Genes and Immunity (2001) 2, 455–460 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Identification of novel polymorphisms in the ␤7 integrin gene: family-based association studies in inflammatory bowel disease DA van Heel1,2, AH Carey3 and DP Jewell2 1Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford, OX3 7BN, UK; 2Gastroenterology Unit, Gibson Laboratories, Radcliffe Infirmary, Oxford, OX2 6HE, UK; 3Oxagen Ltd, 91 Milton Park, Abingdon, OX14 4RY, UK Linkage studies from five groups worldwide have confirmed the presence of an inflammatory bowel disease susceptibility locus on chromosome 12q. Beta 7 integrin is a strong candidate gene within this region, and is involved in lymphocyte homing to the gut and retention of intra-epithelial lymphocytes. Monoclonal antibodies to ␤7 integrin ameliorate colitis in animal models. We obtained genomic sequence for ␤7 integrin, and screened all 16 exons and 1.7 kb of 5Ј promoter region for polymorphisms in 24 individuals. Fourteen single nucleotide polymorphisms were identified in total and, of these, two common (frequency у10%) intronic and two amino acid changing polymorphisms were assessed for potential disease associations. Data were available from 102 multiply affected inflammatory bowel disease families (affected sibling pairs) and 362 simplex (one affected proband) families containing 254 ulcerative colitis, 13 indeterminate colitis and 300 Crohn’s disease trios (parents + affected child). No significant associations with any disease phenotype were found with the transmission disequilibrium test. Beta 7 integrin is unlikely to be involved in the genetic susceptibility to inflammatory bowel disease, and therefore future studies on chromosome 12 should focus on other positional candidate genes. Genes and Immunity (2001) 2, 455–460. Keywords: inflammatory bowel disease; Crohn’s disease; ulcerative colitis; ITGB7; integrin; genetic susceptibility Introduction all lymphocytes to the gut and associated lymphoid tissues. Gut-homing effector cells (expressing high levels Inflammatory bowel disease (IBD), comprising Crohn’s of ␣4␤7 integrin) attach directly to mucosal addressin cell disease (CD) and ulcerative colitis (UC), is likely to result adhesion molecule 1 on high endothelial venules, whilst from inherited mutations in disease susceptibility genes naı¨ve cells attach initially via L-selectin.11 ␣E␤7 integrin is interacting with environmental factors. Epidemiological expressed on gut intraepithelial lymphocytes, which are evidence from twin studies, familial clustering and intra- retained in the gut by binding to the ligand E-cadherin familial disease concordance suggests that IBD has a present on epithelial cells.12,13 1 strong genetic component. Estimates of the sibling rela- Other evidence that ITGB7 plays a key role in the ␭ tive risk s vary from 10 to 35, depending on IBD pheno- development of bowel inflammation comes from animal 2–5 type used. In the Oxford IBD genome-wide scan the and pharmacological studies. Monoclonal antibodies to greatest evidence for linkage was found on chromosome ␣4␤7 ameliorate colitis in both the cotton top tamarin and 6 12q. Subsequently four other groups worldwide have CD45RBhigh CD4+ T cell reconstituted severe combined 7–10 confirmed this IBD2 linkage region (OMIM: 601458). immunodeficiency syndrome (SCID) mouse models of The integrins comprise a large family of transmem- IBD.14,15 Knockout mice deficient for the ␤7 integrin sub- ␣ brane adhesion glycoproteins, each composed of an unit exhibit severely impaired development of the gut ␤ ␤ and subunit. The 7 integrin gene (ITGB7) maps to the associated lymphoid tissue, and attenuated immune IBD2 linkage region on chromosome 12. It is an excellent responses against helminth infection.16,17 candidate gene for IBD susceptibility, both because of its Mutations in the ␤2, ␤3 and ␤4 integrins cause leuko- position and the fact that it is involved in leucocyte traf- cyte adhesion deficiency, thromboasthenia and epiderm- ␣ ␤ ficking and recruitment to the gut. The 4 7 integrin het- olysis bullosa respectively.18–20 We therefore hypoth- erodimer is an adhesion molecule involved in homing of esised that similar functional mutations in the ␤7 integrin gene may play a role in susceptibility to IBD. Potential mechanisms for pathological mutations include increased Correspondence: Dr DA van Heel, Wellcome Trust Centre for Human leukocyte ␤7 integrin expression, changes in ligand affin- Genetics, University of Oxford, Roosevelt Drive, Oxford, OX3 7BN, UK. ity and alterations in the complex integrin signalling and Ȱ E-mail: david.vanheel well.ox.ac.uk lymphocyte activation pathway.21 No polymorphisms in Part of this work was funded by Oxagen Ltd, and a Medical ITGB7 