Sequence Analysis, Characterization and Tissue Distribution of Channel Catﬁsh (Ictalurus Punctatus Raﬁnesque, 1818) Myeloperoxidase Cdna

Fish & Shellﬁsh Immunology 28 (2010) 504e509

Contents lists available at ScienceDirect

Fish & Shellﬁsh Immunology

journal homepage: www.elsevier.com/locate/fsi

Short communication Sequence analysis, characterization and tissue distribution of channel catﬁsh (Ictalurus punctatus Raﬁnesque, 1818) myeloperoxidase cDNA

Hung-Yueh Yeh*, Phillip H. Klesius

United States Department of Agriculture, Agricultural Research Service, Aquatic Animal Health Research Unit, 990 Wire Road, Auburn, AL 36832-4352, United States article info abstract

Article history: Myeloperoxidase (EC 1.11.1.7), a heme-containing lysosomal glycoprotein, is found predominantly in Received 27 October 2009 azurophilic granules of neutrophils. This enzyme upon activation catalyzes hydrogen peroxide in the Received in revised form presence of various halide ions to form hypohalous acids. Subsequently, these reagents are able to kill 12 December 2009 the invading microorganisms. In this study, we report the identification, characterization and expression Accepted 12 December 2009 analysis of the channel catfish myeloperoxidase transcript. The full-length nucleotide sequence of channel Available online 24 December 2009 catfish myeloperoxidase cDNA had 3157 nucleotides, including an open reading frame, which appears to encode a putative peptide of 771 amino acid residues with a calculated molecular mass of 87.14 kDa. By Keywords: fi Channel catfish comparison with the human counterpart, the channel cat sh myeloperoxidase peptide can be divided into Ictalurus punctatus domains and has conservative features, including peroxidase catalytic sites, covalent linkage sites for Myeloperoxidase the heme group and all cysteine residues. The channel catfish myeloperoxidase transcript was detected by MPO RT-PCR in anterior kidneys, where the major leukocyte population is neutrophil precursors. Reagent Edwardsiella ictaluri development and the role of this enzyme in Edwardsiella ictaluri infection are under investigation. Published by Elsevier Ltd.

1. Introduction neutrophils, and in much lower amounts in monocytes and some tissue macrophages [6e11]. Upon activation, neutrophils produce Peroxidases, distributed ubiquitously in both prokaryotes and hydrogen peroxide and release myeloperoxidase from the granules eukaryotes, catalyze hydrogen peroxide into water and various organic that the latter catalyzes the former in the presence of chloride ions and inorganic substrates [1]. According to the recently published to form hypochlorous acid [7,12e15]. Subsequently, this reagent peroxidase databases [2,3],therearemorethan6000peroxidase is able to kill the invading microorganisms [6,16]. However, mye- sequences from over 940 organisms. The peroxidases can be classified loperoxidase has also been detected in microglia and macrophages into two large groups: heme-containing and non-heme-containing surrounding pathological lesions of multiple sclerosis and Alz- peroxidases [1e3]. The latter contains alkylhydro-, glutathione-, halo-, heimer's disease [17,18]. Recently, the studies of this enzyme have NADH-peroxidases, peroxiredoxins and manganese catalases. The been focused on the roles in chronic inflammation [see references former includes catalases, dyp-type peroxidases, di-heme cytochrome [11,19,20] for reviews]. C peroxidases, haloperoxidases, and animal and non-animal peroxi- In teleost fish, the myeloperoxidase activity has been detected in dases. The animal peroxidases are further classified and included channel catfish [21], black bullhead (Ameiurus melas Rafinesque,1820) “mammalian” and “non-mammalian vertebrate” peroxidases [2,3]. [22], Indian major carps (including Cirrhinus mrigala Hamilton, After we and others identified channel catfish peroxiredoxins 1822, Catla catla Hamilton,1822 and Labeo rohita Hamilton,1822) [23], (non-heme-containing peroxidases) [4,5], we found another perox- zebrafish (Danio rerio Hamilton-Buchanan, 1822) [24] and goldfish idasedmyeloperoxidasedESTwasup-regulatedintheearlystageof (Carassius auratus Linnaeus, 1758) [25].Thefish myeloperoxidase Edwardsiella ictaluri infection in catfish ovary cell line (CCO cells) [Yeh gene transcript has been cloned in zebrafish [26,27],andtheprotein and Klesius, unpublished data]. has been purified from turbot (Psetta maxima Linnaeus, 1758) anterior Myeloperoxidase (EC 1.11.1.7), a heme-containing lysosomal kidney neutrophils [28]. However, the roles of this enzyme in fish glycoprotein, is found predominantly in azurophilic granules of infected with various microorganisms have not been characterized. In this study, the channel catfish myeloperoxidase transcript was fi * Corresponding author. Tel.: þ1 334 887 3741; fax: þ1 334 887 2983. completely sequenced and characterized, and the expression pro le in E-mail address: [email protected] (H.-Y. Yeh). varioustissueswasdetermined.

