Church Point Museum Getting a Makeover

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Bobcats win, Blue Jays fall in first round Page 7 The Eunice News VOL. 116 NO. 97 SUNDAY, NOVEMBER 29, 2020 $1.00 Amanda Cain, St. Landry Parish Government finance director, discusses the Parish Council’s 2020 and 2021 budgets at a meeting Wednesday in Opelousas. (Photo by Harlan Kirgan) The Le Vieux Presbytére Museum in Church Point, bousillage. The structure even had a brick wine cellar constructed in 1887 as a home for priests, measures accessible from the central hall at one time. (Photo by 40 feet by 40 feet, with an 8-foot porch surrounding the Claudette Olivier/The Church Point News) structure. The walls are farmed in wood and filled with Parish budget balanced, but Church Point museum questions hover By Harlan Kirgan is balanced.” Editor The parish finances getting a makeover OPELOUSAS — An faced uncertainty from amended 2020 budget and hurricanes that battered a proposed 2021 budget the parish and the CO- Second floor at Le Vieux Presbytère to be opened to public were introduced at a spe- VID-19 pandemic. By Claudette Olivier and a long hallway to reach the brick wine cellar accessible from cial meeting Tuesday. The pandemic caused The Church Point News other two windows — remember, the central hall. The 2020 budget in- revenue shortfalls mainly CHURCH POINT — One of the no air-conditioning. During the In 2007, a group of volunteers cludes an ending balance due to decreases in activ- oldest second stories in Church 11-year restoration, when much collected artifacts, pictures and of $2,123,405 that is car- ity at Evangeline Downs Point will soon be open to the of the building was torn down stories of Church Point and its ried forward into the 2021 and from video poker. public. to its roots, the upstairs was not people, and the building has since ending balance. The 2020 Cain said the racino rev- Local historian Gene slated for renovation. It was left served as the Town of Church beginning balance was enue dropped to zero at Thibodeaux said, “I am not an in whatever condition the workers Point’s museum. The museum was $1,574,569 — A $548,836 one point. architect nor did I see the building left it in.” originally open for tours once a difference. Another major question 100 years ago, but I am familiar One of Church Point’s earli- week and by appointment, and it is Amanda Cain, finance in the 2021 budget is if vot- with the building and have an est, still standing homes to have also available for special events. director, presented the ers will approve a 1-mill, engineering background. This an upstairs area, the Le Vieux Museum curator Harold Fonte budget and said, “I’m hap- 10-year jail maintenance is my opinion — when the pres- Presbytère Museum is undergo- said the two upstairs rooms were py to say the 2021 budget (See Budget, Page 2) bytere was built, there were two ing some major updates, including first occupied by family members bedrooms upstairs, insulated new flooring on the second floor, of Fr. Auguste Vincent Eby who by bousillage. The other spaces an area that has been closed to the was resident pastor of the Sacred (upstairs) were likely never used, public since the building opened Heart of Mary Parish and spear- being so hot during the Louisiana as a museum in 2007. The mu- headed the construction of the summer. They were not boarded seum is closed to the public for the residence. Those family members over — they were never open in updates. were Eby’s two sisters and a neph- Parish meeting the first place. The building, constructed in ew. Eby, a native of Perigueux, “The two upstairs rooms were 1887 as a home for priests, mea- France, lived downstairs. Fonte likely no longer used after the sures 40 feet by 40 feet, with an said the two rooms were likely last addresses soaring porches were enclosed and the bed- eight foot porch all around. The used in the early 1960s and at that room wing added, except maybe for walls are framed in wood and time were still used as bedrooms. storage. In its original state, the filled in with bousillage, and the upstairs had a room on each side structure even originally had a (See Museum, Page 2) virus positivity rate OPELOUSAS — St. which measures human Landry Parish President mobility. Jessie Bellard met with The meeting addressed several parish mayors bars in the parish that are Wednesday about the in- affected by the higher pos- LSU report: Worst may be over for oil&gas crease in positivity rates itivity rates and the gover- By David Jacobs fessor Greg Upton, assume that which could add to the global oil