DOCSLIB.ORG

The Genetic Link Between the Chinese Bamboo Partridge (Bambusicola Thoracica) and the Chicken and Junglefowls of the Genus Gallu

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Genetic Link Between the Chinese Bamboo Partridge (Bambusicola Thoracica) and the Chicken and Junglefowls of the Genus Gallu Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11053-11056, November 1995 Evolution The genetic link between the Chinese bamboo partridge (Bambusicola thoracica) and the chicken and junglefowls of the genus Gallus AKISHINONOMIYA FuMIHITO*, TETSUO MIYAKEt, MASARU TAKADAt, SUSUMU OHNO§, AND NORIO KONDOt *Yamashina Institute for Ornithology, 115 Tsutsumine-aza, Konoyama, Abiko-shi, Chiba Prefecture 270-11, Japan; tWakunaga Pharmaceutical Company Central Laboratories, 1624 Shimokotachi, Kodacho, Takatagun Hiroshima Prefecture 739-11, Japan; tThe Research Institute of Evolutionary Biology, 2-4-28 Kamiyoga, Setagaya-ku, Tokyo 158, Japan; and §Beckman Research Institute of the City of Hope, 1450 East Duarte Road, Duarte, CA 91010-3000 Contributed by Susumu Ohno, August 9, 1995 ABSTRACT Further comparison of mitochondrial con- agated in various zoos of the world, as well as by private trol-region DNA base sequences of 16 avian species belonging fanciers. This is not the case with diverse generalized perdicine to the subfamily Phasianinae revealed the following: (i) Gen- birds (quails and partridges) of the same subfamily. If a few of eralized perdicine birds (quails and partridges) are ofancient them are kept and propagated, they are maintained only as lineages. Even the closest pair, the common quail (Coturnix exotic game birds. Accordingly, we were able to secure blood coturnixjaponica) and the Chinese bamboo partridge (Bam- samples from only five species, although from four (five) busicola thoracica), maintained only 85.71% identity. (ii) The different genera, of the generalized perdicine birds, which are 12 species of phasianine birds previously and presently stud- said to consist of 103 species belonging to 22 different genera ied belonged to three distinct branches. The first branch was (2). They were the common quail of Japanese variety, Coturnix made exclusively of members of the genus Galus, while the coturnixjaponica, the blue-breasted quail (Coturnixsinesis, also second branch was made ofpheasants ofthe genera Phasianus, known as Excalifactoria sinensis), the Chinese bamboo par- Chrysolophus, and Syrmaticus. Gallopheasants of the genus tridge Bambusicola thoracica, the chukar partridge, Alectoris Lophura were distant cousins to these pheasants. The great graeca chukar, and the European grey partridge Perdix perdix argus (Argusianus argus) and peafowls of the genus Pavo perdix. In sharp contrast, there were no difficulties in securing constituted the third branch. The position ofpeacock-pheasants 12 species of the large pheasant-like birds of the subfamily ofthe genus Polypectron in the third branch was similar to that Phasianinae, representing 8 different genera; thus 11 of the 49 of the genus Lophura in the second branch. Members of the extant species were sampled (2). In addition to the red (G. gallus) fourth phasianine branch, such as tragopans and monals, and green (G. varius) previously reported (1), the genus Gallus were not included in the present study. (iii) The one perdicine was represented by two additional junglefowl species, the grey species, Bambusicola thoracica, was more closely related to (G. sonneratii) and Sri Lanka (G. lafayettei) junglefowls. Pheas- phasianine genera Gallus and Pavo than to members of other ants, as such, were represented by three species: the ring- perdicine genera. The above might indicate that Bambusicola necked (Phasianus colchicus), the golden (Chrysolophus pic- belong to one-stem perdicine lineage that later splits into two tus), and Mrs. Hume's (Syrmaticus huminae). Other large sublineages that yielded phasianine birds, one evolving to bodied birds of this subfamily that