2. 5 n . s . TABLE 4 unsaturated 333234a38a5| albulafatty acids, Components % ( w /v ) Range Amount ( g / L ) cis , total * * * Casein proteins 1 - 10 10 - 100 16 : 17 0 . 4 0 .. 1 00 .3 0 . 4 Whey proteins 18 : 17 2 . 1 0 . 7 2 .0 3 . 3 * * ** 55 0 - 1 0 - 10 18 : 21 0 . 2 0 . 1 0 . 5 Plant- based milk fats 0 - 8 0 - 80 ml/ L n . s . Sugar 0 - 5 0 - 50 Ash Trans fatty 2 .. 7 0. 7 0. 6 3. 9 * * * 0 . 1 - 1 1 - 10 acids total Calcium 0 . 1 - 0 . 5 1 - L CLA 0 . 4 0 . 1 0 .3 0 .5 * * * X (Functional 0 - 1 0 - 10 L - 60 additive ) n . s .: Not significant; * p < 0 .05 ; * * p < 0 .01 ; Following Table 4 , milk formulation is achieved through * * * p < 0 . 001. the following procedure , per 1 liter of milk . 26 grams of The estimation of the weighted mean values was based on the proportion of milk delivered to each dairy or dairy company at each sampling occasion ( seven dairies at four sampling occasions during 2001 ) . The lowest and highest values observed and p - values for 65 geographical and seasonal variation are also given . to 55° C . Protein mixture is poured slowly into triglycerides and vortexed at high speed for five minutes . In the mean US 9 ,924 ,728 B2 62 time, 3 . 5 gramsof whey and 24 grams of galactose are added TABLE 7 to 850 mL deionized water; mixture is heated to 37° C . Triglyceride/ protein /ash mixture is moved into Waring com Experiment Result mercial blender and blended at low speed . Whey / galactose CW -roux + Water + Calcium White liquid with normalmouth water mixture is poured slowly into blender ; cap placed on 5 phosphate (optimum amount of Ca feel. Zero protein precipitation . blender . Mixture is blended at high speed for ten minutes. was figured out by trial & error ) Average taste Deionized water is added to a final volume of 1000 mL .Milk can optionally be homogenized using existingmethods . The To improve taste , different sugars were added in different above protocol can be altered for cream or arbitrary milk concentrations to the above mixture . formulations by altering the ratios of solids; however , our preliminary research suggests that the presence of ash in the TABLE 8 protein mixture and the separation of a significant proportion Sugar 2 .4 % 3 . 0 % 3 .6 % 4 . 2 % 4 .8 % of the whey can greatly affect the quality of the emulsion . Glucose Good Too Sweet Too Sweet Too Sweet Too Sweet 5 Galactose Bland Excellent Average Excellent Too Sweet Example 4 Sucrose Bad Bad Bad Bad Bad Maltose Bland Excellent Excellent Too Sweet Too Sweet Synthetic Milk Formulation As a preliminary proof of concept, in order to determine whether the key components of milk could be recombined to All additional ions found in cow milk was incorporated to form milk , dry food - grade purified casein and research grade 20 recreate the ionic environment found in nature . whey was purchased . Irish cream was obtained from a local Reference : R . Rosmaninho , L . F . Melo / Journal of Food source and pure fat was isolated from it by centrifuging the Engineering 73 ( 2006 ) 379 - 387 cream at 14 , 000 g . Finally , all minerals used were purchased TABLE 9 from Sigma Aldrich . 25 Terms: Reagent Composition (mm ) C - roux = roux made by mixing casein proteins & fat KH PO4 11. 60 together while maintaining the temperature of the mixture at Kz Citrate H , 00 3 . 7 37° C . Naz Citrate 2H2O 6 . 1 W -roux - roux made by mixing whey proteins & fat 20 K2SO4 1 .03 together while maintaining the temperature of the mixture at 30 K2CO3 2 . 17 37° C . KCL 8 . 0 CW - roux = roux made by mixing casein & whey proteins CaCL2 . 2H20 8 . 98 together in a mixture first , adding fat and mixing at 37° C . End result was a liquid which was bright white in color, 35 likely because the ionic environment kept the solids present TABLE 5 in milk from joining together and increased the overall Experiment Result refractive index of the solution . Taste was excellent, but it had an average mouthfeel ( e .g ., a certain amount of chalki Casein + Fat + Water A pale yellow liquid with bad taste , precipitation of protein , and bad ness was observed in the liquid ) . Exact mineral composition mouthfeel (watery ) . 40 as described in Table 9 can provide excellent mouthfeel. Casein + Water + Fat A pale yellow liquid with bad taste , Milk Fat Synthesis precipitation of protein , and bad Synthetic milk fat was made by interesterifying short mouthfeel (watery ) . chain fatty acids among the large -chain fatty acids present in (Casein + Fat ) to make a roux . A pale yellow liquid with average taste roux + Water and bad mouthfeel (watery ) . Low high - oleic sunflower oil triglycerides . The four short - chains 45 used were : protein precipitation was observed . 40 % C4 : Butyric acid . found in milk , especially goat , sheep and buffalo milk , butter , Parmesan cheese , and as a Hypothesized that the bad mouthfeel ( e . g . , wateriness ) product of anaerobic fermentation ( including in the colon was due to the lack of whey protein . and as body odor ). It has an unpleasant smell and acrid taste , 50 with a sweetish aftertaste ( similar to ether ) . Butyric acid is TABLE 6 present in , and is the main distinctive smell of, human vomit . Experiment Result 26 % C6 : Caproic acid . a colorless oily liquid with an odor that is fatty , cheesy, waxy, and like that of goats or other Casein + Whey + Fat + Water Pale yellow -white liquid with bad barnyard animals . taste , precipitation of protein , and bad mouthfeel. 55 11 % C8 : Caprylic acid . It is an oily liquid that is mini C -roux + Whey + Water Pale yellow -white liquid with mally soluble in water with a slightly unpleasant rancid - like average taste, low precipitation of smell and taste . protein , and bad mouthfeel W - roux + Casein + Water Pale yellow -white liquid with 22 % C10 : Capric acid . Not much said about the flavor, average taste , low precipitation of and with longer carbon chains you start to get less flavors . protein , and bad mouthfeel . 60 This is in coconut oil so it is not a milk fat flavor per se as CW - roux + Water Pale yellow -white liquid with much as the other ones. average taste and bad mouthfeel. Iterations include lauric acid (C12 ) , as it is present at 2 . 9 % Zero protein precipitation . of total fatty acid content in cow ' s milk (Beare -Rogers , J . ; Dieffenbacher , A . ; Holm , J . V . ( 2001 ) . “ Lexicon of lipid Hypothesized that bad mouth feel was because of bad 65 nutrition ( IUPAC Technical Report ) ” . Pure and Applied casein micelle formation , that addition of Ca would allow Chemistry 73 ( 4 ) : 685 - 744 . doi: 10 . 1351/ the micelle to reform . pac200173040685 . ) US 9 ,924 ,728 B2 63 64 The following procedure as described Yu et al ., The as part of the fat composition in a mixture of synthetic milk modification an analysis of vegetable oil for cheese making . product. This array or combination of fat is expected to J. Am . Oil Chem . Soc. , 77 : 911 (2000 ) was followed in , at result in a synthetic milk fat providing its rich flavor as quarter of the amounts specified below : compared to natural dairy milk . The ability to control the A mixture of butyric , caproic , caprylic , and capric acids 5 composition of one or more triglycerides is likely to enhance ( Sigma Chemical Co . , St. Louis, Mo. ) at the same ratios or change flavor profiles of synthetic dairy products. found for a milk fat sample [ see above ] and totaling 7 . 26 Accordingly, a matrix of long -chain and short- chain can mol, 21. 42 g of p - toluenesulfonic acid ( Sigma Chemical yield in flavor profiles including , but not limited to , multiple Co . ) , 2 . 305 mol of glycerol ( Sigma Chemical Co . ) , and 458 aromatic compounds associated with buttery , nutty , sweet, mL of toluene (Fisher Scientific ) was refluxed with a Dean - sour, fruity , floral, bitter, woody, earthy , beany, spicy, metal Stark water trap for 6 h . The reaction was considered lic , sweet, musty , oily and vinegary sensory impressions . complete when no more water dripped into the trap . The AdditiAdditionally , increase in texture such as creaminess , SCTG were washed once with 5 % sodium carbonate solu improvements in melting characteristics or tolerance and tion and several times with water. Then , the SCTG were increase in stretching ability relative to a corresponding heated at 85° C . in a rotary evaporator to remove water and dairy product can be exhibited . toluene . SCTG from both commercial and natural sources are Example 6 . Recombinant Production of Milk interesterified with HOSO ( Trisun 80 , RBD ; AC Humko , Proteins Memphis , Tenn . ) at a SCTG / HOSO ratio of 1 : 8 . 82 in order to produce a fat that has the same percentage of SCFA as that Alpha- lactalbumin , B - lactoglobulin , a - S1- casein , a -S2 of milk fat. SCTG from the commercial source are also 20 casein , B - casein , and K - casein were produced in recombi interesterified at a SCTG /HOSO ratio of 1: 7 . 19 to produce nant yeast strain ( Pichia pastoris ) strains . As the glycosy a fat that has a level of SCFA equal to 120 % of that in milk lation enzymes in yeast are different than mammalian cells , fat. Sodium methoxide ( Aldrich Chemical Company , St. the proteins producted by the yeast will either be non Louis, Mo . ) is used as a catalyst at 0 . 5 % of total oil weight . glucosylated or have a non -mammalian glycosylation pat The reaction is carried out at 65° C . under nitrogen with 25 tern . The produced proteins can be used as a component in stirring for 6 h . Next, 5 % acetic acid ( Fisher Scientific ) is any of the compositions described herein . added to neutralize the catalyst , and the oil is then washed Plasmids several times with distilled water and dried on a rotary Plasmids were constructed for the expression of each evaporator for 30 min at 90° C . protein . Each plasmid included the following components : A pilot - scale continuous deodorizer similar to the one an inducible promoter ( e . g . , AOX1 promoter ) or a constui described by Smouse (Smouse , T . H ., A Laboratory Con - tive (GAP promoter or PGK promoter ) promoter , for each tinuous Deodorizer , inform 8 : 1176 - 1181 (1997 ). ) is used to protein being expressed ; a sequence encoding a signal deodorize the interesterified oils . The oil flow rate is 600 peptide for each protein being expressed , derived either from mL/ h , the column temperature is 180° C ., pressure at 0 . 5 the native bovine protein sequence or one from a yeast Torr , and the steam rate 12 .6 mL / h . Each batch of deodor - protein sequence ( alpha mating factor or OST1 ) ; a sequence ized oil is tasted by to ensure the flavor. The deodorized oil 35 encoding the milk protein ( s ) to be expressed ; a yeast tran is stored at 4° C . until used for cheese making . scription terminator sequence ( e . g . , AOX1, AOD , or CYC1) for each protein being expressed ; a bacterial origin of Example 5 replication from pUC19 to enable replication of the plasmid in E . coli; and a selectable marker cassette ( e . g . , kanR or Modulation of Fatty Acids 40 zeocinR ) to enable selection in bacteria and yeast with Sunflower oil triglycerides with three oleic acids are antibiotics. transesterified with four short chain fatty acids containing The different plasmids used to produce the different one butyric acid , one hexanoic acid , and one octanoic acid proteins are listed in Table 10 below . TABLE 10 Expression Plasmids (SEQ ID NO ) Signal Plasmid Select Prom 1 peptide Terminat Prom Signal ORF Term name marker ORF 1 1 2 pept 2 2 2 PJAG - Amp P AOX1 SP a TT AOX1 lalunat - LAA (bacteria ) , ( 153 ) lactalbumin lactalbumin ( 158 ) G418 ( 156 ) ( 157 ) (yeast ) ( 159 )