in the parish and what nor’s new modified Phase The Center Square presumptive President-elect Joe supply, and industry efforts to re- the impact of the modified 2. Bellard recommended The worst is likely over for Loui- Biden’s campaign proposal to duce carbon emissions. Ironically, Phase 2. that bar owners follow the siana’s struggling oil-and-gas sec- ban new oil and gas permitting regulatory changes that make it The parish has experi- governor’s proclamation: tor, though employment is unlikely on public lands and waters is not harder to develop oil-and-gas re- enced a second straight For bars in parishes to rebound to levels seen before implemented anytime soon. They sources could benefit certain sec- week of higher COVID-19 above 5% positivity, bars the 2015 crash or even to pre-CO- also assume that trade talks with tors of the industry by increasing positivity percentages. For are closed to indoor sales VID-19 levels, according to a new China will not deteriorate, leading prices for fossil fuels. the week of Nov. 5 to 11, and consumption but open report. to new tariffs, and that the COV- Oil production, both nationally the parish had an 11.90% for outdoor consumption The LSU Center for Energy Stud- ID-19 pandemic is brought under and in the Gulf Coast region, is rate. That number was up at tables only and 25 per- ies projects Louisiana will regain control. expected to decline over the next from the 11.10% recorded cent capacity, with a max- about 2,600 jobs in the upstream “Embedded in this outlook is three years. the week before. imum of 50 people. Social oil and gas extraction and services the assumption that COVID-19 The authors project $105 billion Bellard and the mayors distancing is required. sectors by the end of next year rela- will gradually subside, and that in energy manufacturing invest- agreed to push the mes- Take-out and delivery will tive to the low point in September. a second wave of shutdowns will ment in the Gulf Coast region by sage to their citizens to still be available. Louisiana refining and chemical be avoided,” the authors say. “Yet, 2029. They expect investments to wear a mask, wash hands, Bellard recommended manufacturing employment is ex- within days of sending this [re- consist of $58 billion in liquified and continue to social dis- that bar owners who have pected to increase by about 300 port] off to print, the likelihood natural gas investments (55%) and tance, a parish govern- questions about the modi- jobs by the end of 2021, or about a of a second wave of infections $47 billion (45%) in non-LNG en- ment news release stated. fied Phase 2 should visit 0.8% increase. and associated reduced economic ergy manufacturing investments. St. Landry Parish rat- opensafely.la.gov and reg- The authors of the center’s 2021 activity has increased substan- Most of the total investment will ed a D grade on the CO- ister their business. New Gulf Coast Energy Outlook, LSU tially.” be in Louisiana ($63.5 billion or VID-19 Social Distanc- guidance for the Phase is CES director and professor Da- Other factors to watch include a 60%) followed by Texas ($41.5 bil- ing Scorecard hosted by available for download at vid Dismukes and associate pro- potential re-engagement with Iran, lion or 40%). the website unacast.com that website. Kip & Angie...Teamed Up Again! www.wsbankla.com 1020 West Laurel Ave • Eunice • 337-457-8952 2 Sunday, November 29, 2020 News The Eunice News www.eunicetoday.com the previously unused up- rator and an army of vol- tor was Fr. Eby. Thibodeaux said that when the church decided stairs spaces will be used unteers couldn’t have done “When he arrived, he the building that sat at to demolish the old build- Museum for storage. on their own,” Fonte said. discovered that his church this site was far different ing due to it becoming a (Continued from Page 1) “We will rotate some Meche said the update and his living quarters in from the one Fr. Eby had financial burden.” While the flooring in the of the displays by season, to the museum is long the back room of it were built. In 1910, an annex The church then do- second story hallway was and the storage space will overdue. in a sorry state of repair,” was added by Fr. Auguste nated the building, to be redone with a more mod- allow more items to be “What we are trying to Thibodeaux said. “Fr. Francois Roger, and a moved, to the town, but ern material — plywood housed at the museum, do is get more interest in Eby built a new church kitchen was added in 1928 only the original section and vinyl — wood that Fonte said.
Recommended publications
  • UNIX Essentials (Hands-On)

