Phylogeny of the Polygalaceae and a Revision of Badiera

Home , Alchornea latifolia, Asemeia (plant), Azua Province, Badiera, Barahona Province, Besleria

PHYLOGENY OF THE POLYGALACEAE AND A REVISION OF BADIERA

J. RICHARD ABBOTT

A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA

2009

ACKNOWLEDGMENTS

I thank Ralph Thompson (Berea College) for his assistance, support, training, and

mentorship as I first fell in love with botany. I thank Walter Judd for picking up where

Ralph left off, guiding me through graduate school. Countless other University of Florida

faculty, staff, and other students provided assistance over the years, notably: Norris

Williams, Mark Whitten, Kent Perkins, Trudy Lindler, Kaoru Kitajima, Jon Reiskind, Kurt

Neubig (to whom Figure 4-33D is dedicated), and Mario Blanco. The Electron

Microscopy Core Laboratory at the University of Florida (especially Karen L. Kelley and

Kim Backer) was essential for scanning electron microscopy work. I am also grateful for

the assistance of Dan Skean (Michigan), Teodoro Clase (Dominican Republic), Brigido

Peguero (Dominican Republic), Felix Forest (England), Folkert Aleva (The

Netherlands), Bruno Wallnöfer (Austria), Peter Raven (Missouri), Eldis Bécquer (Cuba),

Luis Roberto (Cuba), Fredy Archila (Guatemala), German Carnevali (Mexico), Y.C.

Chan (Malaysia), Tom Yukawa (Japan), Tom Wendt (Texas), and the curators of all the

herbaria that loaned specimens for study. Finally, I cherish Barbara Carlsward for

putting up with me all these years.

TABLE OF CONTENTS

page

ACKNOWLEDGMENTS...... 3

LIST OF TABLES...... 6

LIST OF FIGURES...... 7

LIST OF OBJECTS ...... 10

ABSTRACT ...... 11

CHAPTERS

1 INTRODUCTION ...... 13

2 BADIERA SUBRHOMBIFOLIA (POLYGALACEAE), A NEW SPECIES FROM HISPANIOLA, WITH A DISCUSSION OF GENERIC CIRCUMSCRIPTION...... 17

Description of New Species ...... Error! Bookmark not defined. Distribution and Habitat...... 31 Phenology...... 33 Additional Specimens Examined ...... 33 Diagnostic Key to Hispaniolan Species of Badiera ...... 37

3 PHYLOGENY AND BIOGEOGRAPHY OF NORTH AMERICAN POLYGALACEAE: NOTES ON THE DISINTEGRATION OF POLYGALA, WITH FOUR NEW GENERA FOR THE FLORA OF NORTH AMERICA...... 42

Introduction ...... 42 Materials and Methods...... 45 Results...... 49 General Discussion...... 59 Taxonomic Conclusions...... 68 North American Groups and Biogeographic Discussion...... 76 New Combinations and Changes of Status ...... 87

4 TAXONOMIC REVISION OF BADIERA (POLYGALACEAE): A CARIBBEAN CLADE...... 110

Introduction ...... 110 Taxonomic History ...... 112 Materials and Methods...... 114 Morphology ...... 118 Anatomy...... 129 Pollination Biology and Fruit Dispersal...... 139

Species Concepts...... 143 Phylogenetic Relationships within Badiera ...... 144 Habitats and Distribution...... 146 Taxonomy ...... 149

5 RESULTS AND CONCLUSIONS ...... 244

APPENDICES

A VOUCHER TAXA USED IN THIS STUDY...... 246

B DISCUSSION OF SPECIES CONCEPTS AND DELIMITATION ISSUES...... 257

List of Unresolved, Potentially Problematic Species Complexes in North America ...... 261 Discussion of Historical Infrageneric Classification of Polygala, in Part Provided as a Guide for Taxon Selection for Future Phylogenetic Analyses ...... 264

C CLADOGRAMS NOT INCLUDED IN THE PRIMARY CHAPTER, WITH FOCUS ON NORTH AMERICAN TAXA ...... 282

LIST OF REFERENCES ...... 283

BIOGRAPHICAL SKETCH...... 291

LIST OF TABLES

Table page

3-1 DNA primers used in this study...... 91

3-2 Numerical results of phylogenetic analyses in this study...... 92

3-3 Absolute increases and percent increases in the number of characters and length with increasing number of taxa...... 93

3-4 Node support values...... 94

3-5 Bootstrap support values for named clades across all analyses...... 95

4-1 List of taxa, vouchers, and provenance for specimens included in DNA-based phylogenetic analyses of Badiera...... 206

4-2 DNA primers used in this study...... 208

LIST OF FIGURES

Figure page

2-1 Badiera subrhombifolia, vegetative features...... 39

2-2 Badiera subrhombifolia, line drawing...... 40

2-3 Badiera subrhombifolia, distribution map...... 41

3-1 Generic clades supported across bootstrap and strict consensus analyses. Combined chloroplast, ITS, and combined nuclear and plastid results...... 97

3-2 Generic clades -- chloroplast details. Plastid trnL-F spacer and trnL intron results...... 98

3-3 Generic clades with support values and known base chromosome numbers. Based on the combined 179 taxa analyses...... 99

3-4 Synopsis of ITS 56 taxa analyses...... 100

3-5 Synopsis of ITS 109 taxa analyses...... 101

3-6 Synopsis of ITS 179 taxa analyses...... 102

3-7 Synopsis of chloroplast (trnL-F and trnL intron) 56 taxa analyses...... 104

3-8 Synopsis of chloroplast (trnL-F and trnL intron) 109 taxa analyses...... 105

3-9 Synopsis of combined (ITS, trnL-F, and trnL intron) 56 taxa analyses...... 106

3-10 Synopsis of combined 109 (ITS, trnL-F, and trnL intron) taxa analyses...... 107

3-11 Synopsis of combined 179 (ITS, trnL-F, and trnL intron) taxa analyses...... 108

4-1 Synopsis of phylogenetic analysis of combined nuclear and plastid data for multiple populations of Badiera, with bootstrap values and branch lengths...... 209

4-2 Flowers...... 210

4-3 Close-up of flower parts, all alcoholized...... 211

4-4 Floral features (scanning electron micrographs), Badiera oblongata...... 212

4-5 Alcoholized gynoecia (except I, which is dried), lateral view, with most sepals removed for visibility of nectar disk, stipe, and ovary...... 213

4-6 Dried pedicels, all with persistent bracts at the base...... 214

4-7 Inflorescence bracts...... 215

4-8 Badiera penaea, B. propinqua, and B. cubensis...... 216

4-9 Badiera oblongata, central Cuba...... 217

4-10 Badiera fruits, part 1, all from dried material...... 218

4-11 Badiera fruits, part 2, all from dried material...... 219

4-12 Seeds, part 1...... 220

4-13 Seeds, part 2...... 221

4-14 Aril surface texture detail (scanning electron micrographs)...... 222

4-15 Anatomical cross sections of leaves...... 223

4-16 Anatomical leaf features, transverse sections, part 1...... 224

4-17 Anatomical leaf features, transverse sections, part 2...... 225

4-18 Anatomical leaf features, transverse sections, part 3...... 226

4-19 Anther details (scanning electron micrographs)...... 227

4-20 Root and stems, anatomical transverse sections...... 228

4-21 Anatomical view of leaf hairs and epidermis, in transverse section...... 229

4-22 View of various leaf features (scanning electron micrographs)...... 230

4-23 Macroscopic leaf features...... 231

4-24 Druse crystals...... 232

4-25 Badiera alternifolia, at the type locality, eastern Cuba...... 233

4-26 Badiera fuertesii...... 234

4-27 Badiera jamaicensis...... 235

4-28 Badiera oblongata, variation in leaves...... 236

4-29 Badiera propinqua, western Cuba...... 237

4-30 Badiera virgata...... 238

4-31 Floral features...... 239

4-32 Alcoholized floral keels (lower petal), lateral view...... 240

4-33 View of various hairs and epidermal features (scanning electron micrographs)...... 241

4-34 Leaf venation, near mid-leaf, polarized light, 5x...... 242

4-35 Floral measurements for species of Badiera (diagrammatic, from B. subrhombifolia)...... 243

LIST OF OBJECTS

Object page

C-1 Cladograms Not Included.pdf (52 pdf pages; 128 printed pages)...... 282

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

PHYLOGENY OF THE POLYGALACEAE AND A REVISION OF BADIERA

J. Richard Abbott

December 2009

Chair: Walter Judd Major: Botany

Polygalaceae are a monophyletic assemblage of genera and species from all over the world, including almost all plant life forms, from annual herbs to lianas and trees. It is only recently that scientists have begun to resolve the patterns of relationship among genera in the family, and it is now clear that Polygala, as traditionally circumscribed, is

an artificial, polyphyletic assemblage. This dissertation addresses the phylogeny of

Polygalaceae, with an emphasis on the Polygaleae (Polygala and relatives), especially

those of North America. It also provides a revision of the clade here recognized as

Badiera, i.e., nine species of shrubs and small trees from the Caribbean region, one of

which is newly described as part of this research.

Badiera subrhombifolia is newly described from Hispaniola. This new species is a

near endemic to high montane forests of the “south island” of Hispaniola, i.e., the Massif

de la Hotte, Massif de la Selle, and Sierra de Bahoruco. A brief discussion of the

generic circumscription of Badiera is provided, as the genus has usually been

considered within a broadly circumscribed and clearly polyphyletic Polygala.

Forty-five species of North American Polygalaceae, representing 80% of the ca.

55 native species and all of the traditional subgenera, sections, and series in North

America, are phylogenetically analyzed, along with 134 extralimital taxa, using nrITS

and the plastid trnL intron and adjacent spacer trnL-F. These analyses increase the

number of Polygala species in published phylogenetic analyses nearly three-fold and of

North American taxa six-fold. The generic recognition of Chamaebuxus (DC.) Spach,

Hebecarpa (Chodat) J.R. Abbott, stat. nov., Hebeclada (Chodat) J.R. Abbott, stat. nov.,

and Rhinotropis (Blake) J.R. Abbott, stat. nov. is proposed, with the remaining North

American species maintained within a monophyletic Polygala, which also includes many

Old World species. These genera are all monophyletic, their recognition does not result

in the paraphyly of any other genera, they are morphologically diagnosable, and they

are all traditionally recognized taxa (as subgenera and sections). At least 10 separate

lineages of Polygalaceae occur in North America, nine of them most closely related to

other New World lineages.

Species of the genus Badiera share the putative morphological synapomorphies of reduced lateral sepals and thick-walled fruits that retain the seeds, which are bluish- black and associated with a fleshy orange aril, presumably involved in dispersal by

birds. Badiera represents the relatively recent diversification of a lineage endemic to the

Caribbean region. The species relationships and correct names within Badiera have

been poorly understood, necessitating this taxonomic revision.

CHAPTER 1 INTRODUCTION

Polygalaceae exhibit a tremendous diversity of habits, varying from achlorophyllous mycoparasites to canopy emergent trees, and they have a nearly cosmopolitan distribution, including several centers of diversity in the New World tropics. When I first chose to study Polygalaceae, the only phylogenetic analysis of the

family was that of Eriksen (1993a), which used morphology to suggest that traditional

Polygala s.l. was not monophyletic. John Wurdack, in a letter of response to my

expression of interest in working with the family, warned me that species of Polygala

were not each other's closest relatives. He noted that many of them are more different

from each other than are the differences between some of the genera within the tribe.

John suggested that one of the first things I should do was address generic limits

amongst Polygala and relatives. More than a decade later, I have finally followed

through on his advice. Part of what took so long was my desire to familiarize myself with

the subgroups of traditional Polygala s.l. as field entities, an expensive endeavor that

has been well worth the cost. My research and travels ultimately led to a three-parted

focus for my dissertation: 1) description of a new species of Badiera, 2) phylogenetic

analysis of the Polygaleae, and 3) revision of the genus Badiera.

Study of herbarium material, and subsequent field work, suggested that there was

quite likely an undescribed species of Badiera. After additional research, Badiera

subrhombifolia was newly described from Hispaniola. The species is most closely

related to B. fuertesii, and it also is superficially similar to B. penaea. Badiera

subrhombifolia lacks the long peduncle of the former species and the scabrous leaves of the latter; it is also often distinguishable by subrhomboid, triplinerved leaves. This

new species is a near endemic to high montane forests of the “south island” of

Hispaniola, i.e., the Massif de la Hotte, Massif de la Selle, and Sierra de Bahoruco.

Badiera was re-segregated out of the traditional, broadly circumscribed, and

clearly polyphyletic Polygala. One of the remaining issues, though, was to determine

which other subgroups might also merit elevation to genera. To that end, extensive field

work was conducted, with a primary focus being to sort out relationships amongst North

American species of Polygalaceae, within a global context, of course.

Forty-five species of North American Polygalaceae, representing 80% of the ca.

55 native species and all of the traditional subgenera, sections, and series in North

America, were phylogenetically analyzed, along with 134 extralimital taxa, using nrITS

and the plastid trnL intron and adjacent spacer trnL-F. These analyses increased the

number of Polygala species in published phylogenetic analyses nearly three-fold and of

North American taxa six-fold. Polygala is polyphyletic as traditionally circumscribed, obfuscating our understanding of the species, their relationships, morphology, ecology, and biogeography. The generic recognition of Chamaebuxus (DC.) Spach, Hebecarpa

(Chodat) J.R. Abbott, stat. nov., Hebeclada (Chodat) J.R. Abbott, stat. nov., and

Rhinotropis (Blake) J.R. Abbott, stat. nov. is proposed, with the remaining North

American species maintained within a monophyletic Polygala, which also includes many

Old World species. These genera are all monophyletic, their recognition does not result in the paraphyly of any other genera, they are morphologically diagnosable, and they are all traditionally recognized taxa (as subgenera and sections). At least 10 separate lineages of Polygalaceae occur in North America, nine of them most closely related to

other New World lineages. For instance, the Rhinotropis group from the southwestern

United States and adjacent Mexico is likely sister to the Phlebotaenia group from the

Caribbean region and the Hebecarpa group is well-supported as sister to Badiera.

In addition to the above-mentioned generic-level issues, the species relationships and correct names within Badiera have also been poorly understood, necessitating this taxonomic revision. For instance, Chodat (1891a) recognized three species in the

Badiera group, while Britton (1910) recognized six species at first with five additional species later recognized (Britton, 1915). Blake (1916) also recognized 11 species but without using all the same names as Britton (1915), and he only recognized ten species a few years later (Blake, 1924). The most recent treatment (Bernardi, 2000) only recognized six species, synonymizing entities that earlier workers had treated as distinct. Thus, there is no resolution as to how many species should be recognized, let alone how to circumscribe them or what their correct names should be. This revision aims to resolve confusion with respect to Badiera.

Badiera is a group of nine species of shrubs to slender, small trees found in the

Caribbean region. The group is strongly supported as monophyletic and is characterized by a mixture of plesiomorphies, e.g., woody habit and flowers with the keel petal lacking a crest, and putative autapomorphies, i.e, reduced lateral sepals

(wings) and thick-walled fruits, which retain the bluish-black seeds, that are associated with a fleshy orange aril. Detailed field and herbarium observations of morphological characters are the basis of this taxonomic treatment, which also includes a DNA-based phylogenetic analysis. Species of Badiera appear to be relatively recent in origin, with little variation in DNA sequence between them, and they are fairly similar morphologically, showing overlap in most phenotypic features. Six of the species are

supported as monophyletic, while the lack of reciprocal monophyly among the other three species likely reflects polymorphisms, due either to incomplete lineage sorting, differential retention of ancestral genotypes, or, possibly, hybridization. Nonetheless, the nine entities recognized here are all morphologically cohesive and diagnosable.

CHAPTER 2 BADIERA SUBRHOMBIFOLIA (POLYGALACEAE), A NEW SPECIES FROM HISPANIOLA, WITH A DISCUSSION OF GENERIC CIRCUMSCRIPTION

The milkwort family, Polygalaceae Hoffmanns. and Link, has been the focus of a few phylogenetic analyses in recent years (Eriksen, 1993; Paiva, 1998; Persson, 2001;

Forest et al., 2007) and of my ongoing dissertation work. One strongly supported result in all analyses is the polyphyly of Polygala L., as traditionally circumscribed. Even

before the incorporation of the phylogenetic approach into botanical systematics, the

artificiality of Polygala was well-known, although traditional solutions, such as

Nieuwland’s (1914) proposed segregate genera, were often just as artificial, in large

part due to a limited geographic focus and lack of phylogenetic perspective, which

includes an emphasis on distinguishing synapomorphies from autapomorphies and

plesiomorphies (Balkwill and Balkwill, 1996; Schrire and Lewis, 1996).

As pointed out by Wendt (2005), there is not yet a modern consensus on the

infrageneric classification of Polygala; neither is there an accepted generic classification

within Polygaleae Chodat. It is quite clear, however, that many clades can no longer be retained in Polygala, because to do so would be to maintain a polyphyletic, artificial assemblage. For example, the Old World genus Heterosamara Kuntze has recently been re-established (Paiva 1998) and expanded (Castro et al., 2007). Yet other historically recognized genera such as the New World Acanthocladus Klotzsch, Badiera

DC., and Phlebotaenia Griseb., which have been included within Polygala in recent decades following workers such as Blake (1916, 1924) and Paiva (1998), have not been formally re-established in a phylogenetic context, despite having support as clades distinct from the core group of Polygala (i.e., the clade containing the type). In addition, there are other clades that have never been formally recognized at the generic level

(e.g., Polygala sect. Hebecarpa Chodat) which are now known to be distinct lineages

(Persson, 2001; Forest et al., 2007).

Notable exceptions to modern usage of a broadly circumscribed Polygala are the

Flora of Cuba (Rankin R., 2003), in which Badiera and Phlebotaenia were recognized as genera, and the Flora of Ecuador (Eriksen et al., 2000), in which Acanthocladus and

Badiera were recognized, although the latter was in an expanded sense, including the

Andean species Polygala caracasana Kunth and, by extension, all of sect. Hebecarpa

Chodat. The only explanation given was a statement that unpublished phylogenetic studies by C. Persson showed that Badiera and sect. Hebecarpa formed a monophyletic group separate from the clade containing the type species of Polygala. I note that this generic recircumscription was made without morphological or revisionary study of these species. Eriksen and Persson (2007) continued to recognize

Acanthocladus and an expanded Badiera. Presumably the unpublished Persson data mentioned in the Eriksen et al. (2000) treatment were those published by Persson

(2001), in which case an alternative morphological and biogeographical interpretation is better supported by the data, i.e., recognition of Badiera and Hebecarpa as sister taxa.

When Chodat (1893) circumscribed sect. Hebecarpa, he included Badiera as a subsection, although no subsequent workers have included it within sect. Hebecarpa.

Blake (1916) and Paiva (1998) recognized subgen. Hebecarpa (Chodat) Blake, excluding Badiera. For convenience and to avoid nomenclatural confusion resulting from different authors’ treatments of the species in sect. Hebecarpa vs. subgen.

Hebecarpa, ‘Hebecarpa group’ will be used here, as I am referring to a taxonomic group without addressing its status as a nomenclatural entity. Neither of the two other

published phylogenetic analyses that have explicitly addressed the placement of the

Hebecarpa group and Badiera (Paiva, 1998; Forest et al., 2007) has supported them, together, as a clade, although the Hebecarpa group and Badiera are each strongly supported as monophyletic. Persson’s (2001) analysis resulted in a good preliminary hypothesis of relationships, many of which have been supported by other analyses, but given his lack of discussion of these clades, the lack of any known morphological synapomorphies for the putative Badiera + Hebecarpa clade, and the fact that the study

was based on a single plastid data set with missing data and limited taxon sampling, I

suggest that lumping the Hebecarpa group and Badiera within a single genus may have

been premature.

Rank is admittedly arbitrary, and if the Hebecarpa group were supported as

phylogenetically nested within Polygala, then I would not try to argue that its features

were somehow worthy of generic status. However, since Polygala is polyphyletic and

generic recircumscription is needed, I suggest that, when possible, genera should be

seen as discrete, morphologically diagnosable groups, as well as clades, increasing

their utility as practical field units. Since the analyses of Paiva (1998) and Forest et al.

(2007) do not support a Badiera + Hebecarpa clade, and there are no clear unifying

morphological features, whereas both analyses (in agreement with Persson (2001) and

the analyses presented in Chapter 3) do support them as separate clades that are each

distinctive morphologically and biogeographically, I believe that treating them as

separate genera results in more meaningful and robust groupings.

The morphological similarities between the Hebecarpa group and Badiera, such as

the lack of a beak or crest on the keel petal, are plesiomorphies. Although the

relationships within the Polygaleae are not yet completely understood (and are currently

being investigated by the first author), it is clear that the species of Badiera constitute a

well-supported clade that is ecologically and morphologically distinct from the

Hebecarpa group. The species of Badiera are shrubs 2 m or more tall (rarely flowering

when smaller), with green, reduced lateral sepals and coriaceous, thick-walled fruits

with persistent seeds and bright orange-red arils (presumably bird-dispersed). They are

all endemic to the Caribbean islands, except for a single species that occurs disjunctly

between Jamaica and the Yucatan to northeastern Guatemala. Species of the

Hebecarpa group are easily distinguished from Badiera as they are herbs, often suffrutescent, less than 1 m tall, with petaloid, expanded lateral sepals and thin-walled fruits with readily-falling presumably ant-dispersed seeds. Most species of the

Hebecarpa group are not Caribbean; they range from the southwestern United States to

South America, with the greatest diversity of species found in Mexico.

Palynological and preliminary anatomical data also support the distinctiveness of

Badiera vs. the Hebecarpa group. Banks et al. (2008) reported that Badiera fuertesii

Urban, B. diversifolia DC. (an invalid name for Polygala jamaicensis Chodat, which has

not yet been formally transferred into Badiera), and B. oblongata Britton have 8-10 colpi,

while B. penaea DC. has 8-9 colpi. I have seen 8(-9) colpi in B. oblongata and the new

species described here (B. subrhombifolia). So, it seems that the pollen grains of

Badiera s.str. have 8(-10) colpi, which is likely plesiomorphic since Acanthocladus

(Polygala klotzschii Chodat) was reported to have 8-10 colpi and Bredemeyera lucida

(Benth.) Klotzsch ex Hassk. has 10-11 colpi. The Hebecarpa group is represented in the

Banks et al. (2008) study by Polygala caracasana Kunth (as Badiera caracasana

(Kunth) C.H. Perss.) with 17-18 colpi and P. obscura Benth. with 18-22 colpi. The more

distant Hebeclada group is represented by P. hebeclada DC. with 11-13 colpi and P.

acuminata Willd. (as Badiera acuminata DC.) with 12-13 colpi. Thus, even when looking

at just the number of colpi, there are fixed pollen differences between Badiera (8-10

colpi) and the Hebecarpa group (17-22 colpi). Preliminary anatomical work by the first

author has found all species of Badiera to have dorsiventral leaves (palisade mesophyll

adaxial only and stomata restricted to the abaxial surface) and all three investigated

species of the Hebecarpa group (Polygala barbeyana Chodat, P. macradenia A. Gray,

and P. obscura Benth.) to have isobilateral leaves (palisade mesophyll and stomata

both ad- and abaxially), along with other anatomical differences, which are under

investigation, such as druses: abundant throughout leaves of Badiera and lacking to

very sparse in leaves of the studied species of the Hebecarpa group.

Putative morphological synapomorphies for Badiera are the reduced lateral sepals

and the coriaceous, thick-walled fruits with persistent bird-dispersed seeds. Generic

recognition of the Badiera clade in a restricted sense, i.e., excluding the Hebecarpa

group, provides both a robust classification that reflects phylogeny and a generic

circumscription that is not only monophyletic but also morphologically diagnosable. A

much more detailed presentation of phylogenetic relationships in the Polygaleae,

including phylogenetic placement of Badiera and its separation from the Hebecarpa group clade, will be presented in Chapter 3.

While studying herbarium material in conjunction with a revision of Badiera, a few

anomalous collections were encountered that -- when combined with subsequent field

work -- led to the discovery of a hitherto undescribed species. Specimens of this

species had been identified or annotated as one of the other Hispaniolan taxa, B.

fuertesii Urb. or B. penaea L., although several were also labeled only to the generic

level or noted as a possible new species, reflecting an awareness of the distinctiveness

of this taxon on the part of some workers, including W.S. Judd, who collected this taxon

25 years ago in Haiti. Two collections from Haiti, both by E. Ekman, were identified by

Chodat as B. ligustrina (H10398) and B. buxifolia (H7656), but neither of those names

was ever validly published. Based on specimens of other species annotated with those

same names, it is clear that they were artificial constructs with no biological connection

to this new species. Careful morphological and molecular studies have indicated that

these plants represent an undescribed species of Badiera (see below). Therefore, these

distinctive populations are described here and compared with their hypothesized closest

relative as well as with a phenetically similar species, providing a treatment of all the

Badiera species known from Hispaniola.

In the following description, the measurements of both vegetative and

inflorescence features are based on dried material. The flowers were rehydrated for

ease of manipulation, and thus recorded measurements of floral parts are based on

rehydrated material, which yields slightly larger measurements than those for dried

flower parts. Information on habit and color of various reproductive parts are based on field observations and/or specimen labels. I have based measurements on leaves that

are fully expanded, avoiding leaves at the apex of shoots if they are smaller than nearby

leaves. Internode length was measured near the expanded inflorescences (or near the

midstem on vegetative specimens). Leaf pubescence density was measured by counting the number of hairs along a linear millimeter of blade tissue perpendicular to

the midvein near mid-leaf. Flowers were measured post-anthesis, with anthesis defined

as flowers with spreading upper petals and dehisced anthers. Dense hairs at the apex

of the filament sheath made it very difficult to ascertain the exact point of distinction between the filament sheath and the free filaments, so length measurements were based only on the portion of the free filaments not obscured by hairs. Only one fruiting collection is known, i.e., Hilaire 2442, from Haiti, and most of its fruits are immature, so only two nearly mature seeds are available for measurement. Many of the fruits on this

specimen have only a single seed, and several are irregularly angled with bluntly

triangular seeds; the latter condition has not been observed in other species. However,

it is not clear if the apparently aberrant fruits and seeds are pathological, teratological,

or characteristic for this species.

Description of New Species

Badiera subrhombifolia J.R. Abbott, sp. nov. TYPE: Haiti. Dept. Sud: Massif de la Hotte, Jeremie, on the ridge between Lopineau and Morne Pain-de-Sucre, ca. 1100 m, 22 July 1928 (fl), E.L. Ekman 10398 (holotype: S; isotypes: IJ, K, NY). (Figs. 2-1, 2-2)

Omnibus speciebus Baderiae similis, frutice vel arbore parva, sempervirenti,

inermi, foliis coriaceis alterneis integreis exstipulateis, flores parvuli vix 5 mm, alae

(sepala interna) redactae sepalis externis parum brevioribus, carinae florales sine cristis, capsulae biloculares loculis unovulatis, semina arillata. Haec species nova a B. penaea DC. foliis laevibus (non scabrosis) et a B. fuertesii Urb. pedunculis brevioribus et ab ambabus foliis plerumque subrhombiformibus et/vel subtriplinerbivus differt.

Evergreen shrubs to ca. 7 m tall, taprooted, at least when young, the roots with methyl salicylate, with one or a few trunks at ground level, sometimes reaching a

diameter of ca. 1 dm although usually much less, proximally branched and usually also

much-branched above, with several main stems at breast height, typically less than 3(-

5) cm dbh, the main stems erect with arching, spreading branchlets; wood very hard;

bark pale brown to gray, fairly smooth except for numerous small fissures and lenticels; stems ca. 0.7 mm wide near second node from base on young lateral branches, 1-1.2 mm wide below the uppermost expanded inflorescence on the main stem, 1.7-2.3 mm wide near midpoint of main branch; internodes 3.7-9.2 mm long; young stems compressed, irregularly angled, terete with age; densely pubescent, the hairs concolorous with the brownish stem, to white or yellow; older stems glabrate.

Indumentum of simple, unicellular hairs, dense to sparse on nearly all parts, at least when young, generally in patches or zones on floral parts, mostly less than 0.1 mm long, antrorsely appressed to slightly spreading, tapering in the upper fourth to an acute apex, the surface with minute irregular bumps and small ridges (verrucae), infrequently

0.2-0.3 mm long, e.g., on the upper filament sheath, and then also slightly kinked or twisted. Leaves alternate, mostly distichous, exstipulate, simple, entire, coriaceous, isomorphic or sometimes dimorphic in shape and size on the same branch, nyctinastic, folding downward in the evening and, sometimes, on overcast days so that the abaxial surfaces on opposite sides of the stem touch, i.e., the plane of the leaves changes from horizontal to vertical; petiole 1.4-3 mm long, ca. 0.8 mm wide, often with very slight decurrent ridges from blade base along entire length, or such ridges restricted to an apical zone ca. 0.3 mm long, densely to moderately pubescent (to glabrate, in part), hairs less than 0.1 mm long, appressed upward to slightly spreading; blade elliptic to somewhat oblong, slightly obovate, slightly ovate, or rarely ovate and tapering for the upper 1/2-2/3 of the leaf, often rhomboidal and somewhat asymmetric with a slightly

different distance to the widest part on each side, 11-24 mm long, 10-15 mm wide, 7-10

mm from apex to widest point, usually flat to slightly abaxially cupped, shiny, wrinkled

(on drying), coriaceous, the apex acute, sometimes abruptly apiculate (with apiculus 1-

1.5 mm long), the base acute (margin forming an angle of ca. 40° with midvein at

junction with petiole); margin slightly revolute, inrolled portion 0.2-0.3 mm wide basally

and medially, to ca. 0.1 mm or plane apically, sparsely pubescent on both surfaces, the

hairs less than 0.1 mm long, appressed toward apex or margin, with 2-3(-4) hairs per

linear mm of blade tissue, hairs sometimes blackish on abaxial surface of lamina and

appearing as dark punctations to the naked eye, although the punctations primarily

result from a dark, shallow pit at the base of each hair; venation pinnate,

brochidodromous, the midvein visible to apex (at least abaxially), with sparse appressed

to slightly spreading hairs, usually with a prominent lateral secondary vein from the base on each side of the midvein (i.e., triplinerved) and 1-3 additional secondary veins per

side that are generally relatively obvious when fresh, very slightly sunken above and raised below, not visible adaxially when dried, inconspicuous abaxially on most leaves,

alternate near base of leaf to often opposite apically, when visible slightly raised to flush with the blade, darker than the blade, poorly branched and the loops not obvious on most leaves, the secondary-to-midvein angles 40-50°, the basal ones sometimes as shallow as 30°, the first non-basal secondary vein 3.4-5.5 mm from the base, 15-16.5 mm long. Inflorescences indeterminate, axillary racemes, although often reduced and fasciculate, at several consecutive nodes, usually several nodes from the apex of the main stem, although sometimes with tiny inflorescence buds in many or all of the upper nodes, and on many or all of the upper nodes of lateral branches, with 1 to ca. 12

flowers per inflorescence, but usually only 1 or 2 open at any one time, 5-9 mm long, 6-

9 mm wide; peduncles (0.3-)1.1-1.6(-2.8) mm long, with hairs dense, brown to yellowish

brown or white, up to ca. 0.1 mm long, appressed to slightly spreading; with 2 small

bracteoles (prophylls) subtending the peduncle, these persistent from bud, densely

hairy, often darker than nearby tissues, narrowly triangular, acute apically, 0.7-1.2 mm long, 0.3-0.4 mm wide, shriveling and curling adaxially with age; a bract and 2 adjacent bracteoles at base of each pedicel, these triangular, blunt to acute apically, 0.4-0.6 mm long, 0.4-0.5 mm wide, with hairs dense (sometimes sparse with age). Flowers complete, structurally perfect (but some flowers appear to be functionally imperfect with misshapen anthers and non-viable pollen; if there are flowers that are functionally staminate, the carpellode is not obviously different from a functional carpel), strongly zygomorphic, 3-4.5 mm long (excluding pedicels); pedicels 1.5-2.2 mm long, densely to moderately pubescent, the hairs appressed upward, often conspicuously white, less than 0.1 mm long. Sepals 5, free, herbaceous, tardily deciduous (falling in young fruit, after the corolla, although the upper sepal is rarely persistent), ovate, green (when fresh), usually widest just above the rounded, slightly narrowed base, rounded to bluntly acute apically; the outer sepals (1 upper and 2 lower) subequal, 1-1.8 mm long, 0.8-1.1 mm wide, sparsely pubescent on both sides, the hairs most common near the midvein, especially near the apex, marginally ciliolate to ciliate; the 2 inner, lateral sepals (wings) ca. 1/3 longer than the outer sepals and much smaller than the petals, 1.4-2.4 mm long,

1.1-1.5 mm wide, the margin ciliate with hairs sometimes longer than on the outer sepals, often denser on the lower edge. Petals 3, herbaceous, the 2 upper petals and the lower keel petal free from each other but basally fused to the filament sheath, so the

corolla falling as a unit with the androecium shortly after fertilization; upper petals

lingulate to narrowly ovate or oblong-elliptic, slightly shorter than or nearly equaling the

keel, 2.1-3.8 mm long, 0.6-1.3 mm wide, usually with the width nearly constant over

most of the petal’s length, although often not appearing so due to the tapered apex and apparent constriction near the middle, i.e., the narrowing in the middle of the upper petals usually results from the cupped, inrolled margins, and the petal being incurved in this region, but sometimes the middle portion actually 0.1-0.2 mm narrower than the

parts above and below, the bases curved around the gynoecium, filament sheath, and

keel base, fused to the lateral base of the filament sheath, with the fused portion varying

in depth (very shallow near the base of the upper corner, angling to ca. 1/3 the total

length along the lower edge), the bases of the upper petals effectively capping the basal

portion of the upper edge of the filament sheath, the apical portion of the upper petals

often cupped and marginally inrolled, at anthesis curving out (toward the base of the

flower), tapering fairly abruptly to a bluntly acute apex, the margins inrolled, subentire to

minutely erose, ciliate, the upper petals basally green, apically white to yellow or

yellowish green, densely pubescent adaxially, with ± spreading to erect hairs 0.1-0.2

mm long, nearly glabrous at the apex, abaxially sparsely pubescent with ± appressed

hairs less than 0.1 mm long; keel petal conduplicate, i.e., longitudinally folded medially,

with the halves folded upward around the androecium and gynoecium, bluntly wedge-

shaped, widest near the blunt apex, without a beak or crest, 2.6-4.2 mm long, 1.2-2 mm wide, and up to 1 mm across, especially at full anthesis when the lateral pouches flare out, green basally, white or yellowish-green along the upper margins, at least with age; the keel with three non-discrete zones, the laterally compressed apex, often white or

yellowish-green, the medial region with poorly developed lateral “pouches” or folds, i.e.,

apically undulate, expanded projections, and the reduced, narrow, semi-tubular basal

region; the pubescence varies from dense lateral patches of appressed hairs ca. 0.1

mm long to fairly sparse or even glabrous on portions of the surface abaxially, spreading hairs 0.1-0.2 mm long occur near the base and also adaxially in the upper

apical fold; the basal portion of the keel fused to the lower filament sheath for 0.4-0.7

mm, sometimes with the zone of adnation fairly loose in parts, the upper margin

subentire to minutely erose with minute irregular lobes near the apex, undulate, the

basal margin ciliate. Stamens 8, 2.2-3.9 mm long; filaments fused into an adaxially-split,

strongly laterally compressed sheath around the gynoecium, the filament sheath 1.5-3.2

mm long, 0.6-1.3 mm tall near the base (flaring at the very base to ca. 1.8 mm), 0.4-0.6

mm tall near the apex, the free apical portion of each filament 0.2-0.8 mm long, 0.05-

0.15 mm wide, the outermost, i.e., lowest, earliest diverging, filaments tend to be longer

and wider, the adaxial upper filament sheath and free filaments densely covered in

spreading, ± wrinkled, mostly strongly compressed (flattened) to subterete hairs (rarely

with only a few scattered short hairs in association with apparently non-functional

anthers), 0.2-0.3 mm long, adaxially glabrous near the base, abaxially hairy in patches

near the base and along the margins to ± glabrous elsewhere; the anthers

bisporangiate, apparently unithecate from developmental suppression of the ventral

sporangia, 0.35-0.9 mm long, 0.1-0.3 mm wide, each anther opening by an apical pore,

the open pore up to ca. 0.3 mm across; rarely with 2 adjacent anthers semi-fused, i.e.,

sharing a common filament and appearing as a 2-lobed anther. Pollen polycolporate,

with 8(-9) apertures. Gynoecium 2-2.5 mm long in flower; stipe 0.15-0.3 mm long, 0.1

mm wide; nectar disk small, at base of stipe; ovary bicarpellate and bilocular, laterally

compressed (one carpel adaxial, the other abaxial), flattened-ellipsoid, ca. 0.6-0.9 mm

long, 0.5-0.6 mm wide (perpendicular to central axis), pubescent along upper and lower margins with appressed to ascending hairs less than 0.1 mm long (sometimes nearly glabrous), these largely deciduous in fruit; placentation axile, with a single ovule per carpel, attached apically along the central axis by a relatively stout funiculus; style 1, apically curved, 1.2-1.5 mm long, 0.15-0.3 mm wide, ca. 0.7-0.9 mm from apex of the ovary to where upward curvature begins, the style curvature to ca. 0.65-1 mm deep, and style positioned well below the anthers at anthesis to slightly surpassing them

(especially in flowers with apparently non-functional stamens), elongating so that the stigmas are eventually held subequal to slightly surpassing the anthers, to 2-3 times as long as the ovary, deciduous in fruit; stigmas 2, depressed capitate, the abaxial one

(associated with the lower carpel) apical (as a result of style curvature), the adaxial one subapical and slightly smaller, the stigmatic regions very closely spaced, ca. 0.1 mm high. Infructescences with only 1-2 fruits each; prophylls, bracts, bracteoles, and pubescence of peduncle and pedicels persistent in fruit, the upper sepal rarely also persistent; fruiting peduncles 0.3-1.4 mm long, most infructescences nearly sessile.

