DOCSLIB.ORG

Identification of Novel Polymorphisms in the 7 Integrin Gene: Family-Based Association Studies in Inflammatory Bowel Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Novel Polymorphisms in the 7 Integrin Gene: Family-Based Association Studies in Inflammatory Bowel Disease Genes and Immunity (2001) 2, 455–460 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Identification of novel polymorphisms in the ␤7 integrin gene: family-based association studies in inflammatory bowel disease DA van Heel1,2, AH Carey3 and DP Jewell2 1Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford, OX3 7BN, UK; 2Gastroenterology Unit, Gibson Laboratories, Radcliffe Infirmary, Oxford, OX2 6HE, UK; 3Oxagen Ltd, 91 Milton Park, Abingdon, OX14 4RY, UK Linkage studies from five groups worldwide have confirmed the presence of an inflammatory bowel disease susceptibility locus on chromosome 12q. Beta 7 integrin is a strong candidate gene within this region, and is involved in lymphocyte homing to the gut and retention of intra-epithelial lymphocytes. Monoclonal antibodies to ␤7 integrin ameliorate colitis in animal models. We obtained genomic sequence for ␤7 integrin, and screened all 16 exons and 1.7 kb of 5Ј promoter region for polymorphisms in 24 individuals. Fourteen single nucleotide polymorphisms were identified in total and, of these, two common (frequency у10%) intronic and two amino acid changing polymorphisms were assessed for potential disease associations. Data were available from 102 multiply affected inflammatory bowel disease families (affected sibling pairs) and 362 simplex (one affected proband) families containing 254 ulcerative colitis, 13 indeterminate colitis and 300 Crohn’s disease trios (parents + affected child). No significant associations with any disease phenotype were found with the transmission disequilibrium test. Beta 7 integrin is unlikely to be involved in the genetic susceptibility to inflammatory bowel disease, and therefore future studies on chromosome 12 should focus on other positional candidate genes. Genes and Immunity (2001) 2, 455–460. Keywords: inflammatory bowel disease; Crohn’s disease; ulcerative colitis; ITGB7; integrin; genetic susceptibility Introduction all lymphocytes to the gut and associated lymphoid tissues. Gut-homing effector cells (expressing high levels Inflammatory bowel disease (IBD), comprising Crohn’s of ␣4␤7 integrin) attach directly to mucosal addressin cell disease (CD) and ulcerative colitis (UC), is likely to result adhesion molecule 1 on high endothelial venules, whilst from inherited mutations in disease susceptibility genes naı¨ve cells attach initially via L-selectin.11 ␣E␤7 integrin is interacting with environmental factors. Epidemiological expressed on gut intraepithelial lymphocytes, which are evidence from twin studies, familial clustering and intra- retained in the gut by binding to the ligand E-cadherin familial disease concordance suggests that IBD has a present on epithelial cells.12,13 1 strong genetic component. Estimates of the sibling rela- Other evidence that ITGB7 plays a key role in the ␭ tive risk s vary from 10 to 35, depending on IBD pheno- development of bowel inflammation comes from animal 2–5 type used. In the Oxford IBD genome-wide scan the and pharmacological studies. Monoclonal antibodies to greatest evidence for linkage was found on chromosome ␣4␤7 ameliorate colitis in both the cotton top tamarin and 6 12q. Subsequently four other groups worldwide have CD45RBhigh CD4+ T cell reconstituted severe combined 7–10 confirmed this IBD2 linkage region (OMIM: 601458). immunodeficiency syndrome (SCID) mouse models of The integrins comprise a large family of transmem- IBD.14,15 Knockout mice deficient for the ␤7 integrin sub- ␣ brane adhesion glycoproteins, each