    UNIX Essentials (Hands-On)

    UNIX essentials (hands-on) • the directory tree • running programs • the shell (using the T-shell) → command line processing → special characters → command types → shell variables → environment variables → wildcards → shell scripts → shell commands → pipes and redirection • OS commands • special files 1 • The Directory Tree → directories contain files and/or directories → / : means either the root directory, or a directory separator • consider /home/afniuser/AFNI_data3 afniuser/suma_demo → an "absolute" pathname begins with '/', a "relative" pathname does not • a relative pathname depends on where you start from • in the directories above, note which is a relative pathname → every directory has a parent directory • the relative pathname for the parent directory is '..' • the relative pathname for the current directory is '.' • consider './run_this_script' and '/bin/ls ../../suma_demo' → many commands can be used to return to the home directory (of "afniuser") • cd, cd ~, cd ~afniuser, cd $HOME, cd /home/afniuser • note the 2 special characters, '~' and '$' → while you work, keep your location within the directory tree in mind 2 → class work: • open a terminal window • commands: cd, pwd, ls, ls -al • use the "cd" command to go to the given directories e.g. for directory /usr/bin, use the command: cd /usr/bin once there, use the commands "pwd", "ls", and "ls -al" note that you can always return to the home directory via: cd / home/afniuser AFNI_data3 .. AFNI_data3/afni /usr/bin ~/abin ../../afniuser/../afniuser • first example (starting with the '/'directory), use the commands: cd / pwd ls ls -al 3 • Running Programs → a program is something that gets "executed", or "run" → the first element of a command line is generally a program (followed by a space) → most shells are case sensitive when processing a command → command examples: /bin/ls $HOME ~/AFNI_data3 count -digits 2 1 10 → script: an interpreted program (interpreted by another program) • e.g.
  • Recompiling Minix

    Recompiling Minix

    8 RECOMPILING MINIX This chapter is intended for those readers who wish to modify MINIX or its utili- ties. In the following pages we will tell what the various files do and howthe pieces are put together to form the whole. It should be emphasized that if you simply intend to use MINIX as distributed, then you do not have torecompile the system and you do not have toread this chapter.Howev er, ifyou want to makechanges to the core of the operating system itself, for example, to add a device driverfor a streamer tape, then you should read this chapter. 8.1. REBUILDING MINIX ON THE IBM PC Although this section is specifically for IBM PC users, it should also be read carefully by everyone interested in recompiling MINIX.Most of what is said here applies to all versions of MINIX.The sections about other processors mostly discuss the differences between recompiling MINIX on an IBM PC and on another system. The MINIX sources are contained in the following directories, normally all subdi- rectories of /usr/src except for include which goes in /usr/include: center allbox; l l. Directory Contents include The headers used by the SEC. 8.1 REBUILDING MINIX ON THE IBM PC 113 commands (has twosubdirectories) kernel Process, message, and I/O device handling mm The memory manager fs The file system tools Miscellaneous tools and utilities test Test programs lib Libraries (has several subdirectories) commands The utility programs (has manysubdirectories) Some of the directories contain subdirectories. If you are working on a hard disk, be sure that all these directories have been set up, and all files copied there from the dis- tribution diskettes and decompressed and dearchived.
  • Minimal Perl for UNIX and Linux People