Fruits laterally flattened capsules, obcordate, obdeltoid, to quadrate, somewhat coriaceous, the valves dehiscing toward the central axis, often with one locule aborted, i.e., underdeveloped and with no seed, and then with a lopsided oblong shape, 13-16 mm long (including stipe), with an apical sinus between the carpels, the sinus depth 0.2-

0.3 mm, but many fruits with a blunt triangular projection at the mid- apex so that the sinus is elevated up to ca. 1 mm above tops of the lobes, the base with a triangular

flange of tissue up to ca. 1 mm long, the fruit margin not conspicuously winged, but once fruit splits, a winged flange, 0.5-0.9 mm wide, evident outside the suture zone, the epidermis nearly glabrous, sometimes with a few scattered minute appressed hairs, especially on the stipe or along fruit margin, the hairs most common and obvious along the open suture; stipe 1.6-2.7 mm long, 0.5-0.6 mm wide at midpoint; capsule body 7.5-

11 mm long, 8.5-12 mm wide, taller than wide when one-seeded, mostly wider than tall when two-seeded (although sometimes nearly isodiametric), the long axis of the ovary lobes mostly angled outward, up to about 1 mm longer than the capsule length; fruiting pedicel 2.5-3 mm long, 0.6-0.7 mm wide, the floral receptacle persisting as a swollen, knobby area, paler than pedicel and stipe, 0.5-0.8 mm long. Seeds typically oblong- ellipsoid (rarely, and presumably aberrantly, bluntly triangular), laterally compressed, bluish-black at maturity, glabrous, 6-6.5 mm long, 4-4.6 mm wide, 1-1.5 mm thick, bluntly rounded at the chalazal end, acute at the funicular end and covered by a fleshy orange aril; aril glabrous with 2 main lobes, one on each side of the seed, each lobe with smaller, irregular lobes, 2.5-3 mm tall near funiculus to 1.5 mm tall distally, 4.2-5 mm wide (narrower apically above the funiculus), the lower margin with 2-3 shallow lobes (fitting into grooves of the indented scar at apex of seed), the exposed funiculus

0.5 mm long, the seed persistent in fruit (presumably bird dispersed); germination from a very thin walled section at the funicular end; seed coat relatively thin, embryo straight, endosperm lacking at maturity, hypocotyl and radicle poorly differentiated, cotyledons ovate, fleshy, nearly flat with the margins cupped, overlapping, and tightly adherent around the embryonic first leaves.

Distribution and Habitat

Badiera subrhombifolia is a near endemic to high montane areas of Hispaniola

(Haiti and the Dominican Republic) (Fig. 2-3). It is known from four disjunct regions: the

Massif de la Hotte (6 collections) and Massif de la Selle (1 collection), both in Haiti, the

north side of the Sierra de Bahoruco (4 collections) and the southern edge of the

Cordillera Central (1 collection), both in the Dominican Republic. The first three of these are part of the “south island” of Hispaniola. The Cordillera Central locality was last collected in 1980, the Sierra de Bahoruco locality was re-collected in 2006 and is in the

Sierra de Bahoruco National Park, and the Massif de la Hotte locality, also last collected in 2006, is at least partially within the U.N. Macaya Biosphere reserve (Judd et al.,

1998). Thus, the populations of B. subrhombifolia appear to be in good condition at this time, even if restricted to isolated high montane regions. There appears to be an

elevational cline from west to east: ca. 960-1200 m in the Massif de la Hotte, ca. 1300 m in the Massif de la Selle, 1670-1875 m in the Sierra de Bahoruco, and 1500-1600 m

in the southern edge of the Cordillera Central, although it is not clear what underlying

environmental or climatic factors, if any, might be involved. The species fairly

consistently occurs in broad-leaf forests, often in pockets of such forest surrounded by

more arid regions or pine forests, and often in disturbed or degraded thickets, indicating

that Badiera subrhombifolia may be somewhat tolerant of environmental disturbance.

Associated species in the broad-leaved forest at the Caseta #2 de Foresta locality

(Sierra de Bahoruco National Forest) include Arthrostylidium sp., Asplenium sp.,

Bocconia frutescens L., Cestrum sp., Daphnopsis crassifolia Meisn., Fuchsia triphylla

L., Garrya fadyena Hook., Ilex sp., Jacaranda sp., Meliosma impressa Krug. and Urb.,

Metastelma sp., Miconia lanceolata DC., Myrsine coriacea (Sw.) R. Br., Oreopanax

capitatus Decne. and Planch., Passiflora sp., Peperomia spp., Pilea spp., Prunus myrtifolia (L.) Urb., Rajania sp., Selaginella sp., Solanum sp., Tillandsia sp., Tragia volubilis L., Turpinia picardae Urb., and Zanthoxylum spinifex DC. I observed ca. 20 shrubs scattered in the area (see Abbott 20914). Associated species of the Massif de la

Hotte localities, all from moist broadleaved forests (to disturbed thickets), usually on

limestone, include Alchornea latifolia Sw., Allophylus rigidus Sw., Banara splendens

Urb., Beilschmiedia pendula (Sw.) Hemsl., Besleria lutea L., Bocconia frutescens L.,

Calycogonium torbecianum Urb. and Ekman, Cestrum bicolor Urb., Chrysophyllum

argenteum Jacq., Citharexylum caudatum L., Coccoloba costata C. Wright,

Dendropanax arboreus (L.) Decne. and Planch., Didmyopanax tremulum Krug and Urb.,

Sideroxylon cubense (Griseb.) T.D. Penn., Eupatorium spp., Gyrotaenia myriocarpa

Griseb., Hamelia patens Jacq., Hieronyma domingensis Urb., Lunania mauritii Urb.,

Mecranium revolutum Skean and Judd, Meliosma recurvata Urb., Miconia

subcompressa Urb., Micropholis polita (Griseb.) Pierre, Myrsine coriacea (Sw.) R. Br.,

Palicourea alpina DC., Persea anomala Britton and P. Wilson, Phyllanthus myriophyllus

Urb., Piper spp., Prunus myrtifolia (L.) Urb., P. occidentalis Sw., Rhytidophyllum bicolor

Urb., Sagraea setulosa (Urb.) Alain, Senecio stenodon Urb., Solanum spp., Tabebuia

berteroi Britton, T. conferta Urb., Trichilia havanensis Jacq., Turpina picardae Urb.,

Vernonia saepium Ekman, Weinmannia pinnata L., and Zanthoxylum spp. (see also

Judd and Skean, 1987; Judd et al., 1990, 1998).

Phenology

Flowering material has been collected in February and from June to September in

both Haiti and the Dominican Republic. The only fruiting specimens also have flowers

and were collected in February (Hilaire 2442, Haiti). Three other collections were made

in February, two have flowers and one is vegetative, so no clear phenological pattern is

evident. Given the nature of the seeds, the most likely dispersers are birds such as

flycatchers, thrushes, or migratory warblers (Doug Levey, pers. comm.). Peak fruiting

during winter months, if confirmed, could support the idea of migratory birds being the

primary dispersers.

Additional Specimens Examined

DOMINICAN REPUBLIC. AZUA PROV.: Cañada Miguel Martín, between Sabana de

Miguel Martín and Sabana de San Juan, [N of Azua], 1500-1600 m, 18°39'N 70°43'W,

18 Sep 1980 (fl), M. Mejía 8247, with T. Zanoni (FTG, IJ). INDEPENDENCIA PROV. [all on the northern edge of the Sierra de Bahoruco]: Pueblo Viejo, above Puerto Escondido,

1850 m, 19 Feb 1969 (fl), A. Liogier 14071 (NY, US); 30.5 km S of Puerto Escondido on the road to Aceitillar, 3.9 km S of Caseta #2 de Foresta, 1875 m, 18°14'N 71°30'W, 17

Mar 1985 (fl), T. Zanoni 33765, with M. Mejía, J. Pimentel, R. García (JBSD); N of Cabo

Rojo on old Alcoa road to Aceitillar, then N on Sendero Bahoruco (jeep trail to Puerto

Escondido), ca. 300 m SSW of Caseta #2, 1670 m, 18°12'22.2"N 71°32'3.5"W (WGS 84 map datum), 3 Jun 2006 (fl), J.R. Abbott 20914, with W.S. Judd, J.D. Skean, R.E. Judd

(DUKE, F, GA, GH, FLAS, JBSD, MICH, MO, NY, S, US, other duplicates to be distributed); Monte Jo, 26 km S of Puerto Escondido, S of Caseta #2 de Foresta, 1800

m, 18°12'23"N 71°32'2"W, 28 July 2006 (fl), T. Clase 4305, with B. Peguero, S. Marten

(FLAS, JBSD).

HAITI. DEPARTMENT DU OUEST: Massif de la Selle, Croix-des-Bouquets, Badeau,

slope towards Camp-Franc, ca. 1300 m, 22 Feb 1927 (fl), E.L. Ekman H7656 (A, F, S);

DEPARTMENT DU SUD [all from Massif de la Hotte]: Parc National Pic Macaya, Bwa

Formon, in vicinity of Ville Formon, S of Morne Formon, 960-1010 m, 2 Feb 1984 (fl),

W.S. Judd 4006 (EHH, FLAS, GH); Parc National Pic Macaya, Bwa Formon--Bwa

Deron, south of Morne Formon, 1130-1150 m, 10 Jun 1993 (veg), W.S. Judd 6924, with

J.D. Skean, Jr. (EHH, FLAS); Macaya Biosphere Reserve, Bwa Deron (Bois Durand), S

of Morne Formon, ca. 0.5 km W of Tila Robert's house, 1000-1100 m, 26 Jul 1989 (fl),

J.D. Skean 2419, with C. McMullen (FLAS); Macaya Biosphere Reserve, Bwa Deron,

1100-1200 m, 9 Aug 1989 (fl), J.D. Skean 2500, with C. McMullen (FLAS); W of Kay

Michel, 1120 m, 18°19'51"N 74°1'46.4"W, 3 Feb 2006 (fl, fr), J.V. Hilaire 2442, with B.

Peguero, T. Clase, R. Bastardo, E. Fernández (FLAS, JBSD).

Badiera subrhombifolia is most closely related to B. fuertesii and B. alternifolia, all

of which constitute a clade in phylogenetic analysis of DNA sequences (Chapter 4), but

the species is also superficially similar to B. penaea. Badiera subrhombifolia lacks the

long peduncle of B. fuertesii, the cuticular leaf pits of B. alternifolia, and the scabrous

leaves of B. penaea. It is also often distinguishable from all three by its subrhomboid, triplinerved leaves. The leaves of B. subrhombifolia are highly variable and some do look very much like B. fuertesii or B. penaea, but, typically, they are more elliptic to oblong and with a sharper apex than is normally found in B. penaea, which tends to narrow cuneately at the base and have a bluntly rounded apex, while B. fuertesii leaves,

which tend to have more conspicuous venation than either of the other species (except for some putative shade forms of B. penaea), tend to be broader, more ovate, and more symmetric, lacking the sharper angles of the leaves of B. subrhombifolia. I believe that

B. subrhombifolia represents a distinct evolutionary lineage (e.g., de Queiroz, 2007)

because it is morphologically diagnosable and phenetically distinct from B. alternifolia,

B. fuertesii, and B. penaea.

Preliminary phylogenetic analyses of DNA sequence data suggest that Badiera

subrhombifolia is not a cladospecies (Fig. 4-1). However, morphology suggests that B.

subrhombifolia likely satisfies the apomorphy species concept (Donoghue, 1985; Judd

et al., 2007; Mishler and Theirot, 2000). It is evident that B. subrhombifolia also satisfies the morphological-phenetic species concept, as a morphologically cohesive entity separated from others by consistent morphological gaps (Judd, 2007), and the diagnostic species concept (Wheeler and Platnick, 2000) – as evidenced in the diagnostic key below. It is not known whether there are any intrinsic isolating mechanisms between B. fuertesii and B. subrhombifolia, although an investigation of the variation in floral form in these two species suggests that there are no differences. It is possible that these species evolved as geographical isolates, as their ranges are largely allopatric. Ecologically, as well, there are no clear patterns indicative of isolating mechanisms, but as there are no known localities where the two species occur together, perhaps there are subtle differences in environmental preferences that differentiate them. Whatever the mechanism, B. subrhombifolia and B. fuertesii appear to be reproductively isolated, thus satisfying the biological species concept (de Queiroz,

2007). Badiera alternifolia is isolated geographically from both B. fuertesii and B.

subrhombifolia.

Badiera penaea has the putative autapomorphy of spreading hairs (causing

scabrosity) on the leaves, while B. fuertesii has the putative autapomorphies of an elongate peduncle and caducous bracts. Putative synapomorphies for B. subrhombifolia

may be the subrhomboidal, subtriplinerved leaves, but B. subrhombifolia could also be

thought of as being characterized by putative plesiomorphies, i.e., the absence of the

distinctive features of the other two species, because these leaf features are not entirely

fixed, with many leaves lacking one or both features, and the leaves are actually quite

variable across this species. Preliminary anatomical studies suggest that a combination

of subtle leaf differences might be diagnostic for most species of Badiera, perhaps

providing apomorphic features (Chapter 4). More work is needed to assess variation

across populations, but potentially useful characters include palisade and spongy

mesophyll composition, epidermal cell shape, cuticular pits and epidermal depressions

associated with hairs, and the shape of the blade near the midvein and near the

margins.

Some of the variation in the leaves of B. subrhombifolia appears to be correlated

with populational differences. The Massif de la Selle collection (Ekman H7056) has the

smallest leaves and the highest percentage of suborbicular leaves. The Azua collection

(Mejía 8247) has the most B. penaea-like leaves, although most of them are apically acute to apiculate (relatively rare, but not unknown, conditions in B. penaea) and the

leaf bases are not as cuneately narrowed as typical in B. penaea. Most importantly,

none of the leaves of the Azua collection have the hairs of B. penaea, and while some

peduncles of this collection are as long as 2.8 mm (getting into the infrequent low end of

the range for B. fuertesii), others are less than 1.5 mm on the same specimen. The

Sierra de Bahoruco and Massif de la Hotte populations show certain vegetative

similarities to B. fuertesii that are not seen in the Azua collection or the Massif de la

Selle collection, although they lack the conspicuous venation and the long peduncles of

B. fuertesii. However, by using leaf scabrosity and peduncle length as the most diagnostic reference characters, all specimens of B. subrhombifolia are easily

distinguished from both B. penaea and B. fuertesii, and the other features discussed

above do largely correlate with the species groups proposed here.

Diagnostic Key to Hispaniolan Species of Badiera

1. Leaves scabrous adaxially (rarely somewhat glabrate with age), the hairs spreading, sometimes with a swollen base (discolored thickening that looks pustular and raised; requires magnification); leaves mostly obovate, to narrowly elliptic, mostly bluntly rounded apically (some acute or even apiculate), often cuneately narrowed basally……………………………………….……..B. penaea.

1. Leaves smooth adaxially, the hairs appressed, lacking a swollen base; leaves mostly ovate, elliptic, or suborbicular, to slightly obovate, mostly acute to obtusely angled apically (rarely bluntly rounded or apiculate), acute to rounded basally, but not cuneately narrowed…………………………………………………………….. 2.

2. Leaves ≥ 3 cm long (excluding the petiole) and 1.9 cm wide (usually larger), mostly ovate or broadly elliptic, to suborbicular, mostly symmetrical and smoothly rounded on edges; never subtriplinerved (no strong lateral veins at base of blade); with visible 2° veins (usually more than 6; sometimes somewhat obscure when fresh) and with higher-level veins forming ± visible reticulations (most conspicuous when dry; often only faintly visible in patches when fresh); mature peduncles ≥ (2.5-)3 mm long; bracts and bracteoles (at base of each pedicel) caducous (gone by anthesis; rarely 1-2 shriveled bracts persist)...... B. fuertesii.

2. Leaves < 2.5 cm long (excluding the petiole) and 1.6 cm wide, mostly elliptic to oblong, slightly obovate, suborbicular, or rarely ovate, often asymmetrically angled to rhomboidal; sometimes subtriplinerved (with 2 strong lateral veins at base of blade); with inconspicuous 2° veins (up to ca. 6 may be partially visible, but often only 2-3) and without any visible reticulation (rarely visible abaxially on thin shade leaves when dry); mature peduncles < 2 (-2.8) mm

long (often subsessile); 3 bracts and bracteoles persistent at base of pedicel...... B. subrhombifolia.

Additional morphological characters of B. penaea are provided here for full

comparability of key features: Leaves mostly < 2.5 cm long and < 1.8 cm wide (rarely thin shade leaves larger, to 3.8 cm long x 2.3 cm wide); veins typically inconspicuous,

but a few 2° veins sometimes present, especially on thinner, broader leaves (which can

rarely also have conspicuous reticulation); mature peduncles < 2 mm long (often

subsessile); 3 bracts and bracteoles persistent at base of pedicel (one collection,

Zanoni 26376 (MO, NY), from Pedernales, has a mix of caducous and persistent bracts,

indicating that this feature might be polymorphic, at least in some populations, and is in

need of greater study).

Badiera subrhombifolia is only documented from two disjunct areas in southern

Haiti (i.e., the Massif de la Hotte, and Massif de la Selle) and two disjunct areas in

southwestern Dominican Republic (i.e., the northern slope of the Sierra de Bahoruco,

Independencia Prov., and an isolated region in the Cordillera Central, Azua Prov.), with

a total of only 12 collections from the four regions. The species is restricted to montane

areas over 960 m elevation, where it is often further restricted to small pockets of broad-

leaf forest surrounded by apparently unsuitable habitat. Given the widespread habitat

degradation in much of its range (especially in Haiti), B. subrhombifolia could be

considered as “endangered” according to the guidelines of the IUCN red data book categories (Lucas and Synge, 1978). Since the Sierra de Bahoruco National Park populations are protected and at least some of the Haitian populations are in a U.N.

Biosphere reserve, and given the ability of this species to grow in disturbed areas,

Badiera subrhombifolia may best be considered as “threatened.”

Figure 2-1. Badiera subrhombifolia, vegetative features. A., subtriplinerved leaf (Abbott 20914). B., subrhomboidal leaves (Hilaire 2442). C., habit, Sierra de Bahoruco, Dominican Republic (Abbott 20914).

FIG. 2-2. Badiera subrhombifolia (all vouchers at FLAS). A., habit (Judd 4006). B. & C., leaf variation (Judd 6924 & Hilaire 2442). D., flower (Clase 4305). E., lower outer sepals (Clase 4305). F., upper outer sepal, abaxial view (Clase 4305). G., inner lateral sepal (wing), adaxial view (Clase 4305). H., upper petal, adaxial view (Clase 4305). I., keel petal (Clase 4305). J., upper petals and androecium, the sparsely hairy upper filaments and misshapen anthers are indicative of a functionally female flower (Hilaire 2442). K., anthers, close up of pore-like slits and hairy upper filaments of staminate & perfect flower (Clase 4305). L., young gynoecium (Clase 4305). M. capsule (Hilaire 2442). N. seed and aril (Hilaire 2442).

Figure 2-3. Distribution map, Hispaniola. From west to east, Massif de la Hotte (2 metapopulations), Massif de la Selle, both in Haiti; Sierra de Bahoruco; Cordillera Central.

CHAPTER 3 PHYLOGENY AND BIOGEOGRAPHY OF NORTH AMERICAN POLYGALACEAE: NOTES ON THE DISINTEGRATION OF POLYGALA, WITH FOUR NEW GENERA FOR THE FLORA OF NORTH AMERICA

Introduction

North American Polygalaceae Hoffmanns. and Link consist of one species of

Monnina Ruiz and Pav. and ca. 56 species of Polygala L., two of which are naturalized.

A morphologically diverse assemblage of herbs and shrubs, they are most speciose in

the southern United States and occur in a wide range of habitats, from wetlands to

woodlands or deserts, mirroring the global diversity and range of Polygala, which, as

traditionally circumscribed, includes everything from annual herbs to lianas and trees

from sea-level to high montane regions. Eriksen and Persson (2007) provided a comprehensive description of the family, as well as a discussion in which they pointed out that there are discrepancies between published phylogenetic analyses and a lack of

clarity with respect to relationships within the Polygaleae Chodat. Preliminary

investigations have indicated that Polygala s.l. is a polyphyletic assemblage (Eriksen,

1993a; Persson, 2001; Forest et al., 2007).

Traditionally, nearly anything with a falsely papilionoid flower (two petals forming a

‘standard,’ one conduplicate petal forming a ‘keel,’ and two petaloid lateral sepals

forming ‘wings’) and with a bilocular capsule has been left in Polygala, while groups with

conspicuous specialized features, primarily modified fruits, have been segregated as

other genera. Globally, many additional groups (e.g., subgenera, sections, series) have

been named, based on vegetative and reproductive differences, but there has been

neither consensus on which groups to recognize nor agreement as to which rank is

appropriate. There have been numerous regional floristic treatments, sometimes even

of a monographic nature, which have suggested various morphological features for

taxonomic use (e.g., Blake, 1916, 1924; Marques, 1979; van der Meijden, 1988; Paiva,

1998; Bernardi, 2000), but not since Chodat’s work (1893, 1896) has there been a

global treatment of the genus Polygala. Thus, there is no clear or reasonably comprehensive phylogenetic framework for assessing level of universality for putative synapomorphies.

Eriksen and Persson (2007), the most recent global review of the family,

suggested that there are 330-425 species of Polygala s.l. (including the segregates

Acanthocladus Klotzsch ex Hassk. and Badiera DC.), while Paiva (1998) had estimated

the total as closer to 725. Given that Paiva (1998) reported 220 species of Polygala

(including Chamaebuxus (DC.) Spach and Heterosamara Kuntze) for Africa, Lüdtke et

al. (2008) reported 110 species for Brazil (although Marques (1979) reported 180

species), van der Meijden (1988) reported 20 species from Malesia, and my view that

there are about 55 species in North America, giving a total of 405 species (since there is

almost no overlap in species composition between these regions), it is clear that the global total must be well over 500 species and is probably close to Paiva’s estimate.

However, the basic monographic work of sorting out the taxa is still lacking, as is the global phylogenetic framework, so that attempts to stress any morphological feature (or suite of features) as more important than any other for taxonomic purposes run the risk of being arbitrary or incomplete in focus. Several of the traditional subgroups within

Polygala have been shown to be non-monophyletic or to make other groups non- monophyletic, some subgroups have been supported as monophyletic, but many smaller groups have simply not been adequately addressed. The two most complete

phylogenetic analyses of Polygalaceae, both using only plastid sequence data, included

25 species of Polygala, five North American (Persson, 2001), and 49 species of

Polygala, seven North American (Forest et al., 2007). While it is clear that some of the

North American species are more closely related to other genera than they are to each

other, a robust global phylogenetic context for assessing morphology and for generic

circumscription has been lacking.

Forty-five species of North American Polygalaceae (a six-fold increase over the

most complete published study), representing 80% of the ca. 55 native species and all

of the traditional subgenera, sections, and series in North America, along with 90 extra-

limital Polygala species (technically 88 species, with two distinctive subspecies that do

not closely associate with the nominant subspecies in all analyses) and 44 members of

other genera (including two legumes as the outgroup), were phylogenetically analyzed

using nrITS and the plastid trnL intron and adjacent spacer trnL-F. My plastid data

builds on the work of Persson (2001) and Forest et al. (2007), while my ITS data

represent the first use of the nuclear genome to assess relationships across

Polygalaceae. The 134 taxa of Polygala represent 18-40% of the total species number

estimates for the genus and include 37 taxa analyzed by Persson (2001) or Forest et al.

(2007), thus roughly tripling the number of Polygala species from previously published phylogenetic analyses and providing the most robust test to date of the monophyletic groups within Polygala and related clades (and the morphological features used to delimit them).

The artificiality of Polygala, as traditionally circumscribed, obfuscates our understanding of these species and their relationships. In addition to providing insight

into the evolutionary history of the included taxa, the phylogenetic hypotheses proposed

here provide a framework for studying the morphology, ecology, and biogeography of

Polygala and relatives, and for producing a natural classification of the group. In preparation for a forthcoming treatment of North American Polygalaceae, I present here

phylogenetic analyses together with a discussion of the morphologically diagnosable

groups that should be recognized as genera in North America. This framework can be

used, among other things, to begin carefully revising these clades, so that questions such as, ‘How many species are there within Polygala and related genera?,’ can finally

be laid to rest. Further developing the existing database of Polygalaceae sequences

also has implications for other research endeavors, such as the evaluation of

deoxynucleic acid (DNA) barcoding and testing phylogenetic diversity indices.

Materials and Methods

DNA material was obtained from wild-collected plants, herbarium specimens, and cultivated plants (Appendix 3-1). Fresh-collected material (primarily leaf fragments) was field-preserved in silica gel (Chase and Hills, 1991). Genomic DNA was later extracted using the cetyltrimethylammonium bromide (CTAB) technique (modified from Doyle and

Doyle, 1987), scaled to a 1 mL volume reaction. Approximately 0.5-1 cm2 of dried tissue was ground in 1 mL of CTAB 2X buffer, with either 8 μL of β-mercaptoethanol or 10 μL of proteinase-K. Most total DNAs were cleaned with Qiagen QIAquick PCR purification columns to remove inhibitory compounds. Amplifications were performed using a

Biometra T-gradient or an Eppendorf Mastercycler EP Gradient S thermocycler and

Sigma brand reagents in 25 μL volumes. Primers, modified from Taberlet et al. (1991) and Blattner (1999), are listed in Table 3-1. Amplification products were cleaned with

Microclean™ (The Gel Company, San Francisco, CA, USA) following the

manufacturer’s protocols, eluted with 50 μL of 10 mM Tris-HCl (pH 8.5), and stored at

4°C until cycle sequenced.

nrITS (ITS 1 + 5.8S rDNA+ ITS 2). This region was amplified using 0.5-1.0 μL

template DNA (~10-100 ng), 11 μL water, 6.5 μL 5M Betaine, 2.5 μL 10X buffer, 3 μL

25mM MgCl2, 0.5 μL of 10 μM dNTPs, 0.5 μL each of 10 μM primers, and 0.5 units Taq.

Thermocycler settings used a “touchdown” with the parameters 94°C, 2 min; 15 cycles

(94°C, 1 min; 76°C, 1 min, reducing 1°C per cycle; 72°C, 1 min); 21 cycles (94°C, 1 min;

59°C, 1 min; 72°C, 1 min); 72°C, 3 min. Sometimes, especially with herbarium material,

the ITS region was amplified in two pieces using internal primers.

trnL and trnL-F. This region includes both the trnL intron (= trnA-leu intron) and the spacer between trnL and trnF (trnL-F). Many workers collectively refer to the intron

and adjacent spacer as trnL-F, and, in fact, they were amplified as a single unit for

many of my taxa. As with ITS, some accessions, especially herbarium material, were

amplified in two pieces using internal primers. This region was amplified using 0.5-1.0

μL template DNA (~10-100 ng), 16-17.5 μL water, 2.5 μL 10X buffer, 2-4 μL mM MgCl2,

0.5 μL of 10 μM dNTPs, 0.5 μL each of 10 μM primers, and 0.5 units Taq. Thermocycler settings were: 94°C, 3 min; 33 cycles of (94°C, 1 min; 58°C, 1 min; 72°C, 1 min, 20 sec); 72°C, 6 min.

Purified PCR products were cycle-sequenced using the parameters 96°C, 10 sec;

25 cycles of (96°C, 10 sec; 50°C, 5 sec; 60°C, 4 min), with a mix of 3 μL water, 1 μL fluorescent Big Dye dideoxy terminator, 2 μL Better Buffer™ (The Gel Company), 1 μL template, and 0.5 μL primer. Cycle sequencing products were cleaned using ExoSAP™

(USB Corporation, OH, USA) following the manufacturer’s protocols. Purified cycle

sequencing products were directly sequenced using Big Dye terminator reagents on an

ABI 377, 3100 or 3130 automated sequencer according to the manufacturer’s protocols

(Applied Biosystems, Foster City, California, USA). Electropherograms were edited and assembled using Sequencher 4.6™ (GeneCodes, Ann Arbor, MI, USA). All sequences were deposited in GenBank (Appendix 3-1).

Sequence data were manually aligned using Se-Al v2.0a11 (Rambaut, 1996).

Indels (insertions/deletions) were not coded as characters. Fitch parsimony analyses

(unordered characters with equal weights; Fitch, 1971) were performed using

PAUP*4.0b10 (Swofford, 2003). Heuristic searches were run with 1000 random-addition

replicates, saving 10 trees per replicate, with the tree bisection reconnection (TBR)

algorithm. Deltran optimization was used for all analyses. All characters were weighted

equally, gaps were treated as missing data, and no regions were excluded from the

alignment. Bootstrap analyses utilized 1000 replicates, with 10 random-addition

replicates (SPR swapping) per bootstrap replicate.

Analyses were conducted with several data sets: (1) ITS data sets containing 56,

109, and 179 individuals; (2) trnL intron data sets containing 56, 109, and 179

individuals; (3) trnL-F data sets containing 53, 56 (3 taxa missing data), 109, and 179

(70 taxa missing data) individuals; (4) combined plastid data sets (trnL and trnL-F) with

56, 109, and 179 taxa (with gaps for the missing plastid data); and (5) total combined data sets of nuclear and plastid regions, using 56, 109, and 179 taxa (again with gaps for the missing plastid data). The 56 taxa data set is, essentially, a test of the North

American taxa with a few other related lineages, representing a typical analysis with a regional emphasis. The 109 taxa data set is comparable numerically to the published

phylogenetic analyses of Persson (2001) and Forest et al. (2007), with 73 and 92 taxa

respectively, and, thus, provides an assessment of relationships that uses nuclear data

and largely independently gathered plastid data. The 179 taxa data set, with 177

Polygalaceae, roughly represents a doubling of the taxa used by Persson (2001) and

Forest et al. (2007) and is, thus, the most complete data set to date, providing a fairly

large sample to address the circumscription of generic clades, especially focused on

North American taxa. By comparing the 56, 109, and 179 taxa analyses across the

nuclear, plastid, and combined data sets, I also address the issue of whether it is better

to add more taxa or more characters (data) to improve the robustness of phylogenetic

hypotheses (Graybeal, 1998).

A closer look at the actual taxa involved shows that 72% of the Forest et al. data

set (66 of the 92 Polygalaceae, representing 90% of the 73 taxa in the Persson data

set) is shared with the Persson data set, mostly from the original DNA extractions by

Persson. Collaboratively sharing data is a desirable, admirable goal, especially when

different questions are being addressed, but it is also important to provide independent

corroboration. In my data set, DNA material for 18 taxa was provided by Felix Forest, an

additional 40 taxa are shared with the Forest et al. data set, although my material was

independently gathered (i.e., from different plant specimens of the same species), and

one additional taxon is in common with the Persson data set, again from an

independent collection. Thus, 10% of my taxa are duplicates from the same DNA extractions used by Forest et al. (2007) and 23% are duplicated taxa from different vouchers; these 58 species represent 63% of the taxa sampled by Forest et al. (2007).

One hundred sixty-one different Polygalaceae (90% of my taxa) are sequenced here for

the first time, 120 representing taxa that have never been included in a published

phylogenetic analysis.

Results

Analyses were run with 56, 109, and 179 taxa. The 56 taxa analyses included only

members of the Polygaleae, they were run with the North American Monnina wrightii A.

Gray as the outgroup (based on it being the only other North American member of the

family), and they included 45 species of Polygala native to North America, three

additional species of Polygala cultivated or naturalized in North America, and seven

Caribbean or Latin American taxa, including two species in clades traditionally treated

as Polygala (Badiera and Phlebotaenia Griseb.). The 109 and 179 taxa analyses were

run using two caesalpinoid legumes as the outgroup (based on Forest et al., 2007) and

included three and eight representatives of tribes other than Polygaleae, 19 and 35 species of Polygaleae from genera not traditionally included within Polygala, and 85 and

134 species of traditional Polygala. In all analyses, the tribe Polygaleae was resolved as monophyletic, and in no analyses were all species traditionally recognized as Polygala

recovered as a monophyletic group. Although the exact relationships between some of

the clades within the Polygaleae were not consistently recovered, the following clades

were consistently supported across all, or nearly all, analyses (and those traditionally

included within Polygala s.l. are indicated with an asterisk): Acanthocladus*, Badiera*,

Bredemeyera Willd. s.str., Chamaebuxus (DC.) Spach*, Comesperma Labill.,

Hebecarpa (Chodat) J.R. Abbott*, Hebeclada (Chodat) J.R. Abbott*, Heterosamara*,

Polygala subgen. Ligustrina (Chodat) Paiva*, Monnina, Muraltia DC., Phlebotaenia*,

Polygala s.str. (with an Old World subclade and a New World subclade), Rhinotropis

(S.F. Blake) J.R. Abbott*, Salomonia Lour., and Securidaca L. In the few analyses

where one of these clades was not recovered, it was a result of a lack of resolution and not from a well-supported conflicting topology (Figures 3-1 to 3-11).

The increase in taxon sampling from 56 to 109 to 179 roughly represents a doubling and tripling of the taxa set. The 109 taxa data set includes 56 additional taxa and the loss of three taxa of the 56 taxa data set (Monnina wrightii, Polygala longa S.F.

Blake, P. myrtifolia L., for which trnL-F data were missing). These three species, however, were included in the 179 taxa analyses (with gaps for the missing data, as was also the case in the 56 taxa analyses). The 179 taxa data set includes all of the taxa present in the 109 taxa set plus 70 additional taxa. The 109 taxa data set included three species from three genera from tribes other than Polygaleae, 17 species from four genera of Polygaleae other than Polygala s.l., 12 species from six clades traditionally recognized as Polygala but not here considered in Polygala, and 22 species of Polygala s.str. (15 of these New World). The 179 taxa data set added five species from four genera from tribes other than Polygaleae, 15 species from seven genera of Polygaleae other than Polygala s.l., 13 species from five clades traditionally recognized as Polygala but not here considered as Polygala, and 34 species of Polygala s.str. (eight New

World). Thus, the increases in 56 and 70 taxa are fairly comparable in terms of the breadth of phylogenetic coverage, with no readily apparent differences between the groups of added taxa that would account for differences in support and topology across the analyses.

Across all analyses, the increase in the number of taxa resulted in an increase in the number of characters, including an increase in the number of parsimony informative characters and in the number of variable but uninformative characters, with the

exception of ITS from 109 to 179 taxa, which decreased from 177 to 156 variable but

uninformative characters; an increase in the tree length; and a decrease in the

consistency index (CI), the consistency index excluding uninformative characters (CIu),

and the rescaled consistency index (RC) (Table 3-2). These results are largely

consistent with what is generally expected, i.e., adding more taxa yields more

characters and decreases support values. The increase in taxa led to a greater number

of equally parsimonious trees for ITS and combined data but actually resulted in a

decrease in number of trees for most of the plastid data (Table 3-2).

There was no direct correlation between an increase in the number of characters

and the increase in number of informative characters. The increase to 109 taxa resulted

in 57 new characters for ITS, almost twice as many more (128) for trnL-F, and over five

times as many more (346) for trnL (Table 3-3). Although those 57 characters only

represented a 6.5% increase in number of characters, the number of phylogenetically informative characters increased by 42% (to 185). In contrast, the 128 new characters for trnL-F represented a 25% increase in number of characters and increased the number of phylogenetically informative characters by 60% (to 71), while the 346 new characters for trnL were a 52% increase in number of characters and increased the number of phylogenetically informative characters by 70% (to 73). Thus, adding more taxa for ITS added fewer new characters than for the chloroplast regions and resulted in a smaller percent increase in phylogenetically informative characters, although all three genomic data sets roughly doubled in terms of total tree length with the doubling of taxa.