1050-4648/$ e see front matter Published by Elsevier Ltd. doi:10.1016/j.fsi.2009.12.007 H.-Y. Yeh, P.H. Klesius / Fish & Shellﬁsh Immunology 28 (2010) 504e509 505

2. Materials and methods CA). Chromatograms were edited, trimmed and analyzed also at the USDA ARS Genomics and Bioinformatics Research Unit in Stone- 2.1. Fish ville, MS. The amino acid sequence of channel catfish myeloperoxidase was deduced from nucleotide sequence by using Transeq Channel catfish (NWAC103 strain, weighed 25e30 g) were used [30], aligned with other myeloperoxidase amino acid sequences in this study. Prior to aseptical tissue excision, the catfish were deposited in GenBank using ClustalW2 [31]. ExPASy server [32] was euthanized by immersion in 300 mg/ml of tricaine methanesulfo- used to calculate the myeloperoxidase peptide molecular mass nate according to the Guidelines for the Use of Fishes in Research and pI, and to analyze the myeloperoxidase N-glycosylation sites. [29]. Spleen, anterior kidney, liver, intestine, skin and gill were The signal peptide site in the amino acid sequence was detected collected and immersed in 1 ml of TRI reagent (Molecular Research with SignalP 3.0 software [33]. Phylogenetic relationships of mye- Center, Inc., Cincinnati, OH). The Institutional Animal Care and Use loperoxidase amino acid sequences from various species were Committee of the USDA ARS Aquatic Animal Health Research Unit in analyzed with MEGA 4.0 software [34] based on the ClustalW2 Auburn, AL approved the experiment. alignment results.