were also called pheasants, Galus, and the other differentiating toward Pavo and its allies. for the want of more descriptive words, were the silver gallopheasant (Lophura nycthemera), the Burmese peacock- In the previous paper (1), we established duplication of the pheasant (Polyplectron bicalcaratum), and the great argus 60-base-long unit within the mitochondrial control (D-loop) pheasant (Argusianus argus), which is as large as a peafowl. The region to be the characteristic unique to the genus Gallus peafowl of the genus Pavo is represented by the common among the phasianine birds. Furthermore, base sequence peafowl (Pavo cristatus) and the green peafowl (Pavo muticus). comparison of this maternally derived noncoding region re- Unfortunately, we were unable to secure samples of one vealed that as diverse as domestic breeds of chicken are, they important group of phasianine birds represented by tragopans, could only have been derived from continental subspecies monals, and others. (e.g., Gallus gallus gallus, Gallus gallus spadiceus) but not an As before, DNA were extracted from blood samples ob- island subspecies (Gallus gallus bankiva) of the red junglefowl tained from live birds with no apparent harm to them. Am- (Gallusgallus) (1). Excluded from the ancestry ofdomesticated plified copies of the mitochondrial control region were ob- chicken were three other species of junglefowls: the green tained by PCR reaction using two described primers (1). The (Gallus varius), the grey (Gallus sonneratii), and the Sri Lanka same DNA-sequencing procedure as before was used (1). As (Gallus lafayettei). a rule, at least two individuals of each species were analyzed., In the present study, we wish to define the position of the Dendrograms were constructed on the basis of the neighbor- genus Gallus within the subfamily Phasianinae in relation to joining method (3), which is based upon the result of a formal other members. The present study did not deal with members mathematical analysis (4) of Kimura's six-parameter model for of the four other subfamilies that together with Phasianinae computation of nucleotide substitutions (5). constitute the family Phasianidae. They were turkeys of the New World subfamily Meleagridinae, guinea fowls of the African subfamily Numidinae, and toothed quails and par- OBSERVATIONS tridges of the New World subfamily Odontophorinae. Grouses Sequences at the 392 positions of the mitochondrial control of the Old World subfamily Tetraoninae were also excluded. region of 14 species not given in our previous paper (1) are Because of their ornamental values, large pheasant-like aligned and shown in three parts in Figs. 1 and 2. As shown birds of the subfamily Phasianinae are widely kept and prop- previously (1), the 60-base-long unit containing the nearly The publication costs of this article were defrayed in part by page charge IThe sequences reported in this paper have been deposited in the payment. This article must therefore be hereby marked "advertisement" in GenBank data base (accession nos. D64163, D64164, D66888- accordance with 18 U.S.C. §1734 solely to indicate this fact. D66900). 11053 Downloaded by guest on September 24, 2021 11054 Evolution: Akishinonomiya et al. Proc. Natl. Acad. Sci. USA 92 (1995) 1) COMMON QUAIL (COTURNIX COTURN I X L.) AACA--CTTmTTTTAACCTAACTCCCCTACTTAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTATACT 2) BLUE-BREASTED QUAIL (COTUR4IX SINENSIS) AACA--CTTTTTTTAACCTAACTCCCCTACTTAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTATACT 3) CHINESE BAMBOO PARTRIDGE (BAmj.sI.jLA THORA;B.A AATffCTTT M TAACCTAACICCCCTAkTTAGTGTACCCCCCCTTTCCCCCCCAGGGGAGGTATACT 4) CHUKAR PARTRIDGR (ALECToBiS GBMAEcA cauyA) AACA--CTTTTTTTAACCXAACTCCCCTACITAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTAIACT 5) EUROPEAN GREY PARTRIDGE (PERDiX PERDIX P.) AAtAXtC!TMTTTTAACfgAACTCCCCTACATAGTGTACCCCCCCTTTCCCCCCCAGGGAGGGTATgCT 1 ) AT61ATAATCGTGCATACATTTATATTCCACATATAITATGGTACCGGTAATATATATTATATA-CGTACTAAACCCATTATATGTATACGGICATTACAt-ATTetCCC-CATTTCTC 