Proc. Natl. Acad. Sci. USA Vol. 92, pp. 11053-11056, November 1995 Evolution The genetic link between the Chinese bamboo partridge (Bambusicola thoracica) and the chicken and junglefowls of the genus Gallus AKISHINONOMIYA FuMIHITO*, TETSUO MIYAKEt, MASARU TAKADAt, SUSUMU OHNO§, AND NORIO KONDOt *Yamashina Institute for Ornithology, 115 Tsutsumine-aza, Konoyama, Abiko-shi, Chiba Prefecture 270-11, Japan; tWakunaga Pharmaceutical Company Central Laboratories, 1624 Shimokotachi, Kodacho, Takatagun Hiroshima Prefecture 739-11, Japan; tThe Research Institute of Evolutionary Biology, 2-4-28 Kamiyoga, Setagaya-ku, Tokyo 158, Japan; and §Beckman Research Institute of the City of Hope, 1450 East Duarte Road, Duarte, CA 91010-3000 Contributed by Susumu Ohno, August 9, 1995 ABSTRACT Further comparison of mitochondrial con- agated in various zoos of the world, as well as by private trol-region DNA base sequences of 16 avian species belonging fanciers. This is not the case with diverse generalized perdicine to the subfamily Phasianinae revealed the following: (i) Gen- birds (quails and partridges) of the same subfamily. If a few of eralized perdicine birds (quails and partridges) are ofancient them are kept and propagated, they are maintained only as lineages. Even the closest pair, the common quail (Coturnix exotic game birds. Accordingly, we were able to secure blood coturnixjaponica) and the Chinese bamboo partridge (Bam- samples from only five species, although from four (five) busicola thoracica), maintained only 85.71% identity. (ii) The different genera, of the generalized perdicine birds, which are 12 species of phasianine birds previously and presently stud- said to consist of 103 species belonging to 22 different genera ied belonged to three distinct branches. The first branch was (2). They were the common quail of Japanese variety, Coturnix made exclusively of members of the genus Galus, while the coturnixjaponica, the blue-breasted quail (Coturnixsinesis, also second branch was made ofpheasants ofthe genera Phasianus, known as Excalifactoria sinensis), the Chinese bamboo par- Chrysolophus, and Syrmaticus. Gallopheasants of the genus tridge Bambusicola thoracica, the chukar partridge, Alectoris Lophura were distant cousins to these pheasants. The great graeca chukar, and the European grey partridge Perdix perdix argus (Argusianus argus) and peafowls of the genus Pavo perdix. In sharp contrast, there were no difficulties in securing constituted the third branch. The position ofpeacock-pheasants 12 species of the large pheasant-like birds of the subfamily ofthe genus Polypectron in the third branch was similar to that Phasianinae, representing 8 different genera; thus 11 of the 49 of the genus Lophura in the second branch. Members of the extant species were sampled (2). In addition to the red (G. gallus) fourth phasianine branch, such as tragopans and monals, and green (G. varius) previously reported (1), the genus Gallus were not included in the present study. (iii) The one perdicine was represented by two additional junglefowl species, the grey species, Bambusicola thoracica, was more closely related to (G. sonneratii) and Sri Lanka (G. lafayettei) junglefowls. Pheas- phasianine genera Gallus and Pavo than to members of other ants, as such, were represented by three species: the ring- perdicine genera. The above might indicate that Bambusicola necked (Phasianus colchicus), the golden (Chrysolophus pic- belong to one-stem perdicine lineage that later splits into two tus), and Mrs. Hume's (Syrmaticus huminae). Other large sublineages that yielded phasianine birds, one evolving to bodied birds of this subfamily that were also called pheasants, Galus, and the other differentiating toward Pavo and its allies. for the want of more descriptive words, were the silver gallopheasant (Lophura nycthemera), the Burmese peacock- In the previous paper (1), we established duplication of the pheasant (Polyplectron bicalcaratum), and the great argus 60-base-long unit within the mitochondrial control (D-loop) pheasant (Argusianus argus), which is as large as a peafowl. The region to be the characteristic unique to the genus Gallus peafowl of the genus Pavo is represented by the common among the phasianine birds. Furthermore, base sequence peafowl (Pavo cristatus) and the green peafowl (Pavo muticus). comparison of this maternally derived noncoding region re- Unfortunately, we were unable to secure samples of one vealed that as diverse as domestic breeds of chicken are, they important group of phasianine birds represented by tragopans, could only have been derived from continental subspecies monals, and others. (e.g., Gallus gallus gallus, Gallus gallus spadiceus) but not an As before, DNA were extracted from blood samples ob- island subspecies (Gallus gallus bankiva) of the red junglefowl tained from