PJAG Ampicillin P AOX1 SP _ Mfa a TT AOX1 Mfa ( bacteria ) , ( 153 ) ( 154 ) lactalbumin ( 158 ) LAA G418 ( 157 ) ( yeast ) ( 159 ) PJAG Ampicillin P _ AOX1 SP _ OST a TT AOX1 OST ( bacteria ) , ( 153 ) ( 155 ) lactalbumin ( 158 ) LAA G418 ( 157 ) ( yeast ) ( 159 ) US 9 ,924 ,728 B2 65 TABLE 10 - continued Expression Plasmids ( SEQ ID NO ) Signal Plasmid Select Prom 1 peptide Terminat Prom Signal ORF Term name marker ORF 1 1 2 pept 2 2 2 pLH37 Zeocin PAOX1 SP Mfat B TT AOX1 ( 151 ) ( 129 ) ( 132 ) lactoglobulin ( 149) ( 143 ) pLHO044 Zeocin P GAP1 SP Mfat B TT AOX1 ( 151 ) ( 130 ) ( 132 ) lactoglobulin ( 149 ) ( 143 ) pLHO045 Zeocin P _ PGK1 SP _ MfalphaT ß TT AOX1 ( 151 ) ( 131 ) ( 132 ) lactoglobulin ( 149 ) ( 143 ) pLH46 Zeocin P _ GAP1 SP _ B _ B - casein TT CYC1 P PGK1 SP asi asi - TT ( 151 ) ( 130 ) casein ( 144 ) ( 150 ) ( 131 ) casein casein AOX1 ( 135 ) ( 137 ) ( 147 ) ( 149 ) PLH47 KanamycinKanamye P GAP1 SP _ a as2 TT CYC1 P PGK1 SPK KC - TT (bacteria ) , ( 130 ) S2 casein ( 150 ) ( 131 ) casein casein AOX1 G418 casein ( 145 ) ( 138 ) ( 148 ) ( 149 ) ( yeast ) ( 133 ) ( 152 ) PLH48 Zeocin P GAP1 SP OST B - casein TT CYC1 P PGK1 SP OSTaS1 - TT ( 151 ) ( 130 ) ( 134 ) ( 144 ) ( 150 ) ( 131 ) ( 134 ) casein AOX1 ( 147 ) ( 149 ) pLH49 Kanamycin P _ GAP1 SP _ OST as2 TT CYC1 P PGK1 SP OST la TT (bacteria ) , ( 130 ) ( 136 ) casein ( 150 ) ( 131 ) ( 134 ) casein AOX1 G418 ( 145 ) ( 148 ) ( 149 ) ( yeast ) lal ( 152 ) pLH50 Zeocin P GAP1 SP OST B - casein TT CYCi P PGK1 SP asiasi - TT ( 151 ) ( 130 ) ( 136 ) ( 144 ) ( 150 ) ( 131 ) casein casein AOX1 ( 137) ( 147 ) ( 149 ) PLH51 Zeocin P GAP1 SP B B - casein TT CYCi P PGK1 SP OST asi - TT ( 151 ) ( 130 ) casein ( 144 ) ( 150 ) ( 131 ) ( 134 ) casein AOX1 ( 135 ) a ( 147 ) ( 149 ) pLH52 Kanamycin P _ GAP1 SP _ as2 _ as2 TT CYC1 P PGK1 SPK K TT (bacteria ) , ( 130 ) casein casein ( 150 ) ( 131 ) casein casein AOX1 G418 ( 133 ) K113E ( 138 ) ( 148 ) ( 149 ) ( yeast ) ( 146 ) ( 152 ) pLH53 Kanamycin P _ GAP1 SP _ OST as2 TT CYC1 P PGK1 SP OST K TT (bacteria ) , ( 130 ) ( 136 ) casein ( 150 ) ( 131 ) ( 134 ) casein AOX1 G418 K113E ( 148 ) ( 149 ) (yeast ) ( 146 ) ( 152 ) PLH54 Kanamycin P GAP1 SP _ OST as2 TT _ CYC1 P _ PGK1 SP _ K _ K - TT (bacteria ) , ( 130 ) ( 136 ) casein ( 150 ) ( 131 ) casein casein AOX1 G418 ( 145 ) ( 138 ) ( 148 ) ( 149 ) (yeast ) ( 152 ) pLH55 Kanamycin P GAP1 SP as2 as2 - TT CYC1 P PGK1 SP OST1 K - TT (bacteria ) , ( 130 ) casein casein ( 150 ) ( 131 ) ( 134 ) casein AOX1 G418 ( 133 ) ( 145 ) ( 148 ) ( 149 ) ( yeast ) ( 152 ) SEQ ID NO : 159 ( Synthetic ) ATGGGTAAGGAAAAGACTCACGTTTCCAGACCAAGATTGAACTCTAACATGGACGCTGACTTGTACGGTTACAAGTGGGCTA GAGACAACGTTGGTCAATCTGGTGCTACTATTTACAGATTGTACGGTAAGCCAGACGCTCCAGAGTTGTTCTTGAAGCACGG TAAGGGTTCTGTTGCTAACGACGTTACTGACGAGATGGTTAGATTGAACTGGTTGACTGAGTTCATGCCATTGCCAACTATT AAGCACTTCATTAGAACTCCAGACGACGCTTGGTTGTTGACTACTGCTATTCCAGGTAAGACTGCTTTCCAAGTTTTGGAGG AGTACCCAGACTCTGGTGAGAACATTGTTGACGCTTTGGCTGTTTTTTTGAGAAGATTGCACTCTATTCCAGTTTGTAACTG TCCATTCAACTCTGACAGAGTTTTCAGATTGGCTCAAGCTCAATCCAGAATGAACAACGGTTTGGTTGACGCTTCTGACTTC GACGACGAGAGAAACGGTTGGCCAGTTGAGCAAGTTTGGAAGGAGATGCACAAGTTGTTGCCATTCTCTCCAGACTCTGTTG TTACTCACGGTGACTTCTCTTTGGACAACTTGATTTTCGACGAGGGTAAGTTGATTGGTTGTATTGACGTTGGTAGAGTTGG TATTGCTGACAGATACCAAGACTTGGCTATTTTGTGGAACTGTTTGGGTGAGTTCTCTCCATCTTTGCAAAAGAGATTGTTC CAAAAGTACGGTATTGACAACCCAGACATGAACAAGTTGCAATTCCACTTGATGTTGGACGAGTTCTTCTAA US 9 , 924 , 728 B2 68 These plasmids were then integrated into wildtype P . washes in TBS + Tween , a chromogenic substrate ( TMB pastoris for expression . The production of the proteins was Single Solution , Life Technologies ) was added , and the detected by SDS -PAGE , ELISA , and Western blot. absorbance at 650 nm was measured . The resulting data Alpha - Lactalbumin show that a -lactalbumin was secreted using the native Strain Construction 5 a - lactalbumin signal peptide or the OST1 signal peptide Three plasmids were created , placing the expression of (FIG . 5 ) . bovine alpha - lactalbumin (bVLAA ) under the control of the methanol- induced promoter Paoxi, with either the native To analyze samples via Western blot, one volume of LAA signal peptide (PJAG - nat- LAA ) , the full length alpha sample was combined with an equal volume of SDS -PAGE mating factor signal peptide (PJAG - AMF -LAA ) , or the 10 sample buffer and run on a 10 % polyacrylamide gel. The OST1 signal peptide (PJAG - OST -LAA ). proteins were transferred to a nitrocellulose membrane , Prior to transformation , 20 ug each plasmid was linear which was blocked by treating with 1 % BSA / TBS for 1 hr. ized by digestion with the restriction enzyme SacI. The After incubating for 1 . 5 hr with primary antibody diluted in digested plasmids were then concentrated by ethanol pre 1 % BSA / TBS + Tween , the blot was washed three times in cipitation , and resuspended in 10 ul distilled water . 15 TBS1B + Tween . The blot was then incubated with secondary Competent Pichia pastoris cells were prepared as follows: antibody conjugated with horseradish peroxidase (HRP ) for A culture of P . pastoris was grown to log phase an additional hour. After three final washes in TBS + Tween , (OD600 ~ 1 . 0 ) in YPD media ( 10 g / L yeast extract, 20 g / L a chromogenic substrate ( 1 -Step Ultra TMB Blotting Solu peptone , 20 g /L dextrose ) . A 1 . 5 mL aliquot was harvested tion , Thermo Fisher ) was added . After staining was com by centrifugation , then resuspended in 1 mL of a 1 : 1 mixture 20 pleted , the blot was washed in distilled water . of YPD + 20 mM HEPES (pH 8 ) : 1M lithium acetate . After Beta -Lactoglobulin adding 10 uL 1 M dithiothreitol, the cells were incubated for Strain Constructions 15 min at 30° C . in a shaker at 300 rpm . The cells were Three plasmids were assembled , placing the expression of pelleted by centrifugation and washed three times in 1 mL bovine beta - lactoglobulin (bvLGB ) under the control of ice cold 1 M sorbitol . After the final wash , the cells were 25 either a methanol- induced promoter (Pson in pLH37 ) or resuspendedre in 50 uL 1 M sorbitol. one of two constitutive promoters (PGap in pLH44 , or PPGK The cells were combined with the linearized plasmid in pLH45 ) . DNA in a chilled 2 mm electroporation cuvette , and sub Prior to transformation , 20 ug pLH37 was linearized by jected to a 1 . 5 kV pulse ( 25 uF, 2002) . The cells were digestion with the restriction enzyme Sach . The same transferred to a culture tube with 200 uL cold 1 : 1 YPD : 1 M 30 amounts of pLH44 and pLH45 were linearized with the sorbitol, and allowed to recover for 2 hours at 30° C . (300 enzyme ApaLI. The digested plasmids were then concen rpm ) . Finally , the cells were plated onto YPD agar plates trated by ethanol precipitation , and resuspended in 10 ul containing zeocin and grown for two days at 30° C . distilled water. Protein Expression Competent Pichia pastoris cells were prepared as follows: Colonies were picked from the agar plates and grown in 35 À culture of P . pastoris was grown to log phase 750 °L BMD1% (0 . 2M Potassium Phosphate buffer, 13 . 4 g /1 (OD600 - 1 .0 ) in YPD media ( 10 g / L yeast extract , 20 g / L Yeast Nitrogen Base, 0 . 4 mg/ ml biotin , 1 . 1 % glucose ) at 30° peptone, 20 g / L dextrose ). A 1 . 5 mL aliquot was harvested C . , 300 rpm . After 48 hours , 900 uL of culture was used to by centrifugation , then resuspended in 1 mL of a 1 : 1 mixture inoculate 750 ul BMM2 ( 0 . 2M Potassium Phosphate buffer, of YPD + 20 mM HEPES (pH 8 ) : 1M lithium acetate . After 13 . 4 g /l Yeast Nitrogen Base , 0 .4 mg/ml Biotin , 1 % metha - 40 adding 10 uL 1 M dithiothreitol, the cells were incubated for nol) . After 24 hours, 150 UL BMM10 (BMM10 : 0 . 2M 15 min at 30° C . in a shaker at 300 rpm . The cells were Potassium Phosphate buffer , 13 . 4 g /l Yeast Nitrogen Base , pelleted by centrifugation and washed three times in 1 mL 0 . 4 mg/ml Biotin , 5 % methanol) , and samples were har ice cold 1 M sorbitol. After the final wash , the cells were vested for analysis after one additional day. resuspended in 50 uL 1 M sorbitol. Analysis 45 The cells were combined with the linearized plasmid Protein expression was analyzed in samples of culture that DNA in a chilled 2 mm electroporation cuvette , and sub were centrifuged to remove the cell mass . The clarified jected to a 1 . 5 kV pulse ( 25 uF , 2009 ) . The cells were supernatant was then evaluated by SDS - PAGE , ELISA , and transferred to a culture tube with 200 uL cold 1 : 1 YPD : 1 M western blot. sorbitol, and allowed to recover for 2 hours at 30° C . (300 To visualize total protein via SDS- PAGE , cell - free super - 50 rpm ) . Finally , the cells were plated onto YPD agar plates natant was treated with SDS - PAGE sample buffer, boiled , containing zeocin and grown for two days at 30° C . and run on a 10 % polyacrylamide gel . The gel was stained Protein Expression with SYPRO Ruby stain ( Life Technologies ). The resulting To evaluate expression in clones transformed with the gel shows that secretion of a - lactalbumin occurs using the plasmid containing a methanol- inducible promoter OST1 or the native lactalbumin signal peptide ( FIG . 4 ) . 55 ( PLH37 ) , individual clones were grown in 750 UL BMD1 % To measure protein titers via ELISA , 25 uL of each ( 0 .2M Potassium Phosphate buffer , 13. 4 g /1 Yeast Nitrogen sample were placed in a half -area 96 well microtiter plate , Base , 0 .4 mg/ml biotin , 1 . 1 % glucose ) at 30° C . , 300 rpm . and allowed to bind overnight at 4° C . After removing the After 48 hours , 900 uL of culture was used to inoculate 750 samples , the binding surface was blocked by filling each ul BMM2 ( 0 .2M Potassium Phosphate buffer , 13 . 4 g / 1 Yeast well with 1 % ( w / v ) bovine serum albumin (BSA ) dissolved 60 Nitrogen Base , 0 . 4 mg/ ml Biotin , 1 % methanol) . After 24 in Tris Buffered Saline (50 mM Tris , pH 7 .6 , 150 mM NaCl) hours , 150 UL BMM10 (BMM10 :0 .2M Potassium Phos and incubating for 1 hour at room temperature . The samples phate buffer, 13 . 4 g/ 1 Yeast Nitrogen Base , 0 . 4 mg/ ml Biotin , were then incubated for 1 . 5 hr in primary antibody that was 5 % methanol) , and samples were harvested for analysis after diluted in 1 % BSA / TBS + 0 . 1 % ( v / v ) Tween - 20 . Following one additional day . three washes in TBS + Tween , the samples were incubated 65 To evaluate expression in clones transformed with a with secondary antibody conjugated with horseradish per - plasmid supporting constitutive expression (pLH44 or oxidase (HRP ) for an additional hour. After three final pLH45 ) , individual clones were grown overnight in PG US 9 , 924 ,728 B2 69 70 media ( 20 g / L peptone, 2 % glycerol) at 30° C . with shaking plasmids , while a -S1 - casein and K - casein were placed under at 300 rpm . The cultures were diluted 1: 10 in minimal the control of the constitutive PPGK promoter . sulfate media : In order to direct the proteins into the secretory pathway , Glucose 20 g / L the proteins were expressed with either their native signal Calcium Chloride ( CaC12 ) 1 g / L 5 peptide (pLH46 and pLH47 ) , or the OST1 signal peptide Sodium phosphate (Na2PO4 ) 24 g/ L ( PLH48 and pLH49 ) . In addition , plasmids were made in Potassium sulfate (K2S04 ) 18 . 2 g / L which one protein was expressed with its native signal Magnesium sulfate (MgSO4 -7H2O ) 14 .9 g / L peptide , and the other protein with the OST1 signal peptide : PLH0050 OST1 - beta , native - a - S1 Ammonium sulfate (NH4 ) 2SO4 9 g / L 10 PLH0051 native - B , OST1- a -S1 EDTA ( Ethylenediaminetetraacetic acid ) 65 .25 mg/ L PLH0054 OST1 - a -S2 , native - K FeSO4- 7H20 (Iron Sulfate heptahydrate ) 12 . 18 g /L pLH0055 native - a - S2, OST1 - K ZnSO4 -7H20 (Zinc sulfate heptahydrate ) 25. 0125 g/ L To generate strains expressing all four casein proteins , CaC12 - 2H20 (Calcium chloride dihydrate ) 12 .615 g / L yeast cells were first transformed with the plasmid encoding CuSO4 - 5H20 ( Copper sulfate pentahydrate ) 2 . 175 g / L 15 beta - casein and a -si - casein . Prior to transformation . 20 ug NaM004 - 2H20 ( Sodium molybdate dihydrate ) 2 .088 g / L of each plasmid was linearized with the enzyme Apall. The CoC12 -6H2O (Cobalt chloride hexahydrate ) 2 . 0445 g / L digested plasmids were then concentrated by ethanol pre MnC12 -4H20 (Manganese chloride tetrahydrate ) 1 .392 cipitation , and resuspended in 10 ul distilled water . g /L Competent Pichia pastoris cells were prepared as follows: Biotin 0 .2175 g/ L 20 A culture of P . pastoris was grown to log phase After 48 hours , samples were harvested for analysis . (OD600 ~ 1 .0 ) in YPD media (10 g /L yeast extract , 20 g /L Analysis peptone, 20 g / L dextrose ) . A 1 . 5 mL aliquot was harvested Protein expression was analyzed in samples of culture that by centrifugation , then resuspended in 1 mL of a 1 : 1 mixture were centrifuged to remove the cell mass . The clarified of YPD + 20 mM HEPES (pH 8 ) : 1M lithium acetate . After supernatant was then evaluated by ELISA and Western blot. 25 adding 10 uL 1 M dithiothreitol , the cells were incubated for To measure protein titers via ELISA , 25 uL of each 15 min at 30° C . in a shaker at 300 rpm . The cells were sample were placed in a half -area 96 well microtiter plate , pelleted by centrifugation and washed three times in 1 mL and allowed to bind overnight at 4° C . After removing the ice cold 1 M sorbitol. After the final wash , the cells were samples , the binding surface was blocked by filling each resuspended in 50 uL 1 M sorbitol . well with 1 % ( w / v ) bovine serum albumin (BSA ) dissolved 30 The cells were combined with the linearized plasmid in Tris Buffered Saline (50 mM Tris , pH 7 .6 , 150 mM NaCl) DNA in a chilled 2 mm electroporation cuvette , and sub and incubating for 1 hour at room temperature . The samples jected to a 1. 5 kV pulse (25 °F , 2002) . The cells were were then incubated for 1 . 5 hr in primary antibody that was transferred to a culture tube with 200 uL cold 1 : 1 YPD : 1 M diluted in 1 % BSA / TBS + 0 . 1 % ( v / v ) Tween - 20 . Following sorbitol, and allowed to recover for 2 hours at 30° C . (300 three washes in TBS + Tween , the samples were incubated 35 rpm ). Finally , the cells were plated onto PG agar (20 g / L with secondary antibody conjugated with horseradish per - peptone, 2 % ( v / v ) glycerol, 2 % agar) plates containing oxidase (HRP ) for an additional hour. After three final zeocin and grown for two days at 30° C . washes in TBS + Tween , a chromogenic substrate ( TMB Six clones from the beta + alphaS1 plates were then grown Single Solution , Life Technologies ) was added , and the in culture , and made competent for DNA uptake using the absorbance at 650 nm was measured . The resulting data 40 procedure described above . They were then transformed show the secretion of B - lactoglobulin (FIG . 6 ) . with the linearized alphaS2 + kappa plasmids, and grown for To analyze samples via western blot, one volume of two days at 30° C . on PG plates containing G418 . sample was combined with an equal volume of SDS -PAGE Expression sample buffer and run on a 10 % polyacrylamide gel . The To evaluate the production of bovine casein proteins, five proteins were transferred to a nitrocellulose membrane , 45 clones expressing casein and a wildtype yeast negative which was blocked by treating with 1 % BSA / TBS for 1 hr. control were grown overnight in PG media (20 g / L peptone , After incubating for 1 .5 hr with primary antibody diluted in 2 % glycerol) at 30° C . with shaking at 300 rpm . All five of 1 % BSA / TBS + Tween , the blot was washed three times in the casein - expressing clones expressed alphaS2 - and K - ca TBS + Tween . The blot was then incubated with secondary sein with the respective native casein signal peptides . Clones antibody conjugated with horseradish peroxidase (HRP ) for 50 sLH115 , 116 , 117, and 118 expressed ß -casein and a -S1 an additional hour . After three final washes in TBS + Tween , casein with the respective native signal peptides ; clone a chromogenic substrate ( 1 - Step Ultra TMB Blotting Solu - sLH122 expressed beta - casein and a -S1 -casein with the tion , Thermo Fisher ) was added . After staining was com - OST1 signal peptide . The cultures were diluted 1 : 10 in pleted , the blot was washed in distilled water. The resulting minimal sulfate media : Western blot shows that B - lactoglobulin was secreted from 55 Glucose 20 g / L the recombinant yeast (FIG . 7 ) . Calcium Chloride (CaCl2 ) 1 g / L Bovine Caseins Sodium phosphate (Na2PO4 ) 24 g / L Dual expression plasmids were built , to support expres Potassium sulfate (K2S04 ) 18 .2 g / L sion of a - S1 - casein with B - casein in one plasmid , and Magnesium sulfate (MgSO4 - 7H20 ) 14 . 9 g / L a -S2 - casein with kappa - casein in another plasmid . These 60 Ammonium sulfate (NH4 ) 2SO4 9 g / L pairings were chosen because the molar ratio of a -S1 : a -S2 : EDTA (Ethylenediaminetetraacetic acid ) 65 .25 mg/ L B : K in fluid milk is approximately 5 . 5 : 1 . 5 : 4 . 0 : 1 . 5 ; it is FeSO4- 7H2O (Iron Sulfate heptahydrate ) 12 .18 g /L therefore desirable to have a similar number of copies of ZnSO4 - 7H2O (Zinc sulfate heptahydrate ) 25 .0125 g / L a -S1 - casein and beta - casein , and a similar number of copies CaC12 -2H20 (Calcium chloride dihydrate ) 12 .615 g / L of a - S2 - casein and kappa - casein . 65 CuSO4- 5H20 ( Copper sulfate pentahydrate ) 2 . 175 g / L Beta - casein and C -S2 - casein were placed under the con NaM004- 2H20 ( Sodium molybdate dihydrate ) 2 .088 g / L trol of the constitutive PGAP promoter in their respective COC12 -6H2O (Cobalt chloride hexahydrate ) 2 .0445 g / L US 9 , 924 , 728 B2 71 72 MnC12 -4H20 (Manganese chloride tetrahydrate ) 1 .392 been optimized as medium which provides enough force to g / L disperse the proteins and avoids the entrapment of air in the Biotin 0 .2175 g / L solution . The water content can be adjusted according to the After 48 hours , samples were harvested for analysis . usage of other ingredients . Analysis 5 In step 3 , separate solutions of CaC1, , KH , PO4, and Naz Protein expression was analyzed in samples of culture that citrate in water are the mineral sources utilized to prepare were centrifuged to remove the cell mass . The clarified similar mineral profile as native bovine milk . In a typical supernatant was then evaluated by ELISA and western blot. instance , CaCl , solution concentration is 0 . 1 g /mL , KH , PO . To measure protein titers via ELISA , 25 uL of each is 0 . 27 g /mL , and Naz citrate solution is 0 .21 g /ml sample were placed in a half -area 96 well microtiter plate , 10 Nazcitrate . The water used to prepare KH P04 with Naz and allowed to bind overnight at 4° C . After removing the citrate solution is usually warm to make sure the complete samples , the binding surface was blocked by filling each dissolution of KH ,PO2 . During the mixing of protein solu well with 1 % (w / v ) bovine serum albumin (BSA ) dissolved tion 1 , 0 .015 % CaCl, is added slowly ( step 4 ) . The volume in Tris Buffered Saline ( 50 mM Tris , pH 7 .6 , 150 mM NaCl) of CaCl, solution used is adjusted according to the weight and incubating for 1 hour at room temperature . The samples 15 percent of CaCl2 needed . The mixing continues for approxi were then incubated for 1 . 5 hr in primary antibody that was mately 30 minutes to allow the complete interaction between diluted in 1 % BSA / TBS + 0 . 1 % ( v / v ) Tween - 20 . Following proteins and Ca ' ions . Subsequently, 0 . 27 % KH , PO , and three washes in TBS + Tween , the samples were incubated 0 .21 % Nazcitrate are divided to 5 portions and each portion with secondary antibody conjugated with horseradish per - is added slowly into the mixing solution at an interval time oxidase (HRP ) for an additional hour. After three final 20 of 5 to 10 minutes (step 5 ) . 0 .085 % CaCl, is divided to 4 washes in TBS + Tween , a chromogenic substrate ( TMB portions and each portion is added slowly into the mixing Single Solution , Life Technologies ) was added , and the solution at an interval time of 5 - 10 minutes (step 6 ) . The absorbance at 650 nm was measured . The ELISA data show mixing continues for at least 30 minutes , preferably 1 - 2 that the different yeast strains can secrete a - Si casein and hours, to obtain the protein solution 2 . B -casein into the culture medium (FIG . 8 ) . 25 In the process B , low speed mixing is sufficient to achieve To analyze samples via western blot, one volume of the homogeneous mixing of different oil ingredients . The sample was combined with an equal volume of SDS- PAGE percent of each component used below for preparing the oil sample buffer and run on a 10 % polyacrylamide gel. The mixture 1 is based on the total oil mixture 1 weight. Initially , proteins were transferred to a nitrocellulose membrane , 65 % sunflower oil, 29 % coconut oil , and 2 % tributyrin are which was blocked by treating with 1 % BSA / TBS for 1 hr. 30 mixed together form the oil base ( step 7) . The sunflower oil After incubating for 1 . 5 hr with primary antibody diluted in and coconut oil is deodorized to prevent an unwanted aroma. 1 % BSA / TBS + Tween , the blot was washed three times in The combination of sunflower oil , coconut oil, and tributyrin TBS + Tween . The blot was then incubated with secondary can mimic a similar fatty acid profile as the native milk . The antibody conjugated with horseradish peroxidase (HRP ) for oil base ingredient and its content can be adjusted according an additional hour. After three final washes in TBS + Tween , 35 to different needs (different types of products ). The aroma a chromogenic substrate ( 1 - Step Ultra TMB Blotting Solu - mixture is prepared by mixing different the aroma compo tion , Thermo Fisher ) was added . After staining was com nents in the sunflower oil ( step 8 ). The compounds used to pleted , the blot was washed in distilled water . mimic the aroma contain , but are not limited to ethyl The data in this Example show that the different expres - butyrate , d -decalactone , 2 - furyl methyl ketone , 2 , 3 - pen sion vectors described herein can be used to generate 40 tanedione, y -undecalactone , d - undecalactone , acetoin , fur transgenic yeast strains that secrete the different milk pro - furyl alcohol, furfural , 2 -methylfurfural , and 2 -methylpyra teins . zine . Their contents can be adjusted by different applications and preference . 2. 5 % mono - and di- glycerides , 0 .6 % free Example 7 . Method of Making a Composition fatty acids, 0 . 5 % phospholipids, and 0 . 4 % aroma mixture 45 are added to prepare the oil mixture 1 with mixing ( step 9 ) . An exemplary composition described herein was gener - In a typical instance , free fatty acids contain 0 . 15 % butyric ated using the specific method described below . A schematic acid and 0 .45 % hexanoic acid . Soy lecithin is used as the diagram of this method is shown in FIG . 9 . phospholipid source. Soy lecithin is readily available and is To prepare the milk product, laboratory equipment such as inexpensive . A ß -carotene solution is prepared in sunflower mixers , stirring plates , and sonicators are employed . For 50 oil at a concentration of 0 . 5 mg/ g ( step 10 ) . 4 % of oil large scale production , standard fluid milk processing equip - mixture 1 and 0 .06 % the ß -carotene solution are mixed ment should be used . together to obtain the oil mixture 2 ( step 11 ) . The usage of As FIG . 9 shows, there are three main components to this B -carotene is adjusted to achieve different color levels of the method of making a composition . These steps include: milk . The usage of oil mixture 1 can also be adjusted A . Preparation of the protein solution 55 according to different milk product applications . B . Preparation of the oil mixture In the process C , oil mixture 2 is added slowly to protein C . Reconstitution of the milk solids solution 2 and mixed thoroughly to prepare productmixture In step A , powdered micellar casein protein and whey 1 ( step 12 ) . The mixing can be performed by mixers or protein are combined and blended ( step 1 ) and subsequently sonicators. In a typical instance , oil mixture 2 and protein mixed with deionized (DI ) water ( step 2 ) to obtain the 60 solution 2 are mixed under medium to high speed to ensure protein solution 1 . Typically , this contains 2 . 8 % powered sure the oil is uniformly dispersed in the aqueous solution . micellar casein , 0 . 7 % powered whey protein , and 85 . 5 % Subsequently , sonication is applied to break down the oil water in this solution . The mixing vessel is covered to globules into smaller size , which leads to an increase of their prevent evaporation of water . This mixing is performed by stability in the solution . It is necessary to prevent the mixers , stirring plates , or a sonicator in a sufficient period of 65 entrapment of air bubbles in the solution during mixing. A time ( approximately 30 minutes ) . This mixing time ensures mixing time of least 20 minutes is utilized to stir the oil all proteins are dispersed in the water . The mixing speed has mixture 2 into the aqueous solution and allow the thorough US 9 ,924 ,728 B2 73 74 dispersion . A 4 % maltose solution is added into product TABLE 12 mixture 1 and was mixed continuously for an additional 30 minutes to yield product mixture 2 ( step 13 ). The sweetness Composition like Cream can be adjusted by the sugar content according to different Total Sample Weight 100 g applications. The source of the sugar can also be adjusted 5 Amount in Weight Percent according to requests . Extra DI water may be required to Wt % Section in 100 g SamnleALIINID make up the final total weight to 100 % . Protein Component 3 g No intensive homogenization , pasteurization , and steril ization is included in this process. However, it will be 10 Micellular Casein 80 % 2 . 4 g 2 . 40 % necessary to apply these steps to prepare the product mixture Whey Protein 20 % 330 a 0909 0 .60 % in the process C for a scale -up production . Fat 40 g Equipment Used Sunflower Oil 65 % 26 g 26 . 0 % Coconut Oil 29 % 11 .6 g 11 . 6 % Mixer : IKA -Labortechnik RW16 Basic , speed level ( 4 -6 ) ,15 Tributyrin 2 % 0 . 8 0 . 8 % Tip sonicator: Qsonica Model CL - 188 , Amplitude 70 % Mono and Di Glycerides 2 .50 % 1 . 0 % Free fatty acids 0 .60 % 0 .24 09090909 0 . 24 % Water bath sonicator: Bransonic Model 1510R -MT (butyric and hexanoic acid ) Phospholipids 0 .50 % 0 . 2 g 0 . 2 % Aroma Compounds 0 . 4 % 0 . 40 % 0 . 16 g 0 . 16 % Example 8 . Example Formulations 20 Minerals 0 . 54 g Calcium 0 . 1005 g 0 . 1005 % Example formulations compositions that have a similar Phosphorus 0 . 09 g 0 . 090 % taste and texture profile as whole milk , cream , high protein Potassium 0 .078 g 0 . 078 % milk , fat - free milk , and sugar - free milk are provided in Sodium 0 .0545 g 0 .0545 % 25 Citrate 0 .1493 g 0 . 1493 % Tables 11 - 15 below . Chloride 0 . 064 g 0 . 064 % As can be appreciated in the art , the compositions listed Sugar 4 g in Tables 11 - 15 are made by making the necessary modifi Maltose 4 % cations to the process described in Example 7 . Water 52 .46 g 52 . 46 % 30 Aroma Compounds List TABLE 11 8 - Decalactone Composition like Whole Milk Ethyl butyrate Total Sample Weight 100 g 2 - furyl methyl ketone 2 , 3 -pentanedione Amount in Weight Percent 35 V -Undecalactone Wt % Section in 100 g Sample d -Undecalactone Protein Component 3 g Micellular Casein 80 % 2 . 40 % Whey Protein 20 % no (j?? 0 .60 % TABLE 13 Fat 3 . 9 g 40 osition like Protein Rich Milk Sunflower Oil 65 % 2 .54 g 2 .54 % Total Sample Weight 100 g Coconut Oil 29 % 1 . 13 g 1 . 13 % Tributyrin 2 % 0 .08 09g 0 .08 % Amount in Weight Percent Wt % in 100 g Sample Mono and Di Glycerides 2 . 50 % 0 .098 g 0 . 098 % 4 ) Section Free fatty acids 0 .60 % 0. 023 g 0 .023 % (butyric and hexanoic acid ) Protein Component 6 g Phospholipids 0 . 50 % 0 .020 g 0 .02 % Micellular Casein 80 % . 4 . 80 % Aroma Compounds 0 . 4 % 0 . 40 % 50 0 .016 g 0 .016 % Whey Protein 20 % 1N 1 . 20 % Minerals 0 .54 g Fat 3 . 9 g 50 Calcium 0 . 1005 g 0 . 1005 % Sunflower Oil 65 % 2 .54 g 2 . 54 % Phosphorus 0 . 09 g 0 .090 % Coconut Oil 29 % 1 . 13 g 1 . 13 % Potassium 0 .078 g 0 . 078 % Tributyrin 2 % 0 .08 g 0 .08 % Sodium 0 .0545 g 0 .0545 % Mono and DiGlycerides 2 . 50 % 0 .098 g 0 . 098 % Citrate 0 . 1493 g 0 . 1493 % Free fatty acids 0 .60 % 0 .023 0909090909g 0 . 023 % Chloride 0 . 064 g 0 . 064 % 55 (butyric and hexanoic acid ) Sugar 4 g Phospholipids 0 . 50 % 0 .020 g 0 .02 % Aroma Compounds 0 . 4 % 0 . 40 % 0 .016 g 0 . 016 % Maltose 4 g 4 % Minerals 0 .54 g Water 88 .56 g 88 . 56 % Aroma Compounds List Calcium 0 .1005 g 0 . 1005 % Phosphorus 0 . 09 g 0 . 090 % Potassium 0 .078 g 0 . 078 % 8 -Decalactone Sodium 0 .0545 g 0 .0545 % Ethyl butyrate Citrate 0 .1493 g 0 . 1493 % 2 -furyl methyl ketone Chloride 0 .064 g 0 . 064 % 2 , 3 - pentanedione Sugar 4 g y -Undecalactone d -Undecalactone 65 Maltose 4 % Water 85 .56 0909 85 .56 % US 9, 924 ,728 B2 75 76 TABLE 13 -continued TABLE 15 Composition like Protein Rich Milk Composition like Sugar Free Milk Total Sample Weight 100 g Total Sample Weight 100 g Amount in Weight Percent Amount in Weight Percent Wt % Section in 100 g Sample Wt % Section in 100 g Sample Aroma Compounds List Protein Component 3 g 80 % 2 . 40 % 8 - Decalactone Micellular Casein Ethyl butyrate 10 Whey Protein 20 % 0. 6 0909 0 .60 % 2- furyl methyl ketone Fat 3 . 9 g 2 , 3 -pentanedione Sunflower Oil 65 % 2 .54 g 2 . 54 % y -Undecalactone Coconut Oil 29 % 1 . 13 g 1 . 13 % d -Undecalactone Tributyrin 2 % 0 .08 09 0 .08 % 15 Mono and Di Glycerides 2 .50 % 0 .098 0 . 098 % Free fatty acids 0 . 60 % 0 .023 g 0 . 023 % (butyric and hexanoic acid ) Phospholipids 0 . 50 % 0 .020 g 0 .02 % TABLE 14 Aroma Compounds 0 . 4 % 0 . 40 % 0 .016 g 0 .016 % Minerals 0 .54 g Composition like Fat - Free Milk Total Sample Weight 100 g 20 Calcium 0 . 1005 g 0 . 1005 % Phosphorus 0 .09 0 . 090 % Amount in Weight Percent Potassium 0 . 078 ????J?????? 0 . 078 % Wt % Section in 100 g Sample Sodium 0 .0545 g 0 . 0545 % Citrate 0 . 1493 g 0 . 1493 % Protein Component 3 g Chloride 0 . 064 g 0 .064 % 25 Sugar 4 g Micellular Casein 80 % 2 .40 % Whey Protein 20 % NO 0 . 60 % Stevia 4 g 4 % Minerals 0 .54 g Water 88. 56 g 88 . 56 % Aroma Compounds List Calcium 0 .1005 g 0 . 1005 % Phosphorus 0 .09 g 0 . 090 % 30 d - Decalactone Potassium 0 .078 g 0 .078 % Ethyl butyrate Sodium 0 .0545 g 0 .0545 % 2 - furyl methyl ketone Citrate 0 . 1493 g 0 . 1493 % 2 , 3 - pentanedione Chloride 0 .064 g 0 . 064 % y -Undecalactone Sugar 4 g d -Undecalactone Maltose 4g 4 % 35 Water 92. 46 g 92 . 46 % Aroma Compounds List Example 9 . Exemplary Composition 8 - Decalactone Ethyl butyrate An exemplary composition made by the presently 2 - furyl methyl ketone 2 , 3 - pentanedione 40 described methods is shown in FIG . 10 . The composition in Y -Undecalactone FIG . 10 has a similar look (color ) , viscosity , foaming d -Undecalactone property , flavor, and nutritional value as a mammal- pro duced milk . The composition shown in FIG . 10 comprises mammal- derived proteins. SEQUENCE LISTING

< 160 > NUMBER OF SEO ID NOS : 159 < 210 > SEQ ID NO 1 < 211 > LENGTH : 190 2 > TYPE : PRT 13 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 1 Met Met Lys Ser Phe Phe Leu Val Val Thr Ile Leu Ala Leu Thr Leu 5 theneedto 10 Pro Phe Leu Gly Ala Gin Glu Gin Asn Gin Glu Gin Pro Ile Arg Cys herbe 20 go30 Glu Lys Asp Glu Arg Phe Phe Ser Asp Lys Ile Ala Lys Tyr Ile Pro 35 40 45 US 9 , 924 , 728 B2

- continued E Ile Gin Tyr Val Leu Ser Arg Tyr 8Pro Ser Tyr 'Gly Leu Asn Tyr Tyr & 55 60 |

Gln Gln Lys &Pro Val Ala Leu Ile 8Asn ?Asn Gin Phe Leu &Pro ETyr ?Pro 65 70 75 Se& Tyr Tyr Ala Lys Pro Ala Ala Val 8Arg Ser Pro Ala Gin Ile Leu 3Gin

Trp Gin Val Leu msSer Asn Thr Val Pro Ala Lys Ser ECys Gin Ala Gin 100 105 1101 8 Pro Thr Thr Met Ala Arq His mmmPro His Pro His Leu Ser Phe Met RAla mmm 125 115 120

Ile Pro &Pro Lys Lys Asn Gin Asp 8Lys Thr Glu Ile &Pro Thr Ile Asn 135 140

Thr Ile Ala Ser Gly Glu Pro Thr 8Ser Thr Pro Thr Ile Glu Ala Val 145 mmm150 F? 155 160

Glu Ser Thr Val Ala Thr Leu Glu 8Ala Ser Pro Glu Val Ile Glu Ser 165 1 170 175 | Pro Pro Glu Ile Asn Thr Val Gin Val Thr Ser Thr Ala Val 180 185 190

< 210 > SED ID NO 2 < 211 > LENGTH : 573 < 212 > TYPE : DNA < 213 > ORGANISM : Bos taurus < 220 > FEATURE : 1 < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 2 atgatgaaga gttttttcct agttgtgact atcctagcat taaccctgcc atttttgggt 60 gcccaagagc aaaaccaaga acaaccaata cgctgtgaga aagatgaaag attcttcagt 120 gacaaaatag ccaaatatat cccaatccag tatgtgctga gtaggtatcc tagttatgga 180 ctcaattact accaacagaa accagttgca ctaattaata atcaatttct gccataccca 240 tattatgcaa agccagctgc agttaggtca cctgcccaaa ttcttcaatg gcaagttttg 300 tcaaatactg tgcctgccaa gtcctgccaa gcccagccaa ccaccatggc acgtcaccca 360 cacccacatt tatcatttat ggccattcca ccaaagaaaa atcaggataa aacagaaato 420 cctaccatca ataccattgc tagtggtgag cctacaagta cacctaccat cgaagcagta 480 gagagcactg tagctactct agaagcttct ccagaagtta ctgagagccc acctgagato 540 aacacagtcc aagttacttc aaccgcggtc taa 573

< 210 > SEQ ID NO 3 < 211 > LENGTH : 192 < 212 > TYPE : PRT < 213 > ORGANISM : Capra hircus < 220 > FEATURE :

< 2221 1 > NAME / KEY : VARIANT < 2222222 2 > LOCATION : ( 0 ) . . . ( 0 )

2 AAA< 2233 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 3 Met Met Lys Ser Phe Phe Leu Val Val Thr Ile Leu Ala Leu Thr Leu ?10 15 Pro Phe Leu Gly Ala Gin Glu Gin Asn Gin Glu Gin Pro Ile Cys Cys 20 25 Glu Lys Asp Glu Arg Phe Phe Asp Asp Lys Ile Ala Lys Tyr Ile Pro 35 40 US 9 , 924 , 728 B2 80 - continued

Ile 5Gln Tyr Val Leu Ser Arg Tyr & Propro ? Ser ETyr GlyGly LeuLeu Asn Tyr Tyr .