2) ATGTATAATCGTGCATACATTTATATTCCACATATATTATGGTACCGGTAATAIATATTATATA-CGTACTAAACCCATTATATGTATACGGACATTAXAg-ATTTGCCC-CATTTCTC 3) ATGTATAATCGTGCATACATTTATATACCACATATA!TATGGTACCGGTAATATATAITATATA-CGTACTAAACCCATTATAIGTATACXGACATTACTC fTATfCCCXCATTTCTC 4) ATGZATAATCGTGCATAfAMATATACCICATATATTATGATAaCGGTAATATATATA!TATA-CGTACTAAACCCATTATATGTAIACGGACATXACAXIATTAGCCC-CATTTCTC 5) ATGTAlAa!CGTGCATAfITTTaTaTTCCICATAIATTATGGTAXCXGTAITATATATTATATAICGTACTAaaCCCATTATATGTAXACGGACATTACACfATIAGCCC-CATITCTC 1) CCCATGTAC1)~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~4CTfTICACfAAC!AGGXCACCATAA CJTATGAATL TTECAGGACATAAI CTTACfXAXTAT!T-AICT-CCI ATTGGTTATGCTXGXCGTACCAGATGG 2) CCXATGTAC CTAA CtCXAACAAGG-CACCATA -AATGAATGGTTACAGGACATACCTCTIAtATA!TAATGTCAfT-CCACATTTGGTTATGCTCGTCGTATCAGATGG 3 ) CCCATGTAC lARfT-CACTAACAAGf-CACC!T-AA-CIATGA,ATGGTTACAGGACATAAA-CTTA!-ATATXIATG!-CTXTCCfCA-TTTGGTTATGCTCGgCGTACCAGATGG 4) CCXAA!EEX CTI!C CCCCCCAAGG-CACC^TAATCTATGAATGGTACAGGACATACT CITACAT!TTA!TGGTACT-CCACOA"TTGGT~TATGCCAGTCGTAtCAGATGG 5) CTCACGTaC XXAa-!!CCIACAAGG-CACCATAA-CTATfAATGGTTACAGGACATAATXCTTAATX;TATATC!ACCT-CCACATTTGGTTATGiCTCGXCGTACCAGATGG 1 ) ATTTATTGATCGTACACCTCACGAGAGATCAICAACCCCTGfCTGTAATGCTXTTC19TGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCITC 2 ) ATTTATTGATCGIACACCTCACGAGAGATCAGCAACCCCTGCTCGTAATGTTTATC!ATGACTAGfTTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCC'fCC 3 ) ATTTATT6ATCGTACACCTCACGAGAGACCAGCAACCCCTGCCTGTAATGTACTCC-ATGACTAGaCTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCTTC 4 ) ATTTATTGATCGTACACCTCACGAGAGATCACCAACCCCTGCCTGTAATGTACTCC-ATGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCCTC 5) ATTTATTGATCGGACACCTCACGAGAGATCAGCAACCCCTGCCCGTAATGTACTTC-ATGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCTXC 0.045 QUAIL ( COTURN I X CQTURNIUXA. t.) 0.006 371 0.075 CHINESE BAMBOO PARTRIDGE (BAms .LA TIOBACgIG) 0. 0 421 0.005 0.057 BLUE-BREASTED QUAIL (CoTuRNix SINENSIS) , 0.075 - CHUKAR PARTRIDGE ( ALECTO iS GRAECA CHUKAR) 0.091 EUROPEAN GREY PARTRIDGE (PERDIX PERD.IXP.)x 0. 150 0
Load more

Recommended publications
  • A Molecular Phylogeny of the Pheasants and Partridges Suggests That These Lineages Are Not Monophyletic R
    Molecular Phylogenetics and Evolution Vol. 11, No. 1, February, pp. 38–54, 1999 Article ID mpev.1998.0562, available online at http://www.idealibrary.com on A Molecular Phylogeny of the Pheasants and Partridges Suggests That These Lineages Are Not Monophyletic R. T. Kimball,* E. L. Braun,*,† P. W. Zwartjes,* T. M. Crowe,‡,§ and J. D. Ligon* *Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131; †National Center for Genome Resources, 1800 Old Pecos Trail, Santa Fe, New Mexico 87505; ‡Percy FitzPatrick Institute, University of Capetown, Rondebosch, 7700, South Africa; and §Department of Ornithology, American Museum of Natural History, Central Park West at 79th Street, New York, New York 10024-5192 Received October 8, 1997; revised June 2, 1998 World partridges are smaller and widely distributed in Cytochrome b and D-loop nucleotide sequences were Asia, Africa, and Europe. Most partridge species are used to study patterns of molecular evolution and monochromatic and primarily dull colored. None exhib- phylogenetic relationships between the pheasants and its the extreme or highly specialized ornamentation the partridges, which are thought to form two closely characteristic of the pheasants. related monophyletic galliform lineages. Our analyses Although the order Galliformes is well defined, taxo- used 34 complete cytochrome b and 22 partial D-loop nomic relationships are less clear within the group sequences from the hypervariable domain I of the (Verheyen, 1956), due to the low variability in anatomi- D-loop, representing 20 pheasant species (15 genera) and 12 partridge species (5 genera). We performed cal and osteological traits (Blanchard, 1857, cited in parsimony, maximum likelihood, and distance analy- Verheyen, 1956; Lowe, 1938; Delacour, 1977).