    Minimal Perl for UNIX and Linux People

    Minimal Perl For UNIX and Linux People BY TIM MAHER MANNING Greenwich (74° w. long.) For online information and ordering of this and other Manning books, please visit www.manning.com. The publisher offers discounts on this book when ordered in quantity. For more information, please contact: Special Sales Department Manning Publications Co. Cherokee Station PO Box 20386 Fax: (609) 877-8256 New York, NY 10021 email: [email protected] ©2007 by Manning Publications Co. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by means electronic, mechanical, photocopying, or otherwise, without prior written permission of the publisher. Many of the designations used by manufacturers and sellers to distinguish their products are claimed as trademarks. Where those designations appear in the book, and Manning Publications was aware of a trademark claim, the designations have been printed in initial caps or all caps. Recognizing the importance of preserving what has been written, it is Manning’s policy to have the books we publish printed on acid-free paper, and we exert our best efforts to that end. Manning Publications Co. Copyeditor: Tiffany Taylor 209 Bruce Park Avenue Typesetters: Denis Dalinnik, Dottie Marsico Greenwich, CT 06830 Cover designer: Leslie Haimes ISBN 1-932394-50-8 Printed in the United States of America 12345678910–VHG–1009080706 To Yeshe Dolma Sherpa, whose fortitude, endurance, and many sacrifices made this book possible. To my parents, Gloria Grady Washington and William N. Maher, who indulged my early interests in literature. To my limbic system, with gratitude for all the good times we’ve had together.
  • Linux Programming

    Linux Programming

    Linux & Shell Programming By High School Technology Services myhsts.org Session 3 Contents Text Editing Types of Editors Basic Editor Tasks with vi Editing Multiple Files Set Commands vi Startup File Types of Editors ed is a line editor for the Unix operating system. It was one of the first parts of the Unix operating system that was developed, in August 1969. Elvis is a vi/ex clone, i.e. it closely resembles the Unix text editor "vi", but adds quite a few commands and features. Elvis is written by Steve Kirkendall and is distributed under the Clarified Artistic License which is used by Perl and is a GPL-compatible free software license. Editing files using the screen-oriented text editor vi is one of the best ways. This editor enables you to edit lines in context with other lines in the file. An improved version of the vi editor which is called the VIM has also been made available now. Here, VIM stands for Vi Improved vi is generally considered the de facto standard in Unix editors because − It's usually available on all the flavors of Unix system. Its implementations are very similar across the board. It requires very few resources. It is more user-friendly than other editors such as the ed or the ex. Basic Editor Tasks with vi Basic Editor Tasks with vi Following is an example to create a new file testfile if it already does not exist in the current working directory − Basic Editor Tasks with vi Operation Modes While working with the vi editor, we usually come across the following two modes − Command mode − This mode enables you to perform administrative tasks such as saving the files, executing the commands, moving the cursor, cutting (yanking) and pasting the lines or words, as well as finding and replacing.
  • Reference Manual for the Minix 1.5 Demonstration Disk

    Reference Manual for the Minix 1.5 Demonstration Disk

    REFERENCE MANUAL FOR THE MINIX 1.5 DEMONSTRATION DISK ANDREW S. TANENBAUM Prentice Hall, Inc 2 Copyright 1991 Prentice Hall, Inc. 1 1 INTRODUCTION Every computer needs an operating system to manage its memory, control its I/O devices, implement its ®le system and provide an interface to its users. Many operating systems exist, such as MS-DOS, OS/2, and UNIX. This manual provides a very brief introduction to another operating system, MINIX. It is intended to accom- pany the MINIX demonstration diskette. Although MINIX was inspired by the well-known AT&T UNIX operating system, its design and implementation are completely new. It does not contain even a single line of AT&T code: not in the operating system, not in the C compiler, and not in any of the nearly 200 utility programs supplied with MINIX. For this reason, it is possible to include not only all the binary programs, but, virtually all the source code of the operating system and utilities as well. In this way, people can study MINIX in detail to learn how a modern operating system is constructed, and can also modify it to suit their own tastes if need be. Before getting started, we would like to point out that this manual and the accompanying demonstration diskette only deal with a tiny fraction of MINIX, just to give the ¯avor of the system. If your favorite feature (e.g., the Berkeley vi edi- tor) is not present here, that does not mean that it is also absent from the full sys- tem.
  • Ebook Download Learning the Vi and Vim Editors