composed of an unit exhibit severely impaired development of the gut ␤ ␤ and subunit. The 7 integrin gene (ITGB7) maps to the associated lymphoid tissue, and attenuated immune IBD2 linkage region on chromosome 12. It is an excellent responses against helminth infection.16,17 candidate gene for IBD susceptibility, both because of its Mutations in the ␤2, ␤3 and ␤4 integrins cause leuko- position and the fact that it is involved in leucocyte traf- cyte adhesion deficiency, thromboasthenia and epiderm- ␣ ␤ ficking and recruitment to the gut. The 4 7 integrin het- olysis bullosa respectively.18–20 We therefore hypoth- erodimer is an adhesion molecule involved in homing of esised that similar functional mutations in the ␤7 integrin gene may play a role in susceptibility to IBD. Potential mechanisms for pathological mutations include increased Correspondence: Dr DA van Heel, Wellcome Trust Centre for Human leukocyte ␤7 integrin expression, changes in ligand affin- Genetics, University of Oxford, Roosevelt Drive, Oxford, OX3 7BN, UK. ity and alterations in the complex integrin signalling and Ȱ E-mail: david.vanheel well.ox.ac.uk lymphocyte activation pathway.21 No polymorphisms in Part of this work was funded by Oxagen Ltd, and a Medical ITGB7 have been reported, and therefore we screened all Research Council LINK grant between the University of Oxford and Ј Oxagen Ltd. exons and the 5 promoter region in order to identify Received 20 August 2001; revised 12 September 2001; accepted 13 markers to test for association. The transmission disequi- September 2001 librium test (TDT) was chosen to overcome the potential ␤7 integrin polymorphisms in IBD DA van Heel et al 456 Table 1 Primer pairs for ITGB7 mutation detection Region Primers (5Ј to 3Ј) promoter (−1688 to −790) CCCCTCCTAGCAGCTACACC GGGATTACAGGCACACTCG promoter (−1011 to −282) CCAGAGCCTATGTAGTCAAGCAC CCAAGGTCCCACAGCTAGTAAG promoter (−434 to −59) CTGGGAAACAGAGCAAGACC CTAGAAGGTGGTGCAGATAGGG promoter (−169) exon 1 ATGTTACGTTCAACACATGACAGG CAGATGACAGCACTCATATACATCC exon 2 AAAGCCGCCAAGTATGTCAG TTCGAAACCAGCCTAGTCAAC exon 3 CACATGTCCCCCTTTATATCC TGTGCACAAACTCAGTCACAC exon 4 ATCAGGGACTCAAGGAGTGGAC TCAGGTCCATAAGGTAGTACAGGTC exon 5 GCGGCCTGGTGAGTTAGG ATGTTGGCAGAGGCTAGGG exon 6 CCACCCCACTTCCCATAGAG GTTCCCAAACAGACCTCCAG exon 7 CCCAGGTGCATAGCCTACC AAGAGGTGTGGCTGAAATGG exon 8 ATGTTGTGGGGGAAACCTG ATATGGGGGACGGAGAATG exon 9 GGAGCCCATTTTCCTAGAGC CAGTTAATGACAGCCACATGC exon 10 GGACATAAGGTGGGGTTGG TTCCTGCCTGCTTAATTTCC exon 11 TAACATGACCCCATCCCTTC GTTGTTGGGAGCCAGGTG exon 12 CCTGGGAGAGACAAGTCAGG AGCCTAAGTGCCTTGGGAAG exon 13 GGGTGTGGTTGGCATACTTC GACGGAGAGTAGGCAGATGG exon 14 CTGCTTGTAGTTGGGCAAGG CAAACTTCCAGGGTTTGTGG exon 15 GGTTCCCTTTGCTTTCAGTG GAATCAGGGCTGGTCTTGTG exon 16 AGGAATCCTGGGATTTTTGC GCAAGAGGAGGATGGACAAG problems of false positive results that can arise in case- sequence (SNP13 and SNP18) had allele frequencies control based association studies. у10%. Association analysis Results The two amino acid changing SNPs were genotyped in the IBD families, as we hypothesised that these may be Polymorphisms directly disease causative. Two intronic SNPs, common Genomic sequence was obtained, enabling all ITGB7 Ј in the healthy population, were also genotyped as these exons and 1.7 kb of 5 promoter region to be screened may represent markers in linkage disequilibrium with a for polymorphisms (primers listed in Table 1). Revised true disease allele. Genotypes were available on 567 IBD Ј 22,23 sequence was obtained for the 5 promoter region. trios (254 ulcerative colitis, 13 indeterminate colitis and Fourteen single nucleotide polymorphisms (SNPs) were 300 Crohn’s disease) from 464 families. No significant identified by mutation detection and sequencing (Table results were obtained with SNP3 (H672Y), SNP13 