    [Show full text]
  • Scottish Birds 22: 9-19
    Scottish Birds THE JOURNAL OF THE SOC Vol 22 No 1 June 2001 Roof and ground nesting Eurasian Oystercatchers in Aberdeen The contrasting status of Ring Ouzels in 2 areas of upper Deeside The distribution of Crested Tits in Scotland during the 1990s Western Capercaillie captures in snares Amendments to the Scottish List Scottish List: species and subspecies Breeding biology of Ring Ouzels in Glen Esk Scottish Birds The Journal of the Scottish Ornithologists' Club Editor: Dr S da Prato Assisted by: Dr I Bainbridge, Professor D Jenkins, Dr M Marquiss, Dr J B Nelson, and R Swann Business Editor: The Secretary sac, 21 Regent Terrace Edinburgh EH7 5BT (tel 0131-5566042, fax 0131 5589947, email [email protected]). Scottish Birds, the official journal of the Scottish Ornithologists' Club, publishes original material relating to ornithology in Scotland. Papers and notes should be sent to The Editor, Scottish Birds, 21 Regent Terrace, Edinburgh EH7 SBT. Two issues of Scottish Birds are published each year, in June and in December. Scottish Birds is issued free to members of the Scottish Ornithologists' Club, who also receive the quarterly newsletter Scottish Bird News, the annual Scottish Bird Report and the annual Raplor round up. These are available to Institutions at a subscription rate (1997) of £36. The Scottish Ornithologists' Club was formed in 1936 to encourage all aspects of ornithology in Scotland. It has local branches which meet in Aberdeen, Ayr, the Borders, Dumfries, Dundee, Edinburgh, Glasgow, Inverness, New Galloway, Orkney, St Andrews, Stirling, Stranraer and Thurso, each with its own programme of field meetings and winter lectures.
    [Show full text]
  • Conservation Genetics and Management of the Chukar Partridge Alectoris Chukar in Cyprus and the Middle East PANICOS PANAYIDES, MONICA GUERRINI & FILIPPO BARBANERA
    Conservation genetics and management of the Chukar Partridge Alectoris chukar in Cyprus and the Middle East PANICOS PANAYIDES, MONICA GUERRINI & FILIPPO BARBANERA The Chukar Partridge Alectoris chukar (Phasianidae) is a popular game bird whose range extends from the Balkans to eastern Asia. The Chukar is threatened by human-mediated hybridization either with congeneric species (Red-Legged A. rufa and Rock A. graeca Partridges) from Europe or exotic conspecifics (from eastern Asia), mainly through introductions. We investigated Chukar populations of the Middle East (Cyprus, Turkey, Lebanon, Israel, Armenia, Georgia, Iran and Turkmenistan: n = 89 specimens) in order to obtain useful genetic information for the management of this species. We sequenced the entire mitochondrial DNA (mtDNA) Control Region using Mediterranean (Greece: n = 27) and eastern Asian (China: n = 18) populations as intraspecific outgroups. The Cypriot Chukars (wild and farmed birds) showed high diversity and only native genotypes; signatures of both demographic and spatial expansion were found. Our dataset suggests that Cyprus holds the most ancient A. chukar haplotype of the Middle East. We found A. rufa mtDNA lineage in Lebanese Chukars as well as A. chukar haplotypes of Chinese origin in Greek and Turkish Chukars. Given the very real risk of genetic pollution, we conclude that present management of game species such as the Chukar cannot avoid anymore the use of molecular tools. We recommend that Chukars must not be translocated from elsewhere to Cyprus. INTRODUCTION The distribution range of the most widespread species of Alectoris partridge, the Chukar (A. chukar, Phasianidae, Plate 1), is claimed to extend from the Balkans to eastern Asia.