Tripling the number of taxa resulted in a tripling of the total tree lengths for ITS and trnL

[trnL-F data were missing], but the tripling of taxa resulted in an absolutely and

proportionally much lower increase in number of characters and informative characters

than did the doubling (Table 3-3). ITS data yielded the highest percentage of

phylogenetically informative characters, twice that of the trnL-F spacer and nearly three

times that of the trnL intron, with the absolute numbers three to four times higher for ITS

than for the chloroplast regions (Table 3-2). This could well explain why trees based on

ITS data have more resolved nodes than those using chloroplast data (Table 3-4), even though plastid data have much higher tree support values than the ITS data (Table 3-2).

Sixty-three percent of the ITS data for the 179 taxa set are phylogenetically informative -- a 50% increase from the 42% for the 56 taxa set. For the plastid trnL

intron 179 taxa set, 21% of the data are phylogenetically informative, and 29% of the

trnL-F spacer 179 taxa set data are phylogenetically informative. For the 179 taxa sets, the aligned chloroplast sequences (total number of characters) are 1043 for trnL and

641 for trnL-F, while ITS has 1094 characters. Although the plastid regions are only

slightly shorter than, to about 2/3 the size of, the ITS sequences (in terms of total

aligned characters), their respective total tree lengths of 924 and 681 are roughly

comparable to the number of characters, while the 6663 tree length for ITS is more than

six times the number of aligned characters. Although the tree length is a function of the

number of characters and character states, it is best thought of as a measure of the

number of steps needed to account for the data in the most parsimonious manner. The

relative percent increase in tree length can be seen as a measure of homoplasy in the

data. Thus, the phylogenetic signals in the plastid and nuclear data sets are quite

different in nature. All in all, the combined nuclear and chloroplast data set splits the

difference between support values for the separate data sets (Table 3-2) and also splits

the difference in terms of percent increases (Table 3-3), i.e., there do not appear to be

any numerical advantages to the combined data set based solely on the overall support

values. However, from the bootstrap and strict consensus values, it is clear that

combined nuclear and plastid data provide the greatest percentage of resolved nodes and provide the highest percentage of well-supported nodes (Table 3-4), as found in

many other published studies (e.g., Soltis et al. 1998).

In the comparisons below, specifically those comparing nodes supported in the 56

taxa analyses to those in the 109 and 179 taxa analyses, it should be kept in mind that

Monnina wrightii, Polygala longa, and P. myrtifolia were not included in the 109 taxa

analyses. The sister relationship between P. longa and P. obscura Benth. in the 56 taxa

analyses was supported by the 179 taxa analyses (with 100% BS in both), while the

sister relationship between P. myrtifolia and P. vulgaris L. in the 56 taxa analyses was

an artifact of limited taxon sampling. While they are both members of the Old World

Polygala clade, P. myrtifolia and P. vulgaris were not sister taxa in the 179 taxa

analyses.

ITS analyses. Across all analyses, even though the ITS region was shorter than

the combined chloroplast regions (Table 3-2), ITS provided substantially more

phylogenetically informative characters and slightly better resolution, but the support

values (CI, CIu, RI, and RC) were consistently lower than those for the chloroplast data.

While the increase in taxa from 56 to 179 only slightly increased the total number of

characters (from 1032 to 1094, a 6% increase), it increased the number of informative

characters by 58% (from 436 to 690), and yielded a dramatic increase in the number of

equally parsimonious trees (from 6 to 3020) and a decrease in all the support values

(except for RI, which actually increased slightly). From 56 taxa to 109, the number of

characters increased by 57 (6.5%), the number of informative characters increased by

185 (42%), and the tree length increased by 2473 (108%); from 109 to 179 taxa, the

number of characters increased by five (0.5%), the number of informative characters

increased by 69 (11%), and the tree length increased by 1910 (40%).

All 30 of the clades that were well-supported (≥ 80%) in the ITS bootstrap

analyses (BS) with 56 taxa were also well-supported in analyses with 109 and 179 taxa

(which had, respectively, 56 and 93 nodes with ≥ 80% BS support), with the exception

of [Phlebotaenia + Securidaca] sister to Rhinotropis (83% BS), which was not recovered

in the 109 or 179 taxa analyses (Figs. 3-4 to 3-6). Across the ITS analyses, there was

robust support for the distinctiveness of the clades recognized or proposed herein as

genera, as well as for several of the subclades within Polygala s.str. (Table 3-5).

trnL intron analyses. The increase in taxa from 56 to 179 increased the total

number of characters from 670 to 1043 (a 56% increase), increasing the number of

informative characters by 108% (from 105 to 218), and it tripled the total aligned length

(from 307 to 924, a 201% increase). The 8670 trees obtained with 56 taxa were reduced to 1170 trees with 109 taxa and then to 830 trees with 179 taxa. The relatively high support values for the 56 taxa analysis dropped for the 109 and 179 taxa analyses

(Table 3-2). From 56 taxa to 109, the number of characters increased by 346 (52%), the

number of informative characters increased by 73 (70%), and the tree length increased

by 313 (102%); from 109 to 179 taxa, the number of characters increased by 27 (3%), the number of informative characters increased by 40 (22%), and the tree length increased by 304 (49%).

All 17 of the clades that were well-supported (≥ 80%) in the trnL bootstrap

analyses (BS) with 56 taxa were also well-supported in analyses with 109 and 179 taxa

(which had, respectively, 32 and 52 nodes with ≥ 80% BS support), with one minor

exception: a clade of 24 taxa including the Decurrentes group, the Galioideae group,

other SE U.S. taxa, and a few Latin American taxa (87% BS) increased to 31 taxa in the

109 and 179 taxa analyses, but the respective support values dropped to 74% BS and

79% BS (Appendix 3-3). Across the trnL analyses, there was robust support for the

distinctiveness of the clades recognized or proposed herein as genera, as well as for

several of the subclades within Polygala s.str. (Table 3-5).

trnL-F analyses. The increase in taxa from 56 to 109 increased the total number

of characters from 513 to 641 (a 25% increase), increasing the number of informative

characters by 60% (from 118 to 189), and it more than doubled the total tree length

(from 320 to 680, a 113% increase). The 8820 trees obtained with 56 taxa were

reduced to 6980 trees with 109 taxa. Because three taxa were missing data, analyses

were also run with 53 taxa, to see what impact the missing data had on the analyses.

The overall tree support values for the 53 taxa analyses were identical to those for the

56 taxa analyses, except that 200 fewer trees were found with the 56 taxa set (Table 3-

2). The 53 and 56 taxa trnL-F data sets had higher tree support values than any other analysis, and the support values for the 109 taxa trnL-F analysis were higher than for all

other analyses except for the 56 taxa analyses across all data sets (Table 3-2).

All 13 of the clades that were well-supported (≥ 80%) in the trnL-F bootstrap

analyses (BS) with 56 taxa were also well-supported in analyses with 109 and 179 taxa

(which had, respectively, 31 and 24 nodes with ≥ 80% BS support), with the minor

exception that support for the Galioideae group (86% BS in the 56 taxa analysis) dropped to 78% BS in the 179 taxa analysis (Appendix 3-3). The 53 taxa analysis generated 27 nodes supported by BS analysis (≥ 50%), 32 nodes supported by the strict consensus, and 39 nodes (of the 51 theoretically possible) in the randomly chosen cladogram, whereas the 56 taxa analysis had 20 nodes supported by BS analysis, only one node supported by the strict consensus, and 38 nodes in the cladogram. The 53 taxa BS analysis had 19 nodes with ≥ 80% support (4 with 100%), whereas the 56 taxa

BS analysis only had 13 (none with 100%). These analyses differed only with respect to the three taxa (Monnina wrightii, Polygala myrtifolia, and P. longa) with missing data; including the missing data lowered the BS support for every node, including nodes that were not directly related to any of the three taxa. Among the 7 nodes to lose BS support of ≥ 80% were a node with 99% BS and two nodes with 100% BS. Although the 179 taxa BS analysis, which included 70 taxa with missing data, generated 43 nodes with

BS support (≥ 50%; only 28 with ≥ 80%), only one node with strict consensus support, and 79 nodes in the cladogram, these values were all lower than those found in the 109 taxa analysis. Thus, it would seem that even a small amount of missing data can have a profound impact on the results. Still, across the trnL-F analyses, there was support for the distinctiveness of the clades recognized or proposed herein as genera, as well as for several of the subclades within Polygala s.str. (Table 3-5).

Chloroplast data combined analyses. The 56 taxa analyses included missing trnL-F data for three taxa, and the 179 taxa analyses included missing trnL-F data for 70 taxa. The increase in taxa from 56 to 179 increased the total number of characters from

1183 to 1684 (a 42% increase), increased the number of informative characters by 82%

(from 223 to 406), and increased the total tree length from 630 to 1610 (a 156% increase). The 6160 trees obtained with 56 taxa increased to 7090 with 109 taxa and then enigmatically decreased to 2770 trees with 179 taxa. The support values for the 56 taxa analysis were the second highest of all analyses, decreasing for the 109 and 179 taxa analyses (Table 3-2). From 56 taxa to 109, the number of characters increased by

474 (40%), the number of informative characters increased by 144 (65%), and the tree length increased by 678 (108%); from 109 to 179 taxa, the number of characters increased by 27 (2%), the number of informative characters increased by 39 (11%), and the tree length increased by 302 (23%).

All 26 of the clades that were well-supported (≥ 80%) in the combined plastid bootstrap analyses (BS) with 56 taxa were also well-supported in analyses with 109 and

179 taxa (which had, respectively, 51 and 68 nodes with ≥ 80% BS support), with one minor exception within the Galioideae group: Polygala leptostachys Shuttlew. [P. ambigua Nutt. + P. verticillata L.] (87% BS) collapsed into a polytomy in the 109 and

179 taxa BS analyses (Figs. 3-7 to 3-8, Appendix 3-3). Across the combined plastid analyses, there was robust support for the distinctiveness of the clades recognized or proposed herein as genera, as well as for several of the subclades within Polygala s.str.

(Table 3-5). Overall, the influence of missing trnL-F data was ameliorated by combination with plastid trnL intron sequence data.

Nuclear and plastid data combined analyses. The nuclear and plastid genomes supported largely congruent cladistic topologies (Figs. 3-1 to 3-8, Table 3-5, Appendix

3-3). Some topologies supported by one genome were not supported by the other, but there were no well-supported conflicting clades between the nuclear and plastid

topologies, except for one minor discrepancy involving Monnina xalapensis Kunth and

M. phillyreoides (Bonpl.) B. Eriksen, the sequences of which should be verified via

comparison with other accessions. The increase in taxa from 56 to 179 increased the

total number of characters from 2215 to 2778 (a 25% increase), increasing the number

of informative characters by 66% (from 659 to 1096), and it increased the total tree

length from 2934 to 8343 (a 184% increase). The six trees obtained with 56 taxa

increased to 137 with 109 taxa and then to 1990 trees with 179 taxa. The support

values for all analyses were slightly higher than those from the comparable ITS

analyses, but even the highest values (for 56 taxa) were lower than the lowest values

from any of the chloroplast analyses (Table 3-2). From 56 taxa to 109, the number of

characters increased by 531 (24%), the number of informative characters increased by

329 (50%), and the tree length increased by 3173 (108%); from 109 to 179 taxa, the

number of characters increased by 27 (2%), the number of informative characters increased by 108 (11%), and the aligned length increased by 2236 (37%).

All 34 of the clades that were well-supported (≥ 80%) in the combined nuclear and

plastid bootstrap analyses (BS) with 56 taxa were also well-supported in analyses with

109 and 179 taxa (which had, respectively, 69 and 111 nodes with ≥ 80% BS support),

with one minor exception: Polygala cornuta Kellogg ssp. fishiae (Parry) Munz [P.

lindheimeri A. Gray + P. nudata Brandegee] (81% BS), which is consistently supported

but the support values drop to 70% BS in the 109 taxa analyses and then go back up to

83% BS in the 179 taxa analysis (Figs. 9-11). Although the addition of more taxa altered

some supported relationships, the overall topology of most clades from the 56 taxa

analysis is robust to the addition of taxa across the combined nuclear and plastid

analyses, with robust support for the distinctiveness of the clades recognized or

proposed herein as genera, as well as for several of the subclades within Polygala s.str.

(Table 3-5).

General Discussion

More than a century ago (Robinson, 1906), botanists were warned about the dangers of describing artificial genera while focused on a geographically restricted flora

and ignoring global patterns of variation among potentially related species. A regional

approach to resolving relationships leads to confusion, overlapping circumscriptions, a

lack of compatibility or comparability across floras, and taxonomic and nomenclatural

instability (Robinson, 1906). Higher level ranking is inherently subjective and was

historically often rather arbitrary, primarily since there was no reliable, agreed-upon

methodology for assessing patterns of evolutionary relationship. Now, however,

phylogenetic hypotheses provide a solid framework for the hierarchical grouping of

species and understanding the interrelationships between groups (e.g., Judd et al.,

2007), even though the importance of broad geographical sampling remains.

There has been much discussion and criticism of the Linnaean system and

traditional type-based ranked names vs. phylogenetic naming systems, e.g., Benton

(2000), Withgott (2000), De Queiroz and Cantino (2001), Langer (2001), Berry (2002),

Forey (2002), Nixon et al. (2003), Pickett (2005). Frustration with legalistic semantics and the arbitrariness of taxonomic rank can make alternative systems seem desirable.

But, as pointed out by Moore (2003), even though our current system does use

Linnaean conventions, it is not strictly bound by traditional ideas and is flexible and able to handle changing ideas.

Names do not exist in a vacuum, they should and do imply something, and they

are important for communication. Advances in our understanding should attempt to

minimize taxonomic change when possible (Entwisle and Weston, 2005), in order to

minimize confusion and disruption of existing communication channels. But advances in

our understanding do necessitate change for effective transmission of improved

knowledge (Knapp et al., 2004). Thus, since it is clear from my results (Figs. 3-1 to 3-

11) that Polygala s.l. is an artificial construct and must be recircumscribed, I have done

so using names in accordance with the International Code of Botanical Nomenclature

(McNeil et al., 2006) that provide historical continuity and minimize disruption. If only

clades that are well-supported and morphologically diagnosable are named, then

taxonomic stability can be achieved, although there is still often some room for

interpretation. Nomenclatural codes are independent of taxonomic opinion, and it is

important not to blur the lines between taxonomy and nomenclature (Dubois, 2007),

keeping in mind that true, lasting nomenclatural stability will only come from the quality

science required to develop robust hypotheses (Knapp et al., 2004). Therefore, I have

avoided renaming any suprageneric clades for now, as the relationships between the

genera proposed herein are not yet robustly supported. Likewise, hypotheses of

relationships of clades closest to the core group of Polygala are also not yet well understood, so much more work is needed to sort out infrageneric groupings within

Polygala s.str.

Monophyly is currently considered by most to be the most important criterion for taxonomic changes (e.g., Backlund and Bremer, 1998; Entwisle and Weston, 2005;

Judd et al., 2007). While phylogenetic studies can yield robust hypotheses of

relationship with predictive power, it should be kept in mind that monophyletic groups

are not necessarily predictive of overall similarity (just of shared derived similarity, e.g.,

Stevens, 1985). Robustness of a clade, i.e., its persistence in new analyses and with

the addition or deletion of taxa, should be well-documented before making taxonomic

changes, as such robustness is an indication of the strength of the hypothesis that the

group actually exists in nature (as a result of genealogical descent with modification).

The results here are robustly supported, i.e., the clades I am recognizing are supported

in all analyses (Figs. 3-1 to 3-3), across all data sets and using double and triple the

number of taxa (Figs. 3-4 to 3-11, Table 3-5). These results also largely mirror those of

other published phenetic (Paiva, 1998) and phylogenetic analyses (Eriksen, 1993a;

Persson, 2001; Forest et al., 2007), at least with respect to recognition of the clades named as generic groups here.

The genera I propose here, Chamaebuxus, Hebecarpa, Hebeclada, and

Rhinotropis, are strongly supported in all the analyses (Figs. 3-1 to 3-11, Table 3-5),

they are morphologically diagnosable, and they make sense biogeographically. Strong

support values in and of themselves, however, are not inherently meaningful, especially

if taxon sampling is limited. When there are alternative interpretations, such as

combining sister clades, the biology of the organisms should be considered to

determine which classification is most meaningful or useful, or makes the most sense in

terms of diagnosable groups. For instance, Eriksen et al. (2000) circumscribed the

genus Badiera to include Polygala subgen. Hebecarpa (Chodat) S.F. Blake on the basis

of unpublished, preliminary data that suggested they were sister taxa, an hypothesis not

supported by other published analyses (Forest et al., 2007) and one that was

formulated without any morphological context or detailed study of the species. Even

though most of my analyses do support the hypothesis of Badiera and Hebecarpa as

sister groups, it makes more sense to treat them as separate genera. Treating them as separate genera is also a more stable means of addressing the lack of robustness, i.e., all analyses support them as clades, but not all analyses support them as sister taxa, so lumping them entails an unnecessary taxonomic and nomenclatural risk, not to mention that there are not yet any known morphological synapomorphies for the putative

Badiera + Hebecarpa clade, although each is independently a morphologically distinctive group.

A representative example of historical attempts to reclassify the North American

species of Polygala is provided by Small (1933), who recognized Asemeia Raf. (for P. grandiflora Walter and some northern hemisphere allies no longer recognized as separate species), Galypola Nieuwland (for P. incarnata L.), Pilostaxis Raf. (for a few species in an endemic southeastern U.S. group recognized as Polygala ser.

Decurrentes Chodat), and Trichlisperma Raf. (for P. paucifolia Willd.), yet Small chose not to recognize Anthalogea Raf. (for P. polygama Walt.) nor Senega Spach. (for P. senega L.), even though all of these groups have distinctive morphological features.

Which genera to recognize was a matter of opinion, based on personal belief in which characters to stress as important and which author(s) to follow. From a modern phylogenetic perspective, I now understand that Asemeia is part of the Hebeclada clade, Trichlisperma is part of the Chamaebuxus clade, and the remaining ‘genera’ are subgroups of the New World Polygala clade, i.e., none of them can be maintained as genera without creating a blatantly artificial Polygala and finely splitting the segregates

such as Chamaebuxus and Hebeclada into small, difficult to diagnose groups. Their

morphological distinctiveness has to be understood within a global phylogenetic context,

i.e., morphological distinctiveness should not be used as the primary criterion for

naming. Thus, the pattern of morphological variation must always be considered within

a phylogenetic framework.

The generic proposals provided here are not a reflection of personal opinion about

which characters I think most represent the concept of a genus; instead, they reflect a phylogenetic approach to understanding relationships (based on DNA sequences), using morphology as a secondary guide/criterion for naming clades and ranking them within a taxonomic system (see Backlund and Bremer, 1998; Judd et al., 2007). A morphology-based phylogenetic analysis of Polygaleae would have allowed distinctions to be more accurately made between morphological characters that are retained ancestral features (plesiomorphies), unique derived features (autapomorphies), and shared derived features (synapomorphies), but attempting to assess the homology of

potentially hundreds of characters across hundreds of species, on a global basis, is

beyond the scope of this work. Thus, even though all of the clades here given generic

recognition are morphologically diagnosable, it is often difficult to determine which

features are synapomorphic for particular generic clades, especially when the

characters are homoplasious. I hope in a future study to develop a detailed

morphological matrix, so that morphological features can be explicitly mapped on to

DNA-based trees as well as total evidence trees.

Even though the generic clades discussed here all have species in North America,

the overall phylogenetic context is global, providing strong support for their monophyly,

i.e., changing the number of taxa or the data being analyzed does not change the circumscription of the named clades (as I have demonstrated in my analyses; see Figs.

3-1 to 3-11, Table 3-5). This is not to say that there is not a certain amount of subjectivity in determining which clades to name (and the rank at which to assign these names), for instance, I am not certain if Chamaebuxus could or should be expanded to include Polygala subgen. Chodatia Paiva and/or Heterosamara. Some workers dismiss as inappropriate the idea that genera should be easy to recognize (Entwisle and

Weston, 2005) or write that the issue of convenience and utility is trivial (Stevens,

1985). I agree that distinctive characters should not be emphasized nomenclaturally if they result in non-monophyletic groups (e.g., Pfeil and Crisp, 2005). However, taxonomists need to keep in mind that classifications serve a user community, and considerations of recognizability, utility, and information retrieval, therefore, are important, at least as secondary criteria (Backlund and Bremer, 1998; Judd et al.,

2007).

All the genera proposed here are monophyletic; they are morphologically diagnosable; they are traditionally recognized taxa (as subgenera or sections); and their recognition does not result in the paraphyly of any other genera. Conversely, to create a broadly circumscribed monophyletic Polygala would necessitate the inclusion of all other genera of Polygaleae! Despite the arbitrariness of rank, subsuming within

Polygala s.l. a dozen or more distinctive generic clades such as the Asian mycoheterotrophs (Epirixanthes Blume and Salomonia), the pantropical samaroid lianas

(Securidaca), the primarily neotropical and mostly drupaceous shrubs (Monnina), etc., would do absolutely nothing to clarify our understanding of relationships within the tribe.

Some workers (e.g., Bremer et al., 1999; Mitchell et al., 2000) have shown that a higher percentage of supported nodes can be achieved by adding more characters than by adding more taxa, although it can depend on the type of data being added, e.g., adding data from a new gene region is better than adding more characters from the region(s) already being used. Other workers have shown that adding more characters with too few taxa can lead to misleading results (Halanych, 1998; Hillis, 1998; Zwickl and Hillis, 2002; Soltis and Soltis, 2004). A nice overview of the ‘more characters vs. more taxa’ debate was provided by Hillis et al. (2003), who concluded that for inferring evolutionary history, a broader sampling of taxa provides a more accurate estimate of phylogeny than does sampling more characters from a small number of taxa. They also point out that, while some researchers have stressed situations in which adding more characters to a few taxa is more important than adding more taxa, the characters vs. taxa issue largely depends on the conditions of the study such as the relative number of taxa and characters already in use, e.g., if there are only a few taxa with lots of characters, then adding more taxa will probably yield better results than adding more characters. Adding more taxa to an analysis can especially be beneficial if those taxa break up long-branch attractions (Graybeal, 1998). Many of these theory-based investigations have been simulations with a very small number of taxa and carry an underlying assumption that one must choose between more characters or more taxa. It is assumed that the same principles apply to much larger data sets, and, in part, the entire issue is a matter of scale, of what percentage of the known taxa and known infra- group diversity has been included in the study. Of course, researchers are often limited by time, money, and resources, including taxon availability. Nonetheless, reducing our

understanding of biological diversity to a reflection of statistical support of minimal

sample sizes seems a pointless risk, especially when the results are used to make

taxonomic changes. My results (in agreement with Graybeal, 1998) suggest that both

approaches should be used, as both led to more robustly supported results. Part of this issue, however, relates to how one measures improvement; typically, higher overall tree support values (CI, RI, etc.), higher bootstrap values, and more nodes in the strict consensus are seen as improvement, even though results may simply be more confidently incorrect, and one must keep in mind that introgression or lateral gene flow, nuclear and plastid genomes with different evolutionary histories, incomplete lineage sorting or concerted evolution can lead to conflicting topologies. Nonetheless, robustness of the clades across analyses seems an appropriate measure of support under most circumstances. All of the clades proposed here as genera are robustly supported (Figs. 3-1 to 3-11, Table 3-5, Appendix 3-3).

Every phylogenetic analysis based on DNA sequence data inherently tests the hypothesis that the morphological features, which have been used to define the group

(and its subgroups) based on careful observation by generations of taxonomists, might

be synapomorphies for the group. Thus, as pointed out by Scotland et al. (2003), even

when morphology is not directly included in a phylogenetic analysis, the underlying

morphological understanding that shaped our concept of the group, determining which

taxa to include, is implicitly being tested by the analysis. There have been many

documented cases of traditional morphological patterns being incongruent with

analyses of molecular data or even of phylogenetic analyses of more broadly sampled

morphological data, often necessitating a reassessment of homology (although the

contrary, i.e., molecular data supportive of morphological patterns, also is common). Yet

I know that, at times, genetic data can be as misleading as morphology (Felsenstein,

1978; Hendy and Penny, 1989; Wendel and Doyle, 1998), and I know that there can be

substantial analytical issues related to taxon and character sampling (e.g., Graybeal,

1998; Mitchell et al., 2000; Hillis, 1998; Hillis et al., 2003; Wiens, 2005). Ideally, then,

most would agree that taxon and character sampling should be as complete as

possible, rather than being a statistical assessment of minimal sampling.

Typically, the problem in relation to sampling is that one may know there are missing data, i.e., that one has not included all possible taxa or all possible characters.

Missing data, whether missing taxa or missing characters, do not necessarily preclude accurate phylogenetic inference (Wiens, 2003), especially if the gaps in our

understanding of the characters are evenly scattered across the taxa and if the

incompletely known taxa are involved in breaking up long branches. It is acknowledged

that studies with limited taxa or characters have merit as they do advance our

understanding of the group. However, even a study such as this one, with both nuclear

and plastid genomic data, including 177 ingroup taxa (representing 80% of the North

American taxa, and nearly all of the major subgroups within Polygala s.l.), would be

improved by even greater sampling of taxa and characters, as there are still several

unresolved or poorly supported patterns of relationship. That said, this study is the most

complete to date, the relationships discussed herein do seem to be robustly supported,

and even preliminary hypotheses can be useful in updating nomenclature for directing

future studies and research.

The genera proposed herein reflect an hypothesis of relationship based on a comprehensive understanding of the infrafamilial groups. The species names transferred here (and the resulting new combinations) reflect my current understanding of the North American species, even though some of them are part of species complexes that could be treated more broadly (see Appendix 3-2). Some of the genetic polymorphisms detected in my phylogenetic analyses raise awareness of species- delimitation issues, especially within Hebecarpa, but such issues must await monographic studies of the groups involved. In addition, most of the groups addressed here contain species outside of North America that are not being nomenclaturally transferred at this time, because the species have not been studied by me and because one of the purposes of this publication is to make the formal name changes required prior to using a name in the Flora North America treatment of Polygala (and related genera; Abbott, in prep.).

Taxonomic Conclusions

Paiva (1998) re-segregated the Old World genus Heterosamara and recognized

12 subgenera within Polygala s.l. My most complete cladistic analyses (Figs. 3-1, 3-3, and 3-11), in congruence with other published analyses, show that eight of the subgenera of Polygala are more closely related to other genera than they are to subgenus Polygala and that Polygala subgen. Brachytropis (DC.) Chodat is phylogenetically nested within subgen. Polygala s.str. The other two subgenera have been supported as distinct from Polygala s.str. in other published phylogenetic analyses

(Forest et al., 2007). Thus, Paiva recognized many distinctive, morphologically

defensible, monophyletic groups but maintained these (except Heterosamara) in an

artificial, polyphyletic assemblage, Polygala s.l.

Our analyses strongly support the monophyly of the following seven subgenera of

Polygala recognized by Paiva (1998) [branch length/BS support, all based on the

combined 179 taxa analyses, Figs. 3 and 11]: subgen. Acanthocladus (Klotzsch ex

Hassk.) Paiva [48/100], subgen. Badiera (DC.) Blake [34/100], subgen. Chamaebuxus

(DC.) Duch. in Orbigny [41/94], subgen. Hebecarpa (Chodat) Blake [61/100], subgen.

Hebeclada (Chodat) Blake [54/100], subgen. Ligustrina (Chodat) Paiva [66/100], subgen. Rhinotropis (Blake) Paiva [33/100]. Only one species of the eighth sugenus,

Polygala subgen. Phlebotaenia (Griseb.) Blake, was included in my analyses, so its monophyly is not tested here. The apparent lack of monophyly for subgen. Phlebotaenia suggested by Forest et al. (2007) is likely erroneous. Not only do the two species of this clade share very distinctive morphological features, but preliminary results of ongoing sequencing work by the first author (Abbott, in prep.) support the two species of subgen.

Phlebotaenia as sister taxa, likely most closely related to subgen. Rhinotropis. A ninth subgenus, Polygala subgen. Gymnospora (Chodat) Paiva, not sampled by me, was supported as sister to the Badiera + Hebecarpa clade by Forest et al. (2007), an hypothesis in need of independent verification. A tenth subgenus, Polygala subgen.

Chodatia Paiva, also not sampled by me, was supported as sister to Heterosamara in the analyses of Persson (2001) and Forest et al. (2007), but it is not yet clear how well- supported that placement is, or whether that group should be recognized as a genus or included within an expanded Heterosamara, or perhaps within an expanded

Chamaebuxus. This lack of clarity is further illustrated by the recent transfer of three

species of the Chodatia group into Heterosamara (Castro et al., 2007). The genus

Heterosamara was only represented by a single species in my analyses, but the two

species sampled by Forest et al. (2007) formed a clade. With the above groups

segregated out of traditional Polygala s.l., modern Polygala s.str. is restricted to Paiva’s

subgen. Polygala, including his monotypic Iberian subgen. Brachytropis (P. microphylla

L.), which has been shown to be closely related to the type group, i.e., it is

phylogenetically nested within subgen. Polygala (as here circumscribed, see Fig. 3-11).

The single species in the Brachytropis lineage may be nomenclaturally recognizable as a subgroup of subgen. Polygala, but resolution of lineages within Polygala s.str. should await more detailed analyses with greater taxon sampling. The final subgenus recognized by Paiva (1998) is subgen. Polygala, which corresponds to the section

Orthopolygala of Chodat (1893). Although his focus was on northern hemisphere New

World taxa, Blake (1916, 1924) also recognized a comparable subgenus, calling it

Orthopolygala. At this point, only members of this clade should be thought of as “true” polygalas. Polygala s.str. is not actually supported as a clade in the strict consensus

tree (Figs. 3 and 11), although it does have bootstrap support of 67. Thus, greater taxon

sampling of Polygala s.str. is needed in order to confirm its monophyly.

Except for traditional Bredemeyera s.l. and Polygala s.l., all other tested genera of

Polygaleae are supported as monophyletic: Bredemeyera s.str. (34/100), Comesperma

(22/62), Monnina (94/100), Muraltia (including Nylandtia Dum.; 39/100), and Securidaca

(69/100). Bredemeyera s.l. has been shown to be non-monophyletic (Persson, 2001;

Forest et al., 2007), with one species requiring segregation as the monotypic genus

Hualania Phil. (B. colletioides (Phil.) Chodat) and another as yet unplaced generically

(B. microphylla Hieron.), but all species sampled by me are part of Bredemeyera s.str.

The phylogenetic placement of the various members of Bredemeyera s.l., such as the placement B. microphylla Hieron. as sister to the Badiera + Hebecarpa clade (Forest et al., 2007), needs to be verified with independent material and greater sampling before generic recircumscription is attempted. Comesperma is the most weakly supported genus, which may be an artifact of the two deep subclades (branch length/bootstrap support, 31/99 and 89/100) and of all the analyzed species having additional long branches (Fig. 3-11). Greater sampling of the ca. 40 taxa of Comesperma is needed.

Two genera, Ancylotropis B. Eriksen and Pteromonnina B. Eriksen, were segregated out of Monnina by Eriksen (Eriksen and Persson, 2007). Ancylotropis is comprised of two species, neither of which was sampled by me, but both were sampled and shown to form a clade sister to the Monnina + Pteromonnina clade by both Persson (2001) and

Forest et al. (2007). Except for the report, based on unpublished ITS data, of

Pteromonnina being monophyletic in Eriksen and Persson (2007), all published analyses, including my ITS data, support Pteromonnina as a paraphyletic grade leading into the remaining species of Monnina. Thus, from the standpoint of monophyly, the distinctive features of Ancylotropis might be genus-level synapomorphies (although the exact level of universality has not been established), while the features of Pteromonnina are better understood as plesiomorphies, characteristic of the lineage that gave rise to the core species of Monnina. I recommend that both lineages be maintained within

Monnina. The only other genus of Polygaleae unsampled by me is the achlorophyllous mycoparasite Epirixanthes, with five species in Asia. Epirixanthes has been included in the Australasian Salomonia by some authors and morphologically does seem to be

closely related. The analyses of Forest et al. (2007) suggested that Salomonia is sister to Heterosamara [Chamaebuxus + Chodatia]. The analyses here are not clear on the placement of Salomonia, perhaps due to the absence of trnL-F data, long-branch attraction (the randomly chosen cladogram for the 179 taxa combined analysis showed

Salomonia to have a branch length of 180), or discordance between the nuclear and plastid genomes (Figs. 3-3 and 3-11).

The monophyly of other tribes and non-Polygaleae genera, although relatively poorly sampled, especially in terms of species, is also well-supported (branch length/bootstrap support value from the 179 taxa analyses): Carpolobiae Eriksen

(55/100), with Atroxima Stapf (39/99), Carpolobia G. Don (37/98); Moutabeae Chodat

(16/97); and Xanthophyllum Roxb. (95/100). Xanthophyllum, with about 90 species of

Australasian trees and shrubs, is the sole representative of the Xanthophylleae Chodat, which my data confirm as sister to the remaining Polygalaceae (Figs. 3-1, 3-2, 3-3, 3-5,

3-6, 3-8, 3-10, and 3-11). Carpolobiae contain two woody African genera, Atroxima (with two species, both sampled by me) and Carpolobia (with four species, two of these sampled by me). Moutabeae contain five genera of woody plants: monotypic Balgoya P.

Morat and Meijden from New Caledonia, monotypic Barnhartia Gleason from the

Guianas and Brazil; Diclidanthera Mart. with four species from Brazil, Guyana, and

Peru; monotypic Eriandra P. Royen and Steenis from New Guinea and Solomon

Islands; and Moutabea Aubl. with ca. eight species in Latin America. Persson (2001) included seven species from four genera (all but Eriandra) of Moutabeae but did not find support for its monophyly. Forest et al. (2007) included six species from four genera (all but Balgoya) of Moutabeae, resolving it as monophyletic, although the genus Moutabea

was not supported as monophyletic. Eriksen (1993a; using morphology) and Forest et

al. (2007; using rbcL, trnL, and trnL-F, all plastid data) supported Carpolobiae as sister

to Polygaleae, but my data suggest that Moutabeae is sister to Polygaleae. It seems

best to consider the relative placement of the Carpolobiae and Moutabeae as

unresolved for now, as supported by Persson (2001; using plastid trnL and trnL-F data).

Two deep clades are supported within the Polygaleae, referred to as Polygaleae 1 and Polygaleae 2 by Persson (2001). The relationships between the generic clades within Polygaleae 1 are consistently supported across the analyses of Persson (2001),

Forest et al. (2007), and ours, at least based on the bootstrap and strict consensus of

total combined data and chloroplast data (Figs. 3-8 and 3-11, Appendix 3-3).

Polygaleae 1 consists of Bredemeyera [Acanthocladus [Badiera + Hebecarpa]]. The nuclear ITS data support different patterns of generic relationship depending on the number of taxa, but ITS data alone never support the same topology supported by plastid data and combined total data (Figs. 3-1 to 3-11, Appendix 3-3). Additional nuclear data, as well as a detailed analysis of morphology, seem essential to enhance

our understanding of relationships within Polygaleae 1, as it seems that our current understanding of this group is largely based on the evolutionary history of the plastid genome.

Polygaleae 2 generic clade relationships are not consistently supported, nor well- supported, across published analyses, primarily because the strict consensus trees show a lack of resolution between many of the generic clades, although, except for

Bredemeyera s.l. and Polygala s.l., all of the genera (those traditionally accepted and those proposed by us) are consistently supported across analyses. The strict

consensus of Persson (2001), based on the same plastid regions used by me (the trnL

and trnL-F regions, which seem to amplify well from herbarium material in

Polygalaceae), supported Phlebotaenia as sister to Rhinotropis (as Chamaebuxus p.p.),

Chamaebuxus as sister to the Chodatia (as Chamaebuxus p.p.) + Heterosamara (as the

Pseudosemeiocardium group) clade, and Ancylotropis as sister to the Monnina +

Pteromonnina (as the paraphyletic M. subgen. Pterocarya (DC.) Chodat) clade, with all other generic relationships within Polygaleae unresolved. The strict consensus topology of my 109 taxa plastid data was more resolved (Fig. 3-8, Appendix 3-3), perhaps as a result of the greater taxon sampling, the inclusion of different clades, or several of the

Persson taxa having missing data. Forest et al. (2007), using a Bayesian analysis of plastid data, supported the following topology for Polygaleae 2: Securidaca

[[Phlebotaenia + Rhinotropis] + [Comesperma + Monnina]] + [[Hebeclada + Polygala subgen. Ligustrina] + Hualania Phil. [Muraltia + [New World Polygala + Old World

Polygala] + Salomonia [Heterosamara [Chamaebuxus + Polygala subgen. Chodatia]]].

The first subclade, i.e., Securidaca [[Phlebotaenia + Rhinotropis] + [Comesperma +

Monnina]], was supported by my combined 179 taxa strict consensus topology (except for the probably aberrant placement of Salomonia as sister to Securidaca, Fig. 3-11), but only the sister relationship of Comesperma and Monnina was supported in the bootstrap topology (Fig. 3-11), with the other genera forming an unresolved polytomy.