Gin Gin Arg Pro Val Ala Leu Ile Asn ?Asn SGin Phe Leu &Pro Tyr Pro 65 75 &80

Tyr Tyr Ala Lys Pro Val Ala Val .Arg Ser &Pro Ala Gin ?Thr Leu Gin 95

Trp Gin Val Leu Pro Asn Thr Val Pro Ala Lys Ser RCys Gin Asp Gin 105

Pro Thr Thr Leu Ala Arg His Pro His Pro ?His Leu Ser Phe EE?4?Met Ala 120 Ile Pro Pro Lys Lys emmmAsp Gin Asp Lys Thr Glu Val Pro Ala Ile Asn &A Thr Ile Ala Ser Ala Glu Pro Thr Val His Ser Thr Pro Thr Thr Glu 145 mmmmm 155 160 Ala Ile Val Asn Thr Val Asp Asn Pro Glu Ala Ser Ser Glu Ser Ile 165 175 , | Ala Ser Ala Ser Glu Thr Asn Thr Ala Gin Val Thr Ser Thr Glu Val mmmm 180 185 < 210 > SEQ ID NO 4 < 211 > LENGTH : 579 < 212 > TYPE : DNA < 213 > ORGANISM : Capra hircus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 4 atgatgaaga gttttttcct agttgtgact atcctggcat taaccctgcc atttttgggt 60 goccaggagc aaaaccagga acagccgata tgctgtgaga aagatgaaag attcttcgat 120 gacaaaatag ccaaatatat cccaattcag tatgtgctga gtaggtatcc tagttatgga 180 ctcaattact atcaacaqaq accaqttqca ctaattaata atcaatttct qocataccca 240 tattatgcaa agccagttgc agttaggtca cctgcccaaa ctcttcaatg gcaagttttg 300 ccaaatactg tgcctgccaa gtcctgccaa gaccagccaa ctaccctggc acgtcaccca 360 cacccacatt tatcatttat ggccattcca ccaaagaaag atcaggataa aacagaagtc 420 cctgccatca ataccattgc tagtgctgag cctacagtac acagtacacc taccaccgaa 480 gcaatagtga acactgtaga taatccagaa gcttcctcag aatcgattgc gagtgcatct 540 gagaccaaca cagcccaagt tacttcaacc gaggtctaa 579

< 210 > SEQ ID NO 5 < 211 > LENGTH : 182 < 212 > TYPE : PRT < 213 > ORGANISM : Felis catus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) 3 > OTHER INFORMATION : Cagein k < 400 > SEQUENCE : 5 Met Lys Thr Phe Phe Leu Val Val Asn Ile Leu Ala Leu Thr Leu Pro 1 10 15 Phe Leu Gly Ala Gin Val Gin Asn Gin Glu Gin Pro Thr Cys Arg Glu 20 25 Asn Asp Glu Arg Leu Leu Asn Gin Lys Thr Ala Lys Tyr Ile Pro Val US 9 , 924 , 728 B2 - continued | 35 40 45

His Tyr Val Leu Ser Asn Tyr Pro His ETyr Glu Pro Ser Tyr Tyr &Pro 1558|smmm His Lys &Pro RAla Val Pro Val Asn Asn Gin Tyr Met &Pro ETyr &Pro Tyr 70 75 &D33 O Tyr Ala Lys Pro Val Ala Val Arg &Pro His Val Gin Ile Pro JGin Trp 95

Gin Val Leu &Pro Asn Thr Tyr Thr Pro Thr Val Val IArg His &Pro His 100 105 Leu Pro Ala Ser ?Phe Ile Ala Ile Pro Pro Lys Lys Ile Gln Asp Lys 115 120 Thr Gly Asn Pro Thr Ile Asn Thr Ile Ala Thr Ala Glu Leu Thr Leu FA& 135

Thr Pro Thr Thr ?Glu Pro Ile Val Asn Thr Val Val Thr Thr Glu Ala 150 155 . Ser Ser Glu Phe Thr Ile Thr Ser Thr Pro Glu Thr Thr Thr Val ?Pro 165 170 175 Val Ala Ser Thr Met Val 180 ma < 210 > SEQ ID NO 6 < 211 > LENGTH : 549 < 212 > TYPE : DNA < 213 > ORGANISM : Felis catus 20 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k CDNA < 400 > SEQUENCE : 6 atgaagactt ttttcctagt tgtgaatatc cttgcattaa ccttgccatt tttgggtgca | 6060 caggtgcaaa accaagaaca accaacttgc cgtgaaaatg atgaaagatt gottaatcag 120 aaaactgcca agtatatccc agttcattat gtactgagta actatcctca ctatgagccc 180 agttactacc cgcataaacc agctgtacca gttaataatcaatatatgcc ctatccatat 240 tatgcaaaac cagttgcagt taggccacat gtccaaattc ctcagtggca agtcctgcca 300 - aatacctaca cacccactgt ggtacgtcac ccacacctac ctgcgtcatt tattgccatt 360

cccccaaaga aaattcagga taagacaggc aaccctacca tcaataccat tgctactget 42

gagcttacac ttactcctac cactgaacca atagtgaaca ctgtagtcac tacagaagca 48 ooo9 tcctcagaat tcaccatcac aagcacacct gagactacca cagttccagt ggcttcaacc 54

atggtctaa 54

< 210 > SEO ID NO 7 < 2115 LENGTH : 196 < 212 > TYPE : PRT < 213 > ORGANISM : Homo sapiens < 220 > FEATURE : 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 7 Met Arq Ala Asn Ala Asn Val Ala Asp Ala Gln Ser Ala Ile Met Lys ? 11 15 Ser Phe Leu Leu Val Val Asn Ala Leu Ala Leu Thr Leu Pro Phe Leu 20 25 3 0 US 9 , 924 , 728 B2 8 84 - continued EAla Val Glu Val Gin Asn Gin Lys Gin Pro Ala Cys His Glu Asn Asp 35 | Glu Arg Pro Phe Tyr Gin Lys Thr Ala Pro Tyr Val Pro Met Tyr Tyr Val Pro Asn Ser Tyr Pro Tyr Tyr Gly Thr Asn Leu Tyr Gin Arg Arg 65 75

&Pro RAla Ile Ala Ile Asn Asn &Pro Tyr Val Pro Arg Thr Tyr Tyr Ala 95

?Asn &Pro Ala Val Val Arg Pro His Ala Gin Ile Pro Gin Arg Gin Tyr 110

Leu &Pro Asn Ser His Pro Pro Thr Val Val Ara Ara Pro Asn Leu His 115 p

&Pro Ser Phe Ile Ala Ile Pro Pro Lys Lys Ile Gln Asp Lys Ile Ile ?8mm E

Ile Pro Thr Ile Asn Thr Ile Ala ?Thr Val Glu Pro Thr Pro Ala Pro 145 mmmmm 155 Ala Thr Glu Pro Thr Val Asp Ser Val Val Thr Pro Glu Ala Phe Ser A mmm175 Glu Ser Ile Ile Thr Ser Thr Pro Glu Thr Thr Thr Val Ala Val Thr 185 ? 190 Pro Pro Thr Ala 195

< 210 > SEQ ID NO 8 < 211 > LENGTH : 591 < 212 > TYPE : DNA < 213 > ORGANISM : Homo gapiens < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 8 atgagggcaa atgcaaatgt agctgatgcg caaagtgcaa taatgaagag ttttcttcta 60 gttgtcaatg ccctggcatt aaccctgcct tttttggctg tggaggttca aaaccagaaa 120 caaccagcat gccatgagaa tgatgaaaga ccattctatc agaaaacagc tccatatgtc 180 ccaatgtatt atgtgccaaa tagctatcct tattatggaa ccaatttgta ccaacgtaga 240 ccagctatag caattaataa tccatatgtg cctcgcacat attatgcaaa cccagctgta 300 gttaggccac atgcccaaat tcctcagcgg caatacctgc caaatagcca cccacccact 360 gtggtacgtc gcccaaacct gcatccatca tttattgcca tccccccaaa gaaaattcag 420 gataaaataa tcatccctac catcaatacc attgctactg ttgaacctac accagctcct 480 gccactgaac caacggtgga cagtgtagtc actccagaag ctttttcaga gtccatcatc 540 acgagcaccc ctgagacaac cacagttgca gttactccac ctacggcata a 591

< 210 > SEQ ID NO 9 < 211 > LENGTH : 178 < 212 > TYPE : PRT < 213 > ORGANISM : Loxodonta Africana < 220 > FEATURE : 6221 > NAME / KEY : VARIANT < 2222 > LOCATION : ( 0 ) . . . ( 0 )

A 2 233 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 9 Met Lys Gly Phe Leu Leu Val Val Asn Ile Leu Leu Leu Pro Leu Pro 10 15 US 9 , 924 , 728 B2 85 86 - continued | Phe Leu Ala Ala Glu Val Gln Asn Gin Glu Glu Ser Arg Cys Leu Glu

Lys Asp Glu Arg Trp Phe Cys Gin ggLys ?Ala 3Val Lys Tyr Ile &Pro Asn 35

Asp Tyr Val Leu Lys Ser Tyr Tyr Arg Tyr Glu &Pro Asn Tyr Asn Gin

Phe Arq Ala Ala Val Pro Ile Asn Asn Pro Tyr Leu Ile Tyr Leu Tyr 65 Tle Aan Asn Pro us EE& Pro Ala Lys Gin Val Ala Val Arg &Pro His ?Thr Gin Ile Pro Gin Trp 85 Gln Val Pro Ser Asn Ile Tyr JEI&?Pro Ser Pro Ser Val Pro His J2?Thr Tyr Leu Lys Pro Pro Phe Ile Val Ile Pro ?&AREPro Lys Lys Thr Gin Asp Lys 115

Pro Ile Ile Pro Pro Thr Gly Thr Val Ala Ser Ile Glu AAla Thr Val

Glu Pro Lys Val Asn Thr Val Val Asn Ala Glu Ala Ser Ser Glu Phe 145 Pro Lys val Aøn The

Ile Ala Thr Asn Thr &Pro Glu Ala Thr Thr Val Pro Val Ile Ser &Pro 165 mmmm Gin Ile

< 210 > SEQ ID NO 10 < 211 > LENGTH : 537 < 212 > TYPE : DNA < 213 > ORGANISM : Loxodonta Africana < 220 > FEATURE : 1 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 10 atgaagggct ttctcttggt tgtgaacatc ctgttgttac ctttgccctt tttggctgca | 60 gaggtgcaaa accaggagga gtcaagatgc cttgagaaag atgaaagatg gttctgtcag 120 aaagcagtca aatatattoo aaatgattat gtgctgaaga gotattatcg ttatgaacca 180 aattataacc aatttagggc agctgtacca atcaataatc catacctaat ttacctatat 240 cctgctaaac aggttgcagt taggccacat acacaaattc cgcaatggca agttccatca 300

aatatctacc catctccatc aqtacctcac acatacctca aaccaccatt tattgtcatt 360 - cccccaaaga aaactcagga taaacctata atccctccca ccggcaccgt tgcttctatt 420

48 o gaagctaccg ttgagcctaa ggtgaacact gtcgtcaatg ctgaagcttc ctcagagttc -

attgccacaa atacacctga ggctaccaca gtcccagtta tttcacccca gatctaa 537

< 210 > SEQ ID NO 11 < 21111 > LENGTH : 175 < 21212 > TYPE : PRT < 21313 > ORGANISM : Mammuthus primigenius < 22020 > FEATURE : < 22121 > NAME / KEY : VARIANT < 2222222 2 > LOCATION : ( 0 ) . . . ( 0 ) < 22323 > OTHER INFORMATION : Casein k < 400 > SEOUENCE : 11 Met Lys Gly Phe Leu Leu Val Val Asn Ile Leu Leu Leu Pro Leu Phe | 5 10 15 Leu Ala Ala Glu Val Gin Asn Gin Glu Glu Ser Arg Cys Leu Glu Lys US 9 , 924 , 728 B2

8 88 - continued | g 30 Asp Glu Arg Trp Phe Cys Gin Lys Ala Val ?Lys ?Tyr Ile &Pro Asn Asp 40

Tyr Val Leu Lys Ser Tyr Tyr Arg Tyr Glu &Pro Asn Tyr Asn Gin Phe 50 55

Arq Ala Ala Val Pro Ile Asn Asn Pro Tyr Leu Ile Tyr Leu Tyr &Pro 65 ?&ARE 70 Ala Lys Gin Val Ala Val Arg Pro His Thr Gin Ile Gin Trp Gin gVal 68 ES Pro Ser Asn mmmIle Tyr Pro Ser Pro Ser Val Pro His Thr Tyr Leu Lys 110

.Pro Pro Phe Ile Ile Pro Pro Lys Lys Thr Gin Asp Lys Pro Ile Ile 120 m Pro Pro Thr Gly Thr Val Ala Ser Ile Glu Ala Thr Val Glu Pro Lys 130 135 Val Asn Thr Val Val Asn Ala Glu Ala ggSer Ser Glu Phe Ile Ala Thr 145 150 Asn Thr Pro Glu Ala Thr Thr Val Pro Val Ile Ser Pro Gin Ile emm 170

< 210 > SEQ ID NO 12 < 211 > LENGTH : 546 | < 212 > TYPE : DNA < 213 > ORGANISM : Mammathus primigenius 20 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 12 atgatgaagg gotttctctt ggttgtgaac atcctgttgt tacctttggc ctttttggct 60 gcagaggtgc aaaaccagga ggagtcaaga agctgttgcc ttgagaaaga tgaaagatgg 120 ttctgtcaga aagcagtcaa atatattcca aatgattatg tgctgaagag ctattatcgt 180 tatgaaccaa attata acca atttagggca gctgtaccaa tcaataatcc atacctaatt 240 tacctatatc ctgctaaaca ggttgcagtt aggccacata cacaaattct gcaatggcaa 300 gttccatcaa atatctaccc atctccatca gtacctcaca catacctcaa accaccattt 360 attgccattc ccccaaagaa aactcaggat aaacctataa tccctcccac cggcaccgtt | 420 gcttctattg aagctaccgt tgagcctaag gtgaacactg tcgtcaatgc tgaagcttcc 480 tcagagttca ttgccacaaa tacacctgag gctaccacag toccagttat ttcaccccag 540

atctaa 546

< 210 > SEQ ID No 13 < 211 > LENGTH : 180 | < 212 > TYPE : PRT < 213 > ORGANI SM : Oryctolagus cuniculus < 220 > FEATURE : AAAAA) 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 13 Met Met Lys His Phe Leu Leu Val Val Asn Ile Leu Ala Val Thr Leu 11 10 1515 Pro Phe Leu Ala Ala Asp Ile Gln Asn Gln Glu Gin Thr Thr Cys Arq 20 25 30 US 9 , 924 , 728 B2 89 - continued | Glu Asn Glu Glu Arg Leu Phe His Gin Val Thr Ala Pro Tyr Ile Pro 35 40

Val His Tyr Val Met Asn Arg Tyr .Pro Gin Tyr Glu Pro Ser ETyr ETyr 55 60 Leu Arg Arg Gin Ala Val Pro Thr Leu Asn Pro Phe Met Leu Asn Pro 65 70 75 80 Tyr Tyr Val Lys Pro Ile Val Phe Lys Pro Asn Val Gin Val &Pro His 8mm 90 95 Trp Gin Ile Leu Pro Asn Ile His Gin Pro Lys Val Gly Arg His Ser 105 mmm ?: His Pro Phe Phe Met Ala Ile Leu &Pro Asn Lys Met Gin Asp Lys Ala 115 120

Val Thr Pro ?Thr Thr Asn Thr Ile Ala Ala Val Glu Pro Thr &Pro Ile 135The lle Ala Ala Val 140 Pro Thr Thr Glu Pro Val Val Ser Thr Glu Val Ile Ala Glu Ala Ser 145 150 155 160 mmmmPro Glu Leu Ile Ile Ser Pro IRGlu Thr Thr Thr Glu Ala Thr Ala Ala 165 170 175

Ser Ala Ala Ala 180 mm < 210 > SEQ ID No 14 < 211 > LENGTH : 543 < 212 > TYPE : DNA < 213 > ORGANISM : Oryctolagus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 22 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 14 atgatgaagc attttcttct agttgtgaac atcctggcag taaccttgcc ttttttggct 60 gcagacatac aaaaccagga acagacaacg tgccgtgaga atgaggaaag actgttccac 120 caggttacag ctccatatat cccagttcac tatgtgatga acagatatcc tcaatacgaa 180 cccagctact acctgcgcag acaagctgtt ccaactctta atccatttat gottaaccca 240 tattatgtaa aaccaattgt atttaagcca aatgtccaag ttcctcactg gcaaatcctg 300 ccaaatatcc accagccaaa agtgggacgt cactcacatc cattttttat ggccattctc 360 ccgaataaaa tgcaggataa agcagtcacc cccaccacca acaccattgc tgctgtggag 420 cctaccccga ttcctaccac tgagccagtg gtgagcactg aagtgattgc agaggcttcc 480 ccagagctca tcatcagccc tgagactacc acggaagcaa ctgctgcatc agcggcagca 540 tga 543

< 210 > SEQ ID NO 15 < 211 > LENGTH : 192 | < 212 > TYPE : PRT < 213 > ORGANISM : Ovis aries < 220 > FEATURE : A 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 15 Met Met Lys Ser Phe Phe Leu Val Val Thr Ile Leu Ala Leu Thr Leu ?10 15

Pro Phe Leu Gly Ala Gln Glu Gln Asn Gin Glu Gln Arg Ile Cys Cys 20 25 30 US 9 , 924 , 728 B2 01 - continued

Glu Lys Asp Glu Arg ?Phe Phe Asp Asp Lys Ile Ala Lys Tyr Ile Pro . ? 45

Ile Gin Tyr Val Leu Ser EArg Tyr &Pro Ser Tyr 2Gly Leu Asn Tyr Tyr

Gin Gin Arg Pro SVal Ala Leu ?gIle Asn Asn Gin Phe Leu &Pro Tyr Pro 65 ES& EE & Tyr Tyr Ala Lys Pro Val Ala Val RArg Ser Pro Ala Gin Thr Leu Gin &

Trp Gin Val Leu Pro Asn EAla Val &Pro EAla Lys 8Ser BCys Gin 2Asp Gin g 105 110 Pro Thr Ala Met AAla Arg His Pro His .Pro His Leu Ser Phe Met Ala 125 Ile Pro Pro Lys Lys REAsp Gin Asp Lys Thr Glu Ile &Pro Ala Ile Asn Thr Ile Ala Ser Ala Glu Pro Thr Val His Ser Thr Pro Thr Thr Glu 145 Ala Val Val Asn Ala Val Asp Asn Pro Glu Ala Ser Ser Glu Ser Ile

g3 Ala Ser Ala Pro Glu Thr Asn Thr Ala Gin Val Thr Ser Thr Glu Val 180 185 190

< 210 > SEQ ID NO 16 < 211 > LENGTH : 579 | < 212 > TYPE : DNA mmmmm( 213 > ORGANISM : Ovis aries < 220 > FEATUREmmmmm : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . ( 0 ) | < 223 > OTHER INFORMATION : Casein k cDNA < 400am > SEQUENCE : 16 atgatgaaga gttttttcct agttgtgact atcctggcat taaccctgcc atttttgggt 60 gcccaggagc aaaaccaaga acaacgaata tgctgtgaga aagatgaaag attcttcgat 120 gacaaaatag ccaaatatat cccaattcagtatgtgctga gtaggtatcc tagttatgga 180 ctcaattact accaacagag accagttgca ctaattaata atcaatttct gccataccca 240 tattatgcga agccagttgc agttaggtca cctgcccaaa ctcttcaatg gcaagttttg 300 ccaaatgctg tgcctgccaa gtcctgccaa gaccagccaa ctgccatggc acgtcaccca 360

cacccacatt tatcatttat qqocattoca ccaaagaaag atcaggata a aacagaaatc 420 cctgccatca ataccattgc tagtgctgag cctacagtac acagtacacc taccaccgaa 480 gcagtagtga acgctgtaga taatccagaa gottcctcag aatcgattgc gagtgcacct 540 gagaccaaca cagcccaagt tacttcaacc gaggtctaa 579

< 210 > SEQ ID No 17 < 21111 > LENGTH : 181 < 21212 > TYPE : PRT < 21313 > ORGANISM : Physeter catodon < 22020 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) AAAA< 223 > OTHER INFORMATION : Casein k < 400 > SEOUENCE : 17 Met Lys Ser Phe Leu Leu Val Val Thr Ile Leu Ala Leu Thr Leu Pro 10 15 Phe Leu Ser Ala Glu Gly Gin Asn Gin Glu Gin Ser Thr Arg Cys Glu US 9 , 924 , 728 B2 93 94 - continued & | g 30 Asn Asp Glu Arg Leu Phe Asn Lys Lys Thr Val Lys Tyr Ile &Pro ?Ile 40 His Tyr Val Leu Ser Arg Tyr &Pro Ser Tyr Gly Leu Asn Tyr ETyr Gin gg& 55 60 His Arq Pro Val Ala Leu Ile Asn Asn Gln Phe Met Pro Tyr Leu Tyr

Tyr Ala Lys Pro Val Val |BamVal Ser Pro His Ala Gln Ile Pro Gln Trp sm ES85 mem" Gin Phe Leu Pro Asn Ile His Pro Pro Thr Leu Ala His His &Pro His 110

Pro Arq APro Ser Phe Thr Ala Ile &Pro Pro Lys Lys Thr Gln Asp Lys 120

Thr Ala Ile Pro Ile Ile Asn Thr Ile Ala Thr Val Glu Pro Thr Leu mmm 135 140 Ile Pro Thr Thr Glu Pro Ile Val Asn Thr Val Val Thr Pro Glu Ala

Ser Ser Glu Phe Ile Thr Ser Thr 8Pro Glu Thr Thr Thr Val Gin Val 165 ? | 175 Ala Ser Pro Val Ala 180

< 210 > SEQ ID NO 18 < 211 > LENGTH : 546 < 212 > TYPE : DNA < 213 > ORGANISM : Physeter catodon < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 18 atgaagagtt ttttactagt tgtgactatc ctggcattaa ccctgccttt tttgagtgca 60 gaggggcaaa accaggaaca atcaacacgc tgtgagaatg atgaaagatt gttcaataaa 120 aaaacagtaa aatatatccc aattcattat gtgctgagta ggtatcctag ttatggacto 180 aattactacc agcacagacc agttgcacta attaataacc aatttatgcc atacctatat 240 tatgcaaagc cagttgtagt tagcccacat gcccaaattc ctcaatggca attcctgcca 300 aatatccacc cacctactct ggcacatcac ccacacccacgtccatcatt tactgccato 360 ccaccaaaga aaactcagga taaaacagca atccctatca tcaataccat tgctactgtt 420 gagcctacac ttatacctac cactgaacca atagtgaaca ctgtagttac tccagaagct 480 tcctcagaat tcatcacgag tacacctgag accaccacag tocaagttgc ttcacctgtg 540

gcctaa 546

< 210 > SEQ ID NO 19 < 211 > LENGTH : 165 < 212 > TYPE : PRT < 213 > ORGANISM : Tachyglossus aculeatus < 220 > FEATURE : AAAAA)< 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 19 Met Lys Thr Leu Leu Leu Val Gly Gly Ile Leu Val Met Thr Val Cys 10 15 US 9 ,924 , 728 B2 96 - continued Phe Ser Ala Ala Glu Asp Glu Glu Trp Lys Lys Val Asp Tyr Ser Glu 13 0 Ser Glu Glu Arg Trp Leu Arg Leu Lys Arg Gin Pro Ser Phe Pro Phe 40 45 Ser Phe Gin Gly Lys Pro Glu Arg Asn Ile Pro Arg Pro Tyr Tyr Pro

Arg Pro Phe Leu Asn Ile Pro Arg Pro Tyr Thr Ile Asn Pro Glu His 70 75 Gln Phe Ala Tyr Val Phe Pro Asn Leu Lys Phe Gin Ile Pro Ser Val