    [Show full text]
  • Than a Meal: the Turkey in History, Myth
    More Than a Meal Abigail at United Poultry Concerns’ Thanksgiving Party Saturday, November 22, 1997. Photo: Barbara Davidson, The Washington Times, 11/27/97 More Than a Meal The Turkey in History, Myth, Ritual, and Reality Karen Davis, Ph.D. Lantern Books New York A Division of Booklight Inc. Lantern Books One Union Square West, Suite 201 New York, NY 10003 Copyright © Karen Davis, Ph.D. 2001 All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the written permission of Lantern Books. Printed in the United States of America Library of Congress Cataloging-in-Publication Data For Boris, who “almost got to be The real turkey inside of me.” From Boris, by Terry Kleeman and Marie Gleason Anne Shirley, 16-year-old star of “Anne of Green Gables” (RKO-Radio) on Thanksgiving Day, 1934 Photo: Underwood & Underwood, © 1988 Underwood Photo Archives, Ltd., San Francisco Table of Contents 1 Acknowledgments . .9 Introduction: Milton, Doris, and Some “Turkeys” in Recent American History . .11 1. A History of Image Problems: The Turkey as a Mock Figure of Speech and Symbol of Failure . .17 2. The Turkey By Many Other Names: Confusing Nomenclature and Species Identification Surrounding the Native American Bird . .25 3. A True Original Native of America . .33 4. Our Token of Festive Joy . .51 5. Why Do We Hate This Celebrated Bird? . .73 6. Rituals of Spectacular Humiliation: An Attempt to Make a Pathetic Situation Seem Funny . .99 7 8 More Than a Meal 7.
    [Show full text]
  • Changes to Category C of the British List†
    Ibis (2005), 147, 803–820 Blackwell Publishing, Ltd. Changes to Category C of the British List† STEVE P. DUDLEY* British Ornithologists’ Union, Department of Zoology, University of Oxford, South Parks Road, Oxford OX1 3PS, UK In its maintenance of the British List, the British Ornithologists’ Union Records Committee (BOURC) is responsible for assigning species to categories to indicate their status on the List. In 1995, the British Ornithologists’ Union (BOU) and the Joint Nature Conservation Committee (JNCC) held a conference on naturalized and introduced birds in Britain (Holmes & Simons 1996). This led to a review of the process of establishment of such species and the terms that best describe their status (Holmes & Stroud 1995) as well as a major review of the categorization of species on the British List (Holmes et al. 1998). The BOURC continues to review the occurrence and establishment of birds of captive origin in Britain. This paper sum- marizes the status of naturalized and introduced birds in Britain and announces changes to the categorization of many on the British List or its associated appendices (Categories D and E): Mute Swan Cygnus olor Categories AC change to AC2 Black Swan Cygnus atratus Category E* – no change Greylag Goose Anser anser Categories ACE* change to AC2C4E* Snow Goose Anser caerulescens Categories AE* change to AC2E* Greater Canada Goose Branta canadensis Categories ACE* change to C2E* Barnacle Goose Branta leucopsis Categories AE* change to AC2E* Egyptian Goose Alopochen aegyptiacus Categories CE* change
    [Show full text]
  • Rapanui Fowl
    BREED FOCUS: RAPANUI FOWL By Christine Heinrichs and Kermit Blackwood (USA) All photos not individually credited are by either Michelle Tullis, Jeremy Yashar-Johnson, Martin Blendulf or Tamiym Lehoux Above: A View of the Monuments of Easter Island, Rapa Nui. Oil on panel, by William Hodges, 1870. On Easter Sunday, April 5, 1722, Dutch sea captain Jacob Roggeveen landed his ship the Tienhoven on an island the inhabitants, the Rapanui, called Te Pito o Te Henua, The Center of the World. Captain Roggeveen renamed it Easter Island. Right: Captain Jacob Roggeveen. By the time the Dutch arrived, Easter Island’s population was in decline. There were probably no more than about 2,000-3,000 people living on the island. Maximum population estimates of previous eras range from 4,000- 15,000. Theories differ as to the cause of their demise. Barbara A. West writes in the Encyclopedia of the Peoples of Asia and Oceania, “… the Rapanui experienced a tremendous upheaval in