The basic structure of the second clade, i.e., [Hebeclada + Polygala subgen. Ligustrina] sister to a clade with Muraltia, [Chamaebuxus + Heterosamara], and Polygala (with Old

World and New World clades), was supported by my analyses (Fig. 3-11, Appendix 3-

3), but the exact relationships between some of the clades differ in the bootstrap and

strict consensus trees (Figs. 3-1 and 3-11, Appendix 3-3). Again, it is unclear how much

of this might be related to differences in the nuclear versus plastid genomes or how

much of it might be related to differences in taxon sampling, but it does demonstrate the

lack of robustness in hypotheses of relationship among this group of genera.

With respect to the circumscription of Polygala s.str. (as here circumscribed), the

two primary concerns are that the relationships between the Old World groups

Chamaebuxus, Polygala subgen. Chodatia, and Heterosamara are not well-resolved,

and that the New World and Old World clades of Polygala s.str. are not always supported as sister taxa. Taxon sampling for the group containing Chamaebuxus,

Polygala subgen. Chodatia, and Heterosamara has been limited, but morphology does

suggest that the three groups are distinctive. It is conceivable that Polygala s.str. could

be expanded, although results to-date suggest that this is unlikely, and depends on the

exact placement of the genera Muraltia and Salomonia.

Polygala s.str., which is defined here as including the New World and Old World

clades (Figs. 3-1, 3-3, 3-6, 3-8, and 3-11) and excluding all of the proposed segregate

groups discussed above (i.e., Chamaebuxus, Polygala subgen. Chodatia, and

Heterosamara), is supported as a clade in Forest et al. (2007) and in my bootstrap and

strict consensus trees for the combined 179 taxa analyses (Figs. 3-1, 3-3, and 3-11,

Appendix 3-3). While some of the individual analyses (Appendix 3-3) do not support the

monophyly of Polygala s.str., it is from a lack of resolution and not the result of a well- supported, resolved, conflicting topology. Nonetheless, much greater taxon sampling and a careful survey of morphological features are needed, especially to sort out the infrageneric clades within Polygala. It should be noted that there is a small group of

phylogenetically untested African taxa that will probably be supported as a subclade

related to the Tenues s.l. group (Fig. 3-11) within the New World clade, thus, my usage

of the terms “New World” and “Old World” should not be seen as dismissive of this

potential minor exception.

North American Groups and Biogeographic Discussion

Monnina is represented by a single species in the U.S., M. wrightii, in Arizona and

New Mexico, representing the northern limit of a wider range in Mexico. Monnina wrightii also occurs disjunctly in Bolivia and Argentina, with single collections known from Peru and Uruguay (Eriksen, 1993b). Eriksen hypothesized that the Mexican-United

States population is likely the result of long-distance dispersal from the region of Bolivia-

Argentina. My analyses show material from Bolivia does form a clade with material from

Mexico, although there is some genetic divergence, suggesting that these populations may have been isolated for some time. My data show that the Central American species of Monnina do not form a clade, thus it seems clear that there have been multiple movements between the Andes and Central America. Most species of Monnina are shrubs with drupaceous fruits in the mountains of Central and South America, but

Monnina wrightii is a member of a basal grade partially characterized by herbaceous habit and dry, flat, samaroid fruits. This group has been recognized generically as

Pteromonnina, but Eriksen and Persson (2007), although citing unpublished, preliminary data suggesting the group is monophyletic, pointed out that the group is difficult to separate morphologically from other Monnina species. My cladistic analyses indicate that the species of Pteromonnina form a paraphyletic grade (M. leptostachya Benth., M. stenophylla A. St.-Hil., M. tristaniana A. St.-Hil., M. wrightii), not a clade, providing

preliminary support for the conclusion that Pteromonnina should be included within

Monnina. Amphitropical distribution patterns that span the neotropical lowlands are well- known (e.g., Raven, 1963; Solbrig, 1972a, 1972b), and although many involve

California and Chile (e.g., Morrell et al., 2000), some patterns are similar to that of

Monnina wrightii (e.g., Holmes et al., 2008). Long-distance dispersal is accepted as the most likely scenario, but possible vectors and timing are not well understood.

All the remaining North American species of Polygalaceae traditionally have been treated as members of Polygala, with various, largely congruent, subgeneric and

sectional classification schemes. The type species of Polygala is P. vulgaris, a

polymorphic, widespread, mostly European taxon that has been reported as sparingly

introduced in North America. Polygala vulgaris ranges natively to W Asia, with literature

reports from N Africa that are likely based on errors or changed species concepts, as

Paiva (1998) does not report this to be an African taxon. Using the criterion of

monophyly, the only other species that can be maintained within Polygala are those that

are phylogenetically supported as belonging to the same monophyletic group that

contains P. vulgaris. Most of the North American taxa, although distantly related to the

type, can be maintained within Polygala (Figs. 3-11). Twenty North American species,

though, corresponding to four different clades, are more closely related to other genera

than they are to the type group of Polygala. All four of these clades correspond, at least

in part, to traditionally recognized subgenera or sections that are morphologically

diagnosable: Chamaebuxus, Hebecarpa, Hebeclada, and Rhinotropis.

The four segregate genera proposed here can be separated from each other in

North America by the following features. Hebecarpa and Hebeclada have no beak or

crest on their keel, and the sepals are free and caducous in Hebecarpa, while the two

lower sepals are connate in Hebeclada, and all the wings and sepals are persistent in

fruit. The species of Rhinotropis have a cylindric or conic hollow beak on their keel

(reduced or obscure in P. acanthoclada A. Gray, P. intermontana T. Wendt, P. nudata,

and lacking in the extra-limital P. parryi A.W. Benn. and P. purpusii Brandegee), five

petals (the two lateral ones are much reduced and scale-like at base of staminal

column), a persistent upper sepal (in the Lindheimeranae group, P. desertorum

Brandegee and P. rusbyi Greene; deciduous in others), the two lower sepals caducous

(persistent in P. desertorum and P. rusbyi), and 7-8 stamens. For comparison, eight

stamens is the normal condition in most North American species of Polygala, although

seven stamens can rarely be found, and having only six stamens is reportedly the

normal condition in two North American species, P. nana DC. and P. paucifolia. This

variation within Rhinotropis is typical of how diagnostic, characteristic features that may

be synapomorphic can still be homoplasious. Chamaebuxus and Polygala have a crest on their keel (there are a few extra-limital taxa without a crest), and the sepals are free and caducous in Chamaebuxus, while they are free (or rarely the lower two are united in extra-limital taxa) and persistent (rarely caducous) in Polygala, which often has more papery or membranous leaves. The Old World taxa of Chamaebuxus are subshrubs to shrubs up to ca. one meter tall with subcoriaceous leaves, while the North American P.

paucifolia has a low, creeping habit with only a few well-developed leaves near the apex

of the stem, with one to four large flowers (> 13 mm) in a terminal raceme with a very

short peduncle, six stamens (also the normal number in the North American P. nana, a

member of the Decurrentes group), and sometimes has cleistogamous flowers (only

known elsewhere from the three species of the P. polygama Walter complex and from two species of Rhinotropis).

Chamaebuxus contains six or seven species globally, five or six in Europe and northern Africa, with one species disjunct in the eastern U.S., P. paucifolia, which, morphologically, is fairly different from the Old World taxa. Originally described as

Polygala sect. Chamaebuxus DC. (1824), the group was elevated to generic status by

Spach (1839), returned to sectional status by Chodat (1893), although in an expanded sense with three informal subgroups (two of which correspond to Rhinotropis and a group of species now recognized as part of the Chodatia or Heterosamara clades), and then transferred to Polygala subgen. Chamaebuxus by Duchartre (1847), the rank later followed by Blake (1916), who erroneously thought he was the first to describe it as a subgenus, and by Paiva (1998). Morphologically, no existing descriptions are entirely accurate, as they all include elements that are not part of this clade or excluded species that are, e.g., in Blake (1916) the only species treated in Chamaebuxus were those belonging to Rhinotropis, with no reference to the Old World species, nor to P. paucifolia. Blake (1924) later circumscribed P. paucifolia as the sole member of the

Trichlisperma group, presumably as a section of Chamaebuxus or as a subsection of

Rhinotropis, but rank was not explicitly stated, although it was presumably based on the segregate genus Trichlisperma Raf. Paiva’s (1998) description of Chamaebuxus makes no mention of the North American taxon. This North American species is disjunct, isolated, and morphologically distinct from its closest relatives in Europe and northern

Africa, perhaps as a vicariant relict of a historical circumboreal flora.

Hebecarpa contains 40-70 species, ranging from the SW U.S. to Andean South

America. Most species are Mexican, with nine extending into the SW U.S, five of which are included in my phylogenetic analyses (Figs. 3-3 to 3-11). There are several species complexes in this group that are in serious need of revision, with overly fine, and perhaps meaningless, historical splitting (often based on only a single or a few specimens), so that the total number of species is probably fewer than 50. Chodat

(1893) included the genus Badiera DC. as a subsect. in his sect. Hebecarpa, recognizing 25 species in subsect. Euhebecarpa (= subsect. Hebecarpa), but Badiera has since been shown to be a distinctive clade separate from Hebecarpa, e.g., Forest et al. (2007) and my analyses (Figs. 3-3 and 3-11, Table 3-5). Blake (1916) circumscribed three sections, three subsections, and two series within his subgen. Hebecarpa. One of the sections, sect. Biloba Blake, is now known to be part of the Rhinotropis group and is discussed there. The monotypic sect. Huateca Blake, with the Mexican P. tehuacana

Brandegee, has not been included in any phylogenetic analyses, so it should be tentatively viewed as incertae sedis. Section Hebecarpa, which includes all of the North

American species, was divided by Blake into three subsections, subsect. Microthrix

Blake, subsect. Hebantha Blake, and subsect. Adenophora Blake. Subsection

Microthrix contains seven of the North American species, one in ser. Ovatifoliae Blake

(P. ovatifolia Gray), the others in ser. Obscurae Blake. Subsection Hebantha Blake was circumscribed with 34 species, none of them North American. Two of the three species of subsect. Adenophora range into North America, P. glandulosa Kunth and P. macradenia A. Gray. Preliminary molecular DNA analyses (Figs. 3-4 to 3-11), although limited in taxon sampling, suggest that subsect. Adenophora (18/84) is sister to the rest

of Hebecarpa (16/99). Final circumscription of subgroups must await additional study of

more taxa. Species of Hebecarpa in the U.S. are largely restricted to (semi-)arid regions of the southwest, representing contiguous northern expansions of their ranges in

Mexico, which is the center of diversity for this group. A few species range into Central

America and Andean South America, but they are not the basal-most species, suggesting that they have arrived in these regions secondarily.

Hebeclada contains ca. 25 species and occurs throughout Latin America, with only

one species in the United States. There are two deep clades within Hebeclada, which correspond, at least in part, to the two sections recognized by Blake (1916), sect.

Apopetala Blake (6 spp.) and sect. Adenotricha Blake (10 spp.), which were separated on the basis of flower size. Aguiar et al. (2008) recognized 12 species (and seven varieties) in Brazil, but she did not treat sect. Adenotricha and sect. Apopetala as

distinct. All three taxa of sect. Apopetala included in my phylogenetic analyses (Figs. 3-

5, 3-6, 3-8, 3-10, and 3-11) are closely related as part of the Polygala floribunda Benth. complex, so they do not provide a robust test of the apparent reciprocal monophyly of the two sections, but sect. Apopetala, with a branch length of 42 and bootstrap of 100, is supported as sister (54/100) to sect. Adenotricha (40/100). The single North American species, P. grandiflora Walter, is part of a widespread Latin American complex considered to be related to P. violacea Aubl. Many workers, including Blake (1916,

1924) have recognized numerous segregate species out of P. grandiflora, while other workers have lumped all of them, including P. grandiflora, into P. violacea (e.g.,

Bernardi, 2000). Preliminary molecular analyses (Abbott, unpublished data) suggest that P. grandiflora and P. violacea are not each other’s closest relatives. Molecular DNA

analyses and observational field work suggest that the North American segregates

cannot reliably be segregated taxonomically and that P. grandiflora can only be included

in P. violacea if several other currently recognized species are also synonymized,

including many taxa considered by Brazilian workers to be distinct (e.g., Aguiar, 2008).

Therefore, I recommend that P. grandiflora be maintained apart from P. violacea, at

least until there has been a detailed, robustly supported, comprehensive study of the

complex. Restricted to the southeastern U.S. within North America, P. grandiflora may

have moved in from Mexico during one of the hypsithermal intervals known to have

brought western species into the southeast, or it may have spread into the southeast

through Florida via the Caribbean.

Rhinotropis contains 17 species, all in SW United States and Mexico (a single

species, P. purpusii, extends into Guatemala), 13 ranging into the southwestern U.S.,

nine of which are included in the current phylogenetic analyses (Figs. 3-4 to 3-11). Of all

the groups treated here, this is the only one that has been explicitly monographed within

the last 100 years (Wendt, 1978). Blake (1916) treated this group as a section within

subgen. Chamaebuxus and divided it into the monotypic subsect. Pantomone Blake (P. desertorum) and subsect. Eurhinotropis Blake. Wendt (1978) discarded Blake’s subsectional classification, dividing sect. Rhinotropis into three series: ser. Californicae

T. Wendt, ser. Intermontanae T. Wendt, and ser. Lindheimeranae T. Wendt. Wendt

included the species treated by Blake (1916, 1924) as sect. Biloba (of subgen.

Hebecarpa) within his ser. Lindheimeranae. Section Biloba has two species, both

Mexican, P. purpusii and P. parryi. These species were not traditionally considered to

be part of Rhinotropis because of their beak-less keel, but some members of

Rhinotropis can also have an obscure (to rarely lacking) beak and flowers of P. purpusii do rarely develop an obscure beak, and all other features support their inclusion

(Wendt, 1978). My molecular DNA analyses confirm that P. purpusii is not actually part of Hebecarpa, but a member of Rhinotropis, corroborating Wendt’s placement within the ser. Lindheimeranae clade. My analyses support two deep clades within Rhinotropis, one corresponding to ser. Lindheimeranae (with P. cornuta, traditionally part of ser.

Californicae, sister to the rest) and one corresponding to combined ser. Californicae and ser. Intermontanae, with P. californica Nutt. sister to the remaining species. Wendt

(1978) discussed P. californica and P. cornuta as the most primitive species morphologically, which is congruent with my topology (Fig. 3-11); he also wrote that they are not closely related, which is also congruent with my topology. The current topology suggests that the features discussed by Wendt (1978) as diagnostic for ser.

Californicae may be plesiomorphic for Rhinotropis and are, thus, partially retained in P. cornuta, which also has several unique features (autapomorphies). Several of the species are on branches nearly as long as to much longer than the branch that supports

Rhinotropis (up to 118 nucleotides long versus ca. 33 supporting the clade, Fig. 3-11), raising the possibility that incorporating additional species could possibly alter the infra- clade topologies. Although the series Californicae and Intermontanae form a clade

(sister to ser. Lindheimeranae), they are not reciprocally monophyletic (Fig. 3-11), i.e., their recognition as separate taxonomic units is not phylogenetically supported. The two taxa of ser. Intermontanae, P. acanthoclada and P. intermontana, shown by Wendt

(1978) to hybridize, are not supported as sister taxa in the combined nuclear and plastid data analyses (Fig. 3-11). They are, however, supported as sister taxa in the chloroplast

data sets (Figs. 3-7 and 3-8), suggesting that there may be some issue with misleading lineage sorting in the ITS region or, perhaps, lateral gene flow with other taxa. If the latter, it seems likely to have been in a limited introgressive fashion that did not obviously impact morphology. This apparent lack of monophyly for ser. Intermontanae is a cautionary note, warning us of the need to fully integrate multiple sources of data before claiming certitude in hypotheses of relationship. Rhinotropis is probably sister to the Caribbean clade Phlebotaenia, and it also appears to be fairly closely related to the pantropical (although predominantly Neotropical) genus Securidaca. Thus, Rhinotropis is largely endemic to arid regions of southwestern North America and Mexico, where it appears to have evolved (but some species, especially the basally branching ones, can occur in mesic areas).

Even with the recognition of all the distantly related clades as separate, segregate genera, Polygala s.str. still contains a few hundred species and has a nearly cosmopolitan distribution, including the remaining North American species. Greater

taxon sampling of African, Asian, Australian, Brazilian, and southern South American

groups is needed to develop a more robust hypothesis of relationships in the core group

of Polygala s.str. There are dozens of traditional subgroups, many of which are

biogeographically and morphologically distinctive, some of which are preliminarily

supported as clades, at least in part, in my analyses (Fig. 3-11), but many groups simply

have not been sampled yet. Therefore, many relationships are still poorly understood

and based solely on morphology. Except for a few members of the pantropical Tenues

group of sect. Timutua Blake, which is nested within the New World clade, native Old

World and New World species form reciprocally monophyletic sister groups. Given the

need for additional sampling, discussion of subgeneric groups within Polygala s. str. may seem premature. However, some patterns already seem well supported among the

North American taxa and are briefly discussed here, with the understanding that they should be regarded as preliminary.

The North American species of Polygala s.str. were divided by Blake (1916) into two sections, sect. Monninopsis Blake and sect. Timutua. Section Monninopsis [P. dolichocarpa S.F. Blake, P. hemipterocarpa A. Gray, P. scoparia Kunth, P. scoparioides

Chodat] is another group largely endemic to (semi-)arid regions of southwestern North

America, and is supported (65 branch length/100 BS) in cladistic analyses (Figs. 3-4 to

3-11, Table 3-5) as the sister clade to all other New World species (42/100). Section

Timutua was divided by Blake (1916) into six series: 1) ser. Galioideae Chodat [P. alba

Nutt., P. ambigua Nutt., P. aparinoides Hook. and Arn., P. asperuloides Kunth, P.

boykinii Nutt., P. crucianelloides DC., P. leptostachys Shuttlew., P. squamifolia Griseb.,

P. subalata S. Watson, P. verticillata L., P. wurdackiana W.H. Lewis], supported as a

clade (21/93) in my combined 179 taxa analyses (Fig. 3-11), but not all traditionally

classified species are included in the clade, e.g., P. squamifolia; 2) ser. Timoutoideae

Chodat [none in North America], P. hygrophila Kunth is supported as sister to P.

squamifolia in an isolated lineage (49/100), but ITS 179 analyses (Fig. 3-6) show the

lineage to be sister to the remainder of the Galioideae group; more work is needed, with

more Latin American taxa; 3) ser. Glochidiatae Chodat [P. glochidiata Kunth], nested

within the Tenues s.l. group (Fig. 3-11); 4) ser. Trichospermae Chodat [none in North

America; P. adenophora DC., P. longicaulis Kunth, P. trichosperma L., P. variabilis

Kunth], supported as a clade (19/99), including P. cf. obovata A. St.-Hil. and Moq.,

which is not a traditional member of this group (Fig. 3-11); 5) ser. Tenues Chodat [P. galapageia Hook. f., P. glochidiata, P. leptocaulis Torr. and A. Gray, P. oxyrhynchos

Chodat, P. paniculata L., P. sancti-georgii L. Riley, P. sericea A.W. Bennett, P. tamariscea Mart. ex A.W. Bennett, P. tenuis DC., P. tuberculata Chodat], weakly supported as a clade (collapses in bootstrap but not strict consensus, Fig. 3-11) and the exact circumscription is in doubt, with greater taxon sampling required; this is the only

New World group that may include a subclade of Old World (African) species; 6) ser.

Incarnatae Chodat [P. incarnata L., P. setacea Michx.], supported as a clade (44/100) as narrowly defined (Fig. 3-11); other treatments have proposed the inclusion of other taxa from the southeastern U.S., e.g., P. cruciata L. and relatives, but those taxa are not supported as closely related (Fig. 3-11). This last group (ser. Incarnatae) also exemplifies how finely split the classification system could become once fuller taxon sampling is nomenclaturally assessed in light of phylogeny and morphology, i.e., it is sister to the P. polygama Walter group (3 species), but one would be morphologically hard-pressed to justify treating the two groups as a single named entity, whereas they are individually distinctive. Another clade, not explicitly named by Blake (1916 or 1924) is the Decurrentes group [P. balduinii Nutt., P. cymosa Walter, P. lutea L., P. nana DC.,

P. ramosa Elliott, P. rugelii Shuttlew. ex Chapm., P. smallii R.R. Sm. and D.B. Ward], which is well-supported (20/100) and also well-supported as sister (Fig. 3-11) to an unnamed clade of species from the southeastern U.S. (17/100). All species of Polygala s.str. from North America have been included in my analyses, and, perhaps, one of the more surprising results of my analyses was the North American Polygala senega L. being well-supported (13/100) as sister to the South American P. duarteana A. St.-Hil.

and Moq. (Figs. 3-5, 3-6, 3-8, 3-10, and 3-11). Ultimately, recircumscribing groups or

naming novel clades should await more detailed studies, especially ones employing

morphology and with greater taxon sampling.

As can be seen in all of the cladograms (Figs. 3-1 to 3-11, Appendix 3-3), there

are several isolated lineages of South American taxa [P. brasiliensis L., P. celosioides

A.W. Bennett, P. cyparissias A. St.-Hil. and Moq., P. subandina Phil.] that likely

represent undersampled clades. These groups, and the other issues requiring additional

taxon sampling, especially relationships within Polygala s. str., will be addressed in a

subsequent publication. The North American species of Polygalaceae also will be

addressed more thoroughly in a forthcoming floristic publication (as part of the Flora of

North America project).

New Combinations and Changes of Status

Chamaebuxus (DC.) Spach, Hist. Nat. Veg. 7: 125. 1839. Polygala L. sect. Chamaebuxus DC., Prod. 1: 331. 1824. Polygala L. subg. Chamaebuxus (DC.) Duch. in Orbigny, Dict. Univ. Hist. Nat. 10: 381. 1849. Type species: Polygala chamaebuxus L.

Chamaebuxus paucifolia (Willd.) J.R. Abbott, comb. nov. Polygala paucifolia Willd., Sp. Pl. 3(2): 880. 1802.

Hebecarpa (Chodat) J.R. Abbott, comb. and stat. nov. Polygala L. sect. Hebecarpa Chodat, Mém. Soc. Phys. Genève 31, pt. 2, no. 2: 9. 1893. Polygala L. subgen. Hebecarpa (Chodat) S.F. Blake, Contr. Gray Herb. 47: 17. 1916. Type species: Polygala obscura Benth.

Hebecarpa barbeyana (Chodat) J.R. Abbott, comb. nov. Polygala barbeyana Chodat, Mém. Soc. Phys. Genève 31, pt. 2, no. 2: 16. 1893.

Hebecarpa glandulosa (Kunth) J.R. Abbott, comb. nov. Polygala glandulosa Kunth, Nov. Gen. Sp. 5: 404. 1823.

Hebecarpa longa (S.F. Blake) J.R. Abbott, comb. nov. Polygala longa S.F. Blake, Contr. Gray Herb. 47: 29. 1916.

Hebecarpa macradenia (A. Gray) J.R. Abbott, comb nov. Polygala macradenia A. Gray, Smithsonian Contr. Knowl. 3: 39. 1852.

Hebecarpa macradenia (A. Gray) J.R. Abbott var. glanduloso-pilosa (Chodat) J.R. Abbott, comb. nov. Polygala macradenia A. Gray var. glanduloso-pilosa (Chodat) S.F. Blake, Contr. Gray Herb. 47: 56. 1916.

Hebecarpa obscura (Benth.) J.R. Abbott, comb. nov. Polygala obscura Benth., Pl. Hartw. 58. 1840.

Hebecarpa orthotricha (S.F. Blake) J.R. Abbott, comb. nov. Polygala orthotricha S.F. Blake, Contr. Gray Herb. 47: 31. 1916.

Hebecarpa ovatifolia (A. Gray) J.R. Abbott, comb. nov. Polygala ovatifolia A. Gray, Smithsonian Contr. Knowl. 3: 39. 1852.

Hebecarpa palmeri (S. Watson) J.R. Abbott, comb. nov. Polygala palmeri S. Watson, Proc. Amer. Acad. Arts 17: 325. 1882.

Hebecarpa piliophora (S.F. Blake) J.R. Abbott, comb. nov. Polygala piliophora S.F. Blake, N. Amer. Fl. 25: 320. 1924.

Hebecarpa racemosa (S.F. Blake) J.R. Abbott, comb. nov. Polygala racemosa S.F. Blake, Contr. Gray Herb. 47: 28. 1916.

Hebecarpa rectipilis (S.F. Blake) J.R. Abbott, comb. nov. Polygala rectipilis S.F. Blake, Contr. Gray Herb. 47: 27. 1916.

Hebecarpa reducta (S.F. Blake) J.R. Abbott, comb. nov. Polygala reducta S.F. Blake, Contr. Gray Herb. 47: 25. 1916.

Hebeclada (Chodat) J.R. Abbott, comb. and stat. nov. Polygala L. sect. Hebeclada Chodat, Mém. Soc. Phys. Genève 31, pt. 2, no. 2: 43. 1893. Polygala L. subgen. Hebeclada (Chodat) S.F. Blake, Contr. Gray Herb. 47: 59. 1916. Type species: Polygala hebeclada DC.

Hebeclada grandiflora (Walter) J.R. Abbott, comb. nov. Polygala grandiflora Walter, Fl. Carol. 179. 1788.

Rhinotropis (S.F. Blake) J.R. Abbott, comb. and stat. nov. Polygala L. sect. Rhinotropis S.F. Blake, Contr. Gray Herb. 47: 70. 1916. Polygala L. subgen. Rhinotropis (Blake) Paiva, Fontqueria 50: 148. 1998. Type species: Polygala lindheimeri A. Gray.

Rhinotropis acanthoclada (A. Gray) J.R. Abbott, comb. nov. Polygala acanthoclada A. Gray, Proc. Amer. Acad. Arts 11: 73. 1876.

Rhinotropis californica (Nutt.) J.R. Abbott, comb. nov. Polygala californica Nutt., Fl. N. Amer. 1: 671. 1840.

Rhinotropis cornuta (Kellogg) J.R. Abbott, comb. nov. Polygala cornuta Kellogg, Proc. Calif. Acad. Sci. 1(ed. 2): 63. 1873.

Rhinotropis cornuta (Kellogg) J.R. Abbott ssp. fishiae (Parry) J.R. Abbott, comb. nov. Polygala fishiae Parry, Proc. Davenport Acad. Nat. Sci. 4: 39. 1884.

Rhinotropis heterorhyncha (Barneby) J.R. Abbott, comb. nov. Polygala subspinosa S. Watson ssp. heterorhyncha Barneby, Leafl. W. Bot. 3: 194. 1943.

Rhinotropis intermontana (T. Wendt) J.R. Abbott, comb. nov. Polygala acanthoclada A. Gray var. intricata Eastwood, Proc. Calif. Acad. Sci. ser. 2, 6: 283. 1896.

Rhinotropis lindheimeri (A. Gray) J.R. Abbott, comb. nov. Polygala lindheimeri A. Gray, Boston J. Nat. Hist. 6: 150. 1850.

Rhinotropis lindheimeri (A. Gray) J.R. Abbott var. eucosma (S.F. Blake) J.R. Abbott, comb. nov. Polygala eucosma S.F. Blake, Contr. Gray Herb. 47: 72. 1916.

Rhinotropis lindheimeri (A.Gray) J.R. Abbott var. parvifolia (Wheelock) J.R. Abbott, comb. nov. Polygala lindheimeri A. Gray var. parvifolia Wheelock, Mem. Torrey Bot. Club 2: 143. 1890.

Rhinotropis maravillasensis (Correll) J.R. Abbott, comb. nov. Polygala maravillasensis Correll, Wrightia 3: 131. 1965.

Rhinotropis minutifolia (Rose) J.R. Abbott, comb. nov. Polygala minutifolia Rose, Contr. U.S. Natl. Herb. 13: 307. 1911.

Rhinotropis nitida (Brandegee) J.R. Abbott, comb nov. Polygala nitida Brandegee, Univ. Calif. Publ. Bot. 4: 272. 1912.

Rhinotropis nitida (Brandegee) J.R. Abbott var. goliadensis (T. Wendt) J.R. Abbott, comb. nov. Polygala nitida Brandegee var. goliadensis T. Wendt, J. Arnold Arbor. 60: 508. 1979.

Rhinotropis nitida (Brandegee) J.R. Abbott var. lithophila (S.F. Blake) J.R. Abbott, comb. nov. Polygala nitida Brandegee var. lithophila (S.F. Blake) T. Wendt, J. Arnold Arbor. 60: 507. 1979. Polygala lithophila S.F. Blake, Contr. Gray Herb. 47: 74. 1916.

Rhinotropis nitida (Brandegee) J.R. Abbott var. tamaulipana (T. Wendt) J.R. Abbott, comb. nov. Polygala nitida Brandegee var. tamaulipana T. Wendt, J. Arnold Arbor. 60: 508. 1979.

Rhinotropis nudata (Brandegee) J.R. Abbott, comb. nov. Polygala nudata Brandegee, Univ. Calif. Pub. Bot. 4: 183. 1911.

Rhinotropis rimulicola (Steyermark) J.R. Abbott, comb. nov. Polygala rimulicola Steyermark var. rimulicola, Ann. Missouri Bot. Gard. 19: 390. 1932.

Rhinotropis rimulicola (Steyermark) J.R. Abbott var. mescalerorum (T. Wendt and T.K. Todsen) J.R. Abbott, comb. nov. Polygala rimulicola Steyermark var. mescalerorum T. Wendt and T.K. Todsen, Madroño 29: 20. 1982.

Rhinotropis rusbyi (Greene) J.R. Abbott, comb. nov. Polygala rusbyi Greene, Bull. Torrey Bot. Club 10: 125. 1883.

Rhinotropis subspinosa (S. Watson) J.R. Abbott, comb. nov. Polygala subspinosa S. Watson, Amer. Naturalist 7: 299. 1873.

Table 3-1. DNA primers used in this study. ITS forward CGAGAAGTCCACTGAACCTTATC ITS reverse TCTTYTCCTCCGCTTATTGATATGC ITS internal reverse GCGTTCAAAGACTCGATGGTTC ITS internal forward GACTCTCGGCAACGGATATCTCGGC ITS 101 (forward) ACGAATTCATGGTCCGGTGAAGTGTTCG ITS 102 (reverse) TAGAATTCCCCGGTTCGCTCGCCGTTAC trnL forward CGAAATCGGTAGACGCTACG trnL-F reverse ATTTGAACTGGTGACACGAG trnL internal forward GGTTCAAGTCCCTCTATCCC trnL internal reverse GGGGATAGAGGGACTTGAAC

Table 3-2. Numerical results of phylogenetic analyses in this study. Length is the tree length, a function of the number of characters and states and a measure of the number of steps to account for the data in the most parsimonious manner; #1 is the total number of characters; #2 is the number of phylogenetically informative characters (% of total characters); and #3 is the number of variable but phylogenetically uninformative characters; # trees is the total number of most parsimonious trees found in the analyses.;CI is the consistency index; CIu is the consistency index excluding uninformative characters; RI is the retention index and RC is the rescaled consistency index. gene region length #1 #2 #3 # CI CIu RI RC trees ITS 56 2280 1032 436 173 6 0.500 0.448 0.703 0.352 (42%) ITS 109 4753 1089 621 177 663 0.357 0.326 0.681 0.243 (57%) ITS 179 6663 1094 690 156 3020 0.287 0.265 0.718 0.206 (63%) trnL intron 56 307 670 105 71 8670 0.726 0.627 0.916 0.665 (16%) trnL intron 109 620 1016 178 88 1170 0.616 0.538 0.889 0.548 (18%) trnL intron 179 924 1043 218 151 830 0.577 0.482 0.879 0.507 (21%) trnL-F spacer 320 513 118 72 8860 0.778 0.702 0.927 0.722 53 (23%) trnL-F spacer 320 513 118 72 8660 0.778 0.702 0.927 0.722 56 (23%) trnL-F spacer 680 641 189 114 6980 0.649 0.569 0.897 0.582 109 (29%) trnL-F spacer 681 641 188 115 5800 0.649 0.569 0.899 0.583 179 (29%) cp com 56 630 1183 223 143 6160 0.749 0.661 0.920 0.689 (19%) cp com 109 1308 1657 367 202 7090 0.629 0.550 0.892 0.561 (22%) cp com 179 1610 1684 406 266 2770 0.606 0.517 0.886 0.537 (24%) total com 56 2934 2215 659 316 6 0.550 0.483 0.773 0.425 (30%) total com 109 6107 2746 988 379 137 0.413 0.366 0.745 0.307 (36%) total com 179 8343 2778 1096 422 1990 0.346 0.305 0.757 0.262 (39%)

Table 3-3. Absolute increases and percent increases in the number of characters and length with increasing number of taxa. total # # informative length characters characters ITS 56-109 57 (6.5%) 185 (42%) 2473 (108%) ITS 109-179 5 (0.5%) 69 (11%) 1910 (40%) ITS 56-179 62 (6%) 254 (58%) 4383 (192%) trnL 56-109 346 (52%) 73 (70%) 313 (102%) trnL 109-179 27 (3%) 40 (22%) 304 (49%) trnL 56-179 373 (56%) 113 (108%) 617 (201%) trnL-F 56-109 128 (25%) 71 (60%) 360 (113%) cp comb 56-109 474 (40%) 144 (65%) 678 (108%) cp comb 109-179 27 (2%) 39 (11%) 302 (23%) cp comb 56-179 501 (42%) 183 (82%) 980 (156%) total comb 56-109 531 (24%) 329 (50%) 3173 (108%) total comb 109-179 32 (1%) 108 (11%) 2236 (37%) total comb 56-179 563 (25%) 437 (66%) 5409 (184%)

Table 3-4. Node support values. The 56 taxa analyses have 55 ingroup taxa (54 nodes theoretically maximal), the 109 taxa analyses have 107 ingroup taxa (106 nodes theoretically maximal), and the 179 taxa analyses have 177 ingroup taxa (176 nodes theoretically maximal); the theoretical maxima were used for calculating the percent of resolved nodes, while the BS values are a percentage of the total BS-supported nodes (rounded to nearest %). # nodes 50–79 # nodes 80–89 # nodes 90-99 # nodes 100 # nodes > 50% BS, # strict BS (%) BS (%) BS (%) BS (%) consensus nodes, # phylogram nodes (%) ITS 56 13 (30%) 6 (14%) 10 (23%) 14 (33%) 43, 42, 53 (55 ingroup taxa) (80%, 78%, 98%) ITS 109 28 (33%) 5 (6%) 26 (31%) 25 (30%) 84, 84, 106 (107 ingroup taxa) (79%, 79%, 100%) ITS 179 39 (29%) 18 (14%) 34 (26%) 41 (31%) 132, 130, 169 (177 ingroup taxa) (75%, 74%, 96%) trnL 56 12 (37%) 4 (19%) 10 (33%) 3 (11%) 29, 29, 39 (54%, 54%, 72%) trnL 109 20 (38%) 16 (29%) 11 (17%) 7 (15%) 54, 59, 77 (51%, 56%, 73%) trnL 179 35 (40%) 20 (20%) 27 (31%) 7 (9%) 89, 103, 125 (51%, 59%, 71%) trnL-F 53 8 (26%) 6 (22%) 9 (33%) 4 (19%) 27, 32, 39 (53%, 63%, 76%) trnL-F 56 (3 taxa missing data) 7 (28%) 9 (44%) 4 (28%) 0 20, 1, 38 (37%, 2%, 70%) trnL-F 109 19 (34%) 9 (19%) 18 (38%) 6 (9%) 52, 55, 83 (49%, 52%, 78%) trnL-F 179 (70 taxa missing data) 15 (43%) 16 (36%) 12 (21%) 0 43, 1, 79 (24%, 0.6%, 45%) chloroplast 56 12 (29%) 2 (11%) 14 (31%) 10 (29%) 38, 39, 46 (70%, 72%, 85%) chloroplast 109 25 (31%) 10 (14%) 23 (25%) 18 (30%) 76, 76, 91 (72%, 72%, 86%) chloroplast 179 38 (37%) 15 (12%) 38 (35%) 15 (15%) 106, 119, 138 (60%, 68%, 78%) combined 56 14 (29%) 3 (6%) 11 (23%) 20 (42%) 48, 52, 54 (89%, 96%, 100%) combined 109 28 (27%) 7 (11%) 23 (22%) 39 (40%) 97, 99, 106 (92%, 93%, 100%) combined 179 44 (26%) 12 (11%) 38 (25%) 58 (38%) 152, 162, 171 (86%, 92%, 97%)

Table 3-5: Bootstrap support (BS) values for named clades across all analyses for 56, 109, and 179 taxa (see Fig. 11 for named groups); chloroplast 179 not included as 70 taxa are missing trnL-F data (so trnL-F 179 also missing data for 70 taxa). (---) - clade not tested; (0) - clade not supported (not recovered or with < 50% BS); (*) - clade not supported in strict consensus; (*0) - clade supported in strict consensus but with < 50% BS support. Non- italicized names are informal groups. Italicized names are genera. ITS trnL trnL-F chloroplast combined 56 109 179 56 109 179 56 109 179 56 109 56 109 179 Acanthocladus ------100 ------98 ------0 ------100 Badiera --- 97 100 --- 0 0 --- 0 0 --- 0 --- 100 100 Badiera + Hebecarpa 0 0 0 98 98 98 89 99 86 100 100 96 95 95 clade Bredemeyera ------100 ------89 ------0 ------100 Carpolobiae ------100 ------60 ------0 ------100 Chamaebuxus --- 100 93 --- 72 59 --- 60 58 --- 86 --- 100 94 Comesperma ------63 ------0 ------0 ------62 Decurrentes 100 99 99 0 0 0 0 66 59 78 79 100 100 100 Galioideae 100 90 86 69 0 0 0 76 64 99 86 100 93 94 Hebecarpa 98 100 100 61 61 68 78 93 88 94 96 76 100 100 Hebeclada --- 100 100 --- 0 53 --- 95 0 --- 99 --- 100 100 Hebeclada + Ligustrina --- 0 69 --- 0 0 --- 0 0 --- *0 --- 67 84 clade Ligustrina ------100 ------100 ------0 ------100 Monnina --- 100 100 --- 100 100 --- 98 0 --- 100 --- 100 100 Monnina + --- 52 0 --- 0 0 --- 0 0 --- *0 --- 72 63 Comesperma clade Monninopsis 100 100 100 100 100 100 0 52 59 99 100 100 100 100 Moutabeae ------67 ------80 ------0 ------97 Muraltia --- 100 100 --- 100 82 --- 100 0 --- 100 --- 100 100 Polygala 84 50 *0 0 0 0 0 0 0 0 59 88 86 67* [NW +OW] Polygala - 55 65 72 93 89 90 0 99 0 100 100 100 100 100 New World (NW) Polygala - 83 65 60 0 0 0 0 83 0 0 91 77 99 96 Old World (OW) Polygaleae 1 (†) 99 92 98 98 83 91 0 0 0 100 83 100 98 99 Polygaleae 2 (†) 0 0 0 0 97 97 0 0 0 0 100 0 0 66 Rhinotropis 70 97 97 64 85 82 69 67 56 97 96 98 100 100 Securidaca --- 99 99 --- 86 89 --- 97 0 --- 100 --- 100 100 Tenues s.l. 0 0 0 0 0 0 0 0 0 0 0 *0 0 *0

Table 3-5. Continued ITS trnL trnL-F chloroplast combined 56 109 179 56 109 179 56 109 179 56 109 56 109 179 Trichospermae --- 97 86 --- 65 56 --- 0 0 --- 79 --- 100 99 Xanthophyllum ------100 ------100 ------0 ------100 unnamed clades with > 23 43 75 13 25 40 12 25 26 19 37 26 52 85 80% BS total # clades with > 30 56 93 17 34 54 13 33 28 26 51 34 69 108 80% BS (†) -- Polygaleae 1 = Acanthocladus, Badiera, Bredemeyera, and Hebecarpa [pro parte in 56 taxa analyses]; Polygaleae 2 = all Polygaleae except Polygaleae

Figure 3-1. Generic clades supported across bootstrap and strict consensus analyses. Combined chloroplast, ITS, and combined nuclear and plastid results.