2.2. RNA isolation and rapid ampliﬁcation of cDNA ends (RACE) 2.5. RT-PCR

Total RNA from channel catfish tissues was isolated by using a Tri Two-step RT-PCR assays were used to profile myeloperoxidase reagent (Molecular Research Center, Inc.) according to the manu- gene transcripts in various tissues as described previously [35e38]. facturer's instruction. The quality and quantity of total RNA were b-Actin was used as an internal control. The amplified products determined by using RNA 1200 chips on an Agilent Bioanalyzer were analyzed by 2% agarose gel electrophoresis and stained with (Agilent Technologies, Santa Clara, CA). A GeneRacer kit (Invitrogen, ethidium bromide. Images were recorded by a KODAK Gel Logic 440 Carlsbad, CA) was used to obtain full-length 50- and 30-end of cDNA Imaging System (version 4.0.3) (Eastman Kodak, Rochester, NY), according to the manufacturer's instruction. Total RNA (5 mg) from and processed with ImageJ software (version 1.41) [39]. three catfish anterior kidneys were used for this RACE construction. 3. Results and discussion 2.3. Myeloperoxidase gene amplification The full-length cDNA sequence of channel catfish myeloperox- 0 0 idase consists of 3157 nucleotides, including a 90-nucleotide Both specific full-length 5 - and 3 -RACE of the myeloperoxidase 50-untranslated region (UTR), an open reading frame and a 741- gene transcript were PCR amplified. The PCR reaction mixtures (50 ml nucleotide 30-UTR (GenBank accession no. GQ429001). The 30-UTR per reaction) contained the following reagents (in final concentra- has a mRNA instability sequence (attta) and a polyadenylation tions): 1 Prime STAR PCR buffer (TaKaRa, Madison, WI), 200 mM signal sequence (tataaa) 168 and 86 nucleotides upstream of dNTP mix (TaKaRa), 300 mM each of gene specific primer and Gen- a 36-nucleotide polyadenylation tail, respectively. The human eRacer primer, 1.25 U Prime STAR HS DNA polymerase (TaKaRa) myeloperoxidase gene also uses the tataaa sequence as the poly- and 1 ml of cDNA template (equivalent to 250 ng RNA input). The adenylation signal [40]. The open reading frame appears to encode amplification was performed on a GeneAmp PCR System 9700 a 771 amino acid peptide with a calculated molecular mass of 87.14 thermocycler (Applied Biosystems, Foster City, CA) according to the kDa and a pI of 7.75 at pH 7.0. The peptide has five potential protocol described in the GeneRacer manual. The primers for PCR N-glycosylation sites at Asn111, Asn181, Asn379, Asn426 and Asn614 amplification are listed in the Table 1. The amplified PCR products (numbering after channel catfish), which may have a critical role were purified by agarose gel electrophoresis, and ligated into the pSC Ò in peroxidase activity. Castro et al. [28] reported that the turbot vector, followed by transformation of the vectors into the Solo Pack myeloperoxidase loses its peroxidase activity significantly, after competent Escherichia coli cells (Agilent Technologies) according to this enzyme is treated with peptide-N-glycosidase F to remove the manufacturer's instruction. At least six colonies per PCR product N-linked carbohydrates. This deglycosylation modification may were randomly selected for DNA sequencing. change the tertiary structure and therefore affect peroxidase activity of this enzyme [28,41,42]. 2.4. DNA sequencing and bioinformatics The BLASTx searches of channel catfish myeloperoxidase against the NCBI nr database identified many related peroxidase ortho- The DNA sequencing reactions were carried out at the USDA ARS logues from other species (E value >3 10 160)(Figs. 1 and 2). Genomics and Bioinformatics Research Unit in Stoneville, MS with When we compared these myelopeorxidases, we found that the an ABI 3730 1 Genetic Analyzer (Applied Biosystems, Foster City, length of myeloperoxidases varies from 718 (mouse) to 783 amino acids (horse), and the degree of conservation ranges from 43% fi Table 1 (vs. horse) to 65% (vs. zebra sh). Furthermore, when aligned with Oligonucleotides used for PCR amplification in this study. the human counterpart, the channel catfish myeloperoxidase can be synthesized from a single gene as a prepropeptide that is further Primer Sequence Direction proteolytically cleaved into (1) a signal peptide (cleavage at Val15- GeneRacer 50Primer 50-GCTGTCAACGATACGCTACGTAACG-30 Forward Ser16Ala17eGln18Thr19), (2) a 121-amino-acid propeptide, (3) a light (Invitrogen) GeneRacer 30Primer 50-CGACTGGAGCACGAGGACACTGA-30 Reverse chain and (4) a heavy chain [40,43e45]. Thus, the mature channel (Invitrogen) catfish myeloperoxidase may consist of a pair of heavy and light 0 0 MPX487eF5- CAAACCCTACCGCCTCCGTGCAGAAC3 Forward chain dimers with the insertion of the heme group [43,44]. Several MPX189-F 50-TGCGGCCTGTCTGCACCTAGGAATGT30 Forward 0 0 important characteristics for myeloperoxidase functions are MPX386-F 5 -GATCCGCCAAGGAGACAGGCTCTGGT 3 Forward fi MPX908eR50-CTGGGAATTTGGATGGGGAAGCATGG30 Reverse conserved in channel cat sh [1,3,41]. First, catalytic residues at 232 236 MPX195-R 50-GGCCGCAAAACCTCCACCATTCGTTA30 Reverse Gln (numbering after channel catfish) and His in the light MPX51-R 50-GCCGTTCAGCTTAGCCGTCCTGCATT30 Reverse chain and Arg395, His433 and Asn588 in the heavy chain of myelo- b 0 0 -Actin-F 5 -GACTTCGAGCAGGAGATGGG-3 Forward peroxidase are conserved among mammals and teleost fish (Fig. 1). b-Actin-R 50-AACCTCTCATTGCCAATGGTG-30 Reverse Second, amino acid residues at Asp235 and Glu398 involved in the 506 H.-Y. Yeh, P.H. Klesius / Fish & Shellfish Immunology 28 (2010) 504e509