their social system brought about by a change in their island's ecology...” Jared Diamond (an American biogeographer) drew attention to the connection between ecological overexploitation and the downfall of society. In Easter Island we are describing a situation where wholesale ecological exploitation destroyed a civilization. They’d cut down every last trees making it impossible to so build seaworthy boats to sail away. As in other Polynesian cultures, the Rapanui people knew cannibalism. By the 18th century, the population of Easter Island were coping with staying warm from Antarctic winds in winter without sufficient clothing. Terry Hunt and Caro Lipo’s studies suggest that humans made permanent settlements on Easter Island around 1200 AD, and that the population never exceeded around 3,000 people.
    [Show full text]
  • Golden Pheasant Chrysolophus Pictus
    Young Golden Pheasant Chrysolophus pictus What is the history of my relationship to man? The Golden Pheasant is commonly found in zoos and aviaries, but often as impure specimens that have the similar Lady Amherst's Pheasant in their lineage. Habitat / Climate Where am I from? dark young conifer forests The Golden Pheasant or "Chinese Pheasant",is a parrot like Map with sparse undergrowth gamebird of the order Galliformes. It is native to forests in mountainous areas of western China but feral populations have been established in the United Kingdom and elsewhere. Other family members: Caspian snowcock Who are my relatives? Gray partridge Silver Pheasant, Little chachalaca, Yellow- knobbed curassow and Western capercaillie the Turkey Breeding Potential How am I born? We lay 8-12 eggs at a time and will then incubate these for around 22-23 days. Clutch size 8 to 12 eggs When we hatch we are able to walk and look for food with in hours. By a few weeks we will loose our down and have our feathers in. How long does it take me to grow up and how long do I live Once we have gotten our feathers we will keep getting bigger. By 3 months we will be full Breeding Season grown, we might add a few pounds after that but wont get larger. We can live up to 6 years. J F M A M J J A S O N D A E A P A U U U E C O E N B R R Y N L G P T V C What kind of family life do I have? We are extremely territorial.
    [Show full text]
  • Partridges, Quails, Pheasants and Turkeys Phasianidae Vigors, 1825: Zoological Journal 2: 402 – Type Genus Phasianus Linnaeus, 1758
    D .W . .5 / DY a 5D t w[ { wt Ç"" " !W5 í ÇI &'(' / b ù b a L w 5 ! ) " í "* " Ç t+ t " h " * { b ù" t* &)/&0 Order GALLIFORMES: Game Birds and Allies The order of galliform taxa in Checklist Committee (1990) appears to have been based on Peters (1934). Johnsgard (1986) synthesised available data, came up with similar groupings of taxa, and produced a dendrogram indicating that turkeys (Meleagridinae) were the most primitive (outside Cracidae and Megapodiidae), with grouse (Tetraoninae), guineafowl (Numidinae), New World quails (Odontophorinae) and pheasants and kin (Phasianinae) successively more derived. Genetic evidence (DNA-hybridisation data) provided by Sibley & Ahlquist (1990) suggested Odontophorinae were the most basal phasianoids and guineafowl the next most basal group. A basal position of the New World quails among phasianoids has been supported by other genetic data (Kimball et al. 1999, Armstrong et al. 2001). A recent analysis based on morphological characters (Dyke et al. 2003) found support for megapodes as the most basal group in the order, then Cracidae, then Phasianidoidea, and within the latter, Numididae the most basal group. In contrast to the above genetic-based analyses, Dyke et al. (2003) found the Odontophorinae to be the most derived group within the order. A recent analysis using both mitochondrial ND2 and cytochrome-b DNA sequences, however, reinforces the basal position of the Odontophorinae (Pereira & Baker 2006). Here we follow a consensus of the above works and place Odontophorinae basal in the phasianids. Worthy & Holdaway (2002) considered that Cheeseman’s (1891) second-hand record of megapodes from Raoul Island, Kermadec Group, before the 1870 volcanic eruption has veracity.