Figure 3-2. Generic clades -- chloroplast details. Plastid trnL-F spacer and trnL intron results.

Figure 3-3. Generic clades with support values and known base chromosome numbers. Based on the combined 179 taxa analyses.

Figure 3-4. Synopsis of ITS 56 taxa analyses.

100

Figure 3-5. Synopsis of ITS 109 taxa analyses.

101

Figure 3-6. Synopsis of ITS 179 taxa analyses.

102

Figure 3-6. Continued

103

Figure 3-7. Synopsis of chloroplast (trnL-F and trnL intron) 56 taxa analyses.

104

Figure 3-8. Synopsis of chloroplast (trnL-F and trnL intron) 109 taxa analyses.

105

Figure 3-9. Synopsis of combined (ITS, trnL-F, and trnL intron) 56 taxa analyses.

106

Figure 3-10. Synopsis of combined 109 (ITS, trnL-F, and trnL intron) taxa analyses.

107

Figure 3-11. Synopsis of combined 179 (ITS, trnL-F, and trnL intron) taxa analyses.

108

Figure 3-11. Continued

109

CHAPTER 4. TAXONOMIC REVISION OF BADIERA (POLYGALACEAE): A CARIBBEAN CLADE

Introduction

There has long been disagreement about generic delimitation within the

Polygaleae (Polygalaceae), especially with respect to the circumscription of traditional

Polygala s.l. (Chodat, 1891a, b, 1893; Nieuwland, 1914; Blake, 1916, 1924; Paiva,

1998; Rankin R., 2003; Eriksen and Persson, 2007). Recent phylogenetic analyses

have demonstrated the polyphyly of Polygala, as broadly circumscribed, and have shed some light on which traditional names correspond to clades (Eriksen, 1993; Paiva,

1998; Persson, 2001; Forest et al., 2007; Abbott et al., see Chapter 3). One clade, referred to as Polygaleae 1 by Persson (2001), includes the genus Bredemeyera s.str. and three traditional subgenera of Polygala, i.e., P. subgen. Acanthocladus, subgen.

Hebecarpa, and subgen. Badiera. A fourth traditional subgenus, P. subgen.

Gymnospora, was also supported as a member of the Polygaleae 1 clade in the analysis of Forest et al. (2007). The Polygaleae 1 clade is more distantly related to the clade that contains the type of Polygala than are all other genera of Polygaleae, thus recognizing the distinctive subclades of Polygaleae 1 as genera results in a more robust and predictive classification, which better reflects patterns of relationship (see Chapter

3).

Both Acanthocladus and Badiera have been treated as segregate genera in the

past, and Hebecarpa has also recently been elevated to generic status (see Chapter 3).

Badiera is sister to the Hebecarpa clade (Figs. 3-11, 4-1, and discussion in Chapter 3).

The most obvious and likely morphological synapomorphies uniting the species of

Badiera are reduced lateral sepals (wings; Figs. 4-2 to 4-7) and thick-walled fruits that

110

retain the seeds, which are bluish-black and associated with a fleshy orange aril (Figs.

4-8 to 4-14), presumably involved in dispersal by birds. Other features traditionally used

to delimit the Badiera clade, such as being shrubs greater than 1 m tall and having

flowers lacking a crest on the keel petal, are now best understood as retained plesiomorphies. Preliminary anatomical work has shown the leaves of all Badiera

species to be dorsiventral (Figs. 4-15 to 4-18), while leaves of all studied species of

Hebecarpa are isobilateral (Abbott and Carlsward, in prep.). Having dorsiventral leaves

is likely the ancestral state, but taxon sampling to date is inadequate to fully address the

level of universality of anatomical features. Palynological data also support the

distinctiveness of Badiera (Banks et al., 2008; Abbott, unpublished data), with this

genus, once again, appearing to have retained the plesiomorphic character state, i.e., 8-

10 colpi per grain vs. 17-22 in Hebecarpa (Fig. 4-19).

In addition to the above-mentioned generic-level problems, the species

relationships and correct names within Badiera have also been poorly understood,

necessitating this taxonomic revision. For instance, Chodat (1891a) recognized three

species in the Badiera group, while Britton (1910) recognized six species at first with

five additional species later recognized (Britton, 1915). Blake (1916) also recognized 11

species but without using all the same names as Britton (1915), and he only recognized

ten species a few years later (Blake, 1924). The most recent treatment (Bernardi, 2000)

only recognized six species, synonymizing entities that earlier workers had treated as

distinct. Thus, there is no consensus as to how many species should be recognized, let

alone how to circumscribe them or what their correct names should be. This revision

aims to resolve species circumscriptions and relationships in Badiera.

111

Taxonomic History

The first species of Badiera to be described was B. penaea. Originally discovered

by Charles Plumier during a visit to the Haitian portion of Hispaniola around the turn of

the 18th century, B. penaea was published in 1703, as Penaea arborescens, an

unavailable genus name in the Polygalaceae as Linnaeus had used it in 1753 for a

different group of plants. Unfortunately, Plumier’s specimens were lost in a shipwreck,

so a scanty description and an illustration of a flower and fruit were the only lasting documentation (Bernardi, 2000). It is likely that Linnaeus was able to study Plumier’s illustrations while working with Boerhaave from 1735-1737, and this formed the basis for his publication of B. penaea, as Polygala penaea, in 1753 (Bernardi, 2000). Thirty years later, N.J. Jacquin published the results of his Antillean travels, including the re- description of B. penaea, as Polygala domingensis. The first to actually propose the name Badiera was A.P. de Candolle (1824), based on Plumier’s illustration, but de

Candolle’s treatment was a compilation of names proposed by others, rather than a

careful analysis of the included taxa. Thus, he included a species now known to be

based on a collection of Securidaca and two species now known to be part of the

Hebecarpa clade (see Chapter 3), and he maintained both B. domingensis and B.

penaea as if they were distinct taxa.

Chodat (1893) treated Badiera as a subgroup of Polygala sect. Hebecarpa and

described the second validly published taxon recognized in this revision, B. jamaicensis

(as P. jamaicensis). Another German worker, Ignacio Urban, described Badiera

fuertesii, chronologically the sixth validly published taxon recognized here (Urban,

1912). With the notable exception of the renowned Swedish botanist, Erik Ekman, who

collected Badiera extensively between 1914 and 1929 (along with thousands of other

112

specimens), none of the European botanists had more than a fleeting familiarity with

Badiera in the wild. Nathaniel Lord Britton was the first American botanist to publish on

Badiera (e.g., 1910, 1916), and he was the first worker to actually have extensive field

experience with Badiera. Britton described many new species, including four taxa

recognized in this revision (order of publication): B. cubensis (fifth), B. oblongata (third),

B. propinqua (seventh) and B. virgata (fourth). Contemporaneously with the later years

of Britton, another American, Sidney Blake published many new combinations and new

names (1916, 1924) related to Badiera, which he recognized as a subgenus of

Polygala. None of the names of Blake are currently recognized, perhaps reflecting the

fact that he had no field experience with the taxa and that for many of the taxa he

described he had not even seen herbarium material, i.e., he compiled descriptions from

others in the absence of personal experience with, or study of, the taxa.

The only modern treatment to provide a broad overview of American Polygala

and relatives (Bernardi, 2000) recognized six species of Badiera, as a section within

Polygala subgen. Procerae. Bernardi’s impressive and beautifully composed and illustrated work is marred by the lack of a phylogenetic context for recognizing groups

and by a clear lack of field-familiarity with many of the taxa. In essence, a strong

emphasis on the study of herbarium material (sometimes limited) in the absence of

complementary field study led to many examples of distinctive entities being combined,

including one example in Badiera, i.e., Bernardi included B. cubensis within B.

propinqua.

The last two species of Badiera to be described were only recognized very

recently, although notes on specimens make it clear that botanists were aware of the

113

distinctiveness of the taxa for decades prior to their publication. The Cuban endemic, B.

alternifolia, was described by a Cuban botanist, Rosa Rankin, while the final taxon, B.

subrhombifolia, a Hispaniolan endemic, is described as part of my dissertation (see

Chapter 2). Phylogenetic analyses of molecular DNA data (Persoon, 2001; Forest et al.,

2007; and my data, see Chapter 3) have supported de Candolle’s view that Badiera

merits generic recognition, a conclusion also supported by Britton in his early

publications (1910, 1916). The next revolution in our understanding of Badiera will likely

depend on detailed study of population-level genetics and morphometrics.

Materials and Methods

Field work was conducted in Cuba, the Dominican Republic, Guatemala, and

Mexico, in order to study all of the species of Badiera in the field, for a total of ca. 500

individuals across 28 populations: B. alternifolia (1 population), B. cubensis (1

population), B. fuertesii (2 populations), B. jamaicensis (2 populations), B. oblongata (10

populations), B. penaea (3 populations), B. propinqua (2 populations), B. subrhombifolia

(1 population), and B. virgata (6 populations). An understanding of the patterns of

variation within natural populations was integrated with the study of approximately 1500

additional herbarium specimens. Vegetative features were measured from herbarium material. Floral and fruit measurements were made with material field-preserved in FAA

(5 parts commercial formalin [= 37% formaldehyde solution], 5 parts glacial acetic acid, and 90 parts ethanol [70%]) that was later transferred to 70% ethanol, or the measurements were made with material rehydrated (in hot water) from herbarium specimens. With respect to specimens examined, HFC is a collection series related to the Cuban Flora Project (= PFC in earlier literature).

114

Information on habit and color of various reproductive parts are based on field observations and/or specimen labels. Leaf measurements are of leaves that are fully expanded, avoiding leaves at the apex of shoots if they are smaller than nearby leaves, as well as the 2-3 cataphyll-like leaves near the base of many lateral shoots. Leaf pubescence density was measured by counting the number of hairs along a linear millimeter of blade tissue perpendicular to the midvein near mid-leaf. Flowers were measured post-anthesis, with anthesis defined as flowers with spreading upper petals and dehisced anthers. Dense hairs at the apex of the filament sheath made it very difficult to ascertain the exact point of distinction between the filament sheath and the free filaments, so length measurements were based only on the portion of the free filaments not obscured by hairs. Because of the fusion at the base of the flower, measurements of a given floral structure can vary based on whether they are measured adaxially or abaxially. For instance, sepals appear longer abaxially than they do adaxially, and the petals are basally fused with the filament sheath. If one carefully rips all the floral organs apart, it is difficult to know how much of the base includes tissue involved in fusion, but if the structure is measured adaxially, the measurements will be smaller, even though the exact degree of fusion is difficult to ascertain without carefully dissecting wetted flowers. This situation primarily affects the sepals; the corolla parts measured adaxially vs. abaxially only differ by 2-3 tenths of a millimeter, depending on the point chosen as the base of the flower.

Vegetative anatomy was studied for all species, using material field-preserved in

FAA that was later transferred to 70% ethanol. Transverse (TS) and longitudinal (LS) sections of unembedded leaves, petioles, stems, and roots were made with a sliding

115

microtome at a thickness of 30 to 90 μm. All sections were stained with Heidenhain’s

iron-alum hematoxylin and safranin. Safranin stains lignin, cutin, and suberin red (e.g.,

xylem, sclerenchyma, and cuticle), while collenchyma and phloem stain dark purplish

with hematoxylin. Leaf clearings were made using a 5% NaOH solution, followed by

saturated chloral hydrate, and then stained with saffranin. Dehydration of stained

sections and leaf clearings was carried out in a graduated ethanol series followed by

clearing in limonene. Sections were then mounted on microscope slides with Canada

balsam and photographed with an Zeiss Axioskop 40 microscope attached to a Pixera

Pro 150es digital camera.

Molecular work with Badiera, i.e., DNA sequence analysis, was based on fifty-four

accessions representing at least 45 populations of all nine species of Badiera.

Phylogenetic analysis of the DNA sequence data was based on nuclear ribosomal ITS

(including ITS1, ITS2, and 5.8S) and five plastid regions: matK, the trnL intron, the trnL-

F spacer, trnC-ycf6, and ycf6-psbM. DNA material was obtained from wild-collected plants, herbarium specimens, and cultivated plants (Table 4-1). Fresh-collected material

(leaf fragments) was field-preserved in silica gel (Chase and Hills, 1991). Genomic DNA was later extracted using a cetyl trimethylammonium bromide (CTAB) technique

(modified from Doyle and Doyle, 1987), scaled to a 1 mL volume reaction.

Approximately 0.5-1 cm2 of dried tissue was ground in 1 mL of CTAB 2X buffer, with

either 8 μL of β-mercaptoethanol or 10 μL of proteinase-K. Most total DNAs were cleaned with Qiagen QIAquick PCR purification columns to remove inhibitory compounds. Amplifications were performed using a Biometra T-gradient or an

Eppendorf Mastercycler EP Gradient S thermocycler and Sigma brand reagents in 25

116

μL volumes. Primers, modified from Taberlet et al. (1991), Johnson and Soltis (1994),

Demesure et al. (1995), Blattner (1999), and Shaw et al. (2005), are listed in Table 4-2.

Amplification products were cleaned with Microclean™ (The Gel Company, San

Francisco, CA, USA) following the manufacturer’s protocols, eluted with 50 μL of 10 mM

Tris-HCl (pH 8.5), and stored at 4°C until cycle sequenced.

nrITS (ITS 1 + 5.8S rDNA+ ITS 2). This region was amplified using 0.5-1.0 μL

template DNA (~10-100 ng), 11 μL water, 6.5 μL 5M Betaine, 2.5 μL 10X buffer, 3 μL

25mM MgCl2, 0.5 μL of 10 μM dNTPs, 0.5 μL each of 10 μM primers, and 0.5 units Taq.

Thermocycler settings used a “touchdown” with the parameters 94°C, 2 min; 15 cycles

(94°C, 1 min; 76°C, 1 min, reducing 1°C per cycle; 72°C, 1 min); 21 cycles (94°C, 1 min;

59°C, 1 min; 72°C, 1 min); 72°C, 3 min. Sometimes, especially with herbarium material,

the ITS region was amplified in two pieces using internal primers.

plastid regions. Five plastid regions were studied: matK, the trnL intron, the trnL-

F spacer, trnC-ycf6, and ycf6-psbM. Many workers collectively refer to the trnL intron

and adjacent trnL-F spacer as trnL-F, and, in fact, they were amplified as a single unit

for many of my taxa. Some accessions of trnL and matK, especially herbarium material, were amplified in two pieces using internal primers. These regions were amplified using

0.5-1.0 μL template DNA (~10-100 ng), 16-17.5 μL water, 2.5 μL 10X buffer, 2-4 μL mM

MgCl2, 0.5 μL of 10 μM dNTPs, 0.5 μL each of 10 μM primers, and 0.5 units Taq.

Thermocycler settings were: 94°C, 3 min; 33 cycles of (94°C, 1 min; 58°C, 1 min; 72°C,

1 min, 20 sec); 72°C, 6 min.

Purified PCR products were cycle-sequenced using the parameters 96°C, 10 sec;

25 cycles of (96°C, 10 sec; 50°C, 5 sec; 60°C, 4 min), with a mix of 3 μL water, 1 μL

117

fluorescent Big Dye dideoxy terminator, 2 μL Better Buffer™ (The Gel Company), 1 μL template, and 0.5 μL primer. Cycle sequencing products were cleaned using ExoSAP™

(USB Corporation, OH, USA) following the manufacturer’s protocols. Purified cycle sequencing products were directly sequenced using Big Dye terminator reagents on an

ABI 377, 3100 or 3130 automated sequencer according to the manufacturer’s protocols

Sequence data were manually aligned using Se-Al v2.0a11 (Rambaut, 1996).

Indels (insertions/deletions) were not coded as characters. Fitch parsimony analyses

(unordered characters with equal weights; Fitch, 1971) were performed using

PAUP*4.0b10 (Swofford, 2003). Heuristic searches were run with 1000 random-addition replicates, saving 10 trees per replicate, with the tree bisection reconnection (TBR) algorithm. Deltran optimization was used for all analyses. All characters were weighted equally, gaps were treated as missing data, and no regions were excluded from the alignment. Bootstrap analyses utilized 1000 replicates, with 10 random-addition replicates (SPR swapping) per bootstrap replicate.

Morphology

Habit. Habit characters are not taxonomically useful in Badiera. All species are taprooted, at least when young, and the roots have a methyl salicylate odor

(wintergreen). They are evergreen, single- to multitrunked, shrubs or slender trees two to six (to eight) m tall, rarely to nearly ten m tall in closed woodlands, e.g., some B. oblongata. The erect branches are often virgate, slender and wispy below with arching, spreading branchlets (Fig. 4-9A). The wood is very hard, and the bark is pale brown to

118

gray and fairly smooth except for numerous small fissures and lenticels (Figs. 4-27, 4-

29C).

Twigs. The pattern of variation of the twigs is also not systematically significant.

All species have young twigs that are densely pubescent, but become glabrate; they are often compressed or angled when young, becoming terete with age, but this character is variable even within a specimen. There are small raised pegs at the nodes, where the

petioles abscise.

Leaves. Species of Badiera have leaves that are alternate, petiolate, exstipulate,

simple, entire, and coriaceous to somewhat leathery chartaceous, especially in the thin

shade leaves (Figs. 4-8 and 4-9). The leaves are generally shiny, from thick cuticular

deposits, despite being sparsely appressed-pubescent. The leaves of B. virgata are frequently in fasciculate clusters on reduced short shoots (Fig. 4-30). The leaves of B. penaea and some leaves of B. virgata are scabrous. The petiole varies from 0.5 to 5.5 mm long and 0.3 to 1.1 mm wide, with longer petioles tending to be wider, but the relationship is absolute. Badiera alternifolia and B. virgata are the only two species that

can have petioles under 1 mm long, although both also routinely have petioles to ca. 1.5

mm long (or exceptionally longer); on average the same two species have narrower

petioles than the other species, with Badiera virgata being the only species that

routinely has some petioles narrower than 0.5 mm. Badiera fuertesii and B. jamaicensis

are the only two species that can have petioles over 4 mm long, although both can have

petioles as short as 2.5 mm, a length only reached routinely by the petioles of B.

oblongata, B. propinqua, and B. subrhombifolia.

119

The lamina varies from 5.5 to 82 mm long and 4 to 41 mm wide. It is convenient to

categorize the species based on leaf size, i.e., small leaves (mostly < 2.5 cm long and <

1.5 cm wide) vs. large leaves (mostly > 2.5 cm long and > 1.5 cm wide, up to ca. 8 cm

long and 4 cm wide). Small-leafed species are B. alternifolia (Fig. 4-25), B. penaea (Fig.

4-8A), B. subrhombifolia (Fig. 2-1), and B. virgata (Fig. 4-30). The leaves of Badiera

penaea, especially shade forms, can surpass these ‘small-leaf’ ranges, but most leaves

on nearly all specimens are smaller. Some specimens of Badiera oblongata, especially full-sun forms from xeric sites, may also have many leaves in the ‘small-leaf’ range, but nearly all specimens have the majority of their leaves entering the range of large leaves.

The lamina can be ovate, elliptic, oblong, or obovate, with the apex acuminate, apiculate, acute, obtuse, rounded, subtruncate, or emarginate, and the base attenuate, cuneate, acute, obtuse, or rounded. Leaf shape is a very useful character in species identification, although none of the character states related to lamina, apex, and base form are completely fixed within any of the taxa. Even though all the species have

variable leaves, it is possible to develop a gestalt sense of leaf morphometrics, i.e., leaf

length to width ratios and shape details that make it possible to identify most specimens

at a glance, once one has a good sense of which variants to focus on and which to

ignore. Unfortunately, this is difficult to capture succinctly in a key, as it is experience-

based, relating to time spent studying the species of Badiera. However occasionally

clear distinctions are found, e.g., B. cubensis (Fig. 4-8C) usually has broadly ovate

leaves, while the morphologically similar B. jamaicensis (Fig. 4-27) and B. fuertesii (Fig.

4-26) have ovate to elliptic leaves. The subrhomboid leaves of B. subrhombifolia (Fig. 2-

1) are quite distinctive, but unfortunately (from the standpoint of practical identification)

120

other leaf shapes also occur in this species. The form of the leaf apex can be used to

distinguish B. propinqua and B. oblongifolia. The lamina in most species is relatively flat

to slightly cupped (curved abaxially), but it can be very strongly cupped in B. penaea

(Fig. 4-15). Marginally, the lamina varies from plane to revolute. When revolute, it is most common for the revolution to be best developed near the base of the leaf, thinning towards the apex, and sometimes even becoming plane. The margin in B. alternifolia and B. virgata sometimes appears to be a thickened rim, rather than a discretely revolute edge (Fig. 4-22C). Badiera virgata is unique in that its marginal revolution or thickening is often most pronounced distally, i.e., often grading to plane at the base.

Venation of the blade is brochidodromous but is typically obscure in most species, so that only small portions of a few secondary veins are visible, frequently only abaxially. When fresh the secondaries are usually only faintly visible on most leaves of most species. The secondary veins are usually more conspicuous on dried leaves. The

midvein is usually more or less flush above to slightly sunken and is more or less flush

to slightly raised below. Triplinervy at or near the base is common in leaves of B.

subrhombifolia and is also present in some leaves of B. jamaicensis and B. oblongata,

although it is usually obscured and may not be visible until the leaves have been

anatomically cleared. There are subtle differences between some of the species of

Badiera in terms of secondary and tertiary venation (Fig. 4-34), but objectively defining

these differences is difficult and they are of no practical utility in the field or in working

with herbarium material. Nonetheless, the differential visibility of veins (in fresh or

herbarium dried material), although somewhat subjective and variable within most taxa,

can be a useful diagnostic feature. The taxa with the most readily-visible secondary

121

veins are B. fuertesii, B. jamaicensis, sometimes B. oblongata, and very rarely in broad

shade-forms of B. penaea, all of which tend to have more than 5 or 6 secondaries at

least partially visible, as well as some of the tertiary veins forming visible reticulations.

Indumentum. The indumentum in species of Badiera is very uniform, with simple,

unicellular hairs that are dense to sparse on nearly all parts (Fig. 4-33), at least when

young, and vegetative structures are often glabrate. Thus hair characters, at least on

vegetative organs, are usually not taxonomically useful. Young stems and petioles are

usually very densely pubescent. The hairs are generally in patches or zones on floral

parts. The hairs are mostly less than 0.1 mm long, antrorsely appressed to slightly

spreading, hollow, and tapering in the upper fourth to an acute apex. The surface of the

hairs has irregular bumps and small ridges (visible via SEM or the use of a compound scope, see Fig. 4-33C, E). The hairs on the filaments can reach 0.2 to 0.3 mm in length

and are also slightly kinked or twisted and flattened. Hairs are sometimes blackish on

the abaxial surface of the lamina, appearing as dark punctations to the naked eye,

although the punctations in many species also result from a shallow pit at the base of

each hair (Fig. 4-23D). Badiera penaea is the only species which routinely has non-

appressed spreading hairs.

Inflorescence. The inflorescences are axillary racemes, although they sometimes

appear to be umbelliform or cymose due to a reduced peduncle, or are rarely reduced

to only one to two flowers (Figs. 4-7, 4-28D). Two small bracts subtend the peduncle

and three small “bracts” subtend each pedicel, i.e., one bract and two lateral basal

bracteoles (Fig. 4-6B). The pedicel bract and bracteoles are caducous in Badiera

fuertesii and persistent in other species, i.e., the pedicel disarticulates above the bracts

122

which remain. All parts are typically pubescent, usually densely so (Fig. 9-6C). The pedicels of B. virgata are glabrous (rarely with 1 or 2 hairs, Fig. 4-6D), and the pedicels of B. alternifolia are subglabrous (usually with a few scattered hairs, Fig. 4-6A). The inflorescence of B. fuertesii is more laxly flowered than in any other species, at least when the central axis is elongated, as it usually is. Badiera fuertesii also has a longer peduncle than is found in other taxa (Fig. 4-26B).

Flower structure and terminology. The flowers of Badiera are fairly uniform across all species, small (2.2 to 5.2 mm long), complete, perfect, strongly zygomorphic, and pedicellate (0.8 to 3.3 mm long, Figs. 4-2 to 4-5, 4-31). The flowers are fundamentally 5-merous, but the corolla is reduced to three, the stamens to eight, and the gynoecium to two. The corolla is basally fused at an oblique angle (varying from less than 0.1 mm to nearly 2 mm) with the filament sheath, falling as a unit. The overall appearance of the open flowers is similar to papilionaceous flowers found in many

Fabaceae, and the same terms are used, although the component structures are not homologous, i.e., the wings are the lateral, innermost sepals (not petals), the keel is a single, conduplicate lower petal (not two fused petals), and the two upper petals are connivent to form a standard- or banner-like structure (not a single petal). Some flowers, although structurally perfect, appear to be functionally imperfect with misshapen anthers and non-viable pollen, i.e., they seem to be carpellate (seen in B. cubensis, B. jamaicensis, B. oblongata, B. penaea, and B. virgata, Fig. 4-19A). If there are flowers that are functionally staminate, the carpellode is not obviously different from a functional carpel, i.e., no obviously staminate flowers were seen. Thus, some populations are

123

likely gynodioecious. Figure 4-35 is a diagrammatic illustration of a floral dissection of

Badiera subrhombifolia, which serves to illustrate terminology and measurements.

Calyx. The five sepals are free, green (when fresh), herbaceous, ovate, apically

blunt, marginally ciliolate, tardily deciduous (falling in young fruit, after the corolla,

although the upper sepal is rarely persistent), and differentiated (Fig. 4-3). The three

outer sepals are subequal (0.7 to 1.8 mm long, 0.7 to 1.3 mm wide) and isodiametric to

longer than wide. Although there is overlap in the ranges, Badiera fuertesii and B.

subrhombifolia can have outer sepals up to 1.8 mm long, while the outer sepals of other

species are less than 1.3 mm long. The outer sepals of B. alternifolia, B. cubensis, B.

jamaicensis, B. subrhombifolia, and B. virgata tend to be narrower (up to 1.1 mm wide)

than in the other four species (which have outer sepals up to 1.3 mm wide). There is a

slight gap between the upper outer sepal and the two lower outer sepals, and there is a

slight overlap by the bases of the two lower outer sepals. All of the outer sepals strongly overlap the two inner lateral sepals (wings). The wings (1.1 to 2.5 mm long, 0.8 to 2 mm wide) are proportionally much smaller than is typically found in other Polygalaceae and are generally about 1/3 to 1/2 longer than the outer sepals, as well as being much smaller than the petals, and this condition may be synapomorphic for the species of

Badiera. The wings of B. alternifolia, B. cubensis, B. propinqua, and B. virgata are up to

1.5 mm long, while those of B. oblongata and B. penaea can be up to 1.7 mm long, and

those of B. fuertesii, B. jamaicensis, B. subrhombifolia, and rarely B. oblongata can be

up to 2.5 mm long. Most of the species have wings 1.5 mm wide or narrower, with only

B. fuertesii, B. jamaicensis, and B. oblongata sometimes having wings wider than 1.5

124

mm. Badiera fuertesii has the largest calyx (always over 2 mm long and 1.7 mm wide),

and can be distinguished from other species on this basis.

Corolla. The species of Badiera have three herbaceous petals, two upper petals

and one lower petal, which are all free from each other but fall as a unit because they

are basally fused to the filament sheath (Figs. 4-2, 4-31, 4-32). The upper petals are lingulate (oblong-elliptic), usually slightly shorter than the keel or subequal to it (2.1 to

4.1 mm long, 0.6 to 1.4 mm wide), with the apical half to third curved upward at anthesis, and they are basally green, apically white, aging to yellow. The lower petal is conduplicately keel-shaped (longitudinally folded medially, with the halves folded upward around the androecium and gynoecium), apically blunt (and lacking not only a beak but also a crest), and green basally to white or yellowish-green at least along the upper edges. The keel (2.6 to 4.7 mm long, 0.9 to 2 mm wide) has three non-discrete zones: the laterally compressed apex (often differently colored at anthesis), the medial region with poorly developed lateral “pouches” or folds (apically undulate, expanded projections), and the reduced, narrow, semi-tubular basal region (“claw”). There is no direct correlation between calyx and corolla length, and both can be quite variable even on the same branch. All petals have sparse to dense patches of pubescence. Corolla characters, although helpful in characterizing Badiera, e.g., lower petal that lacks both a beak and a crest, are of little value at the species level.

Androecium. Species of Badiera have eight stamens (2.2 to 4.2 mm long), with the filaments fused into an adaxially-split, strongly laterally compressed sheath around the gynoecium (1.5 to 3.4 mm long, Figs. 4-3G, H, 4-31). The free filaments (0.1 to 0.8 mm long, 0.05 to 0.5 mm wide) are very short compared to the sheath length, with the

125

outermost (lowest, earliest diverging) filaments tending to be longer and wider than the

uppermost medial ones. The staminal sheath is densely long-pubescent internally near

the apex and often on the free filaments, with the dense, flattened, wrinkled hairs (0.2 to

0.3 mm long) making it very difficult to ascertain the exact point of distinction between

the filament tube and the free filaments. The anthers are bisporangiate and appear

unithecate, even though Polygalaceae are believed to be fundamentally

tetrasporangiate with the bisporangiate condition the result of supression of the ventral

sporangia. The anthers (0.3 to 0.9 mm long, 0.1 to 0.3 mm wide) open via apical pores

that sometimes elongate to become slit-like, the open pore up to ca 0.3 mm across.

Some flowers have atrophied, under-developed anthers, which tend to be narrower and

more acute at the apex than the fertile anthers. Variation in the androecium across

flowers of the same species is at least as great as the variation across species, making

androecial characters of little use for diagnosing species.

Gynoecium. The species of Badiera have a stipitate, bicarpellate gynoecium, with

a bilocular, laterally compressed, superior ovary (one upper adaxial carpel, the other

abaxial), a single style, and two capitate to depressed hemi-globose stigmas (Figs. 4-

4C, E, 4-5). The gynoecium (excluding the stipe) varies from 2 to 4 mm long, and the

stipe varies from 0.05 to 0.6 mm long. In B. cubensis and B. subrhombifolia the

gynoecium is always 2.5 mm long or less, while it is 2.5 mm long or longer in all the

other species (always longer than 3 mm in B. jamaicensis and B. propinqua). The ovary is pubescent, at least marginally, although the hairs are often lost with age. The ovary varies from 0.5 to 1.1 mm long and 0.5 to 1 mm wide. Badiera cubensis tends to be at the small end of the range, while B. fuertesii is at the large end, with the other species

126

falling in between. There is a single ovule per carpel, and it is attached apically along

the central axis by a relatively stout funiculus. The style is held well below the anthers at

anthesis, but elongates and grows in a curve apically, so that the stigmas are eventually held subequal to the anthers. At maturity, the style is two to three times as long as the ovary, and it is deciduous in fruit. The style varies from 1.2 to 2.7 mm long and 0.15 to

0.4 mm wide. Badiera cubensis, B. fuertesii, B. oblongata, B. penaea, and B.

subrhombifolia all have styles 1.7 mm long or less (rarely 1.8 mm in B. oblongata), and

the remaining species all have styles 1.8 mm long or longer (sometimes 1.7 mm in B.

propinqua), with B. alternifolia and B. jamaicensis being the only two species that have

styles routinely longer than 2 mm. Of the two stigmas, the abaxial lower one is larger

and held apically, while the adaxial upper one is smaller and subapical, in part due to

curvature of the style.

Fruit. The fruits are heart-shaped to quadrate capsules, somewhat coriaceous,

with two seeds, although they often have one locule aborted, i.e., underdeveloped and

with no seed, so that the 1-seeded capsule has a lopsided oblong shape (Figs. 4-10, 4-

11). The fruits are green to pale brownish-green at maturity, and the valves dehisce

marginally by folding or curling toward the central axis, sometimes curving into a coiled

roll. The surface of the fruits varies from sparsely pubescent to glabrate or subglabrous,

with B. cubensis and B. penaea sometimes more densely pubescent. The main body of the fruit (excluding the stipe) varies from 4.5 to 13 mm long and 4 to 12 mm wide, with a

stipe from 0.5 to 3(-3.7) mm long. The main body of the capsule is 8 mm long or less in

B. alternifolia, B. cubensis, B. penaea, B. propinqua, and B. virgata, while only B.

fuertesii has fruits consistently 8 mm or more long; the other three species have fruits

127

that are variable in size. The main body of the capsule is 9 mm or less wide in B.

jamaicensis (rarely to 10), B. penaea, and B. virgata, while only B. fuertesii and B.

propinqua are consistently 9 mm or more wide (the other four species can have fruits

narrower or wider than 9 mm). Most fruits (of most species) are nearly isodiametric to

wider than tall. Badiera oblongata and B. penaea have the most variable fruits, ranging from longer than wide to wider than long. Badiera jamaicensis is the only species that has fruits which tend to be longer than wide, while B. cubensis, B. propinqua, and B. virgata all tend to be slightly wider than long. The fruiting stipe is 1.5 (rarely 2) mm or less in B. fuertesii, B. penaea, and B. virgata, while it is consistently 1.5 mm or longer only in B. cubensis and B. subrhombifolia; the other four species have stipes that are variable in length. Badiera propinqua fruits are often distinctive in having the lobes more obviously divergent than in other species.

Seeds. The seeds are more or less oblong, generally about twice as long as wide

(3 to 8 mm long, 1.5 to 4(-5) mm wide), and bluntly rounded at both ends, or sometimes slightly more narrowly obtuse distally (Figs. 4-12, 4-13). The seeds are bluish-black at maturity, and vary from nearly glabrous in B. fuertesii, B. propinqua, and B. subrhombifolia, to sparsely to moderately pubescent in most species and densely pubescent in B. cubensis and some seeds of B. oblongata. A fleshy, glabrous, lobed, appressed, orange aril covers the funicular end of the seeds (Figs. 4-8D, E, 4-9C, D, E,

4-12, 4-13), and is typically 1/4 to 1/3 the length of the seed in most species, varying to nearly half in some B. oblongata, some B. penaea, and B. propinqua. Variation in aril shape, lobing, and size is greater within most species than was observed across the genus. The green embryo occupies nearly the entire seed, and it has two slightly fleshy,

128

shallowly cordate, foliar cotyledons in all species. Germination is epigeal, from the

funicular end in all species in which germination has been studied (seedlings observed

in B. fuertesii, B. oblongata, and B. propinqua).