Fig. 1. Alignment of the deduced channel catfish myeloperoxidase amino acid sequence with other species' myeloperoxidase sequences deposited in the GenBank database. Gaps indicated by hyphens were introduced in the sequences to maximize the sequence homology. Identical amino acids among all species are denoted by asterisks (*) beneath the sequences. The four potential domains of the channel catfish signal peptide, propeptide, light chain and heavy chain are indicated in italic, underline, boldface, and underlined þþ boldface, respectively. The catalytic residues, heme linkage residues, cysteine residues conserved in both light and heavy chains, and Ca -binding motif are denoted by yellow, red, gray and green, respectively. Species and the corresponding accession numbers are as follows: cat, NP_001116218; cattle, NP_001106769; channel catfish, GQ429001; Chinese perch, ABC72122; dog, XP_852445; horse, XP_001500645; human, NP_000241; mouse, NP_034954; and zebrafish, NP_997944. H.-Y. Yeh, P.H. Klesius / Fish & Shellfish Immunology 28 (2010) 504e509 507

Fig. 1. (continued). 508 H.-Y. Yeh, P.H. Klesius / Fish & Shellﬁsh Immunology 28 (2010) 504e509

Fig. 1. (continued). covalent linkage with the heme group are conserved in channel Phylogenetic relationships of mammalian peroxidase amino catfish myeloperoxidase. Third, all the cysteine residues that are acid sequences (myeloperoxidases, eosinoperoxidases and thyroid likely to form intra- and interchain sulfide linkages in both light and peroxidases) and teloest peroxidases were constructed by the heavy chains are conserved in the channel catfish myeloperoxidase. Neighbor-Joining method using the MEGA v 4.0 software [34]. þþ Fourth, the human and mouse myeloperoxidases have a Ca - As seen in Fig. 2, mammalian myeloperoxidases, eosinoperoxidases binding consensus motif, Leu-Thr-Ser-Phe-Val-Asp-Ala-Ser [41].In and thyroid peroxidases formed well separated clades and showed the channel catfish myeloperoxidase, the Phe-Val residues at the the probable evolutionary process of thyroid peroxidases to 4th and 5th positions were substituted by Tyr-Leu residues (Fig. 1, eosinoperoxidases and eosinoperoxidases to myeloperoxidases. highlighted in green). These substitutions are also found in zebra- The tree also reflects the well established physiological functions of fish. In addition, a Gly residue at the 8th position replaced the Ser these mammalian peroxidases [1,41]. Teloest peroxidases clearly þþ residue in channel catfish. Whether these changes affect the Ca - formed their own branch, distantly related to mammalian myelo- binding capacity in channel catfish is yet to be determined. peroxidases, eosinoperoxidases and thyroid peroxidases, and may be a common ancestor of mammalian peroxidases. It is interesting to note that the teloest peroxidases are phylogenetically closely to the mammalian thyroid peroxidases, but seem to have myeloperoxidase activity. Whether the teloest peroxidases have equivalent activities of mammalian eosinoperoxidases and thyroid peroxidases remains to be determined. The expression profile of myeloperoxidase transcripts in channel catfish tissues was determined by a two-step RT-PCR. The amplified fragments of myeloperoxidase and b-actin had 422 and 203 nucleotides, respectively. As shown in Supporting Fig. 1S,themyeloper- oxidase transcript was detected only in anterior kidney of all fish examined and in spleen in one fish, indicating that the catfish myeloperoxidase transcript is constitutively expressed in the restrictive tissue. Like in human that myeloperoxidase expresses in neutrophil promyelocytes [46],catfish anterior kidney is regarded as hemato- poietic tissue, and the predominant white cell population in this tissue is neutrophil precursors [47,48]. In conclusion, the channel catfish myeloperoxidase transcript was cloned, sequenced and characterized. The transcript was detected by RT-PCR in anterior kidneys where the major white cell population is neutrophil precursors. Further investigation of the role of myeloperoxidase in E. ictaluri infection is under way. Fig. 2. Phylogenetic relationships of channel catfish myeloperoxidase amino acid sequence with other species' peroxidases, including mammalian myeloperoxidases (MPO), eosinophil peroxidases (EPO) and thyroid peroxidases (TPO). The sequences were analyzed with the Neighbor-Joining method by using MEGA software (Tamura et al., 2007) with 1000 bootstrap Acknowledgments replicates (value 50%). Along with the sequences listed in Fig. 1, additional peroxidase amino acid sequences were used, and their corresponding accession numbers are: chicken We are grateful to Mrs. Dorothy B. Moseley (USDA ARS Aquatic EPO, XP_415716; chicken TPO, XP_001235673; cattle TPO, XP_603356; dog, TPO, Animal Health Research Unit in Auburn, AL) for excellent technical NP_001003009; horse EPO, XP_001500632; horse TPO, XP_001918216; human EPO, support, and Dr. Brian E. Scheffler and his laboratory staff (USDA ARS NP_000493; human TPO, NP_000538; mouse EPO, NP_031972; mouse TPO, NP_033443; pig TPO, P09933; rat EPO, NP_001100507; rat TPO, NP_062226; and spotted green pufferfish, Genomics and Bioinformatics Research Unit in Stoneville, MS) for CAF99300. DNA sequencing and bioinformatics. We also thank Dr. Thomas L. H.-Y. Yeh, P.H. Klesius / Fish & Shellfish Immunology 28 (2010) 504e509 509