    [Show full text]
  • A Molecular Phylogeny of the Peacock-Pheasants (Galliformes: Polyplectron Spp.) Indicates Loss and Reduction of Ornamental Traits and Display Behaviours
    Biological Journal of the Linnean Society (2001), 73: 187–198. With 3 figures doi:10.1006/bijl.2001.0536, available online at http://www.idealibrary.com on A molecular phylogeny of the peacock-pheasants (Galliformes: Polyplectron spp.) indicates loss and reduction of ornamental traits and display behaviours REBECCA T. KIMBALL1,2∗, EDWARD L. BRAUN1,3, J. DAVID LIGON1, VITTORIO LUCCHINI4 and ETTORE RANDI4 1Department of Biology, University of New Mexico, Albuquerque, NM 87131, USA 2Department of Evolution, Ecology and Organismal Biology, Ohio State University, Columbus, OH 43210, USA 3Department of Plant Biology, Ohio State University, Columbus, OH 43210, USA 4Istituto Nazionale per la Fauna Selvatica, via Ca` Fornacetta 9, 40064 Ozzano dell’Emilia (BO), Italy Received 4 September 2000; accepted for publication 3 March 2001 The South-east Asian pheasant genus Polyplectron is comprised of six or seven species which are characterized by ocelli (ornamental eye-spots) in all but one species, though the sizes and distribution of ocelli vary among species. All Polyplectron species have lateral displays, but species with ocelli also display frontally to females, with feathers held erect and spread to clearly display the ocelli. The two least ornamented Polyplectron species, one of which completely lacks ocelli, have been considered the primitive members of the genus, implying that ocelli are derived. We examined this hypothesis phylogenetically using complete mitochondrial cytochrome b and control region sequences, as well as sequences from intron G in the nuclear ovomucoid gene, and found that the two least ornamented species are in fact the most recently evolved. Thus, the absence and reduction of ocelli and other ornamental traits in Polyplectronare recent losses.
    [Show full text]
  • Document Resume Ed 049 958 So 000 779 Institution Pub
    DOCUMENT RESUME ED 049 958 SO 000 779 AUTHCE Nakosteen, Mehdi TITLE Conflicting Educational Ideals in America, 1775-1831: Documentary Source Book. INSTITUTION Colorado Univ., Boulder. School of Education. PUB DATE 71 NOTE 480p. EDES PRICE EDES Price MF-SC.65 HC-$16.45 DESCRIPTORS *Annotated Bibliographies, Cultural Factors, *Educational History, Educational Legislation, *Educational Practice, Educational Problems, *Educational Theories, Historical Reviews, Resource Materials, Social Factors, *United States History IDENTIFIERS * Documentary History ABSTRACT Educational thought among political, religious, educational, and other social leaders during the formative decades of American national life was the focus of the author's research. The initial objective was the discovery cf primary materials from the period to fill a gap in the history of American educational thought and practice. Extensive searching cf unpublished and uncatalogued library holdings, mainly those of major public and university libraries, yielded a significant quantity of primary documents for this bibliography. The historical and contemporary works, comprising approximately 4,500 primary and secondary educational resources with some surveying the cultural setting of educational thinking in this period, are organized around 26 topics and 109 subtopics with cross-references. Among the educational issues covered by the cited materials are: public vs. private; coed vs. separate; academic freedom, teacher education; teaching and learning theory; and, equality of educational opportunity. In addition to historical surveys and other secondary materials, primary documents include: government documents, books, journals, newspapers, and speeches. (Author/DJB) CO Lir\ 0 CY% -1- OCY% w CONFLICTING EDUCATIONAL I D E A L S I N A M E R I C A , 1 7 7 5 - 1 8 3 1 : DOCUMENTARY SOURCE B 0 0 K by MEHDI NAKOSTEEN Professor of History and Philosophy of Education University of Colorado U.S.