Anatomy

Root. Anatomy of Badiera is typical of a eudicot root with secondary growth, i.e., a

central cylinder of secondary (2°) xylem is surrounded by a thin ring of 2° phloem with

an intermittent band of phloem fibers, which is surrounded by a cortex of non-

differentiated parenchyma with a few scattered isolated fibers and fiber clusters (Fig. 4-

20).

Young stem. Pith is composed of sclerified parenchyma (sometimes thin-walled);

usually in center of stem, but sometimes off-center; the cylinder outline is circular (B.

fuertesii, B. jamaicensis, and B. penaea), bluntly triangular (B. alternifolia, B. oblongata,

B. penaea, B. virgata), or oblong (B. cubensis, B. fuertesii, B. oblongata, B. propinqua,

B. subrhombifolia). In B. fuertesii the oblong pith appears to be correlated with lateral branch formation; B. cubensis and B. propinqua have the flattest, most elongate pith regions (Fig. 4-21). Secondary xylem is positioned in a single closed ring, with copious thick-walled fibers. A nearly complete ring of perivascular fibers surrounds the 2° phloem. No distinct differential layers occur in the cortex, although the cork cambium

(and subsequent periderm) are derived from the outer cortex. The epidermis usually is provided with a thick cuticle (about as wide as the epidermal cells or wider), and the cuticle is smooth to minutely irregularly roughened, or sometimes with some cells having minute ridges, which appear as teeth in sectional view. Epidermal cells are variable in shape, often even on same leaf, i.e., longer than wide or wider than long, somewhat rectangular (with bluntly rounded corners), oval, ovoid, globose, onion-

129

shaped, pyriform, or flask-shaped. The latter three shapes can vary from vertically

elongate to depressed and are usually also associated with an elongate thin beak or

neck protruding into the cuticle.

Wood. Vessels are small (20-60 μm mean tangential diameter), solitary, with spiral thickenings in some; perforations are simple (mostly oblique, infrequently more or

less transverse), alternate. Parenchyma is paratracheal, scanty (limited to one to a few

cells around the vessels). Rays are mostly uniseriate, with scattered small segments of

2-3 cells, and heterogeneous. Fibers are abundant and dense, with bordered pits

equally numerous on radial and tangential walls, which vary from moderately thin to

thick.

Leaves. The petiole more or less terete, usually with minute irregular lobing in

sectional view (Fig. 4-20). One central collateral to nearly amphicribral vascular bundle

surrounded by thick-walled parenchyma occurs mid-petiole, but two small poorly-

differentiated lateral bundles were seen in one petiole of B. penaea. The xylem is

usually somewhat reniform to hemi-circular, often appearing like an upside-down

seashell (seen in B. alternifolia, B. oblongata, B. penaea, and B. virgata), with curved

lateral flanges adaxially, usually as small slightly incurved humps but sometimes curving

together and forming a closed semi-ring around a cluster of parenchyma (seen only in

B. cubensis and B. fuertesii). The vascular bundle fills ca. 1/3 the diameter of the petiole

and is surrounded by homogeneous thin-walled parenchyma with no fibers or idioblasts.

The patterns described above likely occur in all petioles of all species, with differential

development so that mid-petiolar anatomy is not always uniform, i.e., the circle of xylem

enclosing the parenchyma -- which seems transitional between the sclerified

130

parenchyma in the outer pith of the stem and the thin-walled parenchyma in the cortex;

staining dark but not birefringent nor dead and without the uneven angular wall

thickenings of collenchyma -- occurs basally, coalesces medially into an unlobed

cylinder of xylem, and expands apically with the lateral flanges as precursors to lateral vascular bundles.

Blade cross-section through the midvein near middle of lamina reveals a dorsiventral pattern with a palisade mesophyll of 1-3 tiers of tightly packed, regularly

rectangular cells, and usually with another 1-2 rows of more rounded, less regularly

shaped cells that intergrade with the spongy mesophyll above the vascular bundles. In a

line with and between the vascular bundles are 3-5 loose rows of cells that typically look

like the spongy mesophyll cells but are not included in the count of rows of spongy

mesophyll. The spongy mesophyll is dense (small, relatively uniform, tightly packed

parenchyma) to loose (large, irregularly-shaped parenchyma with lots of gaps), with (3-)

4-6 (-10) poorly defined rows of cells below the vascular bundles. The collateral

vascular bundles are more or less round to oblong; xylem adaxially with a bundle cap of

collenchyma, usually with a bundle sheath extension, often small but sometimes

extending to, or nearly to, the epidermis (seen in B. cubensis and some B. fuertesii);

phloem abaxially with bundle cap of sclerenchyma, bundle sheath extension of non-

sclerenchymatous parenchyma below the phloem usually extended to the lower

epidermis. Cells of the bundle sheath extensions differ from surrounding spongy

mesophyll parenchyma in being more uniformly globose, very regularly spaced (tightly

packed), clear (empty), and with slightly thicker walls. Sclereids are apparently absent.

The epidermis is a single layer of narrowly rectangular (tabular) cells, mostly wider than

131

tall, sometimes more quadrate or rounded on corners, often bulging abaxially,

sometimes cupped adaxially (when so, often with lateral horn-like projections curved up

and in from corners). The epidermal cells are usually in a tight row with straight anticlinal walls and no wall thickenings, but the rounded to bulging cells are not as tightly adherent (the anticlinal walls curved near the corners), with thicker wedge of cuticle between cells. The epidermis is smaller abaxially but otherwise similar in shape,

apart from usually having several cells near the midvein rounded outward giving the

margin a scalloped look and usually having a thinner cuticle. There is no visible hypodermis (Figs. 4-16 to 4-18). Stomata are present only abaxially; they are anomocytic. The cuticle varies from very thin to thicker than the epidermis (up to ca. 2x adaxially and up to ca. 3x abaxially), varying from more or less smooth to irregularly roughened, with the cuticle above some cells appearing ridged (toothed in sectional view), especially near the midvein (Fig. 4-20).

Leaves of Badiera alternifolia have the hairs associated with pits up to ca. 1/3 of the thickness of the cuticle (Fig. 4-21 to 4-23). This deep seating of the hairs, which was used as one of this taxon’s diagnostic features by Rankin (2001), may be a result of this species having cuticles relatively thicker than seen in any other species, but it is noteworthy that the pits are not associated with a depression in the epidermis. Badiera subrhombifolia also has shallow cuticular pits associated with the hairs, but in this species they are associated with a depression in the epidermis; B. fuertesii has

irregular, scattered shallow pits that do not appear to be associated with the hairs; and

B. oblongata and B. propinqua are mostly plane at the hair bases, but a few hairs were

seen with shallow pits in the cuticle. Badiera penaea has a slight raised mound at the

132

base of many hairs, and all other species have the cuticle plane at the hair bases,

although a depression in the epidermis is associated with some hairs in B. oblongata

(although these are not necessarily in conjunction with a cuticular pit). Hairs of all

species, when seen in surface view, are associated with a ring of cells around the base,

with differential cuticle thickness sometimes providing the illusion of pitting.

Specific anatomical leaf details by species. Badiera alternifolia, B. fuertesii, and B.

subrhombifolia share the character of usually having 2-3 distinct layers of palisade mesophyll above the midvein (sometimes obscured by the bundle sheath extension in

B. fuertesii), while the palisade layer of other species typically breaks down above the midvein, with the cells becoming rounded and irregular, except for B. penaea, which

usually maintains one distinct palisade layer (rarely two) above the midvein. Badiera

cubensis, B. propinqua, and B. virgata all have a fairly loose spongy mesophyll with

irregularly shaped cells and numerous scattered gaps, while other species have more homogeneous cells with fewer and smaller gaps, with most of the larger gaps appearing to be empty idioblasts (most of them probably had been filled with druses, which were dissolved by the mordant during the staining process; Fig. 4-24).

1. Badiera alternifolia (Fig. 4-25). Leaf more or less plane, margins very slightly

recurved, the upper epidermis curving down to meet the lower epidermis, which is also

slightly downcurved near the tip; midvein with little visual impact on the epidermis, a

minute groove above (2-3 cells), no distinct hump below but ca. 10-15 cells rounded

outward (creating the minutely scalloped margin found on the raised area below the

midvein abaxially in other species); (3)-4 palisade tiers (lowest like those of the spongy

mesophyll), 4-6 spongy layers; vascular bundle height 1/4-1/3 width of lamina, ca. 1/2

133

when including the bundle sheath extensions, with 20-25 columns of cells in the xylem;

epidermal cells plane to slightly cupped above with lateral horns (upper corners with upward projections, also rounded creating small gaps between cells filled with triangular

wedges of cuticle), rounded below (slightly bulging); cuticle very thick, mostly smooth,

some cells ridged (especially near the midvein); sections adaxially with 1-6 (mostly 2-3)

hairs.

2. Badiera cubensis. Leaf shallowly cupped to plane, margins slightly down-

curved with adaxial and abaxial epidermises curving together at tip (bluntly rounded, but

sometimes sub-truncate); with shallow V at midvein, with just a slight angle above (10-

15 cells, from leaf curvature, no indentation) and keel below, mostly lacking a raised

hump (sometimes slightly raised, with the angle formed just by leaf curvature) with 45-

55 cells; 2-4 palisade tiers (lowest 2-3 like those of the spongy mesophyll), 5-7 spongy

layers; vascular bundle height ca. 1/2 width of lamina, to nearly equal when including

the bundle sheath extensions, with 35-40 columns of cells in the xylem; epidermal cells

somewhat rounded, with gaps near upper edge, bulging below (sometimes angular);

cuticle thin, smooth to somewhat irregularly roughened to slightly ridged; sections

adaxially with 0-3 (mostly 1-2) hairs.

3. Badiera fuertesii (Fig. 4-26). Leaf more or less plane to slightly cupped,

margins plane with upper epidermis curving down to meet the plane (to slightly upcurved) lower epidermis; slight V at midvein, grooved above (15-20 cells, 4-5 across bottom of groove), not raised below, the angle just part of the leaf curvature (25-30 small cells with rounded outer margin); 4-5 palisade tiers (lowest 2 like those of the spongy mesophyll), even the most distinct palisade cells smaller, looser, and more

134

rounded on the corners than in other species, 6-10 spongy layers; vascular bundle height ca. 1/3 width of lamina, 1/2 to nearly equal when including the bundle sheath extensions, with 20-30 columns of cells in the xylem; epidermal cells flat above with tight corners (anticlinal walls touching over whole length, corners not curved in), bulging, sometimes angular, below; cuticle thin, smooth, rarely 1-2 cells ridged near the midvein; sections adaxially with 0-3 (mostly 1) hairs.

4. Badiera jamaicensis (Fig. 4-27). Leaf slightly cupped to more or less plane, margins recurved, but neither epidermis strongly curved or tapering (both parallel and curving equally at the truncate to bluntly rounded tip with 7-8 cells); midvein broader than in any other species, with some sclerenchyma (in 2-3 rows) in the abaxial bundle sheath extension, with raised hump adaxially (ca. 20 cells), large bulge abaxially (40-45 cells); 1-2 palisade tiers (if 2, the lowest like those of the spongy mesophyll), 2-4 spongy layers; vascular bundle height about equal to width of lamina, taller than the lamina when including the bundle sheath extensions, with 45-50 columns of cells in the xylem; epidermal cells flat to cupped above, often with rounded edges, bulging below; cuticle thin, smooth, roughened, or ridged; sections adaxially with 3-8 (mostly 4-5) hairs.

5. Badiera oblongata (Fig. 4-28). Leaf plane to cupped, margins more or less plane, with upper epidermis curving down to meet the plane lower epidermis; with shallow V at midvein, slight indentation above (groove ca. 15 cells), raised hump below

(30-35 cells); 3-4 palisade tiers (always at least 2 distinct tiers, often 3, and with no layer of cells similar to those of the spongy mesophyll), 4-5 spongy layers; vascular bundle height ca. 1/2 width of lamina, 2/3 - 3/4 when including the bundle sheath extensions, with ca. 25 columns of cells in the xylem; epidermal cells flat to cupped above, upper

135

corners rounded (with small cuticle-filled gaps), slightly bulging below; cuticle thick,

strongly ridged (more obvious and more common in this species than in any other) or

roughened, rarely nearly smooth; sections adaxially with 5-17 hairs. Populations in the

Banao Mountains of central Cuba with broad-ovate leaves and rounded bases

(recognized as B. montana by some earlier workers) show the following features: leaf margins with the lower epidermis plane or slightly upcurved; rounded depression above midvein (25-40 cells) often also with a small raised hump in the middle (4-6 cells), raised hump below (40-45 cells, much smaller than those in other taxa); 3-4 palisade tiers (lowest 1-2 like those of the spongy mesophyll), 4-6 spongy layers (cells heterogeneous, lots of gaps; unlike the homogeneous condition typical of B. oblongata with fewer gaps); vascular bundle height ca. 1/2 width of lamina, to nearly equal when including the bundle sheath extensions, with 30-35 columns of cells in the xylem; cuticle more or less thick (about equal to epidermis), smooth to ridged (especially near the midvein); sections adaxially with 5-13 hairs.

6. Badiera penaea. Leaf usually strongly cupped and often very strongly incurved, margins revolute but the abaxial epidermis plane or rarely very slightly upcurved near the tip with upper epidermis curving down to meet it; midvein plane above (no groove,

5-10 cells slightly rounded and with roughened to toothed cuticle), but ridged below with small hump (25-40 cells); 2-3 palisade tiers (lowest 2 like those of the spongy mesophyll), 3-5 spongy layers; vascular bundle height ca. 1/3 width of lamina, ca. 2/3 when including the bundle sheath extensions, with ca. 25 columns of cells in the xylem; epidermal cells flat to cupped above with lateral horn-like projections, flat to rounded

(slightly bulging) below, with bigger gaps between cells than seen in any other species

136

(filled with cuticle, with the anticlinal walls of many cells seeming to not even touch);

cuticle thick, mostly smooth, some cells ridged; sections adaxially with 4-7 hairs, the

hairs more strongly perpendicular to lamina than in any other species. The hair

orientation and their raised bases are responsible for the scabrosity in this species.

7. Badiera propinqua (Fig. 4-29). Leaf plane to slightly cupped, margins plane to

very slightly turned down, with the upper epidermis curving down to meet the mostly plane to slightly up- or downcurved lower epidermis; nearly plane at midvein above but

with very slight raised hump above (2-15 cells wide), raised hump below (30-35 cells);

2-3 palisade tiers, 4-6 spongy layers; vascular bundle height ca. 1/2 width of lamina, to

nearly equal when including the bundle sheath extensions, with ca. 30 columns of cells

in the xylem; epidermal cells mostly cupped above, rounded with small gap at upper

corners, flat to rounded (somewhat bulging) below; cuticle thick, mostly roughened, to

smooth or ridged; sections adaxially with 2-5 hairs.

8. Badiera subrhombifolia. Leaf plane to slightly cupped, margin plane to very

slightly downturned, with upper epidermis curving down to meet the slightly down-

curved lower epidermis (slight downcurve at tip even when lamina plane), with very

shallow V at midvein, slight angle above (no groove, just part of leaf curvature), raised

hump below (ca 25 cells); 4-5 palisade tiers (lowest 1-2 like those of the spongy

mesophyll), 5-7 spongy layers; vascular bundle height ca. 1/3 width of lamina, 1/2-2/3

when including the bundle sheath extensions, with 25-30 columns of cells in the xylem;

epidermal cells regularly rectangular, with fairly tight edges, slightly rounded at upper

corners (so with small cuticle-filled gap), upper corners sometimes horned (small

upward projections), inner edge more or less flat (not bulging, rarely with slight bulge);

137

cuticle thick, smooth, sometimes somewhat roughened; sections adaxially with 0-3

(mostly 1-2) hairs.

9. Badiera virgata (Fig. 4-30). Leaf often strongly cupped, with edges curved

down but margins not revolute or sometimes with very slightly incurved tips, usually with

the upper and lower epidermises curving together at the tip, sometimes the abaxial

epidermis plane at the tip, with all curvature from the adaxial layer; upper surface plane

above midvein (no differentiated cells at all), with raised ridge below midvein (10-15

cells); 2-3 palisade tiers (1 usually like those of the spongy mesophyll), 4-5 spongy

layers; vascular bundle height ca. 1/4 width of lamina, 1/3-1/2 when including the bundle

sheath extensions, with 15-20 columns of cells in the xylem; epidermal cell shape more

variable than in other species (one leaf with nearly the full range of variation seen across all other species), flat, slightly rounded outward, or cupped above, the corners mostly rounded with gaps filled with cuticle, more or less flat to rounded (slightly

bulging) below; cuticle thick, mostly smooth, with a few irregularly roughened cells but

strong toothed ridges not seen; sections adaxially with 0-4 (mostly 1-2) hairs; the “var.

scabridula” entity, from central and western Cuba, has been recognized due to its

somewhat scabrous leaves, but leaf scabrosity is a polymorphic trait in this species,

with shifts towards greater scabrosity in some populations, but most collections have a

mixture of smooth and scabrous leaves, including specimens from eastern Cuba,

indicating that this feature is not a valid justification for taxonomic recognition of

otherwise indistinguishable populations.

Chromosome Numbers. The chromosomes of species of Badiera have not been

studied; the base chromosome number of the group is, therefore, unknown.

138

Pollination Biology and Fruit Dispersal

Obviously, a flower at anthesis will be larger than it was as a bud, but size alone is not a reliable indicator of anthesis, as some flowers with spreading upper petals and dehisced anthers (i.e., they’re open) are smaller than floral buds from the same specimen. It is clear that the flowers continue to enlarge, but one flower that was measured was starting to fall apart (i.e., going into young fruit), and it was the same size as others that didn’t even have all the anthers dehisced, so the floral expansion

probably continues only until anthesis, with floral aging not linked with additional

increase in perianth size. I opened several buds with the upper petals still tucked down

into the keel petal and found none of them to have dehisced anthers, and they all had

the stigmas still well below the anthers. Most, but not all, flowers with the upper petals free from the keel (some flexed upwards, others only slightly spreading from the upper

keel) have dehisced anthers, so I am using non-tucked upper petals as my “anthesis”

indicator. I think, however, that the upper petals fold back down after being fully flexed

upwards, so some of my measured flowers might have been past anthesis.

From field and herbarium observations, it is clear that the anthers dehisce before

the style and stigmas finish elongating, so that the stigmas grow up to the level of the

anthers post-dehiscence, but I’ve not seen a single specimen with the stigmas actually

exserted above the anthers -- they seem merely to be subequal. In many flowers,

they’re not covered in pollen, but in some flowers, there is a large pollen load spread

over the stigmas and upper style, hairs of the upper filament sheath, and the apical

portion of the inner keel. This probably represents secondary to tertiary presentation of

the pollen (although there is often more pollen still inside the thecae), although it could

well be that the pollen is released into/onto the inner keel and filament hairs and is only

139

later knocked back onto the stigmas. In Badiera, there are no specialized stigmatic spoons or brushes involved in pollen presentation. So, it appears that flowers begin to attract pollinators by spreading the upper petals. Eriksen & Persson (2007) point out that the upper petals form an abutment involved in depression of the keel by an insect.

Then the anthers dehisce, followed by elongation of the style and stigmas. Thus, while it certainly seems that pollen is secondarily presented, the exact mechanism is not clear.

Perhaps the pollen eventually is deposited back onto the stigma, leading to selfing. The stigmas may not actually be exserted for pollination, i.e., possibly the insect visitor causes the keel and androecium to depress, only then exposing the stigmas. In any case, this appears to be in contradiction to the normal situation presented by Eriksen &

Persson (2007), which is for pollen to be released below the stigma.

Field and herbarium study of various species of Polygala, which have flowers very similar to Badiera, indicates that flowers open fully by having the lateral sepals spread out, the upper petals bend strongly upward (curving near the middle and flexing back, at which point they do look a bit like a split legume standard petal), and the upper edge of the keel becomes more strongly undulate (Fig. 4-31), with lateral folds becoming more strongly developed. These folds are in a position to, perhaps, serve as part of the pivot point when the keel is pushed down by floral visitors (Fig. 4-32). The fused portion at the base of the keel is also probably part of the pivot point as the keel flexes down away from the staminal sheath and upper petals when depressed. The function of Badiera flowers probably is similar. As flowers of Polygaleae mature, there are developmental color changes. In Badiera this means that greenish parts become whitish and whitish parts become yellowish. The problem, however, is understanding if the color changes

140

signal receptiveness or floral post-anthesis. More study is needed, especially in

Badiera.

In Polygala, flowers can open for more than one day, and it seems like the flowers of Badiera also stay open for a while (although maybe not fully flared open). It is not

clear if a flower can open more than once. I think that non-pollinated flowers probably

abscise fairly quickly. In fruit, there are usually numerous empty bracts (the ones that

subtend the pedicels), indicating that most flowers do not get pollinated. There is a clear articulation at the base of the pedicel, so the whole flower apparently falls as a unit

when its ovules are not fertilized. Presumably-pollinated flowers lose the corolla and

staminal sheath, and it is common to find young fruits with only the calyx persisting.

Well before the fruits mature, though, the calyx also falls off, although you can

occasionally find a shriveled sepal or two hanging on (maybe 1 in 10-20 has a single

sepal, and it has always been the upper outer one).

Two factors that are also likely involved in pollination are the small nectar disk at the inner base of the flower and floral fragrance. The nectar disk is a small, slightly differentiated structure at the inner base of the flowers, around the ovary stipe (Fig. 4-3).

The stipe itself elevates the ovary, creating a small chamber, although no flower was

ever seen to contain much fluid (several fresh flowers did have a slight shininess). Thus,

it is not clear how functional the nectar disk may be in Badiera. I have seen no

indication of any osmophores in Badiera flowers, but in the field a slight floral fragrance

was often detectable when there were numerous fully receptive flowers. Although very

faint, a fragrance was detected in B. penaea in the Dominican Republic, and in B.

alternifolia, B. oblongata, and B. virgata in Cuba.

141

Eriksen & Persson (2007) report that in Polygalaceae nectar is held in the inner

base of the filament sheath and they speculate that the bases of the upper petals close

off the filament furrow and form a tongue guide for visiting insects. Bees and

bumblebees are reported to be the main pollinators of zygomorphic Polygalaceae, and I

did see bees visiting flowers of Badiera in the field. However, I also saw other

hymenopterans (wasps and fly-mimics), dipterans (various flies), and homopterans on

and near the flowers, although I don’t know which, if any, were actual pollinators. The

wings (petaloid, lateral sepals) that are typically the dominant showy visual attactants in other Polygaleae are reduced and greenish in Badiera, suggesting that there could have been a pollinator shift. Badiera flowers are also smaller than “typical” Polygalaceae, so it seems risky to assume that structural similarity (probably phylogenetically constrained) results in similar pollinators.

Eriksen & Persson (2007), again as a generalization for papilionoid flowers in the

Polygalaceae, report that the stigma is clean for the first floral visitor in order to receive pollen, with the pollen held in the keel or on the style below the stigma. Subsequent visitors allow for self-pollination with pollen being squeezed out of the rostrum of the

keel. Also, the presence of brushes and spoons (stigmatic modifications, such as a tuft

of hairs or sterilization of one of the stigmas) is supposed to be involved in pollen

presentation. Sticky secretions from the stigma are then supposedly involved in gluing

the pollen to insect visitors, with precise deposition resulting in reproductive isolation

between sympatric species. However, it is not clear if this really describes what is going

on in Badiera. The flowers of Badiera have no strange spoons or brushes, but there are

long hairs at the apex of the filament sheath that could be analagous in function and the

142

upper stigma is smaller and may be abortive, at least in some flowers. Also, the pollen

is not released below the stigmas. So the pollination mechanism in Badiera may differ

from known reports in Polygalaceae.

Eriksen & Persson (2007) go on to say that many small-flowered species (in other

genera) are self-pollinated, often via pollen deposition directly onto the stigma.

Obviously, deposition onto the stigma or having the stigma grow through the dehisced anthers does not necessarily mean selfing occurs. As with the above issues, the situation in Badiera is simply not known.

Fruit or seed dispersal in Badiera is also not directly known. The bluish-black seeds capped by a large, orangish aril are presumably bird-dispersed, presumably by

flycatchers, thrushes, or migratory warblers (Doug Levey, pers. comm.). The restricted

ranges of most taxa and the existence of populations with distinctive morphological and

DNA characters, suggest that the dispersal is restricted, as there does not appear to be

wide-spread gene-flow across populations.

Species Concepts

Species delimitations within Badiera are here based on the morphological-

phenetic species concept, i.e., morphologically cohesive entities separated from others

by consistent morphological gaps (Judd, 2007). Phylogenetic analyses support the

monophyly of six of the nine species as cladospecies, thus satisfying the apomorphy species concept (Donoghue, 1985; Judd et al., 2007; Mishler & Theirot, 2000), since the

species possess several molecular apomorphies. Of course, species are not

necessarily monophyletic, given the facts that reciprocal monophyly does not necessarily quickly follow cladogenesis and that lineage sorting can sometimes lead to conflicting topologies (e.g., De Queiroz, 2007), thus it is not surprising that I found no

143

evidence for the monophyly of some species. The diagnostic species concept (Wheeler

& Platnick, 2000) also applies to Badiera, as evidenced in the identification key.

Phylogenetic Relationships within Badiera

The monophyly of Badiera was strongly supported (see Chapter 3), and all species were represented in my molecular phylogenetic analyses. Fifty-four accessions representing at least 45 populations of all nine species of Badiera were phylogenetically analyzed using nuclear ribosomal ITS (including ITS1, ITS2, and 5.8S) and five plastid regions: matK, the trnL intron, the trnL-F spacer, trnC-ycf6, and ycf6-psbM (Fig. 4-1).

Five outgroup taxa were used, including four members of Hebecarpa. The combined analysis of 5506 characters (408 parsimony informative, 378 variable but parsimony uninformative) yielded 4790 equally parsimonious trees with a length of 1020. The support values were a consistency index (CI) of 0.849, a CI excluding uninformative characters of 0.753, a retention index (RI) of 0.903, and a rescaled consistency index

(RC) of 0.766.

Two deep sister clades were consistently supported within Badiera (Fig. 4-1). One

contained B. alternifolia, B. fuertesii, and B. subrhombifolia. The other clade contained

the remaining species, with Badiera penaea (weakly supported as monophyletic)

moderately supported as sister to the rest. Badiera jamaicensis (strongly supported as

monophyletic) was very weakly supported as sister to an unresolved polytomy of

intermixed B. oblongata and B. virgata, with some populations weakly supported as

closer to the monophyletic B. cubensis and B. propinqua than to other conspecific

populations (Fig. 4-1). Badiera oblongata, B. subrhombifolia, and B. virgata were not

supported as cladospecies, in contrast to the other six species. This apparent lack of

reciprocal monophyly at the species level is quite possibly due to incomplete lineage

144

sorting, especially as the populations did not cluster geographically, suggesting that introgressive gene flow is not likely to be a current ongoing problem, at least for most taxa. Badiera subrhombifolia and B. virgata each do have morphological apomorphies shared by all their populations (putative species-level synapomorphies): a high frequency of subtriplinerved, rhomboid leaves in the former, and glabrous (or nearly glabrous) pedicels in the latter. Badiera oblongata, on the other hand, may well be a metaspecies, perhaps even a paraphyletic entity, that has given rise to other species, as evidenced by the lack of a single consistent, diagnostic feature across all of its populations. It is also possible that the apparent non-monophyly of B. oblongata is indicative of it containing cryptic microspecies, and the populations of this species are in need of detailed population-level study. For instance, unlike any other geographically proximal collections, the populations from the Banao Mountains region of central Cuba form a well-supported clade with 96% bootstrap support (BS), and they correspond to an entity that has been recognized as B. montana. It is my taxonomic judgement that this taxon does not merit recognition as distinct from B. oblongata, as it cannot be consistently distinguished morphologically. Even though these accessions (Abbott

18900 a, b, & c; Bécquer HFC 24770) were collected in several disjunct populations, each more than a kilometer from any other, it is possible that they are simply subpopulations of a larger metapopulation, which would account for their lack of genetic divergence. The remaining 13 accessions of B. oblongata do not form well-supported geographic clusters; in fact, sometimes collections that are relatively proximal geographically are rather distant phylogenetically, e.g., Abbott 19050 and Abbott 19052, both from the Camagüey Province (Fig. 4-1).

145

Nearly all of the duplicate accessions in my analyses represent separate

individuals from the same populations (# of base pair differences), i.e., Abbott 18894

and Bécquer HFC 81696 (7), Abbott 18900a (0), Abbott 18900b (0), Abbott 19025 and

Bécquer HFC 81095 (17), Abbott 19776 (2), and Abbott 20914 (10), demonstrating that

there is sometimes greater variation within some populations than across populations of

some species. Obviously, more detailed population level studies are needed to

rigorously address this issue. Two accessions represent duplicate extractions of the

exact same material, i.e., Bécquer HFC 24770 (with 2 base pair differences) and

Thompson 11218 (with 1 base pair difference), demonstrating that minor variation might

be due to lab error, although it could also reflect differential capture of true sequence

variation. Many of the taxa and even some of the clades have branch lengths equal to

or smaller than the variation documented within populations, suggesting that some of

the lack of resolution may simply be due to random genetic noise. Given the lack of

DNA sequence divergence, it seems very likely that the species of Badiera are of

relatively recent origin, although the lineage itself, i.e., its divergence from a common

ancestor with the Hebecarpa clade, is likely much older. Ultimately, more detailed study

within a larger phylogenetic context is needed to address such issues.

Habitats and Distribution

The sister group to Badiera, Hebecarpa, is widespread in Latin America, including

the Caribbean region, with a center of diversity in Mexico and northern Central America.

Preliminary phylogenetic analyses suggest that the South American taxa of Hebecarpa are derived, i.e., that they moved into the Andes from Mexico and Central America.

Other members of Polygaleae 1 are all New World: Acanthocladus is primarily South

American and Bredemeyera is widespread in Latin America. Greater sampling is

146

needed to confirm generic relationships within Polygaleae 1; it is too early to do more

than speculate on possible patterns, but it seems likely that the common ancestor of

Badiera and Hebecarpa moved north out of South America, giving rise to the

Hebecarpa lineage in Mexico and northern Central America (especially in semi-arid regions, and with subsequent movement south into the Andes) and to the Badiera lineage in the Caribbean.

In examining the topology of the phylogenetic hypothesis of relationships within

Badiera (Fig. 4-1), the only clear pattern is that it seems likely that most species evolved

in an allopatric fashion, as no species are sympatric (if geographically overlapping,

never co-occurring). The clade of B. alternifolia (NE Cuba), B. fuertesii (Dominican

Republic), and B. subrhombifolia (Hispaniola, nearly endemic to the south island) is sister to the remaining taxa. The basalmost species in the second clade is B. penaea

(British Virgin Islands, Hispaniola, and southwestern Puerto Rico). Thus, considering the geographic regions of the extant basal lineages, it seems possible that Badiera began (or early became) a Hispaniolan lineage that then moved to Jamaica and the

Yucatan region (B. jamaicensis) and also moved to Cuba. Within Cuba, speciation was likely still at least partially allopatric given the largely non-overlapping ranges of the species. Badiera propinqua likely moved to the Cayman Islands from Cuba, and B. oblongata likely moved from Cuba into the Bahamas, and the Turks and Caicos Islands.

The messiest species complexes (B. oblongata and B. virgata) are the ones that most strongly overlap geographically, but there are no known co-occurring populations.

Species of Badiera are entirely restricted to the Caribbean region. Only B.

jamaicensis is found on the mainland (in Mexico and northern Central America), with all

147

other species being island endemics. The greatest center of diversity is Cuba, with five

species, although four of the Cuban species are phylogenetically more derived, i.e.,

their presence in Cuba does not appear to be indicative of an ancestral presence there.

Hispaniola is home to three species of Badiera, all positions near the base of the

cladogram (Fig. 4-1), suggesting that Hispaniola may have been the source for the

diversification of Badiera in the Caribbean, or Hispaniola and Cuba together may have

been the source.

Most of the species appear to be fairly well adapted to disturbance, occurring in a

wide variety of habitats, with shrubby thickets being the most common shared habitat

across the species. Species occur from sea-level to the highest peaks in the Caribbean;

usually a given species is either high elevation or low elevation.350-600 m. Badiera

alternifolia is found in xeric, subspiny, shrub thickets on serpentine. Badiera cubensis grows in gallery forests and degraded evergreen forests on limestone. Badiera fuertesii

occurs in a variety of montane habitats, cloud forest, mesic broad-leaf forest, rain forest, pine woodlands, and degraded thickets. Badiera jamaicensis is reported from a broad range of habitats: swamp in Belize; degraded areas and lakeshores in Guatemala; in limestone and bauxitic woods and thickets, serpentine outcroppings, rocky hillsides, dry limestone forest, scrub, and secondary thickets in Jamaica; and semi-deciduous (or semi-evergreen) tall to low forest, usually on limestone, sometimes in floodplains, often in degraded areas in Mexico. Badiera oblongata is also widespread in a variety of habitats: xeromorphic coastal thickets, microphyllous evergreen forest, spiny and subspiny xeromorphic thickets on serpentine, complex mogote vegetation, pine forests, rain forest on limestone, savannah, cloud forest, and secondary vegetation. Badiera

148

penaea ranges from limestone and serpentine substrates, from xeric to mesic areas,

and grows in seasonal deciduous forest, rocky woodland, secondary forest, montane

thicket, semi-humid forest, dense broad-leaf forest, mesic deciduous forest, riverbanks, pine woodlands, semi-arid pinelands, dry woods, xerophytic regions, thickets, open grassland, broad-leaf evergreen forest, dry to moist woods, scrub, subtropical wet forest, moist montane forest, low evergreen scerlophyllous forest, dry thorn-scrub, scrubby thickets, rocky slopes, and degraded open areas. Badiera propinqua is found in xeromorphic thickets near the coast and in semideciduous mesophyllous forest on limestone. Badiera subrhombifolia occurs in broad-leaf forests, often in pockets of such forest surrounded by more arid regions or pine forests, and often in disturbed or degraded thickets. Badiera virgata grows in subspiny and spiny thickets on serpentine and on coastal limestone.

Taxonomy

Badiera DC. Prod. 1.: 334-335. 1824.—TYPE: Badiera penaea L.

Polygala L. sect. Hebecarpa Chodat subsect. Badiera (DC.) Chodat in Engl. &

Prantl, Nat. Pflanzenfam. 3(4): 331. 1896.

Polygala L. subgen. Badiera (DC.) Blake in Contr. Gray Herb., ser. 2, 47: 10.

1916.