or 2). We developed genotyping assays and confirmed two SNP18 for the IBD, UC or CD phenotype (Table 4). Four potentially functional SNPs and eight intronic SNPs haplotypes (Ͼ1% frequency) of the three SNPs were (Table 3). SNP3, a histidine to tyrosine change at amino observed, no significant haplotype TDT results were F acid 672 (GenBank accession number NP 000880), results obtained for any phenotype. No significant results were in a charge change in the region between the extracellular found when the multiplex and simplex families were cysteine repeats and the transmembrane domain. SNP4, analysed separately for the three phenotypes, and allele a threonine to methionine change at amino acid 200, frequencies did not differ between affecteds and controls results in a size and hydrophobicity change in the (data not shown). mucosal addressin cell adhesion molecule-1 binding 24 The T200M mutation was found in only two families region. Two out of eight SNPs confirmed in intronic (one of which was used for mutation detection), and equal patterns of transmission and non-transmission were observed in these families. Table 2 SNPs discovered by mutation detection and sequencing SNP Sequence Position Discussion Linkage analysis has localised an IBD susceptibility gene 18 TTCCC(T/A)CCTCC intronic 171 bp 3Ј of exon 1 Ј to chromosome 12q. The ITGB7 gene, within this IBD2 11 GAGGC(T/C)CAGTC intronic 39 bp 3 of exon 2 locus, plays a key role in the induction of intestine spe- 12 TCCCC(C/A)AATCC intronic 48 bp 3Ј of exon 2 13 GTGCA(C/T)GCCAC intronic 274 bp 3Ј of exon 2 cificinflammation (through leukocyte recruitment and 14 TCTTG(C/T)TTTGT intronic 158 bp 3Ј of exon 2 retention). We therefore sought potential disease causing 4 CAAAA(C/T)GGTGC T200M mutations in this positional candidate gene, encouraged 6 GGGGC(G/A)GGGAT intronic 16 bp 3Ј of exon 6 by the discovery of ␤ integrin abnormalities in other con- Ј 5 AGGTC(T/A)GTTTG intronic 27 bp 3 of exon 6 ditions. 7 CCCTG(T/C)CCCAG intronic 6 bp 5Ј of exon 8 Ј We established genomic sequence for ITGB7, and 8 GTGTG(T/C)GCATG intronic 41 bp 5 of exon 11 Ј 9 CTTCA(A/C)CCACC intronic 24 bp 3Ј of exon 11 screened the entire coding region and 5 region for 3 GTGCC(C/T)ATACC H672Y
Load more

Recommended publications
  • L-Selectin/CD62L Is a Key Driver of Non-Alcoholic Steatohepatitis in Mice and Men
    cells Article L-Selectin/CD62L Is a Key Driver of Non-Alcoholic Steatohepatitis in Mice and Men Hannah K. Drescher 1,2,* , Angela Schippers 3, Stefanie Rosenhain 4 , Felix Gremse 4, Laura Bongiovanni 5 , Alain de Bruin 5, Sreepradha Eswaran 3, Suchira U. Gallage 6, Dominik Pfister 6, Marta Szydlowska 6, Mathias Heikenwalder 6, Sabine Weiskirchen 7, Norbert Wagner 3, Christian Trautwein 1, Ralf Weiskirchen 7 and Daniela C. Kroy 1 1 Department of Internal Medicine III, University Hospital, RWTH Aachen, 52074 Aachen, Germany; [email protected] (C.T.); [email protected] (D.C.K.) 2 Division of Gastroenterology, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114, USA 3 Department of Pediatrics, University Hospital, RWTH Aachen, 52074 Aachen, Germany; [email protected] (A.S.); [email protected] (S.E.); [email protected] (N.W.) 4 Institute for Experimental Molecular Imaging, University Hospital, RWTH Aachen University, 52074 Aachen, Germany; [email protected] (S.R.); [email protected] (F.G.) 5 Dutch Molecular Pathology Centre, Department of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, 3508 Utrecht, The Netherlands; [email protected] (L.B.); [email protected] (A.d.B.) 6 Division of Chronic Inflammation and Cancer, German Cancer Research Center Heidelberg (DKFZ), 69120 Heidelberg, Germany; [email protected] (S.U.G.); dominik.pfi[email protected] (D.P.); [email protected] (M.S.); [email protected] (M.H.)