Phe Pro Phe Pro Leu Glu Phe Leu Pro Pro Phe Tyr Pro Phe Val His 110 Pro Ile Tyr Tyr Gly Pro Gln Thr Ser Thr Pro Pro Arq Asn Pro Thr 120 125 Val Thr Ser GinGin Thr Propro Glncun Propro Propro Val HisHis Ser Ser Ala Asn Thr Pro Glu Ser Ala Thr Ala Ala Pro Val Thr Ala Thr Pro Met Ala Gln mmm145145 | 150 155 160 Thr Pro Leu Gun Pro 165

< 210 > SEQ ID NO 20 < 211 > LENGTH : 498 | < 212 > TYPE : DNA < 213 > ORGANISM : Tachyglossus aculeatus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 22 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 20 atgaagactc tactactggt tggaggtatc ctggttatga ccgtttgctt ctccgcggca | 60 gaggacgagg aatggaaaaa ggttgattac agcgagagtg aagaaagatg gttgaggctg 120 aagcgccagc caagctttcc ctttagcttc caaggcaaac ctgagagaaa catcccacgt 180 ccttattacc ctcgaccatt tctaaatatt ccccgcccct acacgatta a CCctgagcac 240 caattcgcct atgtttttcc caacttgaag ttccaaatcc caagtgtatt tccatttccc 3000 ctggaattcc tcccaccttt ctatcccttt gttcatccca tctattatgg ccctcaaacc 360 tcaacccctc ccagaaatcc caccgtgacc agccaaactc cacagccccc tgtccattcc 420 tccgccaata ccccggagtc tgctactgct gcccccgtga ctgctacccc catggcccaa 480

actcccctcc aaccttaa 498

< 210 > SEO ID NO 21 < 211 > LENGTH : 178 < 212 > TYPE : PRT < 213 > ORGANI SM : Trichosurus Vulpecula < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . ( 0 ) 3 > OTHER INFORMATION : Cagein k < 400 > SEQUENCE : 21 Met Lys Val Leu Phe Leu Thr Val His Ile Leu Ala Val Met Val Cys 1 10 15 Phe Ser Thr Ala Asp Leu Asp Trp Glu Lys Trp Pro Cys 8??Asp Lys Gin 20 25 36 Asn Glu Arg Gin Ser Glu Leu Arg Gin Gin Pro Leu Arg Arg Ser Pro US 9 , 924 , 728 B2 97 98 - continued | | 40 45

3Val JGin Tyr gVal Tyr Thr Pro ETyr Thr His Gin Ser Tyr Val Pro Val 1?2 |AE&55 Ile Tyr SE&JPro &Pro Arg Ala Tyr 3Val IArg His Pro Tyr Phe Ser Arg Val 70 80 80 Ala Trp Gin Lys Pro Tyr Pro 8Ser Tyr Met Pro Leu Leu Pro Ser Ile 890 95 Tyr Pro Trp Ser Val Val Ser Arg Asn Leu His Pro Ala Phe Ala Phe 100

Asn Pro &Pro His Tyr Ala JGin Leu &Pro Val Pro Ser Ser Pro Thr Asn 120 125

Ser &Pro Thr Thr Thr Ile Gin ?Thr ?Thr Asn Ile Pro Ile Thr Asn Pro 135

Thr Ser Thr Ile Val Thr &Pro Ala Val Ser Ser Lys Ser Ala Ala Thr 150 1g 160 Glu Asp Ser Ala Ala Ala Ala Met Leu Thr Ser Pro Thr Ala Ala Gin 170 ) 175 Met Ala sam < 210 > SEQ ID NO 22 < 211 > LENGTH : 537 < 212 > TYPE : DNA < 213 > ORGANISM : Trichosurus Vulpecula < 220 > FEATURE : 219 NAME / KEY : misc _ feature

222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 22 atgaaggtcc tattcttgac tgtgcatatt ctggcagtaa tggtgtgctt ctcaactgct | 60 gacttggact gggaaaaatg gccttgcgat aagcaaaatg aaagacagtc tgagctgaga 120 caacagccac tcagacggtc ccctgtccaa tatgtctaca ccccatatac acatcaatca 180 tacgtgccag tcatttatcc accaagggca tatgtacgtc atccatattt ctctagagta 240 gcatggcaga aaccatatcc ctcctatatg ccactgctgc ccagtatcta cccttggtct 300 gtggtttcta gaaacctaca ccctgcattc gcttttaatc cccctcatta tgcccagctt 3600 ccagtaccat caagtccaac caacagcccc acaactacca ttcagactac aaacattccc 420 atcactaacc ccacaagcac tatagtcacc ccagctgtct cctccaagtc tgcggccaca 480 gaggatagcg cagctgctgc aatgttgact tccccaaccg ctgctcagat ggcataa 537

< 210 > SEQ ID NO 23 < 211 > LENGTH : 178 < 212 > TYPE : PRT < 213 > ORGANI SM : Monodelphis domestica < 220 > FEATURE :

AAAA 2 < 221 > NAME / KEY : VARIANT < 2222 > LOCATION : ( 0 ) . . ( 0 ) AAA< 2232 > OTHER INFORMATION : Casein k < 400 > SEQUENCE : 23

Met Lys Val Leu Phe Leu Ile Gly His Ile Leu Leu Ala ?Met Val Cys - ? ? Phe Ser Thr Ala Glu Leu Asp Trp Arg Lys Trp Pro Cys Glu Lys Gin 20 25 RE Met Glu Arg Pro Ser Glu Leu ?Glu ?Gin Gin Pro Pro Gly Gin Pro Pro 35 40 US 9 , 924 , 728 B2 99 100 - continued | Val Gin Asp Val Tyr Thr Arg Tyr Thr Arg Gin Ile Tyr Val Pro Ile & 55 60

Leu Tyr Ala Pro Lys Thr Ser Ile Gin ETyr &Pro Tyr Phe Ser Lys Leu 65 2 75 80 Ala Trp Gin Arg Pro Tyr Ala Ala Tyr Ile Pro Leu Leu Ser Ser Arg Tyr Pro Trp Pro Val Ile Pro Arg Ser Pro His Pro Ser Phe Ala Phe 105 110

Asn Pro Pro Gln Tyr Ala Ara mmmVal &Pro Ala Pro Ser Gly Pro Thr Ser 115 120 125 gSer A Pro Ala Ala Pro Met Glu Thr Thr Thr Ile Pro Ser Thr Ser Thr 135 140 Val Ala Ala Thr Val Thr Pro Asp Ala Thr Ser Lys Phe Val Thr Thr 145 150 155 160 Glu Tyr Ser Thr Thr Ala Thr Ile Pro Thr Ser Pro Ile Pro Glu Gin 165 170 & Gin Pro

< 210 > SEQ ID NO 24 < 211 > LENGTH : 537 < 212 > TYPE : DNA 13 > ORGANISM : Monodelphis domestica < 220 > FEATURE : < 221 > NAME / KEY : misc _feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein k cDNA < 400 > SEQUENCE : 24 atgaaggtcc tgttcttgat tgggcatatt ctgttggcaa tggtgtgctt ctctactgct 60 gaactggact ggaggaaatg gccttgcgag aagcaaatgg aaagaccatc ggagctggaa 120 caacagccac ccggacagcc ccctgtccaa gacgtctaca cccgatacac ccgtcagato 180 tacgtaccca tcttgtatgc acccaagact tccatccagt atccatattt ctctaagcta 240 gcctggcaga gaccatatgc tgcctacata ccactgctgt ccagtcgcta cccgtggcct 300 gtgattccta gaagcccaca cccttccttc gottttaatc ccccacaata tgcccgggtt 360 ccagccccat caggtcctac cagcagcccc gcagctccca tggagactac aaccattccc 420 agcacgagca ccgtagctgc gactgtcacc cccgacgcca cttctaaatt tgtaaccacc 480 gagtatagca caactgcaac aatcccaact tccccaatcc ctgaacagca accatga 537

< 210 > SEO ID NO 25 < 211 > LENGTH : 224 < 212 > TYPE : PRT < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Cagein beta < 400 > SEQUENCE : 25 ?Met Lys Val Leu Ile Leu AlaAla cysCys LeuLeu Valval Ala Leu Ala LeuLeu Ala AraArg 5 15 Glu Leu Glu Glu Leu Asn Val Pro Gly Glu Ile Val Glu Ser Leu Ser 20 25 30

Ser Ser Glu Glu Ser Ile ?Thr Arg Ile Asn Lys Lys Ile Glu Lys Phe 35 40 ???

Gin Ser 3Glu Glu Gin Gin Gin Thr Glu Asp Glu Leu Gin Asp Lys Ile 50 55 ?? US 9 , 924 , 728 B2 101 102. - continued

His Pro ?Phe Ala Gin Thr Gln Ser Leu SValE Tyr &Pro Phe& Pro 3 Gly Pro 75 & e& Ile Pro Asn Ser Leu Pro Gln Asn Ile &Pro & Pro Leu ?Thr Gln Thr Pro %95 Val Val Val Pro Pro Phe Leu Gin Pro Glu Val Met Gly Val Ser Lys 100 105 | 110

Val Lys Glu Ala Met Ala Pro Lys His Lys3 Glu Met Pro Phe Pro Lys 120

Tyr Pro Val Glu Pro Phe ?Thr Glu Ser Gin Ser Leu Thr Leu ?Thr Asp 135 Val Glu Asn Leu His Leu Pro Leu Pro Leu Leu Gin Ser Trp Met His 155 Gln Pro His Gin Pro Leu Pro Pro Thr Val Met Phe Pro Pro Gln Ser 175 Val Leu Ser Leu Ser Gin Ser Lys Val Leu Pro Val Pro Gln Lys Ala 180 185 190 Val Pro Tyr Pro Gin Arg Asp Met Pro Ile Gin Ala Phe Leu Leu Tyr 200

Gin Glu Pro Val Leu Gly Pro Val 2Arg Gly Pro Phe Pro Ile Ile Val mmmmmmm 215 | 220 < 210 > SEQ ID NO 26 < 211 > LENGTH : 780 1 < 212 > TYPE : DNA < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . ( 0 ) < 223 > OTHER INFORMATION : Cagein beta cDNA < 400 > SEQUENCE : 26 atgccattaa atactatata taaacaacca caaaatcaga tcattatcca ttcagctcct 60 ccttcacttc ttgtcctcta ctttggaaaa aaggaattga gagccatgaa ggtcctcatc 120 cttgcctgcc tggtggctct ggcccttgca agagagctgg aagaactcaa tgtacctggt 180 gagattgtgg aaagcctttc aagcagtgag gaatctatta cacgcatcaa taagaaaatt 240 gagaagtttc agagtgagga acagcagcaa acagaggatg aactccagga taaaatccac 300 ccctttgccc agacacagtc tctagtctat cccttccctg ggcccatccc taacagcctc 360 ccacaaaaca tccctcctct tactcaaacc cctgtggtgg tgccgccttt ccttcagcct 420 gaagtaatgg gagtctccaa agtgaaggag gctatggctc ctaagcacaa agaaatgccc 480 ttccctaaat atccagttga gccctttact gaaagccaga gcctgactct cactgatgtt 540 gaaaatctgc accttcctct gcctctgctc cagtcttgga tgcaccagcc tcaccagcct 600 cttcctccaa ctgtcatgtt tcctcctcag tccgtgctgt ccctttctca gtccaaagtc 660 ctgcctgttc cccagaaagc agtgccctat ccccagagag atatgcccat tcaggccttt 720 ctgctgtacc aggagcctgt actcggtcct gtccggggac ccttccctat tattgtctaa 780

< 210 > SEQ ID NO 27 < 211 > LENGTH : 222 < 212 > TYPE : PRT < 213 > ORGANISM : Capra hircus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) 223 > OTHER INFORMATION : Casein beta US 9 , 924 , 728 B2 | 103 | 104 - continued < 400 > SEQUENCE : 27 ?Met Lys Val Leu Ile Leu Ala ECys Leu Val Ala Leu Ala Ile Ala Arg | 15

Glu Gin Glu Glu Leu Asn Val Val Gly Glu ?Thr 3Val Glu Ser Leu Ser 20 525 30 Ser Ser Glu Glu Ser Ile Thr His Ile Asn Lys Lys Ile Glu Lys Phe 35 40 Gln Ser Glu Glu Gin Gin Gin Thr Glu Asp Glu Leu Gln Asp Lys Ile

His Pro Phe Ala Gln Ala Gln Ser Leu Val ETyr Pro Phe Thr Gly Pro 70 80

Ile Pro Asn Ser Leu Pro Gln Asn Ile Leu &Pro Leu Thr Gln Thr Pro

Val Val Val Pro Pro Phe Leu Gin Pro Glu Ile Met Gly Val Pro Lys 100 105 | 110

Val Lys Glu ?Thr Met Val Pro Lys His Lys Glu Met Pro Phe Pro Lys 115 120 Tyr Pro Val Glu Pro Phe Thr Glu Ser Gin Ser Leu Thr Leu Thr Asp

Val Glu Lys Leu His Leu &Pro Leu Pro Leu Val Gln Ser Trp Met His 150 160

Gln &Pro Pro Gln Pro Leu Ser Pro Thr Val Met Phe Pro Pro Gin Ser

Val Leu Ser Leu Ser Gin Pro Lys Val Leu Pro Val Pro Gln Lys Ala 180 185 190

Val &Pro Gln Arg Asp Met Pro Ile ?Gln Ala Phe Leu Leu Tyr Gln Glu 195 200

?Pro Val Leu Gly Pro Val Arg Gly Pro Phe Pro Ile Leu Val 210

< 210 > SEQ ID NO 28 < 211 > LENGTH : 669 < 212 > TYPE : DNA < 213 > ORGANISM : Capra hircus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature AAAAA< 222 > LOCATION : ( 0 ) . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 28 atgaaggtcc tcatccttgc ctgtctggtg gctctggccammm ttgcaagaga gcaggaagaa 60 ctcaatgtag tcggtgagac tgtggaaagc ctttcaagca gtgaggaatc tattacacac 120 atcaataaga aaattgagaa gtttcaaagt gaggaacaac agcaaacaga ggatgaactc 180 caggataaaa tccacccctt tgcccaggca cagtctctag tctatccctt cactgggccc 240 atccctaaca gcctcccaca aaacatcctg cctcttactc aaacccctgt ggtggtgccg 300 cctttccttc agcctgaaat aatgggagtc cccaaagtga aggagactat ggttcctaag 360 cacaaagaaa tgcccttccc taaatatcca gttgagccct ttactgaaag ccagagcctg 420 actctcactg atgttgaaaa gctgcacctt cctctgcctc tggtccagtc ttggatgcac 480 cagcctcccc agcctctttc tocaaccgtc atgtttcctc ctcagtccgt gctgtccctt 540 tctcagccca aagttctgcc tgttccccag aaagtagtgc cccagagaga tatgcccato 600 caggcctttc tgctgtacca ggagcctgta cttggtcctg tccggggacc cttccctatt 660

cttgtctaa 669 US 9 , 924 , 728 B2 105 106 - continued

< 210 > SEQ ID NO 29 < 211 > LENGTH : 244 < 212 > TYPE : PRT ORGANISM : Felis catus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 29 Met Lys Val Leu Ile Leu Ala ECys Leu Leu Ala Leu Ala Leu Ala Arq Cys Leu 10Leu Ala Leu Ala Leu Ala Arg

u Lys Glu Glu Leu ?Thr Val nSer Thr Glu ?Thr Val Glu Ser Leu Ser 25 Ser Ser Glu Glu Ser 4Ile Thr His Ile Asn Lys Gin Lys Leu Glu Asn 35 40 ge1 Leu Lys Arg Glu Glu Gin EdS&Gin 23Gin Arg Gin Glu Glu Arg Gin Asn Lys 55

Ile His &Pro gVal Phe SGln Pro 1Gln Pro Leu Val Tyr Pro Tyr Ala Glu 70 3gp Pro Ile &Pro Tyr Pro Val Leu Pro Gln Asn Ile Leu Pro Leu Ala Gln 85 90 Pro Ala Met Val Leu Pro Phe Leu Gin Pro Glu Ile Met Glu Ile Pro 105 110 Lys Val Lys Glu Thr Ile Phe Pro Arg Arg Lys Val Met Pro Ile Leu RS 115 120 Lys Ser Pro Val Val &Pro Ser Leu Asp Ser Gln Ile Val Asn Leu Pro 135 Asp Leu Glu Ser Leu His Leu Pro Leu Pro Leu Pro Leu Ser Leu Leu 150 160

Gln Pro Leu Met His Gln Ile Pro Gln Pro Leu Pro Gln Thr Thr Met 165 170

Leu &Pro Pro Gin Pro Leu Leu Ser Ile Pro Gin Pro Lys Val Met Pro 185 | 190 Phe Pro Gin Gin Ile Val Pro Tyr Leu Gin Arg Asp Met Pro Val Gln 195 200 Thr Leu Leu Leu Tyr Gin Asp Ala Thr Arg Glu Ala Gin Pro Val Thr 215

Ala Pro Ala Tyr Asn &Pro Val Ile Val Ser Pro Asn Leu Ile Ile Pro 230 mmm 240 Leu Ser His Leu

< 210 > SEO ID NO 30 < 211 > LENGTH : 735 < 212 > TYPE : DNA < 213 > ORGANISM : Felis catus mmmmm < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 22 > LOCATION : ( 0 ) . . . ( 0 ) AAAA 3 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 30 atgaaggtcc tcatcctcgc ctgcctgctg gotcttgctc ttgcaagaga gaaggaagaa 8 ctcactgtat ccactgagac tgtggaaagt ctttcaagca gtgaggaatc tattacacac atcaacaagc agaaacttga gaatcttaaa cgtgaggage agcagcagag acaggaggaa 1800 cgccagaata aaatccaccc cgttttccag ccacagcctc tagtctatcc ttatgctgag 240 US 9 , 924 , 728 B2 107 108 - continued

cccattcctt accctgttct tccacagaac atccttcccc ttgctcagcc tgctatggtg 300 ctgcctttcc ttcagcctga aataatggaa atccccaaag ttaaggagac catctttccc 360 aggcgcaaag tgatgcccat tctgaaatct ccagtagtgc cctctttgga cagccaaatc 420 gtgaatctcc ctgatcttga aagtctgcac ttgcctctgc ctctgcctct gtctctactc 480 cagcccctga tgcaccagat cccccagcct cttcctcaga ctaccatgct tcctcctcag 540 ccactgctgt ccatcccaca gcccaaagtc atgccttttc cccagcaaat tgtgccctac 600 ctccagagag acatgcccgt gcaaacccta ctgctgtacc aggatgccac ccgtgaggcc 660 caacctgtga ctgccccagc ttacaatcct gttattgtaa gtccaaactt aataattccg 720 ctgtctcact tatga 735

< 210 > SEQ ID NO 31 < 211 > LENGTH : 225 < 212 > TYPE : PRT 13 > ORGANISM : Homo sapiens < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 31 | Met Lys Val Leu Ile Leu Ala Cys ?Leu Val Ala Leu Ala Leu Ala Ara | 915 | Glu Thr Ile Glu Ser Leu Ser Ser Ser Glu 3Glu Ser Ile Thr Glu Tyr 30

Lys Lys Val Glu Lys Val Lys His Glu Asp Gin 3Gin Gin Gly Glu Asp 135 40 45

Glu His Gin Asp Lys Ile Tyr Pro Ser Phe Gin Pro Gin &Pro Leu Ile 50 55 8

Tyr Pro Phe Val Glu Pro Ile &JPro Tyr Gly Phe Leu &Pro Gin Asn Ile 65 70 75

Leu Pro Leu Ala Gln Pro Ala Val Val Leu Pro Val Pro Gln Pro Glu 95 Ile Met Glu Val Pro Lys Ala Lys REAsp Thr Val Tyr Thr Lys Gly Arg 110

Val Met Pro Val Leu Lys Ser &Pro Thr Ile Pro Phe Phe Asp Pro Gin 115 120 125 Ile Pro Lys Leu Thr Asp Leu Glu Asn Leu His Leu Pro Leu Pro Leu 130 135

Leu Gln Pro Leu Met Gln Gln Val Pro Gln Pro Ile Pro Gln Thr Leu 145 150 155 Ala Leu Pro Pro Gin Pro Leu Trp Ser Val Pro Gin Pro Lys Val Leu 175 Pro Ile Pro Gin Gin Val Val Pro Tyr Pro Gin Arg Ala Val Pro Val 190

Gln Ala Leu Leu Leu Asn Gin Glu Leu Leu Leu Asn Pro Thr His Gin 195 mmmmmmm 200 205 Ile Tyr &Pro Val Thr Gln Pro Leu Ala &Pro Val His Asn Pro Ile Ser 210 215 . Val 225

< 210 > SEQ ID NO 32 < 211 > LENGTH : 678 US 9 , 924 , 728 B2 109 110 - continued < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 220 > FEATURE : < 221 > NAME / KEY : misc feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 32 atgaaggtcc tcatcctcgc ctgcctggtg gctcttgctc ttgcaaggga gaccatagaa 60 agcctttcaa gcagtgagga atctattaca gaatacaaga aagttgagaa ggttaaacat 120 gaggaccagc agcaaggaga ggatgaacac caggataaaa tctacccctc tttccagcca 180 cagcctctga tctatccatt cgttgaacct atcccctatg gttttcttcc acaaaacatt 240 ctgcctcttg ctcagcctgc tgtggtgctg cctgtccctc agcctgaaat aatggaagtc 300 cctaaagcta aagacactgt ctacactaag ggcagagtga tgcctgtcct taaatctcca 360 acgataccct tttttgaccc tcaaatccca aaactcactg atcttgaaaa tctgcatctt 420 cctctgcctc tgctccagcc cttgatgcag caggtccctc agcctattcc tcagactctt 480 gcacttcccc ctcagcccct gtggtctgtt cctcagccca aagtcctgcc tatcccccag 540 caagtggtgc cctaccctca gagagctgtg cctgttcaag cccttctgct caaccaagaa 600 cttctactta accccaccca ccagatctac cctgtgactc agccacttgc cccagttcat 660 aaccccatta gtgtctaa 678

< 210 > SED ID No 33 < 211 > LENGTH : 263 < 212 > TYPE : PRT < 213 > ORGANISM : Loxodonta Africana < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) 223 > OTHER INFORMATION : Cagein beta

< 400 > SEQUENCE : 33 | Met Lys Val Phe Ile Leu Ala ECys Leu Val Ala Phe Ala Leu Gly Arg in

Glu Thr Val Glu Asn Leu Ser Ser nSer 3Glu Ile IArg Gin Phe ETyr Ser mm 25 30 Glu Gin Lys Pro Glu Gly Val Lys His Glu Glu Gin Gin Arg Glu Asp 35 40 45

Glu His Gin Asn Lys Ile SGin &Pro Leu Phe Gin &Pro Gin Pro Leu Val

Tyr Pro Phe Ala Glu &Pro Ile APro ETyr Thr Val Phe Pro &Pro Asn Ala 70 | 75 80

Ile Pro Leu Ala Gin &Pro Ile BVal Val Leu Pro Phe &Pro JGin Pro Glu Rºse&? &g Val Lys Gin Leu Pro Glu Ala Lys Glu Ile Thr Phe Pro Arg Gin Lys 105 110

Leu Met Ser Phe Leu Lys Ser &Pro Val Met Pro Phe Phe Asp Pro Gln 115 120 125

Ile Pro Asn Leu Gly Thr Asp Leu Glu Asn Leu His Leu Pro Leu &Pro

Leu Leu Gin Pro Leu Arg His JGin Leu His Gin Pro Leu Ala Gln Thr 145 150 155 160

Pro Val Leu &Pro Leu &Pro Leu Ser Leu Pro Lys Val Leu Pro Val Pro 175 Gin Gin Val Ile Pro Tyr Pro Gin Arg Gly Arg Pro Ile Gin Asn Leu US 9 , 924 , 728 B2 111 112 - continued | 180 190 Gin Leu Tyr Glu Glu Pro Leu Leu Asp Pro Thr Arg Lys Ile Tyr Pro 200

Val Ala 3Gln Pro Leu Ala Pro Val Tyr Asn Pro Val Ala Tyr Met Ile 215

Gly Ile Pro Cys Cys Ser Thr Leu Leu Thr ETyr Leu His Gln Ser Ser ?mm225 &RE 230 240 Arq Ser Gin Tyr Pro Ile Gln Asn Lys Leu Gly Tyr Leu Ile Ala Met He2 245 Pro Lys Lys Val Arg Pro Thr 260

< 210 > SEQ ID NO 34 < 211 > LENGTH : 792 < 212 > TYPE : DNA < 213 > ORGANISM : Loxodonta Africana < 220 > FEATURE : > NAME / KEY : misc _ feature 2 > LOCATION : ( 0 ) . . . ( 0 ) AAAAA< 223 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 34 atgaaggtct tcatccttgc ctgcctggtg gottttgctc ttggaagaga gactgtagaa 60 aatctttcaa gcagtgagat aagacaattt tattcagagc aaaaacctga gggagttaag 120 catgaggaac agcaaagaga ggatgaacat cagaataaaa tccagcccct tttccagcca 180 cagcctctag tctatccttt cgctgagccc attccttata ctgtctttcc accaaacgcc 240 attcctcttg ctcagcctat tgtggtgctg cctttccctc agcctgaagt aaagcaacto 300 cctgaagcta aagaaatcac ctttcctagg caaaaattga tgtccttcct taagtctcca 360 gtaatgccct tttttgatccccagatccca aatcttggga ccgatcttga aaatctgcac 420 cttcctctgc ctctgctcca gcccttaaga caccagctcc accagcctct tgctcagact 480 ccagtgcttc ctcttcctct atccttgccc aaagtcctgc ccgttcccca gcaggtgata 540 ccctatcccc agagaggtag acccatccaa aaccttcaac tgtacgaaga gcctctactt 600 gacccaaccc gtaagatcta cccagtggct caaccacttg ctccagttta taaccctgtt 660 gcttacatga taggtattcc ctgttgctca acattgctca catacttaca ccagagcagt 720 aggagccagt atcccatcca gaataaactg ggttacttaa tagcaatgcc aaagaaagta 780 cgacctacat ga 792