    Ebook Download Learning the Vi and Vim Editors

    LEARNING THE VI AND VIM EDITORS PDF, EPUB, EBOOK Arnold Robbins,Elbert Hannah,Linda Lamb | 494 pages | 29 Jul 2008 | O'Reilly Media, Inc, USA | 9780596529833 | English | Sebastopol, United States Learning the vi and Vim Editors PDF Book Help us improve. Jul 27, James rated it it was amazing Shelves: reference , general-science-math-technology , computers. Understanding few simple, yet highly unintuitive, commands can make you functional when reading and manipulate files like INIs, Logs, etc. View Product. It's the shell that unlocks the real potential of Unix. The appendices are exceptionally helpful. Want to Read saving…. He loves connecting Unix to anything and once wrote a stream editor program to automate JCL edits for mainframe monthly configurations by streaming mainframeJCL to a stream editor on an RJE connected Unix box. Aug 23, Eric rated it really liked it. Takes you through several editors vi, ex, Darrell, other clones. This is probably the most complete VIM book on the market, which can be used both as cover-to-cover read or as a reference. No trivia or quizzes yet. I'm just saying. Author Recent Posts. Vim, however, is not a text formatting program; rather, it is a sophisticated text editor primarily used to write code, short notes, and input to a text formatting system. Latest posts by Sagar Khillar see all. Accessible to vim newbies and easy to navigate. Because I was reading on an ebook, the other egregious problem was a huge chunk of the book devoted to vile, kyle, elvis, and other weird vi-clones, none of which r Definitely showing its age; the first third of the book exclusively discusses vi not vim , to the extent that a lot of it becomes superceded by the rest of the book.
  • Learning the Vi and Vim Editors Other Resources from O’Reilly

    Learning the Vi and Vim Editors Other Resources from O’Reilly

    Learning the vi and Vim Editors Other resources from O’Reilly Related titles vi Editor Pocket Reference The Productive Programmer Unix in a Nutshell Unix Power Tools Classic Shell Scripting Mac OS X for Unix Geeks oreilly.com oreilly.com is more than a complete catalog of O’Reilly books. You’ll also find links to news, events, articles, weblogs, sample chapters, and code examples. oreillynet.com is the essential portal for developers interested in open and emerging technologies, including new platforms, pro- gramming languages, and operating systems. Conferences O’Reilly Media brings diverse innovators together to nurture the ideas that spark revolutionary industries. We specialize in documenting the latest tools and systems, translating the inno- vator’s knowledge into useful skills for those in the trenches. Visit conferences.oreilly.com for our upcoming events. Safari Bookshelf (safari.oreilly.com) is the premier online refer- ence library for programmers and IT professionals. Conduct searches across more than 1,000 books. Subscribers can zero in on answers to time-critical questions in a matter of seconds. Read the books on your Bookshelf from cover to cover or sim- ply flip to the page you need. Try it today for free. main.title Page iii Monday, May 19, 2008 11:21 AM SEVENTH EDITION Learning the vi and VimTomcat Editors™ The Definitive Guide Arnold Robbins, ElbertJason Brittain Hannah, and and Ian Linda F. Darwin Lamb Beijing • Cambridge • Farnham • Köln • Sebastopol • Taipei • Tokyo Learning the vi and Vim Editors, Seventh Edition by Arnold Robbins, Elbert Hannah, and Linda Lamb Copyright © 2008 Arnold Robbins, Elbert Hannah, and Linda Lamb.
  • Download Vim Tutorial (PDF Version)

    Download Vim Tutorial (PDF Version)