Welker (Aquatic Animal Health Research Unit, Auburn, AL) and two [20] Sirpal S. Myeloperoxidase-mediated lipoprotein carbamylation as a mecha- e anonymous reviewers for critical comments on this manuscript. nistic pathway for atherosclerotic vascular disease. Clin Sci 2009;116:681 95. [21] Praveen KN, Nauseef W, Goodwin A. 2000. Evidence for a novel vertebrate This study was supported by the USDA Agricultural Research peroxidase in channel catfish (Ictalurus punctatus). Twenty-fifth Annual Eastern Service CRIS project no. 6420-32000-020-00D. Mention of trade Fish Health Workshop. http://www.lsc.usgs.gov/fhb/workshops/25/13.htm. [22] Garavini C, Martelli P, Borelli B. Alkaline phosphatase and peroxidase in names or commercial products in this paper is solely for the purpose fi fi fi neutrophils of the cat sh Ictalurus melas (Ra nesque) (Siluriformes Ictalur- of providing speci c information and does not imply recommen- idae). Histochemistry 1981;72:75e81. dation or endorsement by the U.S. Department of Agriculture. [23] Sahoo PK, Kumari J, Mishra BK. Non-specific immune responses in juveniles of Indian major carps. J Appl Ichthyol 2005;21:151e5. [24] Moss LD, Monette MM, Jaso-Friedmann L, Leary 3rd JH, Dougan ST, Appendix. Supplementary material Krunkosky T, et al. Identification of phagocytic cells, NK-like cytotoxic cell activity and the production of cellular exudates in the coelomic cavity of adult Fig. S1 Expression of the myeloperoxidase gene transcript in zebrafish. Dev Comp Immunol 2009;33:1077e87. fi ¼ fi [25] Katzenback BA, Belosevic M. Isolation and functional characterization of channel cat sh tissues (n 4). The PCR ampli ed fragments for neutrophil-like cells from goldfish (Carassius auratus L.) kidney. Dev Comp myeloperoxidase and b-actin transcripts had 422 and 203 nucleo- Immunol 2009;33:601e11. tides, respectively. Spleen, lanes A, G, M, and S; anterior kidney, [26] Bennett CM, Kanki JP, Rhodes J, Liu TX, Paw BH, Kieran MW, et al. Myelopoiesis fi e lanes B, H, Q and T; liver, lanes C, I, N and U; intestine, lanes D, J, O in the zebra sh, Danio rerio. Blood 2001;98:643 51. [27] Lieschke GJ, Oates AC, Crowhurst MO, Ward AC, Layton JE. Morphologic and and V; skine, lanes E, K, P and W; and gill, lanes F, L, R and X. Lane Y, functional characterization of granulocytes and macrophages in embryonic no template control and lane Z, 100 bp GeneRuler MW ladders and adult zebrafish. Blood 2001;98:3087e96. (Fermentas Life Science, Glen Burnie, MD). [28] Castro R, Piazzon MC, Noya M, Leiro JM, Lamas J. Isolation and molecular cloning of a fish myeloperoxidase. Mol Immunol 2008;45:428e37. Note: Supplementary data associated with this article can be [29] Nickum JG, Bart Jr HL, Bowser PR, Greer IE, Hubbs C, Jenkins JA, et al. found in the online version at doi:10.1016/j.fsi.2009.12.007 Guidelines for the use of fishes in research. Bethesda, Maryland: American Fisheries Society; 2004. [30] Rice P, Longden I, Bleasby A. EMBOSS: the European molecular biology open References software Suite. Trends Genet 