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Integrin Beta 7 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP54281
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Integrin beta 7 Polyclonal Antibody Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP54281 Specification Integrin beta 7 Polyclonal Antibody - Product Information Application IHC-P Primary Accession P26011 Reactivity Rat Host Rabbit Clonality Polyclonal Calculated MW 87411 Integrin beta 7 Polyclonal Antibody - Additional Information Gene ID 16421 Tissue/cell: human glioma tissue; 4% Paraformaldehyde-fixed and Other Names paraffin-embedded; Integrin beta-7, Integrin beta-P, M290 IEL Antigen retrieval: citrate buffer ( 0.01M, pH antigen, Itgb7 6.0 ), Boiling bathing for 15min; Block Format endogenous peroxidase by 3% Hydrogen 0.01M TBS(pH7.4) with 1% BSA, 0.09% peroxide for 30min; Blocking buffer (normal (W/V) sodium azide and 50% Glyce goat serum,C-0005) at 37℃ for 20 min; Incubation: Anti-Integrin beta 7 Polyclonal Storage Antibody, Unconjugated(bs-1051R) 1:200, Store at -20 ℃ for one year. Avoid repeated overnight at 4°C, followed by conjugation to freeze/thaw cycles. When reconstituted in the secondary antibody(SP-0023) and sterile pH 7.4 0.01M PBS or diluent of DAB(C-0010) staining antibody the antibody is stable for at least two weeks at 2-4 ℃. Integrin beta 7 Polyclonal Antibody - Protein Information Name Itgb7 Function Integrin alpha-4/beta-7 (Peyer patches-specific homing receptor LPAM-1) is involved in adhesive interactions of leukocytes. It is a receptor for fibronectin and recognizes one or more domains within the alternatively spliced CS-1 region of fibronectin. Integrin alpha- 4/beta-7 is also a receptor for MADCAM1 and VCAM1.
    [Show full text]
  • Cd49d Antibody [R1-2] Cat
    CD49d Antibody [R1-2] Cat. No.: 76-809 CD49d Antibody [R1-2] Specifications HOST SPECIES: Rat SPECIES REACTIVITY: Mouse TESTED APPLICATIONS: Flow, Func The R1-2 monoclonal antibody specifically reacts with mouse CD49d (integrin alpha 4), SPECIFICITY: which forms the VLA-4 complex with CD29 (integrin beta 1). Properties The monoclonal antibody was purified utilizing affinity chromatography. The endotoxin PURIFICATION: level is determined by LAL test to be less than 0.01 EU/µg of the protein. CLONALITY: Monoclonal ISOTYPE: Rat IgG2b, kappa CONJUGATE: Unconjugated PHYSICAL STATE: liquid BUFFER: Phosphate-buffered aqueous solution, ph7.2. CONCENTRATION: batch dependent STORAGE CONDITIONS: The product should be stored undiluted at 4˚C . Do not freeze. September 27, 2021 1 https://www.prosci-inc.com/cd49d-antibody-r1-2-76-809.html Additional Info OFFICIAL SYMBOL: Itga4 ALTERNATE NAMES: CD49D, Itga4B, Itga4 GENE ID: 16401 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References The R1-2 monoclonal antibody specifically reacts with mouse CD49d (integrin alpha 4), which forms the VLA-4 complex with CD29 (integrin beta 1). VLA-4 is expressed on BACKGROUND: thymocytes, monocytes, and a subset of peripheral lymphocytes. It is the receptor for fibronectin and CD106 (VCAM-1). CD49d also forms a receptor for mucosal vascular addressin (MAdCAM-1) with integrin beta 7. 1) Deckert, M., Kubar, J., Zoccola, D., Bernard‐Pomier, G., Angelisova, P., Horejsi, V., REFERENCES: Bernard, A. (1992). CD59 molecule: a second ligand for CD2 in T cell adhesion.European journal of immunology,22(11), 2943-2947. 2) Korty, P.