    Vim About the Tutorial Vi IMproved (henceforth referred to as Vim) editor is one of the popular text editors. It is clone of Vi editor and written by Bram Moolenaar. It is cross platform editor and available on most popular platforms like Windows, Linux, Mac and other UNIX variants. It is command-centric editor, so beginners might find it difficult to work with it. But once you master it, you can solve many complex text-related tasks with few Vim commands. After completing this tutorial, readers should be able to use Vim fluently. Audience This tutorial is targeted for both beginners and intermediate users. After completing this tutorial, beginners will be able to use Vim effectively whereas intermediate users will take their knowledge to the next level. Prerequisites This tutorial assumes that reader has basic knowledge of computer system. Additionally, reader should be able to install, uninstall and configure software packages on given system. Conventions Following conventions are followed in entire tutorial: $ command execute this command in terminal as a non-root user 10j execute this command in Vim’s command mode :set nu execute this command in Vim’s command line mode Copyright & Disclaimer Copyright 2018 by Tutorials Point (I) Pvt. Ltd. All the content and graphics published in this e-book are the property of Tutorials Point (I) Pvt. Ltd. The user of this e-book is prohibited to reuse, retain, copy, distribute or republish any contents or a part of contents of this e-book in any manner without written consent of the publisher. We strive to update the contents of our website and tutorials as timely and as precisely as possible, however, the contents may contain inaccuracies or errors.
  • UNIX System Servicesuser's Guide

    UNIX System Servicesuser's Guide

    z/OS Version 2 Release 3 UNIX System Services User's Guide IBM SA23-2279-30 Note Before using this information and the product it supports, read the information in “Notices” on page 321. This edition applies to Version 2 Release 3 of z/OS (5650-ZOS) and to all subsequent releases and modifications until otherwise indicated in new editions. Last updated: 2019-02-16 © Copyright International Business Machines Corporation 1996, 2018. US Government Users Restricted Rights – Use, duplication or disclosure restricted by GSA ADP Schedule Contract with IBM Corp. Contents List of Figures...................................................................................................... xv List of Tables......................................................................................................xvii About this document...........................................................................................xix Who should use z/OS UNIX System Services User's Guide?....................................................................xix What is in z/OS UNIX System Services User's Guide?........................................................................ xix Tasks that can be performed in more than one environment.............................................................xix z/OS information.................................................................................................................................. xix How to send your comments to IBM.....................................................................xxi If you
  • Universal Ctags Documentation Release 0.3.0

    Universal Ctags Documentation Release 0.3.0

    Universal Ctags Documentation Release 0.3.0 Universal Ctags Team 22 September 2021 Contents 1 Building ctags 2 1.1 Building with configure (*nix including GNU/Linux)........................2 1.2 Building/hacking/using on MS-Windows..............................4 1.3 Building on Mac OS.........................................7 2 Man pages 9 2.1 ctags.................................................9 2.2 tags.................................................. 33 2.3 ctags-optlib.............................................. 40 2.4 ctags-client-tools........................................... 46 2.5 ctags-incompatibilities........................................ 53 2.6 ctags-faq............................................... 56 2.7 ctags-lang-inko............................................ 62 2.8 ctags-lang-iPythonCell........................................ 62 2.9 ctags-lang-julia............................................ 63 2.10 ctags-lang-python.......................................... 65 2.11 ctags-lang-r.............................................. 69 2.12 ctags-lang-sql............................................. 70 2.13 ctags-lang-tcl............................................. 72 2.14 ctags-lang-verilog.......................................... 73 2.15 readtags................................................ 76 3 Parsers 81 3.1 Asm parser.............................................. 81 3.2 CMake parser............................................. 81 3.3 The new C/C++ parser........................................ 82 3.4 The
  • Unix, Perl and Bioperl