< 210 > SEQ ID NO 35 < 211 > LENGTH : 302 < 212 > TYPE : PRT < 213 > ORGANISM : Macropus eugenii < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Cagein beta < 400 > SEQUENCE : 35 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Leu Gly Phe Ala Arg n | 5 10 15 Pro Met Val Glu Lys Ile Ser Glu Ser Glu Glu Tyr Val Asn Glu Val 20 25 30 Pro Glu Lys Arg Leu Lys Arg Arg Phe Pro Val Lys Asn Glu His Gin 35 40 45 1g Val Glu Ile Asn His His Leu Arg Pro Glu Ser Glu Met Met Ser Leu US 9 ,924 , 728 B2 113 114 - continued | 8 60 ETyr Tyr Gln Pro Phe Tyr Trp Ser Glu Glu Met Ara Asn Leu Lys Met 70 . 80 23 Thr Ser Leu Pro Lys Asp Arg Arg Met Ala Val Leu Lys Ser Thr Val 90 95

Ser Asp Glu Val Phe Pro Ser Leu Gin His Lys Ser Leu Ser ?Leu Pro 105 110 Lys Ser Lys Val Gin Pro Leu Ser Arg Gin Gin Ile Leu Thr Phe His 115 120 Thr Leu Gln Met Val Pro Leu Ser His Lys Leu Leu Thr Thr Pro Lys 140 Arg Glu Met Leu Pro Ile Tyr Glu Arg Glu Arg Leu Pro Ala His Lys 150 160 Arg Glu Ser Leu Leu Ala His Glu Arg Glu Ser Leu Leu Ala His Glu 170 175 Arg Asp Ile Leu Val Pro Gin Arg Glu Met Ser Phe Val Pro Glu Arg 185 190 Glu Phe Leu Phe Ala Ser Glu Arg Val Val Leu Pro Glu Gin Glu Lys 195 200 Glu Ile Leu His Asn Asp Glu Arg Glu Val Leu Ala Val His Lys Lys mm 220 Glu Ile Leu Pro Pro Phe Glu Lys Glu Lys Val Leu Pro Leu Leu Gin mmmm 230 240 His Arg Val Val Pro Leu Pro Gin Arg Glu Ile Val Pro Pro Phe Gin 250 255 Arg Glu Thr Leu Leu Pro Glu Glu Ile Leu Pro Val Asn Gin Trp Glu mmm 265 270

Leu Met &Pro Glu Val Val Pro Phe Asp Pro Tyr Pro Phe Leu Gin Pro 275 280 Val Ala Pro Phe Tyr Tyr Ser Thr Glu Leu Asn Glu Lys Asn 290 mmmmm 300

< 210 > SED ID NO 36 < 211 > LENGTH : 263 < 2122 > TYPE : PRT < 213 > ORGANISM : Monodelphis domestica < 220301 > FEATURE : 1222 mmmmm < 221 > NAME / KEY : VARIANT < 222222 > LOCATION : ( 0 ) . ( 0 ) |AAAAA< 22323 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 36 Met Lys Leu Leu Ile Leu Ser Cys Leu Val Ala Leu Ala Val Ala Arg 15

Pro Met Val Glu Lys Ile Ser Glu Thr Glu Glu Phe Val ?Thr Val Ile 20 25

&Pro 3 Glu Gin Gin Ile Arg Arg Glu Asp Val Pro Val Lys Asn Glu Arg 40

His Pro Glu Ile Asn Ara Phe Ile &Pro Leu Glu Ala Glu Thr Met Ser mm 55 Phe Tyr Val &Pro mm5Val Tyr Trp Pro Glu Glu Met Arg Asp Ala Lys Met 70 Thr Ser Pro Leu Lys Glu Lys Arg Met Thr Leu Ala Asn Pro Ile Ala mm 95 Pro Glu Glu Glu Leu Pro His Leu Gin His Lys mmmmSer Leu Ser Leu Ala Gin His Lys Ser Leu ser Leu Ala 100 am 105 gp US 9 , 924 , 728 B2 115 116 - continued

Lys Gin Arg ?Phe Leu Ala Ser Leu Arg Pro Lys Ala Ala Gin &Pro Phe 115 120 125

ETyr Ala &Pro Arq ?Met Ala Pro Leu Pro His Lys Leu Phe Thr Met Pro ? 140

Lys Glu Gln Ala Leu Pro Ile Ala Lys Arg Asp Met Leu Ser Ala Ala 150 The als Eye Arg Arg Lear ser ale 160 Glu Leu Val Ile Pro Ala Val His Glu Ara Val Ile Pro Ala Ile Asp 170 175

Lys Arg Glu &Pro Leu Pro Leu Leu Ala Arg Glu Met Pro Ala Leu Pro 185 mg 88 190 Asp Lys Glu Ile Gin Gin Leu Ala Val Pro Phe Val Arg Arg Glu Ser 195 200 205

Ala Leu &Pro His Gin Ara Ala Ile Val Pro Val Ala Thr Ala Ala Ala 220

Ala Val Arq Glu Ser Leu Pro Leu Val Gin Gin Glu Val Val &Pro Pro 230 8 240

Ile Met Pro Leu Asp Val ETyr Leu Val Arg His Pro Glu Val Ser Phe 250 255 Tyr Asn Pro |Thr Glu Lys Tyr mmmm A mg 260

< 210 > SEQ ID NO 37 < 211 > LENGTH : 792 < 212 > TYPE : DNA < 213 > ORGANISM : Monodelphis domestica < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) | < 223 > OTHER INFORMATION : Cagein beta cDNA < 400 > SEQUENCE : 37 atgaagctcc tcatcctcag ctgccttgtg gctcttgctg ttgccaggcc tatggtggaa 60 aagatctcag aaactgagga atttgtcacc gtcatcccgg agcaacagat caggagagag 120 gacgtcccag taaagaacga gcgtcatcct gaaatcaacc gctttattcc ccttgaagct 180 gaaacgatga gottttacgt gcccgtttac tggcccgaag aaatgcgtga cgccaagatg 240 accagccctc taaaagagaa gagaatgacc ctcgctaacc ctattgcccc ggaggaagag 300 ctccctcacc tgcagcacaa atctctgtct ctcgctaagc aaagattcct ggcttctctt 360 cgccccaagg cggcgcagcc cttctatgcc ccaaggatgg cccctctccc tcacaaactg 420 tttaccatgc ccaaggagca ggcgctgcct attgccaaga gagacatgct gtccgccgcc 480 gagctcgtca tccctgcagt gcacgagaga gtcattccag ccattgacaa gagagagccc 540 ctgccgcttc ttgcgagaga gatgccagct cttcccgaca aagagattca acaactggct 600 gtgcccttcg tccgcagaga gagcgcgctc cctcaccaga gagccatcgt gcctgtcgcc 660 accgccgccg ccgccgtgag ggagagcctg cctctggtcc agcaggaagt cgtgcctccc 720 atcatgcctc tcgatgtcta cctggtccgc cacccagagg tcagcttcta caatcccacc 780 gagaagtact aa 792.

< 210 > SEO ID NO 38 < 211 > LENGTH : 260 < 212 > TYPE : PRT 4 213 > ORGANISM : Mammuthus primigenius < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) US 9 , 924 , 728 B2 117 118. - continued < 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 38 | Met Lys Val Phe Ile Leu Ala Cys Leu Val Ala Phe EAla Leu Gly Arg 15 Glu Thr Val Glu Asn Leu Ser Ser Ser Glu Ile Arg Gin ?Phe ETyr Ser 20 Glu Gin Lys Pro Glu Gly Val Lys His Glu Glu Gin Gin Arg Glu Asp 135 ??8g40 8TSR Glu His Gin Asn Lys Ile Gin Pro Leu Phe ?Gin Pro Gin &Pro Leu Val 55

Tyr Pro Phe Ala Glu Pro Ile Pro Tyr Thr Val Phe .Pro &Pro Asn Ala 70 75 Ile Pro Leu Ala Gln Pro Ile Val Val Leu Pro mePhe Pro Gln Pro Glu 85 95

Val Gln Leu Pro Glu Ala Lys Glu Ile Thr Phe Pro Arq SGln Lys Leu 100

Met Ser Phe Leu Lys Ser Pro Val Met Pro Phe Phe Asp &Pro Gin Pro 115 120 Asn Leu Gly Thr Asp Leu Glu Asn Leu His Leu Pro Leu Pro Leu Leu 135

Gln Pro Leu Arq His Gin Leu His gGin Pro Leu Ala Gln ?Thr Pro Val 5sm 150 155 160 Leu Pro Leu Pro Leu Ser Leu Pro Lys Val Leu Pro Val Pro Gin Gin 165 175 Val Ile Pro Tyr Pro Gin Arg Gly Arg Pro Ile Gin Asn Leu Leu ETyr 180 A Glu Glu mmmPro mmmLeu Leu Asp Pro Thr Arq Lys Ile Tyr Pro Val Ala Gln 195 200 E Pro Leu Ala Pro Val Tyr Asn ?Pro Val Ala Tyr Met Ile Gly Ile Pro 215 8? Cys Cys Ser Thr Leu Leu Thr Tyr Leu His Gin Ser Ser Ara Ser Gin 230 235 240 D Tyr Pro Ile Gin Asn Lys Leu Gly Tyr Leu Ile Ala Met Pro Lys Lys 245 255

Val Arq Pro Thr 260

< 210 > SEQ ID NO 39 < 2111 > LENGTH : 717 mmmm < 21212 > TYPE : DNA

1 mm < 2133 > ORGANISM : Mammuthus primigenius < 22020 > FEATURE : < 2222212 1 > NAME / KEY : misc _ feature smmmmm2 < 2222 > LOCATION : ( 0 ) . . . ( 0 ) 2 AAAAA< 2233 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 39 atgaaggtct tcatccttgc ctgcctggtg gottttgctc ttggaagaga gaaggaagaa | 60 attattgtat ctactgagac tgtagaaaat ctttcaagca gtgagataag gcaattttat 120 tcagaggaat ctgttacaca agtcaacaaa caaaaacctg agggagttaa gcatgaggaa 180 cagcaaagag aggatgaaca tcagaataaa atccagccccam ttttccagcc acagcctcta 240 gtctatcctt tcgctgagcc cattccttat actgtctttc caccaaacgc cattcctctt 300 gotcagccta ttgtggtgct gcctttccct cagcctgaag taatgcaact ccctgaagct 360 US 9 , 924 , 728 B2 119 120 - continued aaagaaatca cctttcctag gcaaaaattg atgtccttcc ttaagtctcc agtaatgccc 420 ttttttgacc cccagatgcc aaatcttggg accgatcttg aaaatctgca ccttcctctg 480 cctctactcc agcccttaag acaccagctc caccagcctc ttgctcagac tccagtgctt 540 cctcttcctc tatccttgcc caaagtcctg cccgttcccc agcaggtgat accctatccc 600 cagagaggta gacccatcca aaaccttcca ctgtacgaag agcctctact tgacccaacc 660 cgtaagatct acccagtggc tcaaccactt gctccagttt ataaccctgt tgctgta 717

< 210 > SEQ ID NO 40 < 211 > LENGTH : 228 | < 212 > TYPE : PRT ( 213 > ORGANISM : Oryctolaqus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 40 Met Lys Val Leu Ile Leu Ala ECys ?Leu Val Ala Leu Ala Leu Ala Arg | 5 ? 9 | Glu Lys Glu Gin Leu ?Ser gVal &Pro Thr Glu Ala Val Gly Ser Val Ser & 25

Ser Ser Glu Glu Ile Thr His Ile Asn Lys Gin Lys Leu Glu Thr Ile 35 40 Lys His Val Glu Gin Leu Leu Arg Glu Glu Lys Leu Gin Asp Lys Ile 60 Leu Pro Phe Ile Gin Ser Leu Phe Pro Phe Ala Glu Arg Ile Pro Tyr 65 70

Pro ?Thr Leu Pro Gln Asn Ile Leu Asn Leu Ala Gln Leu Asp Met Leu 85

Leu &Pro Leu Leu Gln Pro Glu Ile Met Glu Asp &Pro Lys Ala Lys Glu 105 Thr Ile Ile Pro Lys His Lys Leu Met Pro Phe Leu Lys Ser Pro Lys 115 120

Thr Val &Pro Phe Val Asp Ser Gin Ile Leu Asn Leu Arq Glu Met Lys 140 Asn Gin His Leu Leu Leu Pro Gin Leu Leu Pro Phe Met His Gin Val 145 150 Phe Gln Pro Phe Pro Gln Thr Pro Ile Pro &EgTyr Pro Gln Ala Leu Leu 165

Ser Leu &Pro Gln Ser Lys Phe Met &Pro Ile Val Pro Gin Val Val Pro 185

Tyr &Pro Gin Arg Asp Met Pro Ile JGin Ala Leu Gin Leu Phe Gin Glu 195 200 Leu Leu Phe Pro Thr His Gin Gly Tyr Pro Val Val Gin Pro Ile Ala 220

?Pro Val Asn Val 225

< 210 > SEQ ID NO 41 < 211 > LENGTH : 687 < 212 > TYPE : DNA < 213 > ORGANISM : Oryctolagus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature V 222 > LOCATION : ( 0 ) . . . ( 0 )

V223 > OTHER INFORMATION : Casein beta cDNA US 9 , 924 , 728 B2 121 122. - continued < 400 > SEQUENCE : 41 atgaaggtcc tcattcttgc ctgcctggtg gctctcgctc ttgcaaggga gaaggaacaa 60 ctcagtgttc ccacagaggc tgtaggaagt gtttccagca gcgaggaaat tacacatatc 120 aacaagcaga aactcgagac gattaagcac gtggaacagc tgctaagaga ggagaaacto 180 caggataaaa tcctcccctt tattcaatca ctctttcctt ttgctgagcg catcccctac 240 cctactcttc cacagaacat cctgaacctt gctcaactcg acatgctgct acctctcctt 3000 cagcctgaaa taatggaaga ccccaaggct aaagagacca ttatccctaa gcacaaactg 360 atgcccttcc ttaaatctcc aaagacggtc ccctttgttg actctcaaat tctgaatctc 420 agggagatga aaaatcaaca ccttcttttg ccccagctcc tgcccttcat gcaccaggtc 480 ttccagcctt ttccccagac tcccattcca tatcctcagg ccctcctctc tcttcctcag 540 tccaaattca tgcctattgt cccacaagtg gtgccctacc ctcaaaggga catgcctatc 600 caagcccttc agctgttcca agaactgett ttccctaccc atcaaggcta ccctgtggtt 660 caaccaatag ccccagttaa tgtctaa 687

< 210 > SEQ ID NO 42 < 211 > LENGTH : 222 < 2121230 > TYPE : PRT 13 > ORGANISM : Ovis aries < 220 > FEATURE : 221 ) NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 42

Met Lys Val ?Leu Ile Leu Ala ECys Leu Val Ala Leu Ala Leu Ala Arq

23 Glu 3Gin Glu Glu Leu Asn Val Val Gly GluThr? 3Val 3Glu Ser Leu Ser & 30 Ser Ser Glu Glu Ser Ile Thr His geIle Asn Lys Lys Ile Glu Lys Phe 35 40 ?3 Gin Ser Glu Glu Gin Gin Gin ?Thr Glu 2Asp Glu Leu Gin Asp Lys Ile

g& His Pro Phe Ala JGin Ala Gin Ser Leu Val Tyr Pro Phe Thr Gly Pro Jae& 3 Ile Pro Asn Ser Leu Pro Gln Asn Ile Leu Pro @Leu Thr Gln Thr Pro

Val Val Val Pro Pro Phe Leu Gin &Pro Glu Ile Met Gly Val Pro Lys 110

Val Lys Glu Thr Met Val 4Pro Lys His Lys Glu Met Pro Phe &Pro Lys 115 120

Tyr Pro Val Glu Pro Phe ?Thr Glu Ser Gin Ser Leu Thr Leu ?Thr Asp

Val Glu Lys Leu His Leu Pro Leu Pro Leu Val Gin Ser Trp Met His

Gln Pro Pro Gin &Pro Leu Pro Pro Thr Val Met Phe Pro &Pro Gln Ser

Val Leu Ser Leu Ser Gin Pro Lys Val Leu Pro Val Pro Gin Lys Ala 190 Val Pro Gin Arg Asp Met Pro Ile Gin Ala Phe Leu Leu Tyr Gln Glu 195 200 mmmmmPro Val Leu Gly Pro Val Arg Gly &Pro Phe Pro Ile Leu Val US 9 , 924 , 728 B2 123 124 - continued

< 210 > SEQ ID NO 43 < 211 > LENGTH : 669 122 TYPE : DNA 13 > ORGANISM : Ovis aries < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein beta cDNA < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : 19 < 223 > OTHER INFORMATION : n = A , T , C or G < 400 > SEQUENCE : 43 atgaaggtcctcatccttnc ctgtctggtg gctctggccc ttgcaagaga gcaggaagaa | 60 ctcaatgtag toggtgagac tgtggaaagc ctttcaagca gtgaggaatc tattacacac 120 atcaataaga aaattgagaa gtttcaaagt gaggaacaac agcaaacaga ggatgaactc 180 caggataaaa tccacccctt tgcccaggca cagtctctag tctatccctt cactgggccc 240 atccctaaca gcctcccaca aaacatcctg cctcttactc aaacccctgt ggtggtgccg 300 cctttccttc agcctgaaat aatgggagtc cccaaagtga aggagactat ggttcctaag 360 cacaaggaaa tgcccttccc taaatatcca gttgagccct ttactgaaag ccagagcctg 420 actctcactg atgttgaaaa gctgcacctt cctctgcctc tggtccagtc ttggatgcac 480 cagcctcccc agcctcttcc tccaaccgtc atgtttcctc ctcagtccgt gctgtccctt 540 tctcagccca aagttctgcc tgttccccag aaagcagtgc cccagagaga tatgcccato 600 caggcctttc tgctgtacca ggagcctgta cttggtcctg tccggggacc cttccctatt 660 cttgtctaa 669

< 210 > SEQ ID NO 44 < 211 > LENGTH : 224 < 212 > TYPE : PRT < 213 > ORGANISM : Physeter catodon < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) AAAAAAAA< 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 44 ?

?Met Lys Val Leu Ile Leu Ala Cys Leu Leu Ala Leu EAla Leu Ala Arg | 5 ? | Glu ?Lys 3Glu Glu Leu Asn 3Val 8Ser ?3?Gly Glu ?Thr 3Val Lys Ser Leu Ser d

Ser Ser Glu Glu Ser Val ?Thr His Met Asn Lys Lys Ile Gly Lys Phe 35 40

Lys His Glu Glu 3Gin Gin 3Gin ?Thr Glu Asp Glu RArg Gln Asp Lys Ile 55

His Arg Phe Ser Gin &Pro Gin Pro Leu Val Tyr Ser Tyr Thr Gly Pro 70 Ile Pro Tyr Pro Ile Leu .Pro Gln Asn Ile Leu Pro Leu 3?Ala Gin Pro Pro Val Leu Val Pro ?Phe Pro 3Gln Pro Gly Ile &??Met Glu Val &Pro Lys

Ala Lys Glu Thr Leu Leu .Pro ?Lys His Lys Glu Met Pro Phe &Pro Lys 115 120

Ser Pro Val Glu Pro Phe Ile Glu Ser Gin Ser Leu Thr Leu Asn Asp 135 US 9 , 924 , 728 B2 125 126 - continued

Leu Glu Asn ?Leu His Leu Pro Leu Pro Leu Leu Gin Ser Leu Met His 150 155

Gln &Pro &Pro His &Pro Leu Pro Pro Thr Pro Met Phe Pro Pro Gln Pro 175 Leu Gln Ser Leu Ser Gln Pro Lys 1??Val Leu Pro Ile Pro Gin Gin Val 185 190

Val .Pro Tyr Leu Gin Arg Asp Met Pro Ile Gin Ala Leu Leu Leu Tyr 200 205 Gin Glu Pro Val Leu Gly Pro Ile Arg Gly Leu Tyr Pro Val Ile Val 210 215 220

< 210 > SEQ ID NO 45 < 211 > LENGTH : 675 < 212 > TYPE : DNA < 213 > ORGANISM : Pygeter catodon < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) AAAAAAAA< 223 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 45 atgaaggtcc tcatccttgc ctgcttgttg gctcttgccc ttgcaagaga gaaagaagaa 60 ctcaatgtat ccggtgagac tgtgaaaagc ctttcaagca gtgaggaatc tgttacgcac 120 atgaacaaga aaattgggaa gtttaaacat gaggaacagc agcaaacaga ggatgaacgc 180 caggataaaa tccaccgctt ttcccagcca cagcctctag tctattccta cactgggcca 240 atcccttacc ctatccttcc acaaaacatc ctgcctcttg ctcagccccc tgtgctggtg 300 cctttccctc agcctggaat aatggaagtc cccaaagcta aggagactct ccttcctaag 360 cataaagaaa tgcccttccc taaatctcca gtagagccct ttattgaaag ccagagcctg 420 actctcaatg atcttgaaaa tctgcacctt cctctgcctc tgctccagtc cttgatgcac 480 cagcctcccc atcctcttcc tcctaccccc atgtttcctc ctcagcccct gcagtccctt 540 tctcagccca aagtcctgcc tattccccag caagtggtgc cctacctcca gagagatatg 600 cccatccagg cccttctgct gtaccaggag cctgtacttg gtcctatccg ggggctctac 660 cctgttattg tctaa 675

< 210 > SEQ ID NO 46 < 211 > LENGTH : 183 < 212 > TYPE : PRT < 213 > ORGANISM : Tachyglossus aculeatus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . ( 0 ) AAAAAAAA< 223 > OTHER INFORMATION : Casein beta < 400 > SEQUENCE : 46

?Met Lys Val Phe Ile Leu Ala ECys Leu Val Ala Val Ala Met Ala Leu | 5 | 10 15

Pro Lys Gln His Ser Ser Ser Ser Ser Ser Glu 3Glu Ser Asp Arq Leu & 25 Leu Val Lys Asp Ile Pro Thr Ala Phe Ser Ser Glu Glu His Ser Val 35

Asp Pro Lys Glu Leu Tyr Glu Pro Arg Gln Ser Tyr Ser Tyr Pro Trp pro Lys Glu Leu Tyr 55Glu Pro Arg Gin ser . 50 &Ee Epg Gin maSer ValR Arg . Pro Ile Asn Thr Tyr Thr Tyr Pro Arg Ala ETyr Gin 65 Egg 70 75 80 US 9 , 924 , 728 B2 127 128 | 127 1 - continued 19Ile &Pro Ala Val Leu Pro Met Thr His Pro Gin Thr Leu Thr Tyr Leu 85 90 95 Gin Pro Gin Phe Lys Pro Glu Asp Met Ser Ile Ser Gin Lys Gin Ile 1?3 105 E

Pro Pro Tyr Val Gln Ala Val Val Met .Pro Tyr Pro Gin Val Glu Ala 120

Ile &Pro Phe Pro Gly Ala Glu Phe Met .Pro Tyr Ala Gin Pro Ile Thr mg 135 EE 140 Thr Pro Leu Leu Gln Pro Glu Val Phe Ser Ala Pro Phe Tyr Arg Glu 145 150 155 160 I 1 |9 Ala Val Phe Lys Pro Val Ile Tyr Gly Leu Pro Gin Ser Gin Pro Val 165 170 175 Gln Lys Ile Pro Glu Thr Asp 180

< 210 > SEQ ID NO 47 < 21111 > LENGTH : 552 < 21212 > TYPE : DNA < 21313 > ORGANISM : Tachyglossus aculeatus A 2020 > FEATURE :

A 21 12 NAME / KEY : misc _ feature < 222222 22 > LOCATION : ( 0 ) . . . ( 0 ) < 22323 > OTHER INFORMATION : Casein beta cDNA < 400 > SEQUENCE : 47 atgaaggtct tcatcctcgc ctgcctagtg gctgttgcca tggcattgcc taaacaacac 60 agcagcagct cttccagtga ggaatctgac agactgctgg ttaaggacat tcctactgcc 120 ttctccagcg aggaacactc tgtggacccg aaggaactct acgagccccg t?agagctat 180 tcctacccat qocaatcaqt ccgtcccato aacacctaca cttatcctcq cacttaccaa 240 attccggctg tcctccccat gactcatcct cagaccctga cttatctcca gcctcaatto 300 aagcccgaag acatgtctat ttctcagaaa caaatcccgc cctacgtcca ggctgtagtc 360 atgccctacc cccaggttga agccattcct ttccccgggg ctgaattcat gccctacgct 420 caacccatca ccacgcctct acttcagcct gaggtcttct ccgccccatt ctacagagag 480 gccgtcttca agccagtgat ctacggcctt cctcaatctc aaccagttca gaagatccca 540 gaaaccgact ga 552