    [Show full text]
  • Endothelial Venules in a Mucosal Site in Naive Lymphocyte Adhesion to High Primary Role of Peripheral Node Addressin Phenotypic
    Nasal-Associated Lymphoid Tissue: Phenotypic and Functional Evidence for the Primary Role of Peripheral Node Addressin in Naive Lymphocyte Adhesion to High This information is current as Endothelial Venules in a Mucosal Site of October 1, 2021. Keri L. Csencsits, Mark A. Jutila and David W. Pascual J Immunol 1999; 163:1382-1389; ; http://www.jimmunol.org/content/163/3/1382 Downloaded from References This article cites 50 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/163/3/1382.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 1, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1999 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Nasal-Associated Lymphoid Tissue: Phenotypic and Functional Evidence for the Primary Role of Peripheral Node Addressin in Naive Lymphocyte Adhesion to High Endothelial Venules in a Mucosal Site1 Keri L. Csencsits, Mark A. Jutila, and David W.
    [Show full text]
  • Impaired T-Cell Migration to the CNS Under Fingolimod and Dimethyl Fumarate
    Impaired T-cell migration to the CNS under fingolimod and dimethyl fumarate Amandine Mathias, PhD ABSTRACT Sylvain Perriot, MSc Objective: To evaluate the long-term effects of treatments used in MS on the T-cell trafficking Mathieu Canales profile. Claudia Blatti Methods: We enrolled 83 patients with MS under fingolimod (FTY), natalizumab (NTZ), dimethyl Coline Gaubicher, MSc fumarate (DMF), or other disease-modifying treatments (DMTs). Blood was drawn before treat- Myriam Schluep, MD ment onset and up to 36–48 months. The ex vivo expression of CNS-related integrins (a4b1 Britta Engelhardt, PhD and a subunit of LFA-1) and the gut-related integrin (a4b7) was assessed using flow cytometry Renaud Du Pasquier, MD L on CD41 and CD81 T cells. The adhesion profiles of CD31 T cells to specific integrin ligands (vascular cell adhesion molecule-1 [VCAM-1], intercellular adhesion molecule-1 [ICAM-1], and Correspondence to mucosal vascular addressin cell adhesion molecule-1 [MAdCAM-1]) were measured in vitro before Dr. Du Pasquier: and after 12 and 36–48 months. [email protected] Results: NTZ decreased the frequency of a4b11 and a4b71 integrin expressing T cells and the binding of these cells to VCAM-1 and MAdCAM-1, respectively. After 12 months, DMF induced high 1 a decreased frequency of aL CD4 T cells combined with reduced binding to ICAM-1. By 1 high contrast, with FTY, there was a doubling of the frequency of a4b1 and aL , but a decreased frequency of a4b71 T cells. Strikingly, the binding of a4b11, a4b71, and to a lesser extent of high aL T cells to VCAM-1, MAdCAM-1, and ICAM-1, respectively, was decreased at month 12 under FTY treatment.
    [Show full text]
  • Anti-Mouse Integrin Alpha 4 Beta 7 (LPAM-1) APC Catalog Number: 17-5887 RUO: for Research Use Only
    Page 1 of 2 Anti-Mouse Integrin alpha 4 beta 7 (LPAM-1) APC Catalog Number: 17-5887 RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of C57Bl/6 bone marrow cells with Anti- Human/Mouse CD45R (B220) FITC (cat. 11- 0452) and 0.125 ug of Rat IgG2a K Isotype Control APC (cat. 17-4321) (left) or 0.125 ug of Anti-Mouse Integrin alpha 4 beta 7 (LPAM-1) APC (right). Total viable cells were used for analysis. Product Information Contents: Anti-Mouse Integrin alpha 4 beta 7 Formulation: aqueous buffer, 0.09% sodium (LPAM-1) APC azide, may contain carrier protein/stabilizer Catalog Number: 17-5887 Temperature Limitation: Store at 2-8°C. Do not Clone: DATK32 (DATK-32) freeze. Light sensitive material. Concentration: 0.2 mg/mL Batch Code: Refer to vial Host/Isotype: Rat IgG2a, kappa Use By: Refer to vial Contains sodium azide Description The DATK32 monoclonal antibody binds to a combinatorial epitope of mouse LPAM-1 (alpha 4/ beta 7), which is a heterodimer of the the 154 kDa alpha 4 subunit and the 130 kDa beta 7 subunit. In mouse, the beta 7 subunit is found on the majority of mature lymphocytes and a small population of thymocytes and bone marrow cells. LPAM-1 is an integrin involved in the transendothelial migration of lymphocytes across high endothelial venules (HEV), and is know to bind several ligands including MAdCAM-1, VCAM-1 and fibronectin. Binding of the DATK32 monoclonal antibody has been shown to induce aggregation of the CD8+ T cell lymphoma TK1, and block LPAM-1-mediated cell adhesion.