    Unix, Perl and Bioperl

    Unix, Perl and BioPerl I: Introduction to Unix for Bioinformatics George Bell, Ph.D. WIBR Biocomputing Group Introduction to Unix for Bioinformatics • Why Unix? • The Unix operating system • Files and directories • Ten required commands • Input/output and command pipelines • Supplementary information – X windows –EMBOSS – Shell scripts 2 Unix, Perl, and BioPerl © Whitehead Institute, February 2004 Objectives • Get around on a Unix computer • Run bioinformatics programs “from the command line” • Design potential ways to streamline data manipulation and analysis with scripts 3 Unix, Perl, and BioPerl © Whitehead Institute, February 2004 Why Unix (for me)? • GEISHA, the Gallus gallus (chicken) EST and in situ hybridization (ISH) database >A01_T3 | GEISHA | Gallus gallus | 496 nt | 77:572 ATCAAAGGCTTTACCGACAAACATCATTTGCACAATTAGTTGTTGGACAGGAGGGAGGACACCCGAGGACATGTAGGCTCGAGCCATAGTGTTGCCAAGGCTCTC CCTGTTTGTTCCTTGGGTGAGCTGAGCCAACAGCTCTCCCTGCCCTCAGGAAGGCAGCAGTGGTGACAGGCACTCTATGGGGACTAACAGGAGGGGGTGGTTGTG GTGACCTCGGAGCAGGCAGCATCTCACCCATCACTCACACTGCAGACAGCATCACTGTGAAGGCCTACAGATACTGCAGTGTGGGTCACAAAAGCATCCACTGGC TGCTCCTCACCTCTTCTTCTTCCTCAGCATCTCCATGTACGTTGAAAGTGACTTCTGGATGGAGTCTTTGGATGTGAACTTGACAAAGTTCTGAATGTCTTCCTC CCGGTGAGCAAGCATGTGGTCCAGCACTGCCTTCCTCATCATGGACTTGGTGAGCTGGCGGGCATGGTCAGGCAGA >A02_T3 | GEISHA | Gallus gallus | 468 nt | 77:544 ACTTCTCGGTTTATTAAAAACGGATACCATAAACAAGACCTGTACAAAAAGAATCCAAAGTCACCCAGAATTTGCTAACAGTGGCATGGGAGAAGTTATCGTCTT GGGCCTCCTCTTCCTCTGCCGCGGCCCCGGCCTCTTCCACGGCCTCGGCCACGGCCTCTTCCAGCAACTGCTTCTCTTTTCTTGGACTTGACTTTTGGTTCAACA TCCACTAGCAAGGTGTCCAGGGGCAAACTGTCTGGCAGAATGAAGTATCGGATGTTATTCCCCCGAATGCTCAGTGTCTCCAGCTGTACAGGCTCCCTGTTCTTC
  • Vis Editor Combining Modal Editing with Structural Regular Expressions

    Vis Editor Combining Modal Editing with Structural Regular Expressions

    Vis Editor Combining modal editing with structural regular expressions Marc Andr´eTanner CoSin 2017, 17. May Editor Lineage1 1966 QED 1971 ed 1974 sed 1975 em 1976 ex 1979 vi 1987 stevie sam 1990 elvis 1991 vim 1994 nvi acme 2010 scintillua 2011 kakoune sandy 2014 neovim vis ... 1Wikipedia, vi family tree, editor history project TL;DR: What is this all about? Demo I https://asciinema.org/a/41361 I asciinema play ... Modal Editing I Most editors are optimized for insertion I What about: navigation, repeated changes, reformatting etc. I Different modes, reuse same keys for different functions The vi(m) Grammar Editing language based on: I Operators (delete, change, yank, put, shift, ...) I Counts I Motions (start/end of next/previous word, ...) I Text Objects (word, sentence, paragraph, block, ...) I Registers Demo: Motions and Text Objects Motions I Search regex /pattern I Find character f{char} I Match brace % Text Objects I Block a{ I Indentation i<Tab> I Lexer Token ii Structural Regular Expressions The current UNIX® text processing tools are weakened by the built-in concept of a line. There is a simple notation that can describe the `shape' of files when the typical array-of-lines picture is inadequate. That notation is regular expressions. Using regular expressions to describe the structure in addition to the contents of files has interesting applications, and yields elegant methods for dealing with some problems the current tools handle clumsily. When operations using these expressions are composed, the result is reminiscent of shell