< 210 > SED ID NO 48 11 > LENGTH : 214 < 212 > TYPE : PRT < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 48 Met Lys Leu Leu Ile Leu ?Thr Cys Leu Val Ala Val Ala Leu Ala Arq 15 a g15 | ?Pro Lys His Pro Ile Lys His Gin Gly Leu 4Pro Gln Glu Val Leu Asn & g25 gg& Glu Asn Leu Leu Arg Phe Phe Val Ala &Pro Phe Pro Glu Val Phe Gly 35 40 am Lys Glu Lys Val Asn Glu Leu Ser Lys Asp Ile Gly Ser Glu Ser Thr 55 gg ?Glu Asp Gin Ala Met Glu Asp Ile Lys Gin Met Glu Ala Glu Ser Ile 70 75 ??80 US 9 , 924 , 728 B2 129 130 - continued

Ser Ser Ser Glu Glu Ile Val &Pro ?Asn Ser Val Glu Gln Lys His Ile 95

3Gin Lys Glu Asp Val Pro Ser Glu Arg Tyr Leu 3Gly ?Tyr Leu Glu Gin 110 Leu Leu Arg Leu Lys Lys Tyr Lys Val Pro Gin Leu Glu Ile Val Pro 115 120 125 Asn Ser Ala Glu Glu Arg Leu His Ser Met Lys Glu Gly Ile His Ala 135 Gin Gin Lys Glu Pro Met Ile Gly Val Asn Gin Glu Leu Ala Tyr Phe 150

Tyr Pro Glu Leu Phe Arg Gin Phe Tyr Gin Leu Asp Ala Tyr &Pro Ser 175 Gly Ala Trp Tyr Tyr Val Pro Leu Gly Thr Gin Tyr Thr Asp Ala Pro 190 | Ser Phe Ser Asp Ile .Pro Asn Pro Ile Gly Ser Glu Asn Ser Gly Lys 195 200 205

Thr Thr Met &Pro Leu Trp 210

< 210 > SEQ ID NO 49 < 211 > LENGTH : 645 < 212 > TYPE : DNA < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 222 > LOCATION : ( 0 ) . . . ( 0 ) 223 2 OTHER INFORMATION : Casein alpha - S1 CDNA

< 400 > SEQUENCE : 49 atgaaacttc tcatccttac ctgtcttgtg gctgttgctc ttgctaggcc taaacatcct 60 atcaagcacc aaggactccc tcaagaagtc ctcaatgaaa atttactcag gttttttgtg 120 gcaccttttc cagaagtgtt tggaaaggag aaggtcaatg aactgagcaa ggatattggg 180 agtgaatcaa ctgaggatca agccatggaa gatattaagc aaatggaagc tgaaagcatt 240 tcgtcaagtg aggaaattgt tcccaatagt gttgagcaga agcacattca aaaggaagat 300 gtgccctctg agcgttacct gggttatctg gaacagcttc tcagactgaa aaaatacaaa 360 gtaccccagc tggaaattgt tcccaatagt gctgaggaac gacttcacag tatgaaagag 420 ggaatccatg cccaacagaa agaacctatg ataggagtga atcaggaact ggcctacttc 480 taccctgagc ttttcagaca attctaccag ctggatgcct atccatctgg tgcctggtat 540 tacgttccac taggcacaca atacactgat gccccatcat tctctgacat ccctaatcct 600 attggctctg agaacagtga aaagactact atgccactgt ggtga 645

< 210 > SEQ ID NO 50 < 211 > LENGTH : 222 | A< 212 > TYPE : PRT A< 213 > ORGANISM : Camelus dromedarius A< 220 > FEATURE : A 221 > NAME / KEY : VARIANT A< 222 > LOCATION : ( 0 ) . . . ( 0 ) A< 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 50 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Val Ala Leu Ala Arg | 5 |ea 10 15 Pro Lys Tyr Pro Leu Arg Tyr Pro Glu Val Phe Gin Asn Glu Pro Asp 20 25 30 US 9 , 924 , 728 B2 131 1132 - continued

Ser ?Ile Glu Glu Val Leu Asn Lys Ara Lys Ile Leu Asp Leu Ala Val 40 g& 3Val Ser Pro ?Ile Gin Phe Arg Gin Glu Asn Ile Asp 3Glu Leu Lys Asp

Thr Arg ?Asn Glu &Pro Thr Glu Asp His Ile Met Glu Asp Thr Glu Arg 80 Lys Glu Ser Gly Ser Ser Ser Ser Glu Glu Val Val Ser Ser Thr Thr 95

Glu Gin Lys Asp Ile Leu Lys Glu Asp Met Pro Ser Gin Arg ETyr Leu

Glu Glu Leu His Arg Leu Asn Lys Tyr Lys Leu Leu Gin Leu Glu Ala 120

Ile Arg Asp Gin Lys Leu Ile ?Pro Arg Val Lys Leu Ser Ser His &Pro

Tyr Leu Glu EGin Leu Tyr Arg Ile Asn Glu Asp Asn His Pro Gln Leu 160

Gly Glu &Pro Val Lys Val Val Thr Gln Pro Phe Pro Gln Phe Phe Gln 175

Leu Gly Ala Ser Pro Tyr Val Ala Trp Tyr Tyr Pro &Pro Gin Val Met

g Gln Tyr Ile Ala His Pro Ser Ser Tyr Asp Thr &Pro Glu Gly ?Ile Ala 200 | Ser Glu Asp Gly Gly Lys Thr Asp Val Met Pro Gin Trp Trp 210 || mmm < 210 > SEQ ID NO 51 < 2111 1 > LENGTH : 669 < 2121 2 > TYPE : DNA < 2131 3 > ORGANISM : Camelus dromedarius 22090 FEATURE : < 22121 > NAME / KEY : misc _ feature < 2222 > LOCATION : ( 0 ) . . . ( 0 ) < 2233 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 51 atgaagcttc tcatccttac ctgccttgtg gctgttgcgc ttgccaggcc taaatatcct 60 ctcaggtacc cagaagtctt tcaaaatgaa ccagacagca tagaggaagt cctcaacaaa 120 agaaagattc ttgatttagc agtggtttca cccattcagt ttagacagga gaacatcgat 180 gaactgaagg atactaggaa cgaaccaacc gaagatcaca tcatggaaga cactgagcga 240 aaggaatctg gaagcagttc aagtgaggaa gttgtttcca gtaccactga gcagaaggac 300 attctcaagg aagatatgcc ctcccaacgc tatctggaag agcttcacag actgaacaaa 360 tacaaactac tccagctgga agctatccgt gaccagaaac ttattccaag agtgaagctg 420 tcctcccacc catatctgga acaactttac agaataaatg aggacaacca cccccaactg 480 ggggagcctg tgaaagtagt gactcagcct ttcccacaat tcttccagct tggtgcctct 540 ccctatgttg cttogtatta tcctccacaa gtcatgcaat atattgctca cccctcatcc 600 tacgacaccc ctgaaggcat tgcctctgag gacggtggaa aaaccgacgt tatgccacag 660 tggtggtga 669

< 210 > SED ID No 52 < 211 > LENGTH : 213 < 212 > TYPE : PRT < 213 > ORGANISM : Capra hircus c220 > FEATURE : US 9 , 924 , 728 B2 133 134 - continued < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 52 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Val Val Ala Leu Ala Arg | 10 915 n& Pro Lys His Pro Ile Asn His Gin Gly Leu Ser &Pro Glu Val Leu ?Asn 20 30

Glu Asn Leu Leu Ara Phe Val Val Ala Pro Phe Pro Glu Val Phe Ara 35 40 Ed Lys Glu Asn Ile Asn Glu Leu Ser Lys Asp Ile Gly Ser Glu Ser Thr 55 Glu Asp Gln Ala Met Glu Asp Ala Lys Gln Met Lys Ala Gly Ser Ser 70 Ser Ser Ser Glu Glu Ile Val Pro Asn Ser Ala Gln Lys Tyr Ile Gln 90 95

Lys Glu Asp Val &Pro Ser Glu Arq Tyr Leu 3Gly Tyr Leu Glu Gln Leu 100 1101 Leu Arg Leu Lys Lys Tyr Asn Val Pro Gin Leu Glu Ile Val Pro Lys 115 120 Ser Ala Glu Glu Gln Leu His Ser Met Lys Glu Gly Asn Pro Ala His 135 Gin Lys Gin Pro Met Ile Ala Val Asn Gin Glu Leu Ala Tyr Phe Tyr 150 Pro Gin Leu Phe Arg Gin Phe Tyr Gin Leu Asp Ala Tyr Pro Ser Gly 170 175

Ala Trp Tyr Tyr Leu &Pro Leu Gly Thr Gin Tyr Thr Asp Ala Pro Ser 180 aaaa 190 Phe Ser Asp Ile Pro Asn Pro Ile Gly Ser Glu Asn Ser Gly Lys Thr 195 200 Thr Met Pro Leu Trp 210

< 210 > SEQ ID NO 53 < 211 > LENGTH : 642 < 212 > TYPE : DNA A 13 > ORGANISM : Capra hircus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature A 2 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 53 atgaaacttc tcatccttac ctgtcttgtg gttgttgctc ttgccaggec taaacatcct 60 atcaatcacc aaggactctc tocagaagtc ctcaatgaaa atttactcag gtttgttgtg 120 gcgccttttc cagaagtgtt tagaaaggag aacatcaatg aactgagtaa ggatattggg 180 agtgaatcaa ctgaggatca agccatggaa gatgctaagc aaatgaaagc tggaagcagt 240 tcgtcaagtg aggaaattgt toccaatagt gotcagaagt acattcaaaa ggaagatgtg 300 ccctctgagc gttacctggg ttatctggaa cagcttctca gactgaaaaa atacaacgtg 360 ccccagctgg aaattgttcc caaaagtgct gaggaacaac ttcacagtat gaaagaggga 420 aaccctgccc accagaaaca gcctatgata gcagtgaacc aggaactggc ctacttctac 480 cctcagcttt tcagacaatt ctaccagctg gacgcctatc catctggtgc ctggtactac 540 cttccactag gcacacaata cactgatgccccctcattct ctgacatccc taatcccatt 600 US 9 , 924 , 728 B2 135 136 - continued ggctctgaga acagtggaaagtggaaa gactactatg ccactgtggtccactgtgge gaga 642642. | < 210 > SEQ ID NO 54 < 211 > LENGTH : 212 < 212 > TYPE : PRT < 213 > ORGANISM : Ecuus przewalskii < 220 > FEATURE : < 221 > NAME / KEY : CONFLICT < 222 > LOCATION : ( 0 ) . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 54

Met Lys Leu Leu Ile Leu Thr ECys Leu Val Ala Val Ala Leu Ala Arq

&Pro Lys Leu Pro His Arq Gln Pro Glu Ile Ile Gln Asn Lys Gln Asp 20 30ye Gin Asp Ser Arg Glu Lys Val Leu Lys Glu Arg Lys Phe &Pro Ser Phe Ala Leu 40 45 Glu Tyr Ile Asn Glu Leu Asn Arq Gln Arg Glu Leu Leu Lys Glu Lys

Gin Lys Asp Glu His Lys 3Glu ETyr Leu Ile Glu Asp Pro Glu Gin Gin 70 80 Glu Ser Ser Ser Thr en&Ser Ser Ser Glu Glu Val Val Pro Ile Asn Thr Glu Gin Lys Arg Ile Pro Arg Glu Asp Met Leu Tyr Gin His Thr Leu 100 110

Glu Gin Leu Arg Arg Leu Ser Lys Tyr Asn Gin Leu Gin Leu JGin Ala 120 125 Ile His Ala Gln Glu Gln Leu Leu Arq Met Lys Glu Asn Ser Gin Arg

Lys Pro Met Ara Val Val Asn Gln Glu Gln Ala Tyr Phe Tyr Leu Glu 150 160 Pro Phe Gin Pro Ser Tyr Gin Leu Asp Val Tyr Pro Tyr Ala Ala Trp

Phe His Pro Ala Gln Ile Met Gln His Val Ala Tyr Ser Pro Phe His 180 190

Asp Thr Ala Lys mmmLeu Ile Ala Ser Glu Asn Ser Glu Lys Thr Asp Ile 8mm 200 205

Ile ?Pro Glu Trp 210 < 210 > SEQ ID NO 55 mmmm < 211 > LENGTH : 639 < 212 > TYPE : DNA < 2131222230 > ORGANISM : Equus przewalskii < 220 > FEATURE : | < 221 > NAME / KEY : misc _ feature AAAAA< 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 55 atgaagcttc tcatccttac ctgccttgtg gotgttgctc ttgccaggcc taaacttcct 60 catagacagc cagaaatcat tcaga ataaa caggacagta gagagaaagt cctcaaagaa 120 agaaagtttc ccagttttgc tctagagtac atcaatgaac tgaacaggca gagagaactt 180

ctgaaagaaa aacagaaaga tgaacacaag gaatatctca tagaagaccc tgagcaacag 240 gaatctagca gcacttcatc aagcgaggaa gttgttccca ttaacactga gcagaagcgc 300 US 9 , 924 , 728 B2 137 138 - continued attccaaggg aagacatgct ctaccaacac actctggaac agcttcgcag actgagcaaa 360 tacaaccaac tccagctgca agccatccat gcccaggaac aacttctcag aatgaaggaa 420 aacagccaga gaaagcctat gagagtagtg aatcaggaac aggcctactt ctaccttgag 480 cctttccaac catcctacca gottgatgtc tatccctatg ctgcttggtt tcatcctgcg 540 caaatcatge aacatgttgc ttactcacca ttccatgaca ctgccaaact cattgcctct 600 gagaactcgg aaaaaactga cattatacca gagtggtga 639

< 210 > SEQ ID NO 56 < 211 > LENGTH : 212 < 212 > TYPE : PRT < 213 > ORGANISM : Equus asinus africanus < 220221 0 > FEATURE : < 221 > NAME / KEY : VARIANT < 222312 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 56 | Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Val Ala Leu Ala 2Arq 15 9 | Pro Lys Leu Pro His Arg His Pro Glu Ile Ile Gln Asn Glu Gln ?Asp &20 25 30 Ser Arg Glu Lys Val Leu Lys Glu Arg Lys Phe Pro Ser Phe Ala Leu 35 40 Glu Tyr Ile Asn Glu Leu Asn Arg Gin Arg Glu Leu Leu Lys Glu Lys & 55 60 Gin Lys Asp Glu His Lys Glu Tyr Leu Ile Glu Asp Pro Glu Gin Gin 65 70 &Eng 80 &? Glu Ser Ser Ser Thr Ser Ser Ser Glu Glu Val Val Pro Ile Asn Thr 85 g

Glu Gln Lys Arq Ile &Pro Arq Glu Asp Met Leu ETyr Gln His Thr Leu 100 105 110 Glu Ala Leu Arg Arg Leu Ser Lys Tyr Asn Gin Leu Gin Leu Gin Ala 115 120 Ile Tyr Ala Gln Glu Gln Leu Leu Arq Met Lys Glu Asn Ser Gin Arg 135 140

Lys &Pro Met Arq Val Val Asn Gin Glu Gln Ala Tyr Phe Tyr Leu Glu 145 150 160 Pro Phe Gin Pro Ser Tyr Gin Leu Asp Val Tyr &Pro Tyr Ala Ala Trp 165 SE Phe His &Pro Ala Gln Ile Met Gln His Val Ala ETyr Ser Pro Phe His 180 185 190 Asp Thr Ala Lys Leu Ile Ala Ser Glu Asn Ser Glu Lys Thr Asp Ile 195 200 mmmmgmmmm Ile Pro Glu Trp 210

< 210 > SEQ ID NO 57 < 211 > LENGTH : 212 < 212 > TYPE : PRT < 213 > ORGANISM : Equus caballus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 57 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Val Ala Leu Ala Arg US 9 , 924 , 728 B2 139 140 - continued | 10 15 Pro Lys Leu Pro His Arg Gln Pro Glu Ile Ile Gln Asn Glu Gln Asp 20 g . &30

Ser Arg Glu Lys Val Leu Lys Glu Arg Lys Phe &Pro Ser Phe Ala Leu 35 40

Glu ETyr Ile Asn Glu Leu Asn Arg Gin Arg Glu Leu Leu Lys Glu Lys gam 60 Gln Lys Asp Glu His Lys Glu Tyr Leu Ile Glu Asp Pro Glu Gin Gin 65 Glu Ser Ser Ser Thr Ser Ser Ser Glu Glu Val Val Pro Ile Asn Thr 85 Glu Gin Lys Arg Ile Pro Arg Glu Asp Met Leu Tyr Gin His Thr Leu 100 110 Glu Gin Leu Arg Arg Leu Ser Lys Tyr Asn Gin Leu Gin Leu Gin Ala 115 120 Ile His Ala Gin Glu Gin Leu Ile Arq Met Lys Glu Asn Ser Gln Arq 140 Lys Pro Met Arg Val Val Asn Gin Glu Gin Ala Tyr Phe Tyr Leu Glu 145 Pro Phe Gin Pro Ser Tyr Gin Leu Asp Val Tyr Pro Tyr Ala Ala Trp 165

Phe His &Pro Ala Gln Ile Met Gln His Val Ala Tyr Ser Pro Phe His am180 mmm 190 Asp Thr Ala Lys Leu Ile Ala Ser Glu Asn Ser Glu Lys Thr Asp ?Ile 195 200 Ile Pro Glu Trp 210

< 210 > SEQ ID NO 58 < 211 > LENGTH : 640 < 212 > TYPE : DNA < 213 > ORGANISM : Equus caballus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature mmm < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 58 catgaagctt ctcatcctta cctgccttgt ggctgttgct cttgccaggc ctaaacttcc 60 tcatagacag ccagaaatca ttcagaatga acaggacagt agagagaaag tcctcaaaga 120 aagaaagttt cccagttttg ctctagagta catcaatgaa ctgaacaggc agagagaact 180 tctgaaagaa aaacagaaag atgaacacaa ggaatatctc atagaagacc ctgagcaaca 240 ggaatctagc agcacttcat caagcgagga agttgttccc attaacactg agcagaagcg 300 cattccaagg gaagacatgc tctaccaaca cactctggaa cagcttcgca gactgagcaa 360 atacaaccaa ctccagctgc aagccatcca tgcccaggaa caacttatca gaatgaagga 420 aaacagccag agaaagccta tgagagtagt gaatcaggaa caggcctact tctaccttga 480 gcctttccaa ccatcctacc agcttgatgt ctatccctat gctgcttggt ttcatcctgc 540 gcaaatcatg caacatgttg cttactcacc attccatgac actgccaaac tcattgcctc 600 tgagaactcg gaaaaaactg acattatacc agagtggtga 640

< 210 > SEQ ID NO 59 < 211 > LENGTH : 125 < 212 > TYPE : PRT US 9 , 924 , 728 B2 141 142. - continued < 213 > ORGANISM : Felis catus < 220 > FEATURE : < 2211 > NAME / KEY : VARIANT < 2222 > LOCATION : ( 0 ) . . . ( 0 ) |AAAA< 2233 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 59

?Met Glu Asp Pro Glu Gln Arg Glu Ile Ser Ser Ser Ser Ser Ser Glu ?

Glu RAla 3 Val Pro Asn Asn ?Thr Gin Gin Lys His Ile Ser Lys Glu Asp 20 25 30 °Ile Leu Ser g&JEGin Arg Tyr Leu Glu Gin Leu His Arg Leu Ser Lys Tyr 35 40 |g? Asn Gin Leu Gin Leu Glu Ala Leu Arg Asp Gin Gin Gin Leu Arg Arg ? Esa Val Thr Glu Asn Asn His Ile Gin Leu Pro Phe meGin Gin Phe Tyr Gln Leu Asp Ala Tyr Pro Tyr Ala Val Trp amTyr Tyr Pro Pro Gin EggVal Met Gin Tyr Ile Ala Tyr memThr Pro Phe Tyr Asp Val Thr Lys Leu Thr Ala 100 105 110 Pro Glu Asn Ala Glu Asn Val amGly Val Val Pro Glu Trp 115 120 mmm mam < 210 > SEQ ID NO 600 < 211 > LENGTH : 378 < 212 > TYPE : DNA < 213 > ORGANISM : Felis catus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 60 atggaagacc ctgagcaaag ggaaattagc agcagttcat caagcgagga agctgttccc 60 aataacactc agcagaagca catttcaaag gaagatatac tctctcaacg ctatctggaa 120 cagcttcata gactgagcaa atacaaccaa ctgcaactgg aagctctccg tgaccagcaa 180 caactgcgca gagtgactga aaacaaccacatccaattqc ctttccaaca attctaccaa 240 cttgatgott atccctatgc tgtgtggtat taccctccac aagtcatgca gtatattgct 300 tacacaccat tctatgacgt cactaaactt acggcccctg agaacgctga aaacgttggt 360 gttgtgccag agtggtag 378

< 210 > SEQ ID NO 61 < 211 > LENGTH : 185 < 212 > TYPE : PRT < 213 > ORGANISM : Homo sapiens < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . ( 0 ) 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 61 Met Arg Leu Leu Ile Leu Thr Cys Leu Val Ala Val Ala Leu Ala Arg 5 10 15 n& Pro Lys Leu Pro Leu Arq Tyr Pro Glu Arq Leu Gin Asn Pro Ser Glu 20 25 30 Ser Ser Glu Pro Ile Pro Leu Glu Ser Arg Glu Glu Tyr Met Asn Gly 35 40 45 US 9 , 924 , 728 B2 143 144 - continued ?Met Asn Arg Gin Arg Asn ?Ile Leu Arg Glu Lys Gin Thr Asp Glu Ile 8 55 160

Lys Asp Thr Arg Asn Glu Ser ?Thr Gln Asn Cys Val Val Ala Glu Pro 65 2

Glu Lys ?Met Glu Ser Ser Ile Ser Ser Ser Ser Glu Glu Met Ser Leu Ser Lys Cys Ala Glu Gin Phe Cys Arg Leu Asn Glu Tyr Asn Gin Leu 100 105 1101 Gin Leu Gln Ala Val His Ala Gin Glu Gin Ile Arq Arq Met Asn Glu 120 125 JEd Asn Ser His Val Gin Val Pro Phe Gin Gin Leu Asn Gln Leu Ala Ala 135 140 Tyr Pro Tyr Ala Val Trp Tyr Tyr Pro Gin Ile Met Gin Tyr Val Pro 145 160 Phe Pro Pro Phe Ser Asp Ile Ser Asn Pro Thr Ala His Glu Asn Tyr 170 | mmmm 1 Glu Lys Asn Asn Val Met Leu Gin Trp m? 180 185

< 210 > SEQ ID NO 62 < 211 > LENGTH : 558 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . ( 0 ) AAAAAAAA< 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 62 atgaggcttc tcattctcac ctgtcttgtg gctgttgctc ttgccaggcc taaacttcct 60 cttagatacc cagaacgcct tcagaatcca tcagagagca gtgagcctat accattagaa 120 tcaagagagg aatacatgaa tggtatgaac aggcagagaa acattctgag agaaaaacag 180 actgatgaaa tcaaggatac taggaatgag tctactcaga actgtgttgt ggcagagcct 2400 gagaagatgg aatccagcat cagttcatcg agtgaggaaa tgtctctcag taagtgtgcg 300 gaacagtttt gtagactgaa cgaatacaac caacttcagc tgcaagctgt ccatgcccag 360 - gagcaaattc gcagaatgaa tgaaaacagc catgtccaag tgcctttcca gcagctcaac 420 caacttgctg cctaccccta tgctgtttgg tactatccac aaatcatgca gtatgttcct 480 ttcccaccgt tttccgacat ctccaatccc actgctcatg aaaattatga aaaaaataac 540 gtcatgctac agtggtga 558

< 210 > SEQ ID NO 63 < 211 > LENGTH : 237 < 212 > TYPE : PRT < 213 > ORGANISM : Macropus eugenii < 220 > FEATURE : < 2221 1 > NAME / KEY : VARIANT < 2222222 2 > LOCATION : ( 0 ) . . . ( 0 )

2 AAA< 2233 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 63 Met Lys Leu Leu Ile Phe Ser Cys Leu Val Thr Leu Ala Leu Ala Arg 5 15 ?& Pro Asp Ala Leu Arg Leu Ser Ile Asp Arg His Phe Lys His Arg Glu 20 25 30

Leu Glu Asn Arg Leu Asn Glu Asp Pro Ile Pro Val Ser Glu Ala Ser 35 45 US 9 , 924 , 728 B2 145 146 - continued

Ser Ser Glu Glu Ser Val His Gin Leu ?Asn Arg Asp Arg ?Arg &Pro Leu o 8 | Glu Lys Tyr Glu Leu Asp Lys Tyr Arg Glu Asp Leu Lys Thr Ser Ser 70 75 80

Ser Glu Glu Phe Val Thr Pro Ser Thr Asn Glu Arg Val 1Arg Arg Gin En 90 95 Val Glu Tyr Asn Phe Asn Glu Glu Asp Ser Ser Ala Ser Arg Glu Arg g105 110 Lys Ile Glu Asp Phe Ser Glu His Asp Arg Gin emmTyr Leu Arg Arg Arg 115 120 Val Glu Glu Arg Ala Leu Asn Leu Arg Tyr Leu Glu Pro Leu IHE&Tyr Tyr