    [Show full text]
  • Supp Table 6.Pdf
    Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin
    [Show full text]
  • Cell Adhesion Molecules in Normal Skin and Melanoma
    biomolecules Review Cell Adhesion Molecules in Normal Skin and Melanoma Cian D’Arcy and Christina Kiel * Systems Biology Ireland & UCD Charles Institute of Dermatology, School of Medicine, University College Dublin, D04 V1W8 Dublin, Ireland; [email protected] * Correspondence: [email protected]; Tel.: +353-1-716-6344 Abstract: Cell adhesion molecules (CAMs) of the cadherin, integrin, immunoglobulin, and selectin protein families are indispensable for the formation and maintenance of multicellular tissues, espe- cially epithelia. In the epidermis, they are involved in cell–cell contacts and in cellular interactions with the extracellular matrix (ECM), thereby contributing to the structural integrity and barrier for- mation of the skin. Bulk and single cell RNA sequencing data show that >170 CAMs are expressed in the healthy human skin, with high expression levels in melanocytes, keratinocytes, endothelial, and smooth muscle cells. Alterations in expression levels of CAMs are involved in melanoma propagation, interaction with the microenvironment, and metastasis. Recent mechanistic analyses together with protein and gene expression data provide a better picture of the role of CAMs in the context of skin physiology and melanoma. Here, we review progress in the field and discuss molecular mechanisms in light of gene expression profiles, including recent single cell RNA expression information. We highlight key adhesion molecules in melanoma, which can guide the identification of pathways and Citation: D’Arcy, C.; Kiel, C. Cell strategies for novel anti-melanoma therapies. Adhesion Molecules in Normal Skin and Melanoma. Biomolecules 2021, 11, Keywords: cadherins; GTEx consortium; Human Protein Atlas; integrins; melanocytes; single cell 1213. https://doi.org/10.3390/ RNA sequencing; selectins; tumour microenvironment biom11081213 Academic Editor: Sang-Han Lee 1.
    [Show full text]
  • Integrin Beta 7 Antibody (F44498)
    Integrin beta 7 Antibody (F44498) Catalog No. Formulation Size F44498-0.4ML In 1X PBS, pH 7.4, with 0.09% sodium azide 0.4 ml F44498-0.08ML In 1X PBS, pH 7.4, with 0.09% sodium azide 0.08 ml Bulk quote request Availability 1-3 business days Species Reactivity Human Format Antigen affinity purified Clonality Polyclonal (rabbit origin) Isotype Rabbit Ig Purity Antigen affinity UniProt P26010 Applications Western blot : 1:1000 Limitations This Integrin beta 7 antibody is available for research use only. Integrin beta 7 antibody western blot analysis in WiDr lysate. Description Integrin alpha-4/beta-7 (Peyer patches-specific homing receptor LPAM-1) is an adhesion molecule that mediates lymphocyte migration and homing to gut-associated lymphoid tissue (GALT). Integrin alpha-4/beta-7 interacts with the cell surface adhesion molecules MADCAM1 which is normally expressed by the vascular endothelium of the gastrointestinal tract. Interacts also with VCAM1 and fibronectin, an extracellular matrix component. It recognizes one or more domains within the alternatively spliced CS-1 region of fibronectin. Interactions involves the tripeptide L-D-T in MADCAM1, and L-D-V in fibronectin. Binds to HIV-1 gp120, thereby allowing the virus to enter GALT, which is thought to be the major trigger of AIDS disease. Interaction would involve a tripeptide L-D-I in HIV-1 gp120. Integrin alpha-E/beta-7 (HML-1) is a receptor for E-cadherin. Application Notes Titration of the Integrin beta 7 antibody may be required due to differences in protocols and secondary/substrate sensitivity.