2000;16:276e7. [31] Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, [1] Zamocky M, Jakopitsch C, Furtmüller PG, Dunand C, Obinger C. The peroxi- et al. ClustalW and ClustalX version 2. Bioinformatics 2007;23:2947e8. dase-cyclooxygenase superfamily: reconstructed evolution of critical enzymes [32] Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. of the innate immune system. Proteins 2008;72:589e605. Protein identification and analysis tools on the ExPASy server. In: Walker John M, [2] Koua D, Cerutti L, Falquet L, Sigrist CJ, Theiler G, Hulo N, et al. PeroxiBase: editor. The proteomics protocols handbook. Humana Press; 2005. p. 571e607. a database with new tools for peroxidase family classification. Nucleic Acids [33] Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal Res 2009;37:D261e6. peptides: signalP 3.0. J Mol Biol 2004;340:783e95. [3] Passardi F, Theiler G, Zamocky M, Cosio C, Rouhier N, Teixera F, et al. Perox- [34] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics iBase: the peroxidase database. Phytochemistry 2007;68:1605e11. analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24:1596e9. [4] Li RW, Waldbieser GC. Genomic organisation and expression of the natural [35] Yeh H-Y, Klesius PH. Molecular cloning and expression of channel catfish, killer cell enhancing factor (NKEF) gene in channel catfish, Ictalurus punctatus Ictalurus punctatus, complement membrane attack complex inhibitor CD59. (Rafinesque). Fish Shellfish Immunol 2006;20:72e82. Vet Immunol Immunopathol 2007;120:246e53. [5] Yeh H-Y, Klesius PH. cDNA cloning, characterization, and expression analysis of [36] Yeh H-Y, Klesius PH. Complete structure, genomic organization, and expres- channel catfish (Ictalurus punctatus Rafinesque, 1818) peroxiredoxin 6 gene. sion of channel catfish (Ictalurus punctatus,Rafinesque 1818) matrix metal- Fish Physiol Biochem 2007;33:233e9. loproteinase-9 gene. Biosci Biotechnol Biochem 2008;72:702e14. [6] Klebanoff SJ. Myeloperoxidase-halide-hydrogen peroxide antibacterial system. [37] Yeh H-Y, Klesius PH. Channel catfish, Ictalurus punctatus, cyclophilin A and B J Bacteriol 1968;95:2131e8. cDNA characterization and expression analysis. Vet Immunol Immunopathol [7] Klebanoff SJ. Oxygen metabolism and the toxic properties of phagocytes. Ann 2008;121:370e7. Intern Med 1980;93:480e9. [38] Yeh H-Y, Klesius PH. Molecular cloning, sequencing and characterization of [8] Nichols BA, Bainton DF. Differentiation of human monocytes in bone marrow channel catfish (Ictalurus punctatus,Rafinesque 1818) cathepsin S gene. Vet and blood. Sequential formation of two granule populations. Lab Invest Immunol Immunopathol 2008;126:382e7. 