    [Show full text]
  • Hybridization & Zoogeographic Patterns in Pheasants
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Paul Johnsgard Collection Papers in the Biological Sciences 1983 Hybridization & Zoogeographic Patterns in Pheasants Paul A. Johnsgard University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/johnsgard Part of the Ornithology Commons Johnsgard, Paul A., "Hybridization & Zoogeographic Patterns in Pheasants" (1983). Paul Johnsgard Collection. 17. https://digitalcommons.unl.edu/johnsgard/17 This Article is brought to you for free and open access by the Papers in the Biological Sciences at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Paul Johnsgard Collection by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. HYBRIDIZATION & ZOOGEOGRAPHIC PATTERNS IN PHEASANTS PAUL A. JOHNSGARD The purpose of this paper is to infonn members of the W.P.A. of an unusual scientific use of the extent and significance of hybridization among pheasants (tribe Phasianini in the proposed classification of Johnsgard~ 1973). This has occasionally occurred naturally, as for example between such locally sympatric species pairs as the kalij (Lophura leucol11elana) and the silver pheasant (L. nycthelnera), but usually occurs "'accidentally" in captive birds, especially in the absence of conspecific mates. Rarely has it been specifically planned for scientific purposes, such as for obtaining genetic, morphological, or biochemical information on hybrid haemoglobins (Brush. 1967), trans­ ferins (Crozier, 1967), or immunoelectrophoretic comparisons of blood sera (Sato, Ishi and HiraI, 1967). The literature has been summarized by Gray (1958), Delacour (1977), and Rutgers and Norris (1970). Some of these alleged hybrids, especially those not involving other Galliformes, were inadequately doculnented, and in a few cases such as a supposed hybrid between domestic fowl (Gallus gal/us) and the lyrebird (Menura novaehollandiae) can be discounted.
    [Show full text]
  • The Big Year Ebook Free Download
    THE BIG YEAR PDF, EPUB, EBOOK Mark Obmascik | 320 pages | 08 Dec 2011 | Transworld Publishers Ltd | 9780857500694 | English | London, United Kingdom The Big Year PDF Book Pete Shackelford Steve Darling Archived from the original on January 26, In , Nicole Koeltzow reached the species milestone on July 1, while in August Gaylee and Richard Dean became the first birders to reach species in consecutive years. Highway runs along the California Coast. Crazy Credits. By Noah Strycker July 26, Stu is hiking with his toddler grandson already enamored by birds in the Rockies. Mary Swit Calum Worthy Miller Greg Miller It also replaces Jack Black's narration of the story with a new narration by John Cleese who also receives a credit in the opening title sequence. Narrator voice Jack Black Brad is a skilled birder who can identify nearly any species solely by sound. Category:Birds and humans Zoomusicology. Added to Watchlist. Retrieved January 25, Get Audubon in Your Inbox Let us send you the latest in bird and conservation news. Retrieved Jessica Steve Martin Paul Lavigne Heather Osborne Share this page:. Birds class : Aves. Yukon News. Tony Cindy Busby Wheel of Fortune Underscore. Visit our What to Watch page. Caprimulgiformes nightjars and relatives Steatornithiformes Podargiformes Apodiformes swifts and hummingbirds. In , an unprecedented four birders attempted simultaneous ABA Area big years. Steve's character provides fatherly guidance and support that helps Jack Black's character move forward with his life and relationships. The company is in the middle of complicated negotiations to merge with a competitor, so his two anointed successors keep calling him back to New York for important meetings; to some extent he is a prisoner of his own success.
    [Show full text]