have been reported, and therefore we screened all Research Council LINK grant between the University of Oxford and Ј Oxagen Ltd. exons and the 5 promoter region in order to identify Received 20 August 2001; revised 12 September 2001; accepted 13 markers to test for association. The transmission disequi- September 2001 librium test (TDT) was chosen to overcome the potential ␤7 integrin polymorphisms in IBD DA van Heel et al 456 Table 1 Primer pairs for ITGB7 mutation detection Region Primers (5Ј to 3Ј) promoter (−1688 to −790) CCCCTCCTAGCAGCTACACC GGGATTACAGGCACACTCG promoter (−1011 to −282) CCAGAGCCTATGTAGTCAAGCAC CCAAGGTCCCACAGCTAGTAAG promoter (−434 to −59) CTGGGAAACAGAGCAAGACC CTAGAAGGTGGTGCAGATAGGG promoter (−169) exon 1 ATGTTACGTTCAACACATGACAGG CAGATGACAGCACTCATATACATCC exon 2 AAAGCCGCCAAGTATGTCAG TTCGAAACCAGCCTAGTCAAC exon 3 CACATGTCCCCCTTTATATCC TGTGCACAAACTCAGTCACAC exon 4 ATCAGGGACTCAAGGAGTGGAC TCAGGTCCATAAGGTAGTACAGGTC exon 5 GCGGCCTGGTGAGTTAGG ATGTTGGCAGAGGCTAGGG exon 6 CCACCCCACTTCCCATAGAG GTTCCCAAACAGACCTCCAG exon 7 CCCAGGTGCATAGCCTACC AAGAGGTGTGGCTGAAATGG exon 8 ATGTTGTGGGGGAAACCTG ATATGGGGGACGGAGAATG exon 9 GGAGCCCATTTTCCTAGAGC CAGTTAATGACAGCCACATGC exon 10 GGACATAAGGTGGGGTTGG TTCCTGCCTGCTTAATTTCC exon 11 TAACATGACCCCATCCCTTC GTTGTTGGGAGCCAGGTG exon 12 CCTGGGAGAGACAAGTCAGG AGCCTAAGTGCCTTGGGAAG exon 13 GGGTGTGGTTGGCATACTTC GACGGAGAGTAGGCAGATGG exon 14 CTGCTTGTAGTTGGGCAAGG CAAACTTCCAGGGTTTGTGG exon 15 GGTTCCCTTTGCTTTCAGTG GAATCAGGGCTGGTCTTGTG exon 16 AGGAATCCTGGGATTTTTGC GCAAGAGGAGGATGGACAAG problems of false positive results that can arise in case- sequence (SNP13 and SNP18) had allele frequencies control based association studies. у10%. Association analysis Results The two amino acid changing SNPs were genotyped in the IBD families, as we hypothesised that these may be Polymorphisms directly disease causative. Two intronic SNPs, common Genomic sequence was obtained, enabling all ITGB7 Ј in the healthy population, were also genotyped as these exons and 1.7 kb of 5 promoter region to be screened may represent markers in linkage disequilibrium with a for polymorphisms (primers listed in Table 1). Revised true disease allele. Genotypes were available on 567 IBD Ј 22,23 sequence was obtained for the 5 promoter region. trios (254 ulcerative colitis, 13 indeterminate colitis and Fourteen single nucleotide polymorphisms (SNPs) were 300 Crohn’s disease) from 464 families. No significant identified by mutation detection and sequencing (Table results were obtained with SNP3 (H672Y), SNP13 or 2). We developed genotyping assays and confirmed two SNP18 for the IBD, UC or CD phenotype (Table 4). Four potentially functional SNPs and eight intronic SNPs haplotypes (Ͼ1% frequency) of the three SNPs were (Table 3). SNP3, a histidine to tyrosine change at amino observed, no significant haplotype TDT results were F acid 672 (GenBank accession number NP 000880), results obtained for any phenotype. No significant results were in a charge change in the region between the extracellular found when the multiplex and simplex families were cysteine repeats and the transmembrane domain. SNP4, analysed separately for the three phenotypes, and allele a threonine to methionine change at amino acid 200, frequencies did not differ between affecteds and controls results in a size and hydrophobicity change in the (data not shown). mucosal addressin cell adhesion molecule-1 binding 24 The T200M mutation was found in only two families region. Two out of eight SNPs confirmed in intronic (one of which was used for mutation detection), and equal patterns of transmission and non-transmission were observed in these families. Table 2 SNPs discovered by mutation detection and sequencing SNP Sequence Position Discussion Linkage analysis has localised an IBD susceptibility gene 18 TTCCC(T/A)CCTCC intronic 171 bp 3Ј of exon 1 Ј to chromosome 12q. The ITGB7 gene, within this IBD2 11 GAGGC(T/C)CAGTC intronic 39 bp 3 of exon 2 locus, plays a key role in the induction of intestine spe- 12 TCCCC(C/A)AATCC intronic 48 bp 3Ј of exon 2 13 GTGCA(C/T)GCCAC intronic 274 bp 3Ј of exon 2 cificinflammation (through leukocyte recruitment and 14 TCTTG(C/T)TTTGT intronic 158 bp 3Ј of exon 2 retention). We therefore sought potential disease causing 4 CAAAA(C/T)GGTGC T200M mutations in this positional candidate gene, encouraged 6 GGGGC(G/A)GGGAT intronic 16 bp 3Ј of exon 6 by the discovery of ␤ integrin abnormalities in other con- Ј 5 AGGTC(T/A)GTTTG intronic 27 bp 3 of exon 6 ditions. 7 CCCTG(T/C)CCCAG intronic 6 bp 5Ј of exon 8 Ј We established genomic sequence for ITGB7, and 8 GTGTG(T/C)GCATG intronic 41 bp 5 of exon 11 Ј 9 CTTCA(A/C)CCACC intronic 24 bp 3Ј of exon 11 screened the entire coding region and 5 region for 3 GTGCC(C/T)ATACC H672Y