    [Show full text]
  • Anti-Human/Mouse Integrin Beta 7 PE Catalog Number: 12-5867 Also Known As:Integrin B7 ITGB7 RUO: for Research Use Only
    Anti-Human/Mouse Integrin beta 7 PE Catalog Number: 12-5867 Also Known As:Integrin b7 ITGB7 RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of normal human peripheral blood cells with Rat IgG2a K Isotype Control PE (cat. 12-4321) (open histogram) or Anti- Human/Mouse Integrin beta 7 PE (filled histogram). Cells in the lymphocyte gate were used for analysis. Product Information Contents: Anti-Human/Mouse Integrin beta 7 PE Formulation: aqueous buffer, 0.09% sodium azide, may Catalog Number: 12-5867 contain carrier protein/stabilizer Clone: FIB504 Temperature Limitation: Store at 2-8°C. Do not freeze. Concentration: 5 uL (0.125 ug)/test Light sensitive material. Host/Isotype: Rat IgG2a, kappa Batch Code: Refer to Vial Use By: Refer to Vial Caution, contains Azide Description The FIB504 monoclonal antibody reacts with human and mouse integrin beta 7. Integrin beta 7 is a 130 kD glycoprotein which associates with integrin alpha 4 (CD49d) to form the alpha 4 beta 7 integrin LPAM-1, expressed on intraepithelial lymphocytes. It also associates with alpha E (CD103) to form the alpha E beta 7 integrin HML-1, expressed on T cells adjacent to mucosal epithelium and intraepithelial lymphocytes. Main ligands for integrin alpha 4 beta 7 include VCAM-1 (CD106), MAdCAM-1 and fibronectin, while the main ligand of integrin alpha E beta 7 is E-cadherin (CD324). Integrin beta 7 plays an important role in the adhesion of leukocytes to endothelial cells promoting the transmigration of leukocytes to extravascular spaces during the inflammatory response. The FIB504 antibody has been reported to have blocking activity.
    [Show full text]
  • STRUCTURAL INVESTIGATION of the COMPLEX of FILAMIN a REPEAT 21 with INTEGRIN Αiib & Β3 CYTOPLASMIC TAILS
    STRUCTURAL INVESTIGATION OF THE COMPLEX OF FILAMIN A REPEAT 21 WITH INTEGRIN αIIb & β3 CYTOPLASMIC TAILS —A POTENTIAL “TRANSMISSION” TO REGULATE CELL MIGRATION JIANMIN LIU Bachelor of Science in Chemical Engineering Changchu University of Technology July, 1999 Master of Science in Chemistry Changchu University of Technology July, 2002 submitted in partial fulfillment of requirements for the degree DOCTOR OF PHILOSOPHY IN CLINICAL-BIOANALYTICAL CHEMISTRY at the CLEVELAND STATE UNIVERSITY August, 2009 This dissertation has been approved for the Department of CHEMISTRY and the College of Graduate Studies by Dissertation Chairman, Edward Plow Ph.D. Department & Date Jun Qin Ph.D. Department & Date Yan Xu Ph.D. Department & Date John Masnovi Ph.D. Department & Date Aimin Zhou Ph.D. Department & Date STRUCTURAL INVESTIGATION OF THE COMPLEX OF FILAMIN A REPEAT 21 WITH INTEGRIN αIIb & β3 CYTOPLASMIC TAILS —A POTENTIAL “TRANSMISSION” TO REGULATE CELL MIGRATION JIANMIN LIU ABSTRACT Cell functions in multi-cellular organisms are strongly depend on the dynamic cooperation between cell adhesion and cytoskeleton reorganization. Integrins, the major cell adhesion receptors, bind to extracellular matrix (ECM) and soluble ligands on the cell surface and link to the actin cytoskeleton inside the cell membrane. In this manner, integrins integrate cell adhesion and cytoskeleton reorganization by acting as a mechanical force transducer and a biochemical signaling hub (Zamir and Geiger 2001). Consequently, integrins are vital for development, immune responses, leukocyte traffic and hemostasis, and a variety of other cellular and physiological processes. Integrins are also are the focal point of many human diseases, including genetic, autoimmune, cardiovascular and others. In terms of the cell-ECM adhesion, integrins can exist in two major states, active, where it binds to appropriate extracellular ligands, and inactive, where it disassociates from extracellular ligands.
    [Show full text]