Ala Thr Glu Pro Glu Tyr Tyr Tyr Tyr Tyr Ala Tyr Val &Pro Val Ser 150 155 40 Ser His Asp Ile Pro Tyr Gin Gin Lys Pro Leu Ser Leu Leu Pro Ala 170 175

Lys Ser His Tyr Leu Ile Ser Thr Gly Leu Leu Asn Glu Pro Leu Pro 10 190 Ile Leu Arg Glu Arg Leu Gly Arg Gly Phe Gin Ser Pro Ser Leu Leu 195 &200 Ile Leu Val Leu Thr Glu Asn Ser Asn Leu Phe Met Gly Ser Val Phe ?

p Cys Leu Gln Ile Ala His &Pro Met Gln Glu Ile mmmmmm ?230 235 < 210 > SEQ ID NO 64 < 211 > LENGTH : 189 < 212 > TYPE : PRT 13 > ORGANISM : Monodelphis domestica 209 FEATURE : < 221 > NAME / KEY : VARIANT < 2222 > LOCATION : ( 0 ) . . . ( 0 ) < 2233 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 64 Met Lys Leu Leu Ile ?Phe Ser Cys Leu Val Ala Leu Ala Leu Ala Arq 5 19 Pro 3Glu Ala Leu Asn ?Phe Ser Ala Arg Arg Val Lys His Gin Glu Ala 25 30 Glu Ser Arq Leu Asn Glu Val Ile Ile Pro Ala Ara Ala Val Ser Ser 35 Glu val 40Te Ile Pro ala Ser Glu Glu Thr Ser ?Gin Glu Ala °Ile Glu Ile Arg Tyr Pro Leu Glu 8

Gin Gin Val Leu Asp Lys Ala Arg Glu Glu Arg Val Arg Arg &Pro Val 75 mem Glu Tyr Ile Ile Glu Asp Asp Ser Ser Ala Leu Asn Glu Arg ELys Ile

Glu Asp Ala Arg Ala Tyr Asp Glu Gin Tyr Leu Arg Arg Pro Glu Glu mmm 105 EE. 110 Glu Arg Ala Val His Tyr Arg Glu Leu Arg Ala Phe Pro Thr Glu Ala 115 120

Arg Lys Leu Lys Ala Tyr Arg Glu &Pro Tyr Val Gin Pro Glu Ile Tyr 140

Tyr Tyr Leu Ile Ser Val Pro Gln APro ?Met Pro Tyr Pro Asp Glu Val mmmm ? mmmm155 160 US 9 , 924 , 728 B2 147 148 - continued Pro Leu Ala Tyr Thr Tyr Lys Phe Val Val Pro Ala Val Asn Arg Ala | 165 | 170 175 Asp Glu Ala Val Asn Thr Pro Val Glu Glu Glu Lys Asn 180 185

< 210 > SEQ ID NO 65 < 211 > LENGTH : 5701 < 212 > TYPE : DNA < 213 > ORGANISM : Monodelphis domestica < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) | A 23 > OTHER INFORMATION : Cagein alpha - S1 CDNA < 400 > SEQUENCE : 65 atgaagctgc tcatcttctc ctgccttgtg gctcttgctc tggccaggcc agaagccctc | 6060 aacttctctg ctaggcgtgt taaacaccaa gaagcagaaa gccgcctgaa tgaagttatc 120 attccagcaa gagcggtttc atcaagtgag gaaacttccc aggaggcaat cgaaatcaga 180 tatcccctgg agcagcaagt actcgacaaa gccagagagg aacgtgtccg cagaccggtc 240 gagtacatca togaggatga ttcttctgcc ttaaatgaga gaaagattga agatgcccgt 300 gcatacgacg agcagtacct gagaagacct gaggaagaga gagctgttca ctaccgggaa 360 cttcgcgctt ttcctactga ggcaagaaaa cttaaggett acagagaacc ctacgtgcag 420 ccagaaatct actactatct catttccgtg ccacaaccca tgccttatcc agatgaggtc 480 cctcttgott acacctacaa attcgtagta cctgctgtca acagggcaga tgaggcagtc 540 aatacccctg tggaagagga gaagaactaa 570

< 210 > SEQ ID NO 66 < 211 > LENGTH : 207 < 212 > TYPE : PRT A 13 > ORGANISM : Microcebus murinus A 209 FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 66 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Val Ala Leu Ala Arq | 5

Pro Lys His Pro Leu Arq His &Pro Glu Leu Ile 3Gln Asn Gin Pro Gly 25 30 &E Ser Ser Glu Glu Ile Leu Lys Glu 1Arg Lys Phe Ser Ala Ile Ala Leu 35 40 45 ?3 Ala Thr &Pro Ile Glu Leu Arq Gln 3Glu Tyr Ile Asn 3Glu Leu Asn Arq 55

Glu Gln His Val Ile Thr Glu ?Thr Glu Gin Ser 3Glu Ser Ser Ser Ser 7 0 15 Jpg&S &80 Ser Ser Ser Glu Glu Val Ala Ser Gin Ser Ser Thr Glu Pro Lys Cys ?3 Ala Leu Asn Glu Asp Val Thr Asn Gin Cys Asn Gin 3Glu Gin Leu His 105 110 Arg Met Asn Lys Tyr Asn Gin Leu Gin Leu Glu Ala Ile His Ala Gin 115 mmm 120 125 Glu Gin Leu Arg Arg Met Asn Glu Tyr Asn His Ala Gin Val Glu Glu 135 mm . | Pro Val Ara Val Val Asn Gin Glu Gin Ala Gln Phe Tyr Pro Glu Pro msm gammmm 150 155 160 US 9 , 924 , 728 B2 149 150 - continued

Phe Pro Gin Val Tyr Gin ?Leu Asp Ala Thr Trp Tyr Tyr Phe Pro Gin 165 ? | 175 | Asn Met Gin Tyr Pro Ser Phe Leu Pro Ser Gin Asp Ile Ala Lys Gin 180 185 190 Thr Ser Ala Glu Asn Asn Glu Lys Thr Asn Val Met Ala Gin Trp 195 200 205 1

< 210 > SEO ID NO 67 < 211 > LENGTH : 624 < 212 > TYPE : DNA < 2131 > ORGANISM : Microcebus murinus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 67 atgaagcttc tcatactcac ctgccttgtg gctgtcgctc ttgccagacc taaacatcct 60 cttagacacc cagaactcat tcaaaatcaa ccaggcagca gcgaggaaat cctcaaagaa 120 agaaagtttt cagcaattgc tctggccaca ccaatagaat taagacagga atacatcaat 180 gaactgaaca gggaacaaca tgtaataacc gagactgagc agagtgaatc tagcagcagt 240 tcatcaagcg aggaagttgc ttcccaaagc agcaccgagc caaaatgcgc tttaaatgaa 300 gatgtgacca accaatgcaa tcaggaacag cttcatagaa tgaacaaata caaccaactc 360 cagctggaag ctatccatgc tcaggagcaa cttcgcagaa tgaatgaata caaccatgct 420 caagtggaag agcccgtaag agtagtgaat caggaacagg cccaattcta ccctgagccc 480 ttccctcaag tctaccagct tgacgctact tggtactatt toccacaaaa catgcagtac 540 ccatctttcc tgccatccca agacatcgct aagcaaactt ccgctgagaa caatgagaaa 600 actaatgtta tggcacagtg gtga 624

< 210 > SEQ ID NO 68 < 211 > LENGTH : 215 < 212 > TYPE : PRT < 213 > ORGANISM : Oryctolagus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT AAAAA< 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 68 Met Lys Leu Leu Ile Leu Thr Cys Leu Val Ala Thr Ala Leu Ala Arq - 15 9& His Lys Phe His Leu Gly His Leu ELys Leu Thr 3Gln Glu Gln Pro Glu 20 25 30

Ser Ser Glu Gln Glu Ile Leu Lys Glu 2Arq Lys Leu Leu Arq Phe Val 35 1 Gin Giu Ile Leu Lys Giu Arg Lys Leu Gin Thr Val &Pro Leu Glu Leu Arg Glu Glu ?EepTyr Val Asn Glu Leu Asn Arg Gin Arg Glu Leu Leu Arg Glu ELys Glu Asn Glu Glu Ile Lys Gly 70 75 sam 3So Thr Arg Asn Glu Val Thr Glu Glu His Val Leu Ala Asp Arg Glu Thr 95

Glu Ala Ser Ile Ser Ser Ser Ser Glu Glu Ile Val Pro Ser Ser Thr am 100 105 mmm110 Lys Gin Lys Tyr Val Pro Arg Glu Asp Leu Ala Tyr Gin Pro Tyr Val 115 8 mam US 9 , 924 , 728 B2 151 152 - continued

Gln Gln Gln Leu Leu Arq Met Lys Glu Arq Tyr Gin Ile Gln Glu Arq Gin140 Ile Gin Giu Arg

Glu &Pro ?Met Arg Val Val Asn 3Gin Glu Leu Ala 3Gin Leu Tyr Leu Gin 150 155 160

&Pro Phe Glu Gin Pro Tyr Gin Leu Asp Ala Tyr Leu Pro Ala Pro Trp 175

Tyr Tyr ?Thr Pro Glu Val Met Gin Tyr Val Leu Ser Pro Leu Phe Tyr 185 190

AAsp Leu Val Thr Pro gSer Ala Phe Glu Ser Ala 3Glu Lys Thr Asp Val 195 200 205

Ile .Pro Glu Trp Leu Lys Asn 210 1? 215 REDTER < 210 > SEQ ID NO 69 < 211 > LENGTH : 648 < 212 > TYPE : DNA < 213 > ORGANISM : Oryctolagus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 69 atgaagcttc tcatcctcac ttgccttgtg gctactgctc ttgccaggca taaatttcat 60 ttaggacacc tgaaactcac tcaggagcag cctgagagca gtgagcagga aatcttaaaa 120 gaaagaaagc tcctcaggtt tgtccagaca gtaccactag aattaagaga ggaatatgtc 180 aatgaactga acaggcagag agaacttctg agagaaaaag agaatgagga aatcaaggga 240 actagaaatg aagtaactga ggaacatgtt ttggcagacc gtgagacaga agctagcatc 300 agctcatcaa gtgaggaa at tgttcccagc agcaccaagc agaagtacgt gccaagggaa 360 gacctggctt accaacctta cgtgcagcag cagcttctca gaatgaaaga acgctaccaa 420 atccaggaga gagagcctat gagagtggtg aatcaggaac tggotcagct ctatcttcag 480 cctttcgaac aaccctacca gottgatgcctatctccctg ctccttggta ctatactccg 540 gaagtgatgc agtatgttct ttccccactg ttctatgacc tcgttacacc cagtgccttt 600 gagagtgctg aaaaaactga cgttattcca gagtggttga agaattaa 648

< 210 > SED ID No 70 < 211 > LENGTH : 214 < 212 > TYPE : PRT < 213 > ORGANISM : Ovis aries < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 70

Met Lys Leu Leu Ile Leu ?Thr Cys Leu Val Ala Val Ala Leu Ala Arq 15 a g15

? Pro Lys His Pro Ile Lys His ?Gin Gly Leu Ser &Pro Glu Val Leu Asn 20 25 30

Glu Asn Leu Leu Arg Phe Val Val RAla & Pro Phe &Pro Glu Val Phe RArg 35 msm Lys Glu Asn Ile Asn Glu Leu Ser Lys Asp Ile Gly Ser Glu Ser Ile 55 ?Glu Asp Gin Ala Met Glu Asp Ala Lys Gin Met Lys Ala Gly Ser Ser 70 75 80 US 9 , 924 , 728 B2 153 154 - continued

Ser Ser Ser Glu Glu Ile Val &Pro Asn Ser Ala Glu Gln Lys Tyr Ile

3Gin Lys Glu Asp Val &Pro Ser Glu Arg Tyr Leu Gly ?Tyr Leu Glu Gin Leu Leu Arg Leu Lys Lys Tyr Asn Val Pro Gin Leu Glu Ile Val Pro 115 120 125

Lys Ser Ala Glu Glu Gin Leu His Ser Met Lys Glu Gly Asn &Pro Ala

His Gin Lys Gin Pro Met Ile Ala Val Asn Gin Glu Leu Ala ETyr Phe 145 150 Tyr Pro Gin Leu Phe Arg Gin Phe Tyr Gin Leu Asp Ala Tyr &Pro Ser Gly Ala Trp Tyr Tyr Leu Pro Leu Gly Thr Gin Tyr Thr Asp Ala Pro

| Ser Phe Ser Asp Ile Pro Asn Pro Ile Gly Ser Glu Asn Ser Gly Lys 195 200 205

Ile Thr Met &Pro Leu Tri 210

< 210 > SEQ ID NO 71 < 211 > LENGTH : 645 < 212 > TYPE : DNA < 213 > ORGANISM : Ovis aries < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 222 > LOCATION : ( 0 ) . . . ( 0 ) 223 2 OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 71 atgaaacttc tcatccttac ctgtcttgtg gotgttgctc ttgccaggcc taaacatcct | 6060 atcaagcacC aaggactctc tccagaagtc ctcaatgaaa atttactcag gtttgttgtg 120 gcgccttttc cagaagtgtt tagaaaggag aacatcaatg aactgagtaa ggatattggg 180 agtgaatcaa ttgaggatca agccatggaa gatgctaagc aaatgaaagc tggaagcagt 240 tcgtcaagtg aggaaattgt tcccaatagt gctgagcaga agtacattca aaaggaagat 300 gtgccctctg agcgttacct gggttatctg gaacagcttc tcagactgaa aaaatacaac 360 gtgccccagc tggaaattgt tcccaaaagt gctgaggaac aacttcatag tatgaaagag 420 ggaaaccctg cccaccagaa acagcctatg atagcagtga atcaggaact ggcctacttc 480 taccctcagc ttttcagaca attctaccag ctggacgcct atccatctgg tgcctggtat 540 taccttccac taggcacaca atacactgat gccccctcat tctctgacat ccctaatccc 600 attggctctg agaacagtgg aaagattact atgccactgt ggtga 645

< 210 > SEO ID NO 72 < 211 > LENGTH : 199 A< 21212 > TYPE : PRT

A < 21313 > ORGANISM : Physeter catodon A< 22020 > FEATURE : 222 A 22121 > NAME / KEY : VARIANT A< 222 > LOCATION : ( 0 ) . . . ( 0 ) 2 A< 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 72 Val Leu Thr Thr Met Lys Leu Leu Ile Leu Thr Cys Leu Val Thr Ala | 5 10 15

Ala Leu Ala Lys Pro Asn Glu Pro Asp Ser Arg Glu Pro Leu Ser Glu 20 25 Glu Pro Leu3 0 ser ciu US 9 , 924 , 728 B2 155 156 - continued Gin Leu Arg Glu Asp His Gly Met Glu Asp Pro Glu Gin Arg Gly Ser 40 45 Gly Ser Ser Ser Ser Ser Glu Val Asn Arg Phe Asp Val Asn Ser Ala 55

Ser Gin Leu Glu ?Asn Val Cys Glu Ser Leu Leu Tyr Gin Glu Gly Tyr 65 | 80

Leu Ser Pro Lys Glu Val 3Val Pro Asn Gly Asn Glu Arg Lys His Ile Beg& 95 8g Gin Gly Glu Asp Val Pro Ser Glu IArg Tyr Leu Arg Glu Pro Met Arg 105 mm 110 Val Val Asn Gin Pro Phe Gin Gin Phe Tyr Gin Leu Asp Val His Pro 120 EE3 125 Tyr Ala Ala Trp Tyr Tyr Pro Pro JGin Val Thr Gln Tyr Ile Ala Ser 135 em Pro Ser Phe Phe Asp Ile Pro Lys Pro Ile Ala Ser Glu Asn Gly Gly 145 160

Lys Thr Ile Met Pro Gin Trp Cys Phe Tyr His Met Ser Val &Pro Asn 175 Glu Ser Thr Glu His Ser Phe Thr cys cys Glu Ser Tyr Arg Asn Lys 185 190 Ala Ile Asp Val Met Asn Ala 195

< 210 > SEQ ID No 73 < 211 > LENGTH : 600 < 2122 > TYPE : DNA < 21313 > ORGANISM : Physeter catodon 22020 > FEATURE : < 22121 > NAME / KEY : misc _ feature < 22222 > LOCATION : ( 0 ) . . . ( 0 ) < 22323 > OTHER INFORMATION : Casein alpha - S1 partial cDNA < 400 > SEQUENCE : 73 gtcttgacaa ccatgaaact tctcatcctt acctgccttg tgactgctgc tcttgccaag | 60 cctaatgaac cagatagcag agagccttta tcagaacagc ttagagagga tcatggcatg 120 gaagaccctg agcaaagggg gtctggcagc agttcatcaa gtgaggtaaa tcgttttgat 180 gttaattcag catcccaatt agaaaatgtt tgtgaaagct tgttgtacca ggaaggttac 240 ctgtccccta aggaagttgt tcccaatggc aatgagcgga agcacattca aggggaagat 300 gtgccctctg aacgctatct gagagagcct atgagagtag tgaatcaacc tttccaacaa 360 ttctatcagc ttgatgtcca tccttatgct gottggtatt atcctccaca agtcacacaa 420 tatattactt ctccatcatt cttcqacatc cctaaaccca ttgcctctga gaacggtgga 480 aaaacaatta tgccacagtg gtgcttctat catatgtcgg ttcccaacga atcaacagaa 540 cacagcttca cgtgttgtga atcctacagg aataaagcca tcgatgtaat gaatgcatga 600

< 210 > SEQ ID NO 74 < 211 > LENGTH : 183 < 212 > TYPE : PRT < 213 > ORGANISM : Tachyglossus aculeatus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 74 Met Lys Val Leu Ile Leu Ala Cys Leu Val Ala Phe Val Val Ala Met US 9 , 924 , 728 B2 157 158 - continued 15 | Pro Glu Ser Pro Ser ?Ser Ser Ser Ser Ser Glu ?Glu Ala Ser Lys Ile 820 a &30

Leu Thr Lys Lys Arg3 Val 3Gin Arg Asp Gin Glu Tyr Tyr Leu &Pro His 35

Gln Glu Glu 8Ser Val Ser Ser Ser Ser Ser Glu Glu Ser Thr Asp Arq RS 55 60 Leu Lys Arg Arg Leu Leu Lys Asp Lys Pro Ile Phe Arg Leu Leu Lys 65 313 70 2

Ala Thr Glu Ser Ser Ser Ser Glu Glu Ser Asp Ser Ala Ile JGlu Lys

Arg Ile Leu Arg Glu Arg Gin Tyr Tyr Gin Gin Lys Leu Asp Glu Leu 1mm 100 110 Lys Glu Tyr Phe Arg Gin Phe Glu &Pro Tyr Phe Tyr Pro Val Ala Tyr | 115

Gin Lys Lys Glu Val ?Met Pro Tyr Gin Leu Glu Tyr Phe Val &Pro Gin RE 135 140 Pro Glu Val Tyr Ser Ile Pro Gin Pro Val Tyr Arg Val Pro Gln Glu 145 150

Val Thr Phe &Pro Ser Leu Leu His Phe Arg Tyr Ala Phe Pro Gin Ser mmmg ? 175 ? Thr Leu Pro Ile Glu Arg Lys 180

< 210 > SEQ ID NO 75 < 211 > LENGTH : 552 < 21212 > TYPE : DNA < 21313 > ORGANISM : Tachyglossus aculeatus < 220 > FEATURE : A 12 NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) A 23 > OTHER INFORMATION : Cagein alpha - S1 CDNA

< 400 > SEOUENCE : 75 atgaaggtcc tcatcctggc ctgcctggtg gottttgtcg tggcaatgcc tgagt caccc 60 agcagcagtt catccagcga ggaagcttcc aaaattctga caaaaaagcg tgtccaaaga 120 gaccaagaat actaccttcc ccatcaggag gaatccgtaa gcagctcatc cagtgaggaa 180 tcgaccgatc gactcaaaag acgtctcctg aaagacaaac ccatcttccg tctcctgaag 240 gctacagaga gctcttcaag tgaggaatct gacagtgcta ttgaaaagcg tattctgagg 300 gagagacagt actatcaaca gaagctggat gaactcaaag aatattttcg t?agtttgaa 360 ccctacttct accctgtggc ttatcagaaa aaagaagtca tgccctacca gctggaatac 420 tttgttcctc aaccagaagt gtacagcatc ccccaaccag tatatagggt tcctcaagag 480 gtaaccttcc ccagtcttct ccatttccgc tacgcttttc ctcagtcaac cctccccatt 540 gagaggaagt aa 552.

< 210 > SEQ ID NO 76 < 211 > LENGTH : 230 < 212 > TYPE : PRT V< 213 > ORGANISM : Ailuropoda melanoleuca < 220NO1A > FEATURE : < 221 > NAME / KEY : VARIANT V< 222 > LOCATION : ( 0 ) . . ( 0 ) < NNNNNN223ANNNN > OTHER INFORMATION : Casein alpha - S1 < 400 > SEQUENCE : 76 US 9 , 924 , 728 B2 159 160 - continued

Met Glu Ile Lys His Cys &Pro Lys Asp Leu Lys Asp 3Gly ?Ser Leu Lys 15 Gin Cys Thr Gly Ser Gly His Lys Ala Ala Leu Ser Gin Glu Glu Gin 30

Gly Ser Ser Ala Val Ile Glu His Gly Ser Ile Pro Arg Gly Gly ?Asn Asn Val His Arg Val Gly Gly Val Arg Ala Ser Cys Thr Leu Glu Ser Thr Arg Arg Leu 5mmLeu Trp Met Cys Pro Ser Glu Lys Thr Ser Val Leu sg He

Ala Leu Thr Thr Met Lys Val Leu Ile Leu Thr Cys Leu Val EAla Val 95 Ala Leu Ala Arg Pro Gly Gin Ala Val Glu Asp E&SPro Glu Gin Arg Gin 110 Ser Ser Ser Ser Ser Ser Ser Glu Glu Val Val Pro Ser Thr Thr Glu 115 |smGln Lys Gln Ile Pro Arg Glu Asp Ile Leu Asn Gln Arq Tyr Leu Glu Gln Leu Arg Arg Leu Ser 3IELys Tyr Asn Gln Gln Gln Gln Glu Thr Ile His Asp Gin Gin Gin Leu Arg Gly Val Asn Glu Asn Asn Leu Leu Gln 175 Leu Pro Phe Gin Gin Phe Tyr Gin Leu Asp Ala Tyr Pro Phe Ala Ala mmm 190 Trp Tyr Tyr Leu Pro Gin Ile Met Gin Tyr Ile Gly Tyr Thr &Pro Ser 195 ET9 1 Tyr Asp Ile Ile Lys Pro Ile Ala Ser Glu Asn Ile Glu Asn Val Asp Ile Lys Pro Ile Ala mamSer Glu Aøn 220Ile Glu Val Val Pro Glu Trp Trp 225 am 230 mmmm < 210 > SEQ ID No 77 < 211 > LENGTH : 693 A 12 > TYPE : DNA

A 13 > ORGANISM : Ailuropoda melanoleuca A 20 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S1 CDNA < 400 > SEQUENCE : 77 atggaaatta aacactgtcc aaaagacctc aaagacgggt cacttaaaca gtgcacggga 60 agtggtcaca aggcagcgct aagccaggaa gagcagggaa gtagtgctgt aatagaacac 120 ggaagcattc cacgtggagg aaataacgtg catagggttg gaggagtaag agcttcatgo 180 actcttgaaa gcacaagaag attgttgtgg atgtgtcctt cagaaaagac gagtgtgctg 240 gccttgacaa ccatgaaggt tctcatcctt acctgccttg tggctgttgc tcttgccagg 300 cctggacagg ccgtggaaga ccctgagcaa aggcaatcta gcagcagttc gtcaagtgag 360 gaagttgttc ccagtaccac tgagcagaag caaattccaa gagaagacat actcaaccaa 420 cgctatctgg aacagcttcg tagactgagc aaatacaacc aacaacagca ggaaactatc 480 catgaccagc aacaacttcg cggagtgaat gaaaacaacc tcctccaact gcctttccaa 540 cagttctacc agcttgatgc ttatcccttt gctgcttggt attatcttcc acaaatcatg 600 cagtatattg gttatacacc atcctatgac atcattaaac ccattgcctc tgagaacatt 660 US 9 , 924 , 728 B2 161 162 - continued gaaaacgttg atgttgtgcc agagtggtgg taa 693

< 210 > SEQ ID NO 78 < 211 > LENGTH : 222 TYPE : PRT < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 78

?Met Lys Phe ?Phe Ile Phe Thr Cys Leu Leu Ala Val Ala Leu Ala Lys . ? 98 Asn ?Thr Met Glu His Val Ser Ser Ser Glu Glu Ser Ile 2Ile Ser Gin R8 30 Glu Thr Tyr Lys Gin Glu Lys Asn Met Asp Ile Asn Pro Ser Lys 3Glu 40 Asn Leu Cys Ser Thr Phe Cys Lys Glu Val Val Arg Asn Ala Asn Glu 5 Glu Glu Tyr Ser Ile Gly Ser Ser Ser Glu Glu Ser Ala Glu Val Ala EE ?? 70 75 Thr Glu Glu Val Lys Ile Thr Val Asp Asp Lys His Tyr Gin Lys Ala g

Leu Asn Glu Ile Asn ?Gln Phe Tyr Arg Lys Phe &Pro Gen Tyr Leu Gln 110 Tyr Leu Tyr Gin Gly Pro Ile Val Leu Asn Pro Trp Asp Gin Val Lys 120