Taprooted, at least when young, the roots with methyl salicylate odor

(wintergreen); shrubs or slender trees 2-6(-8) m tall in open areas, rarely to nearly 10 m

tall in closed woodlands, usually with one trunk (to a few trunks) at ground level, where

diameter may reach ca. 1 dm but usually much less, typically less than 3(-5) cm dbh,

usually much-branched above, the erect branches often virgate, slender and wispy

below with arching, spreading branchlets; wood very hard; bark pale brownish to

149

grayish, fairly smooth except for numerous small fissures and lenticels; young stems

densely pubescent, glabrate with age. Indumentum of simple hairs, dense to sparse on

nearly all parts, at least when young, generally in patches or zones on floral parts,

mostly less than 0.1 mm long, antrorsely appressed to slightly spreading, unicellular,

hollow, tapering in the upper fourth to an acute apex, the surface with irregular bumps

and small ridges (visible in SEM or by use of a compound scope), infrequently 0.2-0.3

mm long (e.g., on the upper filament sheath) and then also slightly kinked or twisted and

flattened (Fig. 4-33); hairs sometimes blackish on abaxial surface of lamina and

appearing as dark punctations to the naked eye, although the punctations in many

species also result from a shallow pit at the base of each hair. Leaves alternate,

exstipulate, simple, entire, evergreen, variable in shape and size, coriaceous to

somewhat leathery chartaceous, especially in the thin shade leaves, when coriaceous the venation inconspicuous when dry, apart from the midvein, although a few partial

veins are usually visible abaxially near the midvein on at least a few leaves, when fresh

the secondaries usually faintly visible on most leaves, thinner leaves have veins more or

less conspicuous (at least the secondaries), midvein usually more or less flush above

to slightly sunken and slightly raised below to more or less flush, sometimes strongly raised below; blades mostly shiny, varying from more or less plane (especially in shade) to minutely revolute, varying from thin and inconspicuous (to ca. 0.1 mm wide) to a thick, conspicuous rim (to 0.2-0.3 mm wide), usually thickest basally and medially and

thin to plane apically, sometimes revolutely cupped, typically at least sparsely

pubescent; leaves nyctinastic, folding downward in the evening and sometimes on

overcast days, so that the abaxial surfaces of leaves on opposite sides of the stem

150

touch, i.e., the plane of the mostly distichous leaves changes by about 90 degrees from

horizontal to vertical. Inflorescences axillary, racemose although sometimes appearing

umbelliform or cymose, or reduced to 1-2 flowers, with 2 small bracts subtending the peduncle (or inflorescence) and 3 small “bracts” subtending each pedicel, i.e., 1 bract and 2 lateral basal bracteoles; all parts typically pubescent, usually densely so. Flowers perfect or imperfect, small, generally 2-5 mm long, perfect, strongly zygomorphic; sepals 5, free, green, herbaceous, ovate, apically blunt, marginally ciliolate, tardily

deciduous (falling in young fruit, after the corolla, although the upper sepal rarely persistent), the 3 outer subequal (1 upper, 2 lower), the 2 inner lateral sepals (wings) ca. 1/3 longer than the outer sepals and much smaller than the petals; petals 3, herbaceous, 2 upper petals and the lower keel petal free from each other but basally fused to the filament sheath so the corolla falling as a unit with the androecium shortly after fertilization, the upper petals lingulate (oblong-elliptic), usually slightly shorter than the keel or subequal, the apical half to third curved upward at anthesis, basally green, apically white, turning yellow with age, the lower petal keel-shaped, i.e., longitudinally folded medially with the halves folded upward around the androecium and gynoecium, apically blunt and lacking not only a beak but also a crest, green basally to white or yellowish-green at least along the upper edges, the keel with three non-discrete zones, the laterally compressed apex (often differently colored at anthesis), the medial region with poorly developed lateral pouches or folds (apically undulate, expanded projections), and the reduced, narrow, semi-tubular basal region (claw); all parts usually sparsely to densely pubescent, at least in patches. Stamens 8, the filaments fused into an adaxially-split, strongly laterally compressed sheath around the gynoecium with short

151

free portions (compared to sheath length), the sheath densely long-pubescent internally apically, sparsely pubescent elsewhere; anthers bisporangiate, apparently unithecate, opening via apical pores that sometimes elongate to become slit-like. Ovary bicarpellate and bilocular, usually stipitate, laterally compressed, with one upper adaxial carpel, the other abaxial, usually pubescent, at least marginally, the hairs often lost with age, with a single style that is well below the anthers at anthesis, elongating and growing in a curve apically, so that the stigmas are eventually held subequal to the anthers, to 2-3 times as long as the ovary, deciduous in fruit; stigmas 2, the abaxial lower one apical, the upper one subapical and smaller; a single ovule per carpel, attached apically along the central axis by a relatively stout funiculus. Fruit a heart-shaped to quadrate capsule, somewhat coriaceous, often with one cell aborted, i.e., underdeveloped and with no seed, so the capsule then with a lopsided oblong shape, the valves dehiscing toward the central axis, sometimes curving into a coiled roll, with the bluish-black seeds persistent and capped by a large, glabrous, lobed, appressed, orange aril. Pollen polycolporate, with 8-10 colpi. Seeds oblong, 3-5 mm long, 1.5-2.5 mm wide, germinating from the funicular end; seedlings with slightly fleshy, epigeal, shallowly cordate, foliar cotyledons held ca. 2-3 cm above the soil surface, earliest leaves smaller and blunter but otherwise like the adult leaves.

Key to the Species of Badiera

1. Leaves small (mostly < 2.5 cm long and 1.5 cm wide); venation obscure (generally fewer than ca. 5 partial 2° veins visible)...... 2

2. Many leaves in fasciculate clusters; pedicels glabrous...... B. virgata

2’. Leaves all alternate; pedicels pubescent……………………………………..3

3. Leaves scabrous (at least some rough to the touch adaxially) ………………………………………………………...... B. penaea

152

3’. Leaves smooth to the touch (strigillose, but not rough)...... 4

4. At least some leaves triplinerved and/or subrhomboidal; a few 2° veins generally visible abaxially...... B. subrhombifolia

4’. Leaves not triplinerved nor subrhomboidal; lateral veins generally not visible…………………………………………...... B. alternifolia

1’. Leaves large (most > 2.5 cm long and 1.5 cm wide); venation obscure to conspicuous (often with 5 or more 2° veins at least partially visible abaxially; 3° veins also sometimes visible)...... 5

5. Most leaves apically emarginate...... 6

6. Emarginations usually conspicuous (very tip generally blunt with deeply sunken emargination); often with several 2° veins visible (even adaxially); fruit locules erect to slightly spreading, fruit wall and seeds usually pubescent; leaf apex rarely abruptly narrowed, if so, not acuminate...... B. oblongata

6’. Emarginations usually inconspicuous (shallow or infrequently even absent); only rarely with visible 2° veins; fruit locules widely divergent; fruit wall and seeds glabrous (or with a few inconspicuous hairs); leaf apex generally tapering and with at least a few leaves abruptly bluntly acuminate...... B. propinqua

5’. Leaves not emarginate apically (or only very rarely so on a few leaves)..... 7

7. Leaves mostly broadly obovate (sometimes broadly elliptic), base cuneately narrowed...... B. cubensis

7’. Leaves ovate to elliptic (sometimes narrowly so; very rarely slightly obovate), base rounded, obtuse, or acute, but not elongatedly cuneate...... 8

8. Peduncles short, less than pedicel length; racemes densely flowered, bracts and pedicels largely obscuring the rachis internodes; pedicel bracts persistent...... B. jamaicensis

8’. Peduncles elongate, greater than pedicel length; racemes laxly flowered, rachis internodes generally readily visible; pedicel bracts caducous...... B. fuertesii

1. Badiera alternifolia (R. Rankin) J.R. Abbott, stat. et comb. nov. Polygala guantanamana S.F. Blake ssp. alternifolia (R. Rankin) R. Rankin, Willdenowia 31: 428.

2001. Badiera virgata Britton ssp. alternifolia (R.Rankin) R.Rankin, Fl. Rep. Cuba, Ser.

153

A. Pl. Vasc. 7(1): 13. 2003.—TYPE: CUBA. Holguín, Moa: Charrasco al O de

Yamanigüey, suelo serpentinoso-rocoso, 50 m, 7 May 1980, A. Álvarez, J. Bisse, J.

Gutierrez, & F. K. Meyer HFC 42965 (holotype: HAJB; isotypes: B (photo!), JE).

Petiole 0.7-1.5(-1.7) mm long, ca. 0.5-0.7 mm wide; blade obovate to elliptic, 8-

16(-21) mm long, 4-8.5 mm wide, the base cuneately narrowed (especially when

strongly revolute) to acute, rarely obtusely rounded, the apex mostly rounded, often

shallowly emarginate, sometimes obtuse; margin revolute along entire blade (appearing

like a thickened rim), inrolled portion 0.2-0.3 mm wide basally and medially, to ca. 0.1

mm or plane apically; secondary veins typically obscure (not visible adaxially), with 0-3

secondary veins per side rarely faintly visible abaxially (as discolored lines, flush to

rarely somewhat raised near midvein). Flowers 3.7-4.7 mm long; pedicels 1.3-2.7 mm

long, subglabrous, usually with a few scattered hairs apically. Outer sepals 0.8-1 mm

long, 0.9-1.1 mm wide; inner lateral sepals (wings) 1.3-1.5 mm long, 1.1-1.5 mm wide.

Upper petals 2.7-4.1 mm long, 0.9-1.2 mm wide; keel petal 3.3-4.7 mm long, 1.2-2 mm wide. Gynoecium 2.7-3.7 mm long in flower; stipe 0.1-0.3 mm long; ovary ca. 0.7 mm long, ca. 0.5 mm wide; style 1.9-2.7 mm long, 0.25-0.35 mm wide, ca. 1.3-2.5 mm from

apex of the ovary to where upward curvature begins, the style curvature up to ca. 0.5

mm deep. Fully mature fruits poorly known (see Bisse and Lippold 17835, HAJB); fruit

body 5-5.5 mm long, 6 mm wide; stipe 0.8-1.1 mm long (Figs. 4-3E, 4-5A, 4-6A, 4-11B,

4-13D, 4-15B, 4-16A and B, 4-20A, 4-21C, 4-22C-H, 4-23D, 4-25, 4-32A, 4-33F, 4-34A).

Phenology. Flowering material has been collected from April to November, with

mature fruits known only from August.

154

Distribution. Badiera alternifolia is endemic to eastern Cuba, occurring in the

provinces of Guantánamo, Holguín, and Santa Clara; it grows in xeric, subspiny, shrub

thickets on serpentine; 350-600 m.

Additional Specimens Examined. CUBA. GUANTÁNAMO PROV.: Maisí, la zona de

Peladero de Jauco, Apr 1975 (veg), A. Álvarez de Zayas HFC 25917 (HAJB); Baracoa,

en los alrededores del Arroyo Maguana, 12 Apr 1985 (veg), A. Álvarez de Zayas HFC

55690 (HAJB); Baracoa, cerca del arroyo Maguana, 28 Jan 1977 (veg), A. Areces HFC

33887 (HAJB); Baracoa, en el valle del Río Maraví, Feb 1968 (veg), J. Bisse HFC 5800

(HAJB); Baracoa, en el valle del Río Maraví, 11 Feb 1972 (veg), J. Bisse HFC 21514

(HAJB); Maisí, La Tinta, Peladero de Jauco, cerca de Guajimero, 6 Jun 1982 (veg), J.

Bisse HFC 47822 (HAJB); Maisí, entre Boca de Jauco y la Tinta, 30 Apr 1986 (veg), E.

Genes HFC 58500 (HAJB); Maisí, orillas del Arroyo del Pino entre Guajimero y Alto del

Pino, 23 Apr 1986 (veg), E. Genes HFC 59141 (HAJB); Baracoa, la Cuaba, 14 Apr

1960 (veg), M. López Figueiras 860 (HAC, HAJB). HOLGUÍN PROV.: Moa, al SW de

Yamanigüey, al NW de Río Jiguaní, 20º34'23.8"N 74º44'46.8"W to 20º33'8.6"N

74º44'2.9"W (WGS 84), 22 May 2004 (fl), J. Richard Abbott 19025 (FLAS, HAJB); Moa,

Breñales de Moa, 10 Nov 1945 (veg), J. Acuña 13132 (HAJB); Moa, Yamanigüey, E de

Moa, km 1.5 carretera Moa-Baracoa, 8 Sep 1994 (fl, veg), R. Berazaín HFC 71392

(HAJB, NY); Cueto, Sierra de Nipe, 20 Feb 1918 (veg), E.L. Ekman 9131 (NY, S); Moa, al E de Yamanigüey, Mar 1968 (veg), J. Bisse HFC 6222 (HAJB); Moa, al E de

Yamanigüey, 6 Jan 1969 (veg), J. Bisse HFC 12016 (HAJB); Mayari Arriba, falda S de

Sierra de Micara, Apr 1970 (veg), J. Bisse HFC 15983 (HAJB); Moa, al E de

Yamanigüey, 15 Aug 1970 (fr, veg), J. Bisse HFC 17835 (HAJB); Mayarí, Sierra de

155

Nipe, cerca de la mina Woodfred, Aug 1970 (fl), J. Bisse HFC 18043 (HAJB); Mayarí,

Sierra de Nipe, Río Piloto, 9 Sep 1922 (fl), E.L. Ekman 15073 (C, S); Mayarí, Sierra de

Nipe, Río Piloto, 3 Jul 1924 (fl, veg), E.L. Ekman 19163 (LL, S); Moa, al E de

Yamanigüey, 7 Jun 1997 (fl), J. Gutierrez 74666 (UPRRP); Mayarí, Pinares de Mayarí, camino a Birán desde la ECODEM, 31 Mar 1990 (veg), R. Oviedo HFC 68911 (HAJB).

SANTIAGO DE CUBA PROV.: Segundo Frente, Cristal, Sierra Saca la Lengua, 26-27 May

1955 (fl buds, veg), J. Acuña 19682 (HAC, HAJB); Mayarí, region de la Sierra de Cristal

"Saca Lengua," 2-7 Apr 1956 (veg), Hno. Alain 5416 (HAC, HAJB); Segundo Frente,

Sierra Cristal, al S de los pinares de Mícara, 24 Feb 1976 (veg), A. Areces HFC 30638

(HAC, HAJB); Segundo Frente, Sierra Cristal, Loma Saca la Lengua, Apr 1968 (veg), J.

Bisse HFC 7087 (HAJB); Segundo Frente, Sierra Cristal, cerca de Mandinga, Apr 1968

(veg), J. Bisse HFC 7333 (HAJB); Segundo Frente, cerca de Seboruco, 1 Nov 1977

(veg), J. Bisse HFC 35933 (HAJB); Segundo Frente, zona de Saca la Lengua, 3 Mar

1998 (veg), J. Gutiérrez HFC 75261 (HAJB).

Badiera alternifolia is tentatively considered as a cladospecies and is strongly

supported as not closely related to the remaining Cuban species, suggesting that the

similar leaf size and shape between this species, B. virgata, and some xeric forms of B. oblongata, all in eastern Cuba, are likely convergent, perhaps driven by environmental factors. Badiera alternifolia is the only species in which methyl salicylate was detected

(by smell) in the twigs. In all other species, only the roots smelled of methyl salicylate.

However, it is not clear if this is a feature unique to the single population encountered or is shared across all populations of this species.

156

Badiera alternifolia is highly endemic and very restricted; it is represented by only

a few populations in northeastern Cuba. Thus, any habitat degradation over its range

would mean that B. alternifolia could be considered as “endangered” according to the

guidelines of the IUCN red data book categories (Lucas and Synge, 1978).

2. Badiera cubensis Britton, Bull. Torrey Club 37: 362. 1910. Polygala stipitata

Blake, Contr. Gray Herb. 47: 15.1916.—TYPE: CUBA. Pinar del Río, La Loma Pelada, 27

Dec [1862?], Wright 1913 p.p. (holotype: NY!; isotypes: BREM!, HAC!, K!).

Petiole 1.5-2(-2.7) mm long, ca. 0.6-0.7 mm wide; blade mostly broadly obovate, sometimes broadly ovate, (25-)30-50(-65) mm long, (12-)20-35(-40) mm wide, the base

acute to cuneate, usually with a conspicuously narrowed, attenuate base, the apex

mostly shortly and abruptly acuminate, the acumen 0.2-0.5(-0.8) mm long, sometimes

obtuse, rarely rounded, rarely emarginate; margin often revolute along very edge,

varying from 0.2-0.3 mm wide at base to 0.1 mm or plane at apex; veins usually more or

less obscured (in part by wrinkling above), when visible with 3-5 veins per side,

impressed above, slightly raised below, leaf often somewhat keeled below along

midvein. Flowers 2.8-3.2 mm long; pedicels 0.8-1.2 mm long. Outer sepals 0.8-1 mm

long, 0.9-1.1 mm wide; inner lateral sepals (wings) ca. 1.5 mm long, 1.1-1.3 mm wide.

Upper petals 2.7-3 mm long, 0.7-0.9 mm wide; keel petal 2.8-3.2 mm long, 0.9-1.3 mm

wide. Gynoecium 2.2-2.5 mm long in flower; stipe 0.05-0.2 mm long; ovary ca. 0.5 mm

long, ca. 0.5 mm wide; style 1.2-1.7 mm long, ca. 0.2 mm wide, ca. 1 mm from apex of

the ovary to where upward curvature begins, the style curvature up to ca. 0.5 mm deep.

Fruit body 6-8 mm long, 8-10 mm wide; stipe 1.5-2 mm long (Figs. 4-5B, 4-8C, 4-10A

157

and B, 4-12C, 4-14A to C, 4-15E, 4-17A and B, 4-20D, 4-21D, 4-24A, 4-32B, 4-33A, 4-

34B).

Phenology. Flowering material has been collected from August to January, with fruits known from December to June.

Distribution. Badiera cubensis is endemic to western Cuba, in the province of

Pinar del Río; it grows in gallery forests and degraded evergreen forests on limestone;

200-650 m.

Additional Specimens Examined. CUBA. PINAR DEL RÍO PROV.: Bahía Honda,

Pan de Guajaibón, ladera N entre 500 y 600 m, 22º47'23.6"N 83º21'59.5"W (WGS 84),

8 May 2004 (veg), J. Richard Abbott 18894 (FLAS, HAJB); Bahía Honda, Pan de

Guajaibón, La Palma, 16 May 1953 (fr), J. Acuña 18569 (HAC, HAJB); San Cristóbal,

Rangel, Arroyo de la Plata, Jan 1949 (fl), Hno. Alain 703 (HAC); San Cristóbal, top of

Pico Tey, Rangel, Jan 1953 (fr), Hno. Alain 2743 (GH, HAC, US); Consolación del

Norte, Pan de Guajaibón, 14 Oct 1976 (fr), A. Álvarez de Zayas HFC 32534 (HAJB);

Consolación del Sur, Sierra de los Organos, between San Diego de Tapias and

Sabanilla, 3 Apr 1920 (fr), E.L. Ekman 10666 (MICH, NY, S); Bahía Honda, Pan de

Guajaibón, 9 Jan 1921 (fr), E.L. Ekman 12781 (G, S); La Palma, Sierra de los Organos,

Rosario group, top of Sierra del Pendejeral, 13 Sep 1923 (fl, fr), E.L. Ekman 17521 (G,

NY, S); San Cristóbal, El Rangel, Aug 1928 (fl), Hno. León 13508 (HAC, NY); San

Cristóbal, 7 Dec 1915 (fr), J.T. Roig y Mesa 1191 (HAC); San Cristóbal, Las Animas,

Rangel, Taco-Taco, 28-30 Aug 1927 (fl, fr), J.T. Roig y Mesa 8932 (HAC); Bahía

Honda, 18-19 Dec 1910 (fr), P. Wilson 9429 (NY).

158

My preliminary phylogenetic analyses of DNA sequence data support Badiera cubensis as a cladospecies (Fig. 4-1), and the species also shows the putative morphological apomorphy of broadly obovate leaves. It is a distinctive species that is not readily confused with any others, except for rare branches that have leaves which approach those of B. propinqua. Nearly all specimens of B. cubensis have at least some

(usually most) leaves obovate and cuneate at the base, whereas B. propinqua

specimens have ovate to elliptic leaves that are mostly bluntly rounded at the base.

Also, B. cubensis seeds are densely pubescent in a fruit that is more or less

isodiametric with more or less erect lobes, while the seeds of B. propinqua are

subglabrous to very sparsely pubescent in a fruit that is typically wider than long, with

divergent lobes.

Badiera cubensis is highly endemic and very restricted, with only 12 collections

known from western Cuba. Thus, given the widespread habitat degradation over much

of its range, if most of the populations do have few individuals, then B. cubensis could

be considered as “endangered” according to the guidelines of the IUCN red data book categories (Lucas and Synge, 1978).

3. Badiera fuertesii Urb., Symb. Antill. 7: 244. 1912. Polygala fuertesii (Urb.) S.F.

Blake, Contr. Gray Herb., ser. 2, 47: 17. 1916.—TYPE: DOMINICAN REPUBLIC. Barahona,

Gipfel des Noche Buena Berges, Sep 1911 (fl), M. Fuertes 1065 (holotype: B,

destroyed; lectotype, here designated: G!; isolectotypes: A!, BM!, E!, F!, GH!, HBG!, K!,

L!, NY!, P!, U!, US!, W!, Z!).

Petiole 2.5-5 mm long, ca. (0.5-)0.6-1 mm wide; blade broadly elliptic to slightly

ovate or slightly obovate, sometimes suborbicular, (13-)25-55(-60) mm long, (9-)18-25(-

159

38) mm wide, but leaves mostly 30-45 mm long by 20-30 mm wide, the base obtuse to

slightly acute or broadly cuneate, the apex mostly obtuse, infrequently rounded or slightly and shortly acuminate; margin thinly revolute; secondary veins very conspicuous, usually more than 6, sometimes somewhat obscure when fresh, and with higher-level veins forming ± visible reticulations (most conspicuous when dry; often only faintly visible in patches when fresh). Flowers (3.2-)4-4.5 mm long; pedicels 1.7-2.5 mm

long. Outer sepals 1.2-1.8 mm long, 1.1-1.3 mm wide; inner lateral sepals (wings) 2-2.5

mm long, 1.7-2 mm wide. Upper petals 3-3.3 mm long, 1-1.2 mm wide; keel petal 3-4.1

mm long, 1.1-1.9 mm wide. Gynoecium 2.8-2.9 mm long in flower; stipe 0.2-0.3 mm

long; ovary 0.9-1.1 mm long, ca. 0.9 mm wide; style 1.3-1.6 mm long, ca. 0.3 mm wide,

0.6-1 mm from apex of the ovary to where upward curvature begins, the style curvature

up to ca. 0.5 mm deep. Fruit body 8-9(-10) mm long, 9-11 mm wide, with stipe 1(-2) mm

long (Figs. 4-2A and D, 4-3F, 4-5C, 4-7C, 4-10F, 4-13C, 4-14D, 4-15F, 4-16C and D, 4-

20B, 4-24E, 4-26, 4-31B, 4-32C, 4-34C).

Phenology. Flowering material has been collected in every month except

January, March, and April, with peak flowering from June to August, and fruiting

material has been collected in every month except September, with no readily apparent

peak period.

Distribution. Endemic to the Dominican Republic, mostly in the Cordillera Central,

with a few collections from the Sierra de Bahoruco; in a variety of montane habitats,

cloud forest, mesic broad-leaf forest, rain forest, pine woodlands, and degraded

thickets; (800-)1100-2000 m.

160

Additional specimens examined. DOMINICAN REPUBLIC. AZUA PROV.: Sierra

de Ocoa, San José de Ocoa, Loma del Rancho, 23 Feb 1929 (fr), E.L. Ekman H11659

(A, S). BARAHONA PROV.: Loma Trocha de Pey, 1340-1350 m, 18°6'38.6"N

71°13'36.9"W (WGS 84), 31 May 2006 (fl), J. Richard Abbott 20901 (FLAS, JBSD); SW

of Barahona, La Tierra Fria, 27 Jul 1950 (fl), R.A. Howard 12219 (A, BM, FLAS, IJ,

MICH, NY); Monteada Nueva, Cortico, 6-7 Nov 1976 (veg), A.H. Liogier 25859 (NY,

UPR); Sierra de Bahoruco, Loma "Pie Pol" (Pie de Palo) de La Guasára de Barahona,

18°10'N 71°12'W, 25 Mar 1987 (veg), T. Zanoni 38654 (NY). INDEPENDENCIA PROV.: 3 km S of Angel Feliz, 18°37'N 71°46'W, 16 Oct 1991 (fr), S.A. Thompson 9763 (CM,

FLAS). LA VEGA PROV.: Alto Casabito, along E entrance into the Ebano Verde Scientific

Reserve, 1280 m, 19°1'34.2"N 70°31'9.7"W (WGS 84), 18 Jun 2006 (fl), J. Richard

Abbott 21093 (FLAS, JBSD); Cordillera Central, Constanza, road to Valle Nuevo, Los

Montazos, 21 Oct 1929 (fl), E.L. Ekman H13894 (F, G, GH, LL, NY, S, US); Cordillera

Central, Constanza, El Paragua, 18°58'N 70°44'W, 23 Jan 1986 (fr), R. García 946

(MO, NY); Cordillera Central, Constanza, al SE del poblado de Pinalito, 18°53'N

70°38'W, 7 Feb 1986 (fl, fr), R. García 1020 (MO, NY, U); Cordillera Central, al SE de

Constanza, "El Alto de Sonador," 18°52'N 70°38.5'W, 6 Apr 1986 (fr), R. García 1091

(MO, NY, US); Cordillera Central, Constanza, en el lugar llamado La Culata, en la loma

El Campanario, 18°57.5'N 70°47'W, 13 Dec 1986 (fr), R. García 1824 (NY); Cordillera

Central, Reserva Científica Ebano Verde, sobre Loma Golondrina (camino a antena),

19°3'N 70°33'W, 29 May 1992 (fr), R. García 46092 (FTG, MAPR); La Cienega and

environs, N of Constanza, 16 May 1959 (fl, fr), J.J. Jimenez 3993 (US); Jarabacoa,

Loma de la Sal, 24 May 1968 (veg), A.H. Liogier 11394 (NY); Jarabacoa, Loma de la

161

Sal, 7-10 Aug 1968 (fl), A.H. Liogier 11947 (GH, NY, US); Jarabacoa, Loma de la Sal,

30-31 Oct 1968 (fl, fr), A.H. Liogier 13384 (GH, NY, US); Alto de Casabito, Bonao, 19

Sep 1970 (fl, veg), A.H. Liogier 17470 (F, NY); Constanza, La Descubierta, 1-2 May

1971 (fr), A.H. Liogier 18018 (F, NY); Reserva Científica Ebano Verde, Loma Alto

Casabito, 19°3'N 70°31'W, 20 Nov 1992 (fr), S.A. Thompson 11218 (CM, FLAS);

Constanza, Valle Nuevo, 1971 (fl, fr), R.O. Woodbury s.n. (UPR); Cordillera Central, sobre Loma de La Golondrina (cerca del poblado La Sal, al S de Jarabacoa), 19°3'N

70°35'W, 23 May 1986 (fl), T. Zanoni 36492 (FTG, NY, U); Cordillera Central, aprox. 5 km al SO de Jarabacoa (carretera a Manabao), sobre El Mogote, al S del poblado rural de Pinar Quemado, 19°5'N 70°40'W, 3 Jul 1986 (fl), T. Zanoni 36835 (MO, NY);

Cordillera Central, Reserva Científica Ebano Verde, en al cima de loma La Sal, 19°4'N

70°34'W, 27 May 1992 (fl), T. Zanoni 45946 (NY); Cordillera Central, Reserva Cientifica

Ebano Verde, en la Loma Alto de Casabito, al N del paso de Casabito (cruce Abanico de Bonao-La Palma-El Río de Constanza), 19°2.5'N 70°31.5'W, 22 Jun 1992 (fl), T.

Zanoni 46479 (CM, FTG, MO, UPRRP); Cordillera Central, Reserva Científica Ebano

Verde, sobre la cima de Loma El Col, 19°5'N 70°32'W, 24 Jun 1996 (fl), T. Zanoni

46717 (MAPR). MONTE CRISTI PROV.: Cordillera Central, Monción, between Rio Cenobi and Rio San Juán, 16 Jun 1929 (fl, fr), E.L. Ekman 12803 (F, G, GH, K, NY, S). PERAVIA

PROV.: Firme de Banilejo, Piedra Blanca, 9 Aug 1973 (fl, fr), A.H. Liogier 19952 (F, NY);

San José de Ocoa, Loma del Rancho, al SE de Parra, 18°31'N 70°30'W, 8 Jul 1978 (fl),

M. Mejía 48 (MO, NY); Cordillera Central, 9 km al SE de San José de Ocoa, en el poblado de El Limón, Loma Punto, al O del nacimiento del arroyo El Limón, 18°29.5'N

70°28'W, 29 May 1984 (fl), M. Mejía 523 (NY); 19 km E de San José de Ocoa, en El

162

Manaclar, 18°30'N 70°27'W, 23 Nov 1981 (fl, fr), M. Mejía 18227 (MO, NY); Cordillera

Central, Loma del Rancho, SE de San José de Ocoa, 18°29'N 70°27.5'W, 19 Aug 1987

(fl), J. Pimentel 813 (MO, NY, US); Cordillera Central, El Manaclar (de Los Anones), 18

km del Parque Central de San José de Ocoa en el camino a Los Anones, 18°32'N

70°25'W, 6 Jul 1982 (fl), T. Zanoni 21353 (FTG, MO, NY); Cordillera Central, lado N de

Loma de La Valvacoa, arriba del poblado rural de El Guineal, 18°28'N 70°22'W, 14 Jul

1982 (fl), T. Zanoni 21657 (NY); Cordillera Central, 15 km N desde el Parque Central y

8 a 10 km desde el cruce de Los Arroyos en el camino a Carmona, 18°40'N 70°32'W,

21 Jul 1982 (fl, fr), T. Zanoni 21892 (NY, U); Cordillera Central, "El Tope" de la Loma

Rodríguez, 18°26'N 70°18'W, 29 Dec 1983 (fl, fr), T. Zanoni 28293 (MO, NY, WU);

Cordillera Central, aproximadamente 10 km de Rancho Arriba en la carretera a Piedra

Blanca, próximo al poblado rural "Dieciseis," 18°45'N 70°22'W, 20 Aug 1984 (fl, fr), T.

Zanoni 31526 (FTG, MO, NY); Cordillera Central, en las cimas de Loma del Rancho, al

SE de San Jose de Ocoa, subida por el lado de "Tumbaca," 18° 31'N 70° 28'W, 14 Aug

1987 (fl, fr), T. Zanoni 40217 (FLAS, MO, NY, U, UPRRP). SAN JUAN PROV.: Piedra del

Aguacate to Rio del Oro, 10 Oct 1946 (fl, fr, veg), R.A. Howard 9400 (BM, GH, NY, S,

US); Cordillera Central, Parque Nacional Ramírez, en el sendero de la subida a la cuenca del Río Prieto, subiendo desde El Valle de Tetero al Cruce de Tetero, 18°59'N

70°56'W, 24 Jun 1989 (fl), T. Zanoni 41602 (NY). SANTIAGO PROV.: At base of La

Cotorra, 26 Mar 1964 (fr), J.J. Jimenez 4815 (NY); San José de las Matas, Valley of Rio de la Laguna, Rancho del Medio, Mata Grande, 1-7 Oct 1968 (fl, fr), A.H. Liogier 12953

(GH, NY, US); Cordillera Central, al NO del Valle de Bao, 19° 4'N 71° 2'W, 10 Feb 1997

(fr), A. Veloz 694 (FLAS, MO, TENN).

163

My preliminary phylogenetic analyses of DNA sequence data support Badiera

fuertesii as a cladospecies (Fig. 4-1), and the species also shows the putative

morphological apomorphy of elongated pedicels. It is a distinctive species that is not

readily confused with any others. From a global perspective, B. fuertesii is obviously highly endemic and very restricted, but it is relatively widespread on a regional level.

Thus, given the widespread habitat degradation over much of its range, if most of the populations do have few individuals, then B. fuertesii could be considered as

“endangered” according to the guidelines of the IUCN red data book categories (Lucas and Synge, 1978).

4. Badiera jamaicensis (Chod.) J.R. Abbott, comb. nov. Polygala jamaicensis

Chodat, Mém. Soc. Phys. Genève 31(2, 2): 11. 1893.—TYPE: JAMAICA. 1886 (fl, fr), J.H.

Hart 641 (holotype: B, destroyed; lectotype, here designated: GOET!; isolectotypes: F!,

NY!, US!).

Petiole 2.5-4.5(-5.5) mm long, ca. 0.5-0.8(-1.1) mm wide; blade mostly broadly to

narrowly elliptic, varying to slightly obovate or slightly ovate (sometimes narrowly so), rarely strongly ovate or obovate, (22-)30-65(-82) mm long, (7-)15-25(-41) mm wide, the base acute to cuneate, rarely obtuse, the apex mostly acute, sometimes obtuse, rarely bluntly rounded; margin thinly revolute; secondary veins very conspicuous, usually with

5-10 major veins per side (and with 5-20 smaller secondaries), sometimes with a prominent lateral secondary vein from the base on each side of the midvein (i.e., triplinerved), with higher-level veins forming ± visible reticulations (most conspicuous when dry). Flowers 3.1-5.2 mm long; pedicels 1.8-3.3 mm long. Outer sepals 0.7-1.3 mm long, 0.7-1 mm wide; inner lateral sepals (wings) 1.3-2.2 mm long, 0.9-2.3 mm

164

wide. Upper petals 3.1-3.9 mm long, 0.9-1.3 mm wide; keel petal 3-4.7 mm long, 1-2

mm wide. Gynoecium 3-4 mm long in flower; stipe 0.1-0.2 mm long; ovary 0.5-1 mm

long, 0.6-0.8 mm wide; style 1.8-2.6 mm long, ca. 0.3 mm wide, 0.7-1.8 mm from apex

of the ovary to where upward curvature begins, the style curvature up to ca. 0.5 mm

deep. Fruit body 7-10(-13) mm long, 7-9(-10) mm wide, with stipe 1-2.6 mm long, mostly

slightly taller than wide or isodiametric (Figs. 4-5D, 4-10E, 4-12B, 4-14E and F, 4-15G

and H, 4-17C and D, 4-20G and H, 4-21E, 4-27, 4-32D, 4-34D).

Phenology. Only a single collection is known from Belize, and it was flowering in

June. In Guatemala, flowering material is known from December to May, July, and

August, and fruiting material is known from January, May, July, and August, with no

apparent peak phenology period. In Jamaica, flowering material is known from all

months except February and April, and fruiting material is known from every month except February, June, and November, with a slight peak in flowering and fruiting during

July and August. In Mexico, flowering material is known from March and August to

December, with fruiting material only known from October and November. Only in

Mexico, then, does it seem that there is a strong seasonality to phenology.

Distribution. Belize, Guatemala, Jamaica, and Mexico; the only Belize collection

was from a swampy habitat; collections from Guatemala were made in degraded areas,

roadside forest, on buildings at Tikal, and on lakeshore gypsum escarpment; in

Jamaica, B. jamaicensis occurs in the widest range of habitats, in limestone and

bauxitic woods and thickets, serpentine outcroppings, rocky hillsides, dry limestone

forest, scrub, and secondary thickets; in Mexico, habitat is primarily semi-deciduous (or

165

semi-evergreen) tall to low forest, usually on limestone, sometimes in floodplains, often

in degraded areas; 0-1300 m.

Additional specimens examined. BELIZE. PRECISE LOCALITY UNKNOWN:

Guatemala Survey, Camp 36. B.H., 4 Jun 1934 (fl), W.A. Schipp 1254 (BM, G, MO, Z).

GUATEMALA. IZABAL DEPT.: Mun. El Estor La Mina de Exmibal, al E del Estor, 17 Jul

1988 (fl), P. Tenorio L. 14594 (TEX). PETÉN DEPT.: S of Santa Ana, 4.9 km N of

Sabaneta (Dolores), 16°37'21.9"N 89°33'28.9"W (NAD 27), 2 Jan 2005 (veg), J. Richard

Abbott 19776 (CICY, FLAS); Tikal, on top of Temple III, 29 Jul 1959 (fl, fr), E. Contreras

43 (CAS, F, MO, WIS, XAL); Tikal National Park, Bajo de Santa Fe, salida de Arroyo

Corriental, on Aguada Terminos road, 28 Jul 1960 (fl), E. Contreras 1375 (MO, RSA,

WIS, XAL); About 25 km E of Tikal, Bajo Santa Fe, 24 Aug 1960 (fl, fr), E. Contreras

1444 (CAS, F, MO); About 200 m from Santo Toribio, 24 Aug 1961 (fr), E. Contreras

2765 (CAS, MO); Tikal National Park, on top of Temple III, 3 Jan 1964 (fr), E. Contreras

3681 (F, MO, RSA, WIS); Bordering Laguna Petén Itza, about 3 km from San Jose to El

Remate, 10 Aug 1966 (fl, fr), E. Contreras 5878 (CAS, LL, MO, RSA); Bordering Laguna

Petén between San Jose and El Remate, 5 Aug 1967 (fl), E. Contreras 6988 (LL, MO,

RSA); Tikal-Remate Road, km 49, Jan 1969 (fl), E. Contreras 8260 (LL, RSA); Poptun

Road, La Cumbre de Yal-Tutu, 22 Mar 1970 (fl), E. Contreras 9820 (LL); Lake Petén, 3

May 1933 (fl), C.L. Lundell 3187 (US, W); Tikal, N of Main Plaza, 31 Jan 1959 (fl), C.L.

Lundell 15263 (CAS, LL, MO, WIS); Tikal, hanging from roof comb of Temple V, 7 Feb

1959 (fl), C.L. Lundell 15387 (LL); Tikal, on top of Temple V, 8 Jul 1959 (fl), C.L. Lundell

16249 (CAS, LL, MO, RSA, WIS); Tikal, top of Temple I, 2 Mar 1961 (fl), C.L. Lundell

16831 (F, MO, XAL); Tikal, on Temple IV, 17 Jan 1962 (fl, fr), C.L. Lundell 17148 (CAS,

166

MO); Lake Petén Itza, between San Jose and Remate, 23 Jan 1962 (fl, fr), C.L. Lundell

17287 (F, MO, RSA, WIS, XAL); En Santa Elena, en la cueva de Jabitzenaj, 20 Jan

1969 (fl), R. Tún Ortíz 110 (F, MO); Tikal, Parque Nacional, en la cúpula del Templo #5,

13 Dec 1969 (fl), R. Tún Ortíz 458 (DUKE, F, MO, US); Orillando el camino para

Poctún, km 78, 16 Apr 1970 (fl), R. Tún Ortíz 988 (F, MICH); Santa Elena, orillando el camino para San Andrés, km 20, 28 May 1970 (fl, fr), R. Tún Ortíz 1163 (BM, F, MO,

WIS). JAMAICA. CLARENDON PARISH: Portland Ridge, Oct 1955 (fl, fr), G. Asprey 2212

(NY); Ca. 3 km W of Milk River Bath, top of Round Hill, 13 Jan 1980 (veg), V. Kapos

1537 (MO); N slope of Round Hill, 22 Nov 1954 (fl), G.R. Proctor 9499 (A, F, MO, NY);

Alcoa Teak Pen mining area, between Pits H-9 and H-7, 31 Dec 1963 (fl, fr), G.R.