live birds with no apparent harm to them. Am- (Gallusgallus) (1). Excluded from the ancestry ofdomesticated plified copies of the mitochondrial control region were ob- chicken were three other species of junglefowls: the green tained by PCR reaction using two described primers (1). The (Gallus varius), the grey (Gallus sonneratii), and the Sri Lanka same DNA-sequencing procedure as before was used (1). As (Gallus lafayettei). a rule, at least two individuals of each species were analyzed., In the present study, we wish to define the position of the Dendrograms were constructed on the basis of the neighbor- genus Gallus within the subfamily Phasianinae in relation to joining method (3), which is based upon the result of a formal other members. The present study did not deal with members mathematical analysis (4) of Kimura's six-parameter model for of the four other subfamilies that together with Phasianinae computation of nucleotide substitutions (5). constitute the family Phasianidae. They were turkeys of the New World subfamily Meleagridinae, guinea fowls of the African subfamily Numidinae, and toothed quails and par- OBSERVATIONS tridges of the New World subfamily Odontophorinae. Grouses Sequences at the 392 positions of the mitochondrial control of the Old World subfamily Tetraoninae were also excluded. region of 14 species not given in our previous paper (1) are Because of their ornamental values, large pheasant-like aligned and shown in three parts in Figs. 1 and 2. As shown birds of the subfamily Phasianinae are widely kept and prop- previously (1), the 60-base-long unit containing the nearly The publication costs of this article were defrayed in part by page charge IThe sequences reported in this paper have been deposited in the payment. This article must therefore be hereby marked "advertisement" in GenBank data base (accession nos. D64163, D64164, D66888- accordance with 18 U.S.C. §1734 solely to indicate this fact. D66900). 11053 Downloaded by guest on September 24, 2021 11054 Evolution: Akishinonomiya et al. Proc. Natl. Acad. Sci. USA 92 (1995) 1) COMMON QUAIL (COTURNIX COTURN I X L.) AACA--CTTmTTTTAACCTAACTCCCCTACTTAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTATACT 2) BLUE-BREASTED QUAIL (COTUR4IX SINENSIS) AACA--CTTTTTTTAACCTAACTCCCCTACTTAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTATACT 3) CHINESE BAMBOO PARTRIDGE (BAmj.sI.jLA THORA;B.A AATffCTTT M TAACCTAACICCCCTAkTTAGTGTACCCCCCCTTTCCCCCCCAGGGGAGGTATACT 4) CHUKAR PARTRIDGR (ALECToBiS GBMAEcA cauyA) AACA--CTTTTTTTAACCXAACTCCCCTACITAGTGTACCCCCCCTTTCCCCCCCAGGGGGGGTAIACT 5) EUROPEAN GREY PARTRIDGE (PERDiX PERDIX P.) AAtAXtC!TMTTTTAACfgAACTCCCCTACATAGTGTACCCCCCCTTTCCCCCCCAGGGAGGGTATgCT 1 ) AT61ATAATCGTGCATACATTTATATTCCACATATAITATGGTACCGGTAATATATATTATATA-CGTACTAAACCCATTATATGTATACGGICATTACAt-ATTetCCC-CATTTCTC 2) ATGTATAATCGTGCATACATTTATATTCCACATATATTATGGTACCGGTAATAIATATTATATA-CGTACTAAACCCATTATATGTATACGGACATTAXAg-ATTTGCCC-CATTTCTC 3) ATGTATAATCGTGCATACATTTATATACCACATATA!TATGGTACCGGTAATATATAITATATA-CGTACTAAACCCATTATAIGTATACXGACATTACTC fTATfCCCXCATTTCTC 4) ATGZATAATCGTGCATAfAMATATACCICATATATTATGATAaCGGTAATATATATA!TATA-CGTACTAAACCCATTATATGTAIACGGACATXACAXIATTAGCCC-CATTTCTC 5) ATGTAlAa!CGTGCATAfITTTaTaTTCCICATAIATTATGGTAXCXGTAITATATATTATATAICGTACTAaaCCCATTATATGTAXACGGACATTACACfATIAGCCC-CATITCTC 1) CCCATGTAC1)~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~4CTfTICACfAAC!AGGXCACCATAA CJTATGAATL TTECAGGACATAAI CTTACfXAXTAT!T-AICT-CCI ATTGGTTATGCTXGXCGTACCAGATGG 2) CCXATGTAC CTAA CtCXAACAAGG-CACCATA -AATGAATGGTTACAGGACATACCTCTIAtATA!TAATGTCAfT-CCACATTTGGTTATGCTCGTCGTATCAGATGG 3 ) CCCATGTAC lARfT-CACTAACAAGf-CACC!T-AA-CIATGA,ATGGTTACAGGACATAAA-CTTA!-ATATXIATG!-CTXTCCfCA-TTTGGTTATGCTCGgCGTACCAGATGG 4) CCXAA!EEX CTI!C CCCCCCAAGG-CACC^TAATCTATGAATGGTACAGGACATACT CITACAT!TTA!TGGTACT-CCACOA"TTGGT~TATGCCAGTCGTAtCAGATGG 5) CTCACGTaC XXAa-!!CCIACAAGG-CACCATAA-CTATfAATGGTTACAGGACATAATXCTTAATX;TATATC!ACCT-CCACATTTGGTTATGiCTCGXCGTACCAGATGG 1 ) ATTTATTGATCGTACACCTCACGAGAGATCAICAACCCCTGfCTGTAATGCTXTTC19TGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCITC 2 ) ATTTATTGATCGIACACCTCACGAGAGATCAGCAACCCCTGCTCGTAATGTTTATC!ATGACTAGfTTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCC'fCC 3 ) ATTTATT6ATCGTACACCTCACGAGAGACCAGCAACCCCTGCCTGTAATGTACTCC-ATGACTAGaCTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCTTC 4 ) ATTTATTGATCGTACACCTCACGAGAGATCACCAACCCCTGCCTGTAATGTACTCC-ATGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCCTC 5) ATTTATTGATCGGACACCTCACGAGAGATCAGCAACCCCTGCCCGTAATGTACTTC-ATGACTAGCTTCAGGCCCATTCTTTCCCCCTACACCCCTCGCCCTXC 0.045 QUAIL ( COTURN I X CQTURNIUXA. t.) 0.006 371 0.075 CHINESE BAMBOO PARTRIDGE (BAms .LA TIOBACgIG) 0. 0 421 0.005 0.057 BLUE-BREASTED QUAIL (CoTuRNix SINENSIS) , 0.075 - CHUKAR PARTRIDGE ( ALECTO iS GRAECA CHUKAR) 0.091 EUROPEAN GREY PARTRIDGE (PERDIX PERD.IXP.)x 0. 150 0