Arg Asn Ala Val Pro Ile Thr &Pro ?Thr Leu Asn Arg Glu Gln Leu Ser

Thr Ser Glu Glu Asn Ser Lys Lys Thr Val Asp Met Glu Ser Thr Glu 150 155 Val Phe Thr Lys Lys Thr Lys Leu Thr Glu Glu Glu Lys Asn Arg Leu

Asn Phe Leu Lys Lys Ile Ser Gin Arg Tyr Gin Lys Phe Ala Leu &Pro 190

Gin Tyr Leu Lys Thr Val Tyr Gln His Gin Lys Ala Met Lys &Pro Trp 200 mmm Ile Gin Pro Lys Thr Lys Val Ile Pro Tyr Val Arg Tyr Leu 210 mm mmm < 210 > SEQ ID NO 79 < 211 > LENGTH : 669 < 212 > TYPE : DNA < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Cagein alpha - S2 CDNA < 400 > SEQUENCE : 79 atgaagttct tcatctttac ctgccttttg gctgttgccc ttgcaaagaa tacgatggaa 1 60 catgtctcct ccagtgagga atctatcatc toccaggaaa catataagca ggaaaagaat 120 atggacatta atcccagcaa ggagaacctt tgctccacat tctgcaagga agttgtaagg 180 aacgcaaatg aagaggaata ttctatcggc tcatctagtg aggaatctgc tgaagttgcc 240 acagaggaag ttaagattac tgtggacgat aagcactacc agaaagcact gaatgaaatc 300 aatcagtttt atcggaagtt cccccagtat ctccagtatc tgtatcaagg tccaattgtt 360 US 9 , 924 , 728 B2 163 164 - continued

ttgaacccat gggatcaggt taagagaaat gctgttccca ttactcccac tctgaacaga 420 gagcagctct ccaccagtga ggaaaattca aagaagaccg ttgacatgga atcaacagaa 480 gtattcacta agaaaactaa actgactgaa gaagaaaaga atcgcctaaa ttttctgaaa 540 aaaatcagcc agcgttacca gaaattcgcc ttgccccagt atctcaaaac tgtttatcag 600 catcagaaag ctatgaagcc atggattcaa cctaagacaa aggttattcc ctatgtgagg 660

tacctttaa 669

< 210 > SEQ ID NO 80 < 211 > LENGTH : 223 < 212 > TYPE : PRT < 213 > ORGANISM : Capra hircus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 80 Met Lys Phe Phe Ile Phe Thr Cys Leu Leu Ala Val Ala Leu Ala Lys

5 ? 15 His Lys Met Glu His Val Ser Ser Ser Glu Glu Pro Ile Asn Ile Phe Gin Glu Ile Tyr Lys m?Gin Glu Lys Asn Met Ala Ile His Pro Arg Lys Glu Lys Leu Cys Thr Thr Ser 3Cys Glu Glu Val Val Arg Asn Ala Asn & 55 me Glu Glu Glu Tyr Ser Ile Arg Ser Ser Ser Glu Glu Ser Ala Glu Val 65 70

Ala Pro Glu Glu Ile Lys Ile ?Thr Val Asp Asp Lys His Tyr Gin Lys 95 Ala Leu Asn Glu Ile Asn Gin Phe Tyr Gin Lys Phe Pro Gin Tyr Leu ESGin ETyr Pro Tyr Gin Gly Pro Ile Val Leu Asn Pro Trp Asp Gin Val Lys Arg Asn Ala Gly Pro Phe Thr Pro Thr Val Asn Arg Glu Gin Leu 135

Ser Thr Ser Glu Glu Asn Ser Lys Lys Thr Ile Asp Met Glu Ser Thr 145 150 Glu Val Phe Thr Lys Lys Thr Lys Leu Thr Glu Glu Glu Lys Asn Ara 175 Leu Asn Phe Leu Lys Lys Ile Ser Gin Tyr Tyr Gin Lys Phe Ala Trp Pro Gin Tyr Leu Lys Thr Val Asp Gin His Gin Lys Ala Met Lys Pro

Trp Thr Gin Pro Lys Thr Asn Ala Ile &Pro Tyr Val Arg Tyr Leu am 220 210 215 mmmmm < 210 > SEQ ID NO 81 < 21111 > LENGTH : 672 |

12 mmm < |212 > TYPE : DNA < 22131 3 > ORGANISM : Capra hircus V2 2 200 > FEATURE :

< 22212 1 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 CDNA < 400 > SEQUENCE : 81 US 9 ,924 , 728 B2 165 166 - continued atgaagttct tcatttttac ctgccttttg gccgttgccc ttgcaaagca taagatggaa 60 catgtctcct ccagtgagga acctatcaat atcttccagg aaatatataa gcaggaaaag 120 aatatggcca ttcatcccag aaaggagaaa ctttgcacca catcctgtga ggaagttgta 180 aggaacgcaa atgaagagga atattctatc agatcatcta gtgaggaatc tgctgaagtt 240 gccccagagg aaattaagat tactgtggac gataagcact accagaaagc cctgaatgaa 300 atcaatcagt tttatcagaa gttcccccag tatctccagt atccgtatca aggtccaatt 360 gttttgaacc catgggatca ggttaagaga aatgctggcc cctttactcc caccgtgaac 420 agagagcagc tctccaccag tgaggaaaat tcaaagaaga ccattgatat ggaatcaaca 480 gaagtattca ctaagaaaac taaactgact gaagaagaaa agaatcgcct aaattttctg 540 aaaaaaatca gccagtatta ccagaaattt gcctggcccc agtatctcaa gactgttgat 600 cagcatcaga aagctatgaa gccatggact caacctaaga caaatgctat tccctatgtg 660 aggtaccttt aa 672

< 210 > SEQ ID NO 82 < 211 > LENGTH : 239 < 212 > TYPE : PRT A 13 > ORGANISM : Felis catus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 82 g Met Ser Gly Ala Glu Ala Val Asp ETrp 3Glu Val Ser Glu ?Lys Lys Leu

His Ile Cys Arg Leu Ser Arg 3Gly Cys 3Gly Val Ser 4Pro Arg ggVal ?Thr 20 25 30

Met Asn Phe Leu Leu Phe Thr Cys Leu Leu Ala 3Val Ala Leu Ala Lys 35 . ? 3 His Glu Leu Lys Gin Leu Ser Ser Ser Glu Glu Ser Ala Thr Ser Ser 55 3 82 Ser Ser Gin Glu Thr Gly Asp Val Pro ?Thr Asp ?Thr °Ile Glu Leu Thr

Glu Glu Glu Lys Val Tyr Leu Asn Gin Leu Ser Lys Ile Asn JGin Phe 3 en Tyr Gin Ala Trp Asn Leu Pro Gin Tyr Leu Glu Ala Tyr His Gin Gin 100 Egg105 110 His Ser Val Arg Asn &Pro Trp Asn His Ile Lys Thr Asn Gly Tyr His 115

Leu Phe Pro Leu Leu Glu Lys 3Glu Tyr Leu Ser Ser Ser Glu Val Arg 135 E3 Gly Phe Pro Val Arg Thr Glu ?Thr Trp His Pro Glu Thr Glu Ile Lys

Glu Val Gin Leu Asn Asp Glu Glu Lys Asn Tyr Leu Lys Gin Leu Val

Lys Ile Asn Gin Tyr Gin Gin Lys Phe Thr Phe Pro His Tyr Phe Gin 180 185 190

Ala Val His Pro Gin Gin Ile Ala Leu Asn &Pro Trp Asn Arg Leu Lys 195 Glu Asn Thr Tyr Pro Phe Ile Leu Thr Leu Leu Gly Ser Leu Asn Gin 215

?Phe Gly Pro Pro Asp Asp Glu Lys Gly Leu Asp Tyr Phe Ser Lys US 9 , 924 , 728 B2 167 168. - continued 225 230 235

< 210 > SEQ ID NO 83 < 211 > LENGTH : 720 < 212 > TYPE : DNA < 213 > ORGANISM : Felis catus < 220 > FEATURE : 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 CDNA < 400 > SEQUENCE : 83 atgtccggtg cagaggcagt ggactgggaa gttagtgaga agaagctgca catatgtcgt | 60 ctttcaagag gctgcggggt cagtccccga gtaaccatga atttcctcct ctttacctgc 120 cttttggctg tggctctggc aaagcatgag ctaaagcagc tctcctccag cgaggaatct 180 gocaccagtt catctagtca ggaaactggt gatgtcccta ctgacacaat tgagctgact 240 gaggaagaaa aggtctacct caatcaactg agcaaaatca accagtttta tcaggcatgg 300 aatcttcccc agtatcttga ggcttatcat caacagcaca gtgttaggaa cccatggaat 360 cacattaaga caaatggcta tcatctattt ccccttctgg aaaaagagta cctgtcctcc 420 agtgaggtga ggggctttcc tgtgaggaca gaaacatggc atccagaaac agagattaag 480 gaagttcagc tgaatgatga agaaaagaat tacctgaaac agctggtcaa aatcaaccag 540 tatcaacaga agttcacctt cccccactat ttccaggctg ttcatccaca gcagatagct 600 ctgaaccctt ggaatcgcct taaggaaaat acttacccat tcattctcac tttgottggt 660 tctctgaacc agtttggtcc tcctgatgat gaaaagggat tagactactt ttctaaataa 720

< 210 > SEQ ID NO 84 < 211 > LENGTH : 121 1

< -212 1230 > TYPE : PRT < 2213 1 > ORGANISM : Homo sapiens

A2 2209 FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 84 Met Lys Phe Phe Ile Phe Thr Cys Leu Leu Ala Ile Ala Leu Ala Lys |

His 3Glu Ser Ala Glu Val Ser Thr Glu Glu Val Lys His Thr Val Asp m5 25 30

Gin Lys His Tyr Val Lys Gin Leu Asn Lys Ile Asn Pro Phe Tyr 3Gin 40 Lys Try Agn Phe Leu Pro Phe Leu Gln Lys Thr Glu Leu Thr ggEEGlu Glu 3J Glu Lys Asn Asp Gin Lys His Leu Asn Lys Ile Asn Gin Tyr Tyr Gin 75 Phe Thr Leu Pro Gin EETyr Val Lys Ala Val Tyr Gin Tyr His Lys Ile Met Lys Pro amTrp Lys Asn Met Lys Thr Asn Ala Tyr Gin Val Ile Pro Aøn Met Lys 105Thr Asn Ala Tyr Gin 110val Ile Pro | Thr Leu Gly Ser Leu Arg Phe Leu Asn 115 120

< 210 > SEQ ID NO 85 < 211 > LENGTH : 84 < 212 > TYPE : DNA < 213 > ORGANISM : Homo sapiens US 9 , 924 , 728 B2 169 170 - continued ( 2202 FEATURE : < 221 > NAME / KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 85 atgaagttct tcatctttac ctgccttttg gctgttgctc tggcacatca tgagataaag 8 cactcctcct cttccagtga gtaa 8

< 210 > SEQ ID NO 86 < 211 > LENGTH : 182 | < 212 > TYPE : PRT < 213 > ORGANISM : Oryctolagus cuni culus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) 223 > OTHER INFORMATION : Casein alpha - S2 R < 400 > SEQUENCE : 86 Met Lys Phe Phe Ile Phe Thr Cys Leu Leu Ala Val Ala Leu Ala Lys

Pro Lys Ile Glu Gin Ser Ser Ser Glu Glu Thr °Ile Ala Val Ser 3Gin 25

Glu mVal Ser Pro Asn Leu 3Glu Asn Ile Cys Ser Thr Ala Cys Glu Glu 5 E Pro Ile Lys Asn Ile Asn Glu 3Val Glu EETyr Val Glu Val &Pro Thr Glu Ile Lys Asp Gin Glu Phe 8ETyr Gin Lys Val Asn Leu Leu Gin Tyr Leu 65 70

Gin Ala Leu Tyr Gin Tyr Pro Thr Val Met Asp Pro Trp ?Thr Arg Ala Glu Thr Lys Ala Ile Pro Phe Ile Arg Thr ge?Met Gin Tyr Lys IgEGin Glu 188? 105 Lys Asp Ala Thr Lys His Thr Ser Gin Lys Thr Glu Leu ?Thr Glu Glu Glu Lys Ala Phe Leu Lys Tyr Leu m?Asp Glu Met Lys Gin Tyr Tyr Gin Lys Phe Val Phe Pro Gln Tyr Leu Lys Asn Ala His His Phe Gln Lys 145 mm 150 Thr Met Asn Pro Trp Asn His Val Lys Thr Ile Ile Tyr Gin Ser Val ? Pro Thr Leu Arg Tyr Leu ggggg180 < 210 > SEQ ID NO 87 < 211 > LENGTH : 549 < 212 > TYPE : DNA < 213 > ORGANISM : Oryctolagus cuniculus < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 22 > LOCATION : ( 0 ) . . . ( 0 ) mmmm AAA223 > OTHER INFORMATION : Casein alpha - S2 CDNA < 400 > SEQUENCE : 87 atgaagttct tcattttcac ctgccttctg gctgttgctc tggcaaagcc taagattgag 60 caatcttcaa gtgaggaaac tattgctgtc tcccaagaag tatccccaaa cttagaaaac 120 atttgttcta cagcctgtga ggaacccata aagaatatca atgaagtgga atacgttgaa 180 gttcccacag agataaaaga tcaggaattt tatcagaagg tgaacctcct ccagtatctc 240 US 9 ,924 , 728 B2 171 172 . - continued caggctcttt accaatatcc cactgtcatg gacccatgga ctcgggctga gacaaaggcc 300 atccccttta ttcgcactat gcaatataag caggaaaagg atgccactaa gcataccagt 360 cagaaaaccg aactgaccga agaagaaaag gcttttctaa aatacttgga tgaaatgaaa 420 caatattatc aqaaqttcat ttttccccaa tacctaaaaa atqctcatca ttttcaqaaa 480 actatgaacc cttggaatca tgttaagaca attatttacc aaagtgtgcc cactctgaga 540 tacttataa 549

< 210 > SEQ ID NO 88 < 211 > LENGTH : 223 < 212 > TYPE : PRT ( 213 > ORGANISM : Ovis aries < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 88 Met Lys Phe Phe Ile Phe Thr Cys ?Leu Leu Ala Val Ala Leu Ala Lys 15 | | ?3 15 His Lys ?Met Glu His Val Ser Ser Ser Glu Glu Pro Ile Asn Ile Ser 25 30 &E Gln Glu Ile Tyr Lys m?Gin Glu Lys Asn Met Ala Ile His Pro Arg Lys Glu Lys Leu Cys Thr Thr Ser Cys Glu Glu Val Val Arg Asn EAla Asp & 55 60 &ARE Glu Glu Glu Tyr Ser Ile Arg Ser Ser Ser Glu Glu Ser Ala Glu Val 70 mas Ala Pro Glu Glu Val Lys Ile FERThr Val Asp Asp Lys His Tyr Gin Lys Ala Leu Asn Glu Ile Asn Gin Phe Tyr Gin Lys Phe Pro Gln Tyr Leu 105 110 Gin Tyr Leu Tyr Gin Gly Pro Ile Val Leu Asn Pro Trp Asp SE3Gin Val

Lys Arg Asn Ala Gly Pro Phe Thr Pro Thr Val Asn Arg Glu Gin Leu 135 140 E3? Ser Thr Ser Glu Glu Asn Ser Lys Lys Thr Ile Asp Met Glu Ser Thr 150 Glu Val Phe Thr Lys Lys Thr Lys Leu Thr Glu Glu Glu Lys Asn Arg 2 Leu Asn Phe Leu Lys Lys Ile Ser Gin Tyr Tyr Gin Lys Phe Ala Trp 185 mmm 190 | &Pro Gin Tyr Leu Lys Thr Val Asp Gin His Gin Lys Ala Met Lys Pro

Trp Thr Gin Pro Lys Thr Asn Ala Ile Pro Tyr Val Arg Tyr Leu 210 215 220

< 210 > SEQ ID NO 89 < 211 > LENGTH : 672 mmm < 212 > TYPE : DNA ( 213 > ORGANISM : Ovis aries < 220 > FEATURE : < 2211 > NAME / KEY : misc _ feature < 2222 > LOCATION : ( 0 ) . . . ( 0 ) < 2233 > OTHER INFORMATION : Casein alpha - S2 CDNA < 400 > SEQUENCE : 89 atgaagttct tcatttttac ctgccttttg gccgttgccc ttgcaaagca taagatggaa 60 US 9 , 924 , 728 B2 173 174 - continued catgtctcct ccagtgagga acctatcaat atctcccagg aaatatataa gcaggaaaag 120 aatatggcca ttcatcccag aaaggagaaa ctttgcacca catcctgtga ggaagttgta 180 aggaacgcag atgaagagga atattctatc agatcatcta gtgaggaatc tgctgaagtt 240 gccccagagg aagttaagat tactgtggac gataagcact accagaaagc actgaatgaa 300 atcaatcagt tttatcagaa gttcccccag tacctccagt atctgtatca aggcccaatt 360 gttttgaacc catgggatca ggttaagaga aatgctggcc cctttactcc caccgtgaac 420 agagagcagc tctccaccag tgaggaaaat tcaaagaaga ccattgatat ggaatcaaca 480 gaagtattca ctaagaaaac taaactgact gaagaagaaa agaatcgcct aaattttctg 540 aaaaaaatca gccagtatta ccagaaattt gcctggcccc agtatctcaa gactgttgat 600 cagcatcaga aagctatgaa gccatggact caacctaaga caaacgctat tccctatgtg 660 aggtaccttt aa 672

< 210 > SEQ ID NO 90 < 211 > LENGTH : 243

< 21212 > TYPE : PRT < 21313 > ORGANISM : Physeter catodon < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 < 400 > SEQUENCE : 90 Met Lys ?Phe Phe Leu Phe Thr Cys Leu Leu Ala 3Val EAla Leu Ala Lys 5 His Glu Met Glu His Val Ser Ser Ser Glu Glu Ser Ile Asn Met Phe 25

?Gin Glu Lys Tyr Lys Gin Arg Lys Asn Val Val Leu His Pro Ser Lys 135 ?8? Glu Asn Ile Cys Ser Thr Ser cys Glu Val Cys Ile Asp Phe Thr Ser 8 . Val Val Gin Cys Glu Val Lys Tyr Ser Ile Arg Ser Ser Pro Lys Glu meam 175 80 Thr Ala Glu Val Pro Arg Glu REELys Val Lys Leu Thr Val Glu Asp Lys Gin Tyr Leu Lys Gin Leu Ser Lys Ile Ser Gin Phe Tyr Gin Lys Phe 105 Pro Gin Tyr Ile Gln Ala Leu Tyr Gln Ala Pro Thr Val Met Asn Pro 115 sm Trp Gly Gin Val Lys Arg Ser Ala Glu Pro Phe Ile Leu Thr Val Ser Arg Gin Gin Leu Ser Thr Gly Glu Glu Asn Ser Lys Lys Thr Val Asp 155 160 Met Glu Ser Thr Glu Val Leu Thr Lys Lys Thr Thr Leu Thr Glu Glu

Glu Lys Asn Arq Leu Lys Phe Leu Asn Lys Ile Asn Gln Tyr Tyr Gln mammmm 185 Lys Leu Thr Trp Pro Gin Tyr Leu Lys Thr Ile Ser Gin Tyr Gin Lys 195 Thr Val Lys Pro Trp Asn His Ile Lys Thr Asn Val Ile Pro Tyr Leu

|

Asp Tyr Ser Gly Asn Pro Gly Ser Pro Tyr Pro Val ?Asn Pro Thr Leu ? mmmm mmmmm mm235 240 US 9 , 924 , 728 B2 175 176 - continued

Asn Ile Pro

< 210 > SEQ ID NO 91 < 211 > LENGTH : 732 | < 212 > TYPE : DNA < 213 > ORGANISM : Physeter catodon < 220 > FEATURE : < 221 > NAME / KEY : misc _ feature 22 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : Casein alpha - S2 CDNA < 400 > SEQUENCE : 91 atgaagttct tcctttttac ctgccttttg gctgttgctc ttgcaaagca tgagatggaa | 60 catgtctcct ccagtgagga atctatcaac atgttccagg aaaaatataa gcagagaaag | 120 aatgtggtcc ttcatcccag caaggagaac atttgttcca catcctgtga ggtatgtatt 180 gatttcacat cagtagtaca atgtgaagta aaatatagta ttagatcttc ccctaaggaa 240 actgctgaag ttcccaggga gaaagttaag cttactgtgg aagataagca atacctgaaa 300 caactgagca aaatcagtca gttttatcag aagttccccc aatatatcca ggctctatat 360 caagctccaa ctgttatgaa cccatggggt caagttaaga gaagtgctga gccctttatt 420 ctcactgtga gcagacagca gctctctacc ggtgaggaaa attcaaagaa gactgttgat 480 atggaatcaa cggaagtact cactaagaaa actacattga ctgaagaaga aaagaatcgc 540 ctaaaatttc tqaacaaaat caaccaatat tatcaqaaat taacctqaccccagtatoto 600 aagactattt ctcagtatca gaaaactgtg aagccgtgga atcacattaa gacaaatgtt 660 atcccctatc tggattacag cggcaatcct ggcagtcctt acccagttaa cccaactctg 720 aatattcctt aa 732

< 210 > SEQ ID NO 92 < 211 > LENGTH : 142 < 212 > TYPE : PRT < 213 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : alpha - lactalbumin < 400 > SEQUENCE : 92 ?Met Met Ser Phe Val Ser Leu Leu Leu Val Gly Ile Leu Phe His Ala 15 10 | Thr Gin Ala Glu Gin Leu ?Thr Lys ECys Glu Val Phe Arg Glu Leu Lys 20 Asp Leu Lys Gly Tyr Gly Gly Val Ser Leu Pro Glu Trp Val Cys Thr 35 40 Thr Phe His Thr Ser Gly Tyr amAsp Thr Gin Ala meIle Val Gin Asn Asn Asp Ser Thr Glu Tyr Gly Leu Phe Gin Ile Asn Asn Lys Ile Trp Cys 70 Lys Asp Asp Gin Asn Pro His Ser Ser Asn Ile Cys Asn Ile Ser Cys 90 Asp Lys Phe Leu Asp Asp Asp Leu Thr Asp Asp Ile Met Cys Val Lys 100 mms Lys Ile Leu Asp Lys Val Gly Ile Asn Tyr Trp Leu Ala His Lys Ala 115 120 Leu Cys Ser Glu Lys Leu Asp Gin Trp Leu Cys Glu Lys Leu E | 140 am US 9 , 924 ,728 B2 177 178 - continued

< 210 > SEQ ID NO 93 < 211 > LENGTH : 429 < 212 > TYPE : DNA 13 > ORGANISM : Bos taurus < 220 > FEATURE : < 221 > NAME /KEY : misc _ feature < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : alpha - lactalbumin cDNA < 400 > SEQUENCE : 93 atgatgtcct ttgtctctct gctcctggta ggcatcctat tocatgccac ccaggctgaa 60 cagttaacaa aatgtgaggt gttccgggag ctgaaagact tgaagggcta cggaggtgtc 120 agtttgcctg aatgggtctg taccacgttt cataccagtg gttatgacac acaagccata 180 gtacaaaaca atgacagcac agaatatgga ctcttccaga taaataataa aatttggtgc 240 aaagacgacc agaaccctca ctcaagcaac atctgtaaca tctcctgtga caagttcctg 300 gatgatgatc ttactgatga cattatgtgt gtcaagaaga ttctggataa agtaggaatt 360 aactactggt tggcccataa agcactctgt tctgagaagc tggatcagtg gctctgtgag 420 aagttgtga 429

< 210 > SEQ ID NO 94 < 211 > LENGTH : 142 < 212 > TYPE : PRT < 213 > ORGANISM : Capra hircus 20 > FEATURE : < 221 > NAME / KEY : VARIANT < 222 > LOCATION : ( 0 ) . . . ( 0 ) < 223 > OTHER INFORMATION : alpha - lactalbumin < 400 > SEQUENCE : 94 Met Met Ser Phe Val Ser Leu Leu Leu Val Gly Ile Leu Phe His Ala

Thr Gin Ala Glu Gin Leu Thr Lys cys Glu Val Phe Gin Lys Leu Lys 25 30 Asp Leu Lys Asp Tyr Gly Gly Val Ser Leu Pro Glu Trp Val Cys Thr

Ala Phe His Thr Ser Gly Tyr Asp Thr Gin Ala Ile Val Gin Asn Asn

Asp Ser Thr Glu Tyr Gly Leu Phe Gin Ile Asn Asn Lys Ile Trp Cys 75 Lys Asp Asp Gin Asn Pro His Ser Arg Asn gebedenaIle Cys Asn Ile Ser Cys Asp Lys Phe Leu Asp Asp Asp Leu Thr Asp Asp Ile Val Cys Ala Lys 105 110 Lys Ile Leu Asp Lys Val Gly Ile Asn Tyr Trp Leu Ala His Lys Ala da 125 Leu Cys Ser Glu Lys Leu Asp Gin Trp Leu Cys Glu Lys Leu 130 140 Elbette < 210 > SEQ ID NO 95 < 211 > LENGTH : 735 ?< 212 > TYPE : DNA ?< 213 > ORGANISM : Capra hircus ?< 220 > FEATURE : ?< 221 > NAME / KEY : misc _ feature ?< 222WNA > LOCATION : ( 0 ) . . . ( 0 ) ?< 223 > OTHER INFORMATION : alpha - lactalbumin cDNA < 400 > SEQUENCE : 95