1973;29:27e40. [39] Abramoff MD, Magelhaes PJ, Ram SJ. Images processing with ImageJ. Bio- [9] Kinkade Jr JM, Pember SO, Barnes KC, Shapira R, Spitznagel JK, Martin LE. photonics Int 2004;11:36e42. Differential distribution of distinct forms of myeloperoxidase in different [40] Morishita K, Kubota N, Asano S, Kaziro Y, Nagata S. Molecular cloning and char- azurophilic granule subpopulations from human neutrophils. Biochem acterization of cDNA for human myeloperoxidase. J Biol Chem 1987;262:3844e51. Biophys Res Commun 1983;114:296e303. [41] Furtmüller PG, Zederbauer M, Jantschko W, Helm J, Bogner M, Jakopitsch C, [10] Daugherty A, Dunn JL, Rateri DL, Heinecke JW. Myeloperoxidase, a catalyst for et al. Active site structure and catalytic mechanisms of human peroxidases. lipoprotein oxidation, is expressed in human atherosclerotic lesions. J Clin Arch Biochem Biophys 2006;445:199e213. Invest 1994;94:437e44. [42] Long Y, Franc JL, Kaniewski J, Lanet J, Giraud A. Effect of N-glycan removal on [11] Nicholls SJ, Hazen SL. Myeloperoxidase, modified lipoproteins, and athero- the enzymatic activity of porcine thyroid peroxidase. Eur J Biochem genesis. J Lipid Res 2009;50:S346e51. 1991;202:501e5. [12] Babior BM. Oxygen-dependent microbial killing by phagocytes. N Engl J Med [43] Nauseef WM, Malech HL. Analysis of the peptide subunits of human neutro- 1978;298:659e68. phil myeloperoxidase. Blood 1986;67:1504e7. [13] Babior BM. Oxygen-dependent microbial killing by phagocytes. N Engl J Med [44] Taylor KL, Guzman GS, Pohl J, Kinkade Jr JM. Distinct chromatographic forms of 1978;298:721e5. human hemi-myeloperoxidase obtained by reductive cleavage of the dimeric [14] Weiss SJ. Tissue destruction by neutrophils. N Engl J Med 1989;320:365e76. enzyme. Evidence for subunit heterogeneity. J Biol Chem 1990;265:15938e46. [15] Hazen SL, Hsu FF,Mueller DM, Crowley JR,Heinecke JW.Human neutrophils employ [45] Johnson KR, Nauseef WM, Care A, Wheelock MJ, Shane S, Hudson S, et al. chlorine gas as an oxidant during phagocytosis. J Clin Invest 1996;98:1283e9. Characterization of cDNA clones for human myeloperoxidase: predicted [16] Klebanoff SJ. Myeloperoxidase: contribution to the microbicidal activity of amino acid sequence and evidence for multiple mRNA species. Nucleic Acids intact leukocytes. Science 1970;169:1095e7. Res 1987;15:2013e28. [17] Nagra RM, Becher B, Tourtellotte WW, Antel JP, Gold D, Paladino T, et al. [46] Egesten A, Breton-Gorius J, Guichard J, Gullberg U, Olsson I. The heterogeneity Immunohistochemical and genetic evidence of myeloperoxidase involvement of azurophil granules in neutrophil promyelocytes: immunogold localization in multiple sclerosis. J Neuroimmunol 1997;78:97e107. of myeloperoxidase, cathepsin G, elastase, proteinase 3, and bactericidal/ [18] Reynolds WF, Rhees J, Maciejewski D, Paladino T, Sieburg H, Maki RA, et al. permeability increasing protein. Blood 1994;83:2985e94. Myeloperoxidase polymorphism is associated with gender specific risk for [47] Petrie-Hanson L, Ainsworth AJ. Differential cytochemical staining character- Alzheimer's disease. Exp Neurol 1999;155:31e41. istics of channel catfish leukocytes identify cell populations in lymphoid [19] Davies MJ, Hawkins CL, Pattison DI, Rees MD. Mammalian heme peroxidases: organs. Vet Immunol Immunopathol 2000;73:129e44. from molecular mechanisms to health implication. Antitoxid Redox Signal [48] Petrie-Hanson L, Ainsworth AJ. Ontogeny of channel catfish lymphoid organs. 2008;10:1199e234. Vet Immunol Immunopathol 2001;81:113e27.