Proctor 24359 (LL); Harris Savanna, 7 Jan 1975 (fl, fr), G.R. Proctor 34594 (IJ); Upper slopes of Round Hill, 26 Jul 1979 (fl, veg), G.R. Proctor 38263 (FTG, IJ). MANCHESTER

PARISH: Near Old England, 9 Aug 1895 (fl, fr), W. Harris 5838 (A, BM, F, NY, US); Old

England, 16 Sep 1896 (fl), W. Harris 6597 (BM, G, GH, NY, US); Near Providence, 1.5 miles W of Newport, 23 Apr 1961 (fr), K.U. Kramer 1660 (U); Wales, 1 mile E of

Newport, 19 Dec 1951 (fl), G.R. Proctor 6040 (NY); 1/2 mile NE of Spur Tree, 2600' elev., 21 May 1953 (fl), G.R. Proctor 7899 (GH); ca. 1/2 mile NE of Spur Tree, 10 Aug

1954 (fl, fr), G.L. Webster 5238 (A, BM, MICH, US); Providence, 1.5 miles WSW of

Newport, 9 Jan 1961 (fl, fr), G.R. Proctor 21912 (LL, MICH, NY, TRIN, US); Huntley Hill,

20 Jul 1978 (fl, fr), G.R. Proctor 37904 (BRIT, FTG, MO). PORTLAND PARISH: Blue

Mountains, Pleasant Hill, 28 May 1916 (fl, fr), J.R. Perkins 1259 (GH, K, WU). ST.

ANDREW PARISH: Clifton Mount, 1885 (fl), J.H. Hart 650 (NY, US); Blue Mountains,

Cinchona, 24 Aug 1939 (fl, fr), W.R. Philipson 903 (A, BM, NY); Along the Newcastle

167

road between mileposts 16 and 17, 24 Jun 1968 (fl), G.R. Proctor 28790 (RSA, U); 0.8

mile S of Silver Hill Gap, 11 Jul 1965 (fl, fr), G.L. Webster 13703 (DAV, DUKE, F, GH,

MICH, MO, RSA, S, TEX, U, US). ST. ANN PARISH: Saint Ann's Bay and vicinity, Liberty

Hill, 27-30 Mar 1908 (fl, fr), N.L. Britton 2498 (F, NY); Saint Ann's Bay and vicinity,

Salem, 27-30 Mar 1908 (fr), N.L. Britton 2548 (F, NY); between Priory and Bamboo, 20-

31 Dec 1953 (fl), R.A. Howard 13528 (A, IJ). ST. CATHERINE PARISH: Planters Hall, 21

Jan 1962 (fl, fr), C.D. Adams 10306 (M, MO); Long Road Track, 12 Aug 1970 (fl), M.

duQuesnay 616 (IJ); near Ewarton, 24 Nov 1896 (fl), W. Harris 6671 (A, BM, F, NY, UC,

YU); Polly Ground, 1.5 miles SSW of Ewarton, 24 Mar 1969 (fr), G.R. Proctor 30013

(IJ); Roaring River district, 1.5 miles due SE of Lluidas Vale, 21 Nov 1970 (fl), G.R.

Proctor 31515 (F, IJ, LL, MO, U); Coleman's Bay, 9 Sep 1970 (fl), T. Tulloch 382 (IJ).

ST. ELIZABETH PARISH: Santa Cruz Mountains, 5 Sep 1907 (fl, fr), N.L. Britton 1185 (NY);

Malvern, 3 Sep 1907 (fl, fr), W. Harris 9651 (BM, F, K, NY, P, US); Santa Cruz

Mountains, Bethlehem, 1916 (fr), J.R. Perkins 894 (WU); Hampton School, near

Malvern, 14 Mar 1953 (fr), G.R. Proctor 7768 (A, NY); Santa Cruz Mountains, 1 mile

SW of Hampton School, 12 Aug 1954 (fl), G.L. Webster 5309 (A, IJ, MICH). ST. THOMAS

PARISH: Whitfield Hall, 29 Jul 1960 (fl, fr), C.D. Adams 7684 (BM, DUKE, MO); Arntully,

3 Jul 1963 (fl), M.R. Crosby 465 (DAV, DUKE, F, GH, LL, MICH, MO, MSC, NY, RSA,

UC, US); Arntully, 9 Mar 1963 (fl, fr), G.R. Proctor 23311 (IJ, LL, MICH); Arntully, 3 Aug

1966 (fl, fr), D.C. Sternberg 3364 (DUKE, LL, MICH, MO, UC, US). UNSPECIFIED

LOCALITY: White River, 1 Jan 1850 (fl), R.O. Alexander s.n. (GOET, K, NY); Bridge Hill,

19 Jan 1898 (fr), W. Harris 7092 (BM, F, S); Mac Fadyen, 1838 (fl), W.J. Hooker s.n.

(NY). MEXICO. CAMPECHE ESTADO [ALL FROM MUN. CALAKMUL]: Loc. Ejido Narciso

168

Mendoza, 18°13'38"N 89°27'12"W, 20 Sep 1997 (fl), D. Álvarez M. 347 (MO); A 400 m

al O del poblado Plan de San Luis, 15 Aug 2002 (fl), D. Álvarez 1816 (MO); 20 Km al S

de la caseta de vigilancia de la Reserva de la Biósfera de Calakmul, antigua caseta de

vigilancia, 24 Nov 1997 (fl), E.M. Lira C. 476 (MO); loc. Km 29 al S de la Caseta a la

entrada de Calakmul, 19 Oct 1997 (fl, fr), E. Madrid N. 310 (MO); 9 Km al SE de Dos

Naciones, camino a El Civalito, 4 Dec 1998 (fl), E. Martínez S. 31433 (MO); En el Km

31 de Calakmul, 9 Dec 1998, E. Martínez S. 31684 (MO). QUINTANA ROO ESTADO: W of

Cancun, a few thousand feet N of Leona Vicario, 21°18'23.9"N 87°5'15.8"W (NAD 27),

28 Dec 2004 (veg), J. Richard Abbott 19735 (CICY, FLAS); 10 km al S de Akumal, 25

Sep 1982 (fl), E. Cabrera 3609 (TEX); Mun. Benito Juárez, 29 km al N del km 31 de la

carretera Cancún-Leona Vicario, 16 Mar 1998 (fl), R. Durán 3084 (CICY); Mun. Lazaro

Cardenas, El Eden Reserve, ca. 30 miles NW of Cancun, Sep 1996 (fl), L.M. Ortega-

Torres 2628 (TEX); Reserva de la Biósfera Sian Ka'an, km 1.5 carretera Vigía Chico -

Felipe Carrillo Puerto, 13 Nov 1985 (fl, fr), R. Villanueva 503 & 508 (XAL).

Badiera jamaicensis is strongly supported as a cladospecies (Fig. 4-1), and in

addition possesses the morphological characters stressed in the identification key above. Material from Jamaica is morphologically indistinguishable from material from

Guatemala and Mexico. Some specimens of B. oblongata from eastern Cuba can at a glance seem like B. jamaicensis, but B. jamaicensis leaves almost always have an

acute apex, are very rarely emarginate, and are usually conspicuously veiny abaxially

(with secondary and tertiary veins visible), while B. oblongata leaves are usually bluntly

rounded apically, are almost always conspicuously emarginate, and usually have

obscure venation.

169

From a global perspective, B. jamaicensis is obviously highly endemic and very

restricted, but it is fairly widespread in Jamaica and across the Yucatan Peninsula and

northern Guatemala. Thus, despite widespread habitat degradation over much of its

range, B. jamaicensis may not be under any immediate threat, especially since this

species commonly occurs in disturbed areas.

5. Badiera oblongata Britton, Bull. N.Y. Bot. Gard. 5: 314. 1907. Polygala oblongata (Britton) S.F. Blake, Contr. Gray Herb., ser. 2, 47: 13, 1916. Polygala penaea

L. ssp. oblongata (Britton) Gillis, Phytologia 32: 37. 1975.—TYPE: BAHAMAS. New

Providence, N slope of Blue Hills, 6 Sep 1904 (fl), N.L. Britton 578 (holotype: NY!; photo

of holotype: A!; isotypes: F!, MO!, US!).

Badiera heterophylla Britton, Bull. Torr. Bot. Club 42: 496. 1915. Polygala

dimorphophylla Blake, Contr. Gray Herb, 47: 16. 1916.—TYPE: CUBA. Holguín, Sierra

Nipe, near Woodfred, 7 Dec 1909 (fr), J.A. Shafer 3070 (holotype: NY!; isotypes: MO!,

NY!, US!).

Badiera montana Britton, Bull. Torr. Bot. Club 37: 363. 1910. Polygala montana

(Britton) Blake, Contr. Gray Herb., ser. 2, 47: 16. 1916.—TYPE: CUBA. Sancti Spíritus,

Trinidad Mountains, Arroyo Grande, 11-12 Mar 1910 (fr), N.L. Britton 5461 (holotype:

NY!; isotype: US!).

Badiera punctata Britton, Bull. Torr. Bot. Club 42: 496. 1915. Polygala punctifera

Blake, Contr. Gray Herb., ser. 2, 47: 13. 1916.—TYPE: CUBA. Holguín, Mayarí, Sierra de

Nipe, Arroyo del Medio, above the falls, 24 Jan 1910 (fr), J.A. Shafer 3644 (holotype:

NY!; isotypes: NY!, US!).

170

Petiole 1.5-3.2(-4) mm long, ca. 0.5-1.1 mm wide; blade broadly to narrowly elliptic to oblong, oval, ovate, or slightly obovate, rarely ovate-lanceolate, (9.5-)15-45(-50) mm long, (5-)10-25(-32) mm wide, the leaves mostly 20-35 mm long x 10-20 mm wide, size often variable on same branch but not usually with the large and small extremes (some collections are predominately small-leaved, others are predominately large-leaved), the base acute, cuneate, or obtusely rounded, the apex obtuse, acute, or bluntly rounded, usually emarginate (when the apex is acute, the extreme tip is still somewhat blunt); margin slightly revolute (very thin, less than 0.1 mm, or rarely up to ca. 0.2 mm near the base); secondary veins somewhat obscure, especially adaxially, with 4-7 major secondary veins per side (infrequently with a few additional smaller secondaries), sometimes with an inconspicuous to prominent lateral secondary vein from the base on each side of the midvein (i.e., triplinerved), veins slightly raised below to ± flush with lamina (never as strongly raised or conspicuous as in B. fuertesii and B. jamaicensis).

Flowers 2.7-3.9(-4.7) mm long; pedicels 0.8-2.5(-3.1) mm long. Outer sepals 1-1.2(1.4) mm long, 0.9-1.3 mm wide; inner lateral sepals (wings) 1.1-1.7(-2.3) mm long, 1.4-1.7 mm wide. Upper petals (2.6-)2.7-3.3(-3.6) mm long, (0.6-)0.7-1.2(-1.4) mm wide; keel petal 2.9-3.8(-4.2) mm long, 1.3-1.5(-1.8) mm wide. Gynoecium (2.4-)2.5-2.8(-3.1) mm long in flower; stipe 0.1-0.4 mm long; ovary 0.6-0.7 mm long, ca. 0.5-0.6(-0.8) mm wide; style 1.2-1.7(-1.8) mm long, ca. 0.2-0.3(-0.4) mm wide, ca. 0.7-0.9(-1.2) mm from apex of the ovary to where upward curvature begins, the style curvature up to ca. 0.7 mm deep. Fruit body 5.5-11 mm long, 5.5-11 mm wide, with stipe 1-2(-3.7) mm long, varying from wider than tall, to taller than wide, or isodiametric (Figs. 4-2B and E, 4-3H, 4-4, 4-

171

5F, 4-9, 4-10D, 4-11E, 4-12D and F, 4-14G, 4-15D, 4-18A to D, 4-19A, 4-21A, 4-22A, 4-

24D,4-28, 4-31A, E, and H, 4-33B to D, 4-34E).

Phenology. In the Bahamas, flowering material is known from every month except

April or October, with a peak in May, and fruiting material is known from October to

March. In Cuba, flowering material is known year-round, with a peak in July and a

secondary peak in March and April, and fruiting material is known from every month

except May and September, with a peak in July. In the Turks and Caicos Islands, all

three studied collections were flowering in December.

Distribution. Bahamas, Cuba, Turks and Caicos Islands; widespread in a variety

of habitats, in xeromorphic coastal thickets, microphyllous evergreen forest, spiny and

subspiny xeromorphic thickets on serpentine, complex mogote vegetation, pine forests,

rain forest on limestone, savannah, cloud forest, and secondary vegetation; 0-1000 m.

Additional specimens examined. BAHAMAS. ABACO [= GREAT ABACO] ISLAND:

Schooner Bay, 27 May 1979 (fl), D.S. Correll 50689 (F, FTG, IJ, MO, NY, US); near

Hole in the Wall at S end of island, 6 Jul 1970, J. Popenoe 130 (FTG); 2.5 miles N of lighthouse at Hole-in-the-Wall, 28 Jun 1980 (fl), R.P. Sauleda 3690 (FLAS, RSA).

ACKLIN'S ISLAND: Spring Point, 21 Dec 1905 - 6 Jan 1906, L.J.K. Brace 4359 (F, NY,

US). ANDROS ISLAND: No precise locality, 15 May 1952 (fl), R.E.D. Baker B.30 (K); Atalla

Coppice near Owen's Town, 30 Dec 1979 (fl), D. Black 812 (FTG); Deep Creek, 18 Aug

- 10 Sep 1906 (fl), L.J.K. Brace 5178 (F, NY, US); Nicholl's Town and vicinity, 13-15 Mar

1907 (fl, veg), L.J.K. Brace 6876 (F, NY, US); S of Staniard Creek, 0.8 mile W of main

road, 6 Jun 1975 (fl, veg), S.R. Hill 3119 (FTG, VT); Nicolls Town, 14 Dec 1971 (fr), J.

Popenoe 163 (FTG, MSC); ca. 1.5 mile SE of Red Bays, 19 Jul 1969 (fl), G.R. Proctor

172

30889 (BM, FTG, IJ); Long Bay Cays Section, Smith Hill, 23-24 Jan 1910 (veg), J.K.

Small 8681 (F, GH, K, NY, US); London Ridge Coppice, 23 Jul 1989 (veg), I.K. Smith s.n. (MU); Orchid Ridge Coppice, 13 Aug 1989 (fl, veg), I.K. Smith s.n. (CM, MU);

London Ridge Coppice, 25 May 1990 (fl), I.K. Smith s.n. (MU). CAT ISLAND: Orange

Creek and vicinity, 27-28 Feb 1907 (veg), N.L. Britton 5753 (F, NY); The Bight and vicinity, 1-6 Mar 1907 (fr, veg), N.L. Britton 5894 (NY, US); S of Bennets Harbor, 31 Sep

1967 (fl), R. Byrne 317 (A, FTG, WIS). CROOKED ISLAND: Near Marine View Hill, 9-23

Jan 1906 (fl, fr), L.J.K. Brace 4696 (F, NY); Jingo Hill, 9-23 Jan 1906 (veg), L.J.K. Brace

4764 (F, NY); along road to Turtle Sound, W of Church Grove, 17 Feb 1975 (fr), D.S.

Correll 44348 (FTG, NY); just NE of Landrail Point, 19 Feb 1975 (fl, veg), D.S. Correll

44410 (F, FTG, NY); along road to Cabbage Hill, E of Landrail Landing, 6 Jun 1977 (fl),

D.S. Correll 48795 (FTG, IJ, MO, NY, US). ELEUTHERA: 6 miles S of Rock Sound, 13

Jun 1977 (fl, veg), W.T. Gillis 13820 (MSC). GREAT EXUMA: Between George Town airstrip and the sea, 15 Dec 1976 (fr, veg), D.S. Correll 47934 (F, FTG, MO, NY). NEW

PROVIDENCE: Nassau, Blue Hill Road from Coconut Grove, 25°3'N 77°21.2'W, 11 Jul

1960 (fl), G.L. Webster 10422 (DAV); Coral Harbor, 24°59'N 77°27.5'W, 7 Aug 1960 (fl),

G.L. Webster 10860 (DAV, DUKE, S, US). NORTH ANDROS ISLAND: 2 miles W of Stafford

Creek Settlement, 7 Dec 1976 (veg), D.S. Correll 47800 (FTG, IJ); about 9 miles NW of

Fresh Creek, in Maidenhair Coppice #2, 17 May 1978 (fl), D.S. Correll 49720 (FTG, IJ,

NY); Atala Coppice, 22 May 1988 (fl), W.H. Eshbaugh 93-88 (MU); Maidenhair Coppice,

21 May 1999 (fl), E. Freid 99-093 (MU); Atala Coppice, 25 May 1987 (fl), D.D. Taylor

87-45 (MU); Old Owenstown site, 15 May 2002 (fl), M.A. Vincent 10511 (FLAS, MU).

SAN SALVADOR ISLAND: About 1 mile N of Teachers College and Riding Rock airstrip, 21

173

Nov 1974 (fl, fr), D.S. Correll 43856 (BRIT, F, FTG, GH, LL, MO, NY); about 1 mile N of

Riding Rock Inn, 13 Feb 1976 (fr), D.S. Correll 46716 (BRIT, F, FTG, GH, MO, NY, US);

Unspecified locality, Jan 1968 (fr), J. Patterson s.n. (FTG). WATLING ISLAND: Cockburn

Town, 25 Nov 1907 (fl), P. Wilson 7203 (F, GH, NY). PRECISE LOCALITY UNKNOWN [IN

BAHAMAS]: 15 Oct 1877 (fr), L.J.K. Brace 320 (NY); 15 Mar 1877 (veg), Robinson 7/77

(K). CUBA. CAMAGÜEY PROV.: Nuevitas, Bahia de Nuevitas, Punta de Pastelillo, ca. 600

m NE of 21º32'23.3"N 77º13'23.0"W (WGS 84), 28 May 2004 (veg), J. Richard Abbott

19052 (FLAS, HAJB); Near Camagüey, 2-7 Apr 1912 (fl), N.L. Britton 13286 (NY);

Nuevitas, Tiffin, railroad Camagüey-Nuevitas, 6 Oct 1922 (fl), E.L. Ekman 15385 (S);

Nuevitas, Pastelillo, near Nuevitas, 7 Oct 1922 (fl), E.L. Ekman 15424 (C, IJ, LL, S);

Nuevitas, ínsula Cayo Sabinal, between Corte Jicotea and Corte Ganado, 15 Oct 1922

(fl, fr, veg), E.L. Ekman 15510 (G, MICH, NY, S); Nuevitas, Cayo Sabinal, Ganado, 17-

18 Mar 1909 (fl, veg), J.A. Shafer 878 (F, GH, NY, US); Nuevitas, Santa Lucía, 19 Mar

1909 (fr), J.A. Shafer 977 (NY); Nuevitas, Tiffin, 26 Mar 1909 (veg), J.A. Shafer 1085

(A, NY); Nuevitas, vicinity of Tiffin, 30-31 Oct 1909 (fl), J.A. Shafer 2867 (NY). CIEGO DE

ÁVILA PROV.: Morón, Cayo Coco, Punta Colorada, 19 Sep 1988 (fl), A. Pérez Asso 1111

(NY). CIENFUEGOS PROV.: Cumanayagua, Barrio Manantiales, 12 Apr 1994 (fr), P.

Acevedo-Rodriguez 6422 (FTG, NY, UPRRP, US); Cumanayagua, Mountains of

Siguanea, Trinidad group, valley Hanabanilla, Finca Playitas, 14 Feb 1924 (fr), E.L.

Ekman 18488 (G, NY, S); Cumanayagua, Trinidad Mountains, San Blas-Buenos Aires,

Gavinas, 12 Feb 1941 (fl), A. Gonzales 374 (A, BM, DAV, DUKE, F, FLAS, IJ, MICH,

NY, S, U); Cumanayagua, Trinidad muntains, San Blas, Buenos Aires, Aug 1941 (fl, fr),

R.A. Howard 6535 (GH, NY, MT); Cumanayagua, Las Vegas de Madagua, above San

174

Blas, 7 Apr 1928 (fr), J.G. Jack 5937 (A, HAC, MAD, NY, P, US, YU); Cumanayagua,

San Blas, la Sierra, 7 Apr 1928 (veg), J.G. Jack 5942 (A, HAC); Cumanayagua, Las

Lagunas, Buenos Aires, 5 Dec 1928 (fl, fr), J.G. Jack 6815 (A, US), 6861 (A, K, RSA,

US); Cumanayagua, Buenos Aires, Trinidad hills, 16 Mar 1932 (fr), J.G. Jack 8584 (A,

F, NY, US). GUANTÁNAMO PROV.: Maisí, Meseta de Maisí, Feb 1929 (veg), J. Acuña

5145 (HAC, NY); Yateras, Palenquito, 20 Jul 1953 (fl), Hno. Alain 3109 (GH, HAC, IJ);

Yateras, Toa, Peña Prieta, 30 Dec 1953 (veg), Hno. Alain 3584 (GH, HAC); Yateras,

Monte Libanon, San Fernandez, 25 Dec 1919 (fl, fr), E.L. Ekman 10294 (MICH, S);

Yateras, prope Villam Monte Verde dictam, Jan-Jul 1859 (fl), C. Wright 115 (GH, HAC,

K, MO, NY, P, PH, S, UC, US, YU, W); Yateras, prope Monte Verde, 1860 (fl, fr), C.

Wright 1914 (G, GOET, K, MA, S). HOLGUÍN PROV.: Mayarí, Sierra de Nipe, Alto de la

Torre, 20º31'47.9"N 75º45'58.4"W (WGS 84), 19 May 2004 (fl), J. Richard Abbott 18947

(FLAS, HAJB); Mayarí, Sierra de Nipe, base de la Loma de Mensura, 20º28'55.4"N

75º48'31.7"W (WGS 84), 19 May 2004 (fl), J. Richard Abbott 18967 (FLAS, HAJB);

Mayarí, Mogotes El Cerrado, Río Piloto, al E de la unidad silvicola Pinal Redondo (La

Chivera), 20º24'58.9"N 75º49'15.8"W (WGS 84), 20 May 2004 (fl), J. Richard Abbott

18977 (FLAS, JBSD); Rafael Freyre, en la carretera Santa Lucía a Holguín, cerca 15

km de Santa Lucía, Cruce de Melones, 20º57'50.8"N 76º3'23.7"W (WGS 84), 18 May

2004 (fl), J. Richard Abbott 18927 (FLAS, HAJB); Moa, Aeropuerto de Moa, 9 Apr 1945

(fl, fr), J. Acuña 12471 (HAC, US); Moa, Cayo Coco, 15 Apr 1945 (fl), J. Acuña 12470

(HAC, HAJB, US); Rafael Freyre, alrededores de la presa Gibara, 2 Apr 1996 (fl), R.

Berazain HFC 72353 (UPRRP); Antilla, 6-8 Mar 1912 (fl), N.L. Britton 12443 (NY);

Antilla, Punta Piedra, Nipe Bay, 7 Mar 1912 (fl, fr, veg), N.L. Britton 12463 (MO, NY,

175

US); Moa, Franklyn Mines, May 1944 (fl), Hno. Clemente 3663 (GH, HAC, HAJB, US);

Moa, la Breña, 16 Apr 1946 (fl), Hno. Clemente 4992 (GH, HAC); Mayarí, Sierra de

Nipe, headwaters of Brazo Dolores, 15 Oct 1914 (fr, veg), E.L. Ekman 3120 (NY, S);

Mayarí, Sierra de Nipe, on top of Loma Mensura, 19 Oct 1914 (fr), E.L. Ekman 3172 (G,

K, NY, S); Antilla, Preston, the big sugar mill on Nipe Bay, 13 Nov 1914 (fl), E.L. Ekman

3427 (S); Mayarí, Sierra de Nipe, Río Piloto, 17 May 1915 (veg), E.L. Ekman 5781 (NY,

S); Mayarí, Sierra de Nipe, top of Loma Mensura, 16 Jun 1915 (fl), E.L. Ekman 5732 (G,

NY, S); Banes, Puerto Rico, 18 Nov 1915 (fl), E.L. Ekman 6615 (G, NY, S); Antilla, Nipe

Bay, 20 May 1916 (fl), E.L. Ekman 7322 (G, NY, S); Mayarí, Sierra de Nipe, San José,

Jul 1941 (fl, fr), R.A. Howard 6212 (GH, NY); Holguín, sabana de la Yaba, 4 Jul 1932

(fl), Hno. León 15705 (US); Moa, near Moa saw-mill, Jul 1941 (fl, fr), Hno. León 20224

(GH, HAC, US); Mayarí, crest of Sierra de Nipe, S of Lumber Camp, 16-17 Oct 1941 (fl,

veg), C.V. Morton 3039 (UC, US); Holguín, prope Holguín, 1860 (fl), C. Wright 115

(BREM, GOET). LA HABANA PROV.: Sierra de Tapaste, 30 Dec 1921 (fr), E.L. Ekman

13590 (G, LL, MICH). LAS TUNAS PROV.: Puerto Padre, Pico de Gallo, 5 Jul 1921 (fl), M.

Curbelo 5288 (HAC, NY); Puerto Padre, El Cupey, 8 Aug 1930 (fl), M. Curbelo 5288a

(NY); Pico de Gallo, 24 Nov 1931 (fr), M. Curbelo 5844 (NY). SANCTI SPIRITUS PROV.:

Reserva Ecológica Alturas de Banao, camino entre el filo de Caja de Agua y el filo de

La Sabina, 21º52'39.4"N 79º36'15.0"W (WGS 84), 15 May 2004 (fl, fr), J. Richard

Abbott 18900 (FLAS, HAJB); Trinidad, Sierra del Escambray, Topes de Collantes,

Mogote mi Retiro, 2 Jul 1993 (fl), P. Acevedo-Rodriguez 5585 (HAC, K, NY, UPRRP);

Lomas de Trinidad, Pico Potrerillo, 6 Apr 1940 (fr), J. Acuña 11342 (HAC); Costa N,

Potrerillo, 19 Aug 1956 (veg), J. Acuña 20335 (HAC); Trinidad Mts., crest of Pico

176

Potrerillo, 16 Jul 1957 (fl), Hno. Alain 6376 (GH, HAC); Trinidad Mts., near Pico

Potrerillo, 18 Jul 1957 (fl, veg), Hno. Alain 6447 (GH, HAC, US); Lomas de Banao, on

the ridge between El Purial and Los Guineos, 27 Jan 1923 (fl, fr), E.L. Ekman 16263

(MICH, S, US); Trinidad, Trinidad Mts., 12 Mar 1930 (fl), F.W. Hunnewell 11578 (GH);

Banao Mts., La Gloria, 30 Jul 1918 (fl), Hno. León 7994 (GH, HAC, NY, US); Lomas de

Banao, Santa Clara, 9 Jan 1920 (fl, fr), A. Luna 25 & 26 (HAC, NY); Trinidad Mountains,

Pico Sombrero, 19 Jul 1953 (fl, fr), G.L. Webster 226 (DAV). SANTIAGO DE CUBA PROV.:

Gran Piedra, camino a la Mercedita, 20º00'9.9"N 75º36'47.2"W (WGS 84), 25 May 2004

(fl), J. Richard Abbott 19038 (FLAS, HAJB); Guamá, Sierra Maestra, El Gato, 1 Aug

1944 (fl, fr), Hno. Alain 233 (GH, HAC, US); Guamá, Sierra Maestra, Loma del Gato,

Aug 1952 (fl), Hno. Alain 2481 (GH, HAC, IJ, US); Segundo Frente, near the summit of

Sierra Cristal, 2-7 Apr 1956 (veg), Hno. Alain 5805 (GH); Guamá, Sierra Maestra, Loma del Gato, Aug 1927 (fl, fr), Hno. Clemente 2008 (GH, HAC); Guamá, Sierra Maestra,

Río Alcarraza Abajo, 17 Jul 1946 (fl), Hno. Clemente 5064 (GH, HAC, HAJB); near the summit of Gran Piedra, Jun 1949, Hno. Clemente 6614 (GH, HAC, HAJB, US); Guamá,

Loma del Gato and vicinity, Cobre Range of Sierra Maestra, 11 Jul - 14 Aug 1925 (fl, fr),

Hno. Edmond 19 (HAC, NY); Sierra Maestra, la Gran Piedra, 28-29 Jun 1914 (fl), E.L.

Ekman 1621 (G, K, NY, S, US); Guamá, Sierra del Cobre, Monte Real, 7 Oct 1916 (fl, fr), E.L. Ekman 7864 (K, S, US); Sierra Maestra, above Firmeza, 9 Nov 1917 (fl, fr), E.L.

Ekman 8764 (HAC, K, S, US); Guamá, Sierra Maestra, on top of Punta de Palma

Mocha, S of Yara, 15 Jul 1922 (fl), E.L. Ekman 14313 (G, K, NY, S, US); Guamá, Sierra

Maestra, on the water divide between Rio Yara and Rio Palma, 19 Jul 1922 (fl), E.L.

Ekman 14435 (G, K, NY, S); Guamá, Sierra Maestra, Loma del Gato, 9 Nov 1922 (fl, fr),

177

E.L. Ekman 15684 (NY, S); Segundo Frente, Sierra Cristal, 15 Dec 1922 (fr), E.L.

Ekman 15984 (S); La Isabelica, Cordillera de la Gran Piedra, 10 Feb 1980 (veg), P.

Herrera s.n. (WIS); Guamá, Cobre Range of Sierra Maestra, Loma del Gato, Jul 1923,

Hno. Hioram 6586 (GH, NY); Guamá, Cobre Range of Sierra Maestra, Loma del Gato and vicinity, 11 Jul - 14 Aug 1921 (fl), Hno. León 9873 (HAC, NY); Sierra Maestra,

Loma del Gato, Jul 1921 (fl, fr), Hno. León 10375 (GH, HAC, NY); Guamá, Sierra

Maestra, Loma del Gato and vicinity, 11 Jul - 14 Aug 1921, Hno. León 10567 (HAC,

NY); Guamá, Sierra Maestra, S Oriente to Pico Turquino, Jul 1922 (fl), Hno. León

10807 (NY); Guamá, Sierra Maestra, Turquino region, Jul 1922 (fl), Hno. León 10835

(GH, HAC, NY, US); Guamá, Sierra Maestra, Turquino region, Jul 1922 (fl), Hno. León

11007 (GH, HAC, NY, US); Guamá, Santiago de Cuba, Jun 1844 (fl), J. Linden 1970

(G, P); Guamá, Ninanima, 1843-1844 (fl, fr), J. Linden 2161 (BM, G, IJ, K, P); Guamá,

Cueva del Aura, S of Turquino Peak, 31 Jul 1935 (fl), J.T. Roig y Mesa 6609 (NY). VILLA

CLARA PROV.: Santa Clara, Loma Cruz, 12 Apr 1954 (veg), Hno. Alain 3990 (GH, HAC,

IJ); Santa Clara, Palm Barren, 29-31 Mar 1910 (fl), N.L. Britton 6066 (NY); Santa Clara,

Palm Barren Santa Clara, 21-22 Mar 1911 (fl), N.L. Britton 10177 (F, GH, MO, NY);

Santa Clara palm barren, 8-9 Apr 1912 (fl), N.L. Britton 13286 (F, MO, NY, US); Santa

Clara, E of Santa Clara, 13 Jun 1922 (fl), E.L. Ekman 14025 (S); Santa Clara, E of

Santa Clara city, 19 Feb 1923 (fl, fr), E.L. Ekman 16329 (G, NY, S); Santa Clara, E of

Santa Clara city, 25 Mar 1924 (fl), E.L. Ekman 18847 (S); Santa Clara, El Cumbre, 31

Mar 1924 (fl), E.L. Ekman 18985 (G, K, S, US); Yarey, 5 km W of Santa Clara, 1-20 Jul

1950 (fl, fr), R.A. Howard 412 (A, LL, MICH, MIN, MO, NY, PH, UC); Santa Clara, La

Lanza Hill, Manajanabo, 3 Apr 1915 (fr), Hno. León 5281 (GH); Santa Clara, Sancti

178

Spíritus Mts., Loma de Ponciano, 1-11 Aug 1916 (fl), Hno. León 6677 (GH, NY); Santa

Clara, 4-8 km S of Santa Clara on road to Manicaragua, Jun-Jul 1955 (fl), R.E. Schultes

266 (GH); Santa Clara, about 6 km W of Santa Clara, 15 Jul 1936 (fl, fr), L.B. Smith

3144 (GH, US); Santa Clara, river 10 km E of Santa Clara, 25 Jul 1936 (fl), L.B. Smith

3201 (GH); Santa Clara, 6 km W of Santa Clara, 22 Jun 1953 (fl), G.L. Webster 45 (A,

DAV); Yarey, 6 km S of Santa Clara, 22 Jun 1953 (fl, fr), G.L. Webster 188 (A). TURKS

& CAICOS ISLANDS. NORTH CAICOS: Wades Green, 30 Dec 1991 (fl), B.A. Neis 534

(MU); Kew and vicinity, 18 Dec 1907 (fl), P. Wilson 7731 (F, GH, K, NY).

PROVIDENCIALES: no specific locality, 19 Dec 1907 (fl), P. Wilson 7749 (F, GH, NY).

UNITED STATES. CULTIVATED -- FLORIDA: Miami, Coconut Grove, Fairchild Tropical

Garden, 8 Jul 2001 (fl, fr), J. Richard Abbott 14363 (FLAS); Miami, Fairchild Tropical

Garden [reported as originally from Cuba], 4 Jul 1999 (fl), W.B. Zomlefer 727 (FLAS).

Badiera oblongata is not supported as monophyletic in my preliminary

phylogenetic analyses of DNA sequence data (Fig. 4-1). In fact, some populations are clearly supported as more closely related to other species than to other B. oblongata

populations. While it is possible that taxa such as B. cubensis and B. propinqua may be peripheral isolates out of the stem lineage of B. oblongata, the lack of reciprocal monophyly could simply reflect incomplete lineage sorting or differential retention of ancestral molecular characters. Since the populations are not clustered geographically in the molecular analyses, it seems likely that ongoing hybridization or lateral gene flow is not an issue, although tokogenesis with infrequent long-distance dispersal cannot be ruled out at this time.

179

Various populations of Badiera oblongata can superficially resemble nearly all of the other species of Badiera, but my field work in Cuba made it quite clear to me that much of the variation also occurs within populations. In a sense then, this species can be thought of as being diagnosable by the lack of the distinctive features of the other taxa (as might be expected if this species is actually non-monophyletic). Fruits can vary from small to large without any apparent populational or geographical correlation.

Leaves are also highly variable. Wilson 7731 (from the Turks & Caicos Islands) has very small leaves, but the leaves of this specimen are within the range of populations in the

Bahamas, which tend to have smaller, narrower leaves than are found in Cuba. Some populations from central and eastern Cuba have thicker, more coriaceous leaves that are more strongly revolute than is typically seen elsewhere. Some regions in eastern

Cuba (i.e., Maisi, Moa, Nipe) have some populations with broader, more ovate leaves that are more broadly rounded at the base. This is also the normal leaf shape in the

Trinidad Mountains of central Cuba. Plants with broad leaves that are broadly rounded at the base have been segregated as B. montana (e.g., Britton, 1910; Blake, 1916).

Over most of its range, the leaves of B. oblongata are usually narrower and more elongate than in the entity described as B. montana, but leaf form is actually a polymorphic feature and likely merely represents variation in the frequency of alleles relating to leaf size. The B. montana entity, here synonymized because it is not consistently diagnosable, also often has slightly larger flowers, representing most of the large size extremes recorded in the species description. In addition, its inflorescences are often smaller and sparser than in other species, commonly with only 1-4 flowers.

Given the highly variable, non-monophyletic nature of B. oblongata, it is possible that

180

future study may well find the Trinidad Mountains populations, and possibly others, to

be worthy of taxonomic recognition.

Badiera oblongata is second only to B. penaea in terms of existing specimens and

total range. Its ability to persist in degraded habitats and the fact that its populations

tend to be large with many individuals suggest that this species is not of immediate

conservation concern. However, as pointed out above, some populations that are

currently included within this taxon may, with future population-level field and genetic

studies, be shown to be discrete evolutionary lineages.

6. Badiera penaea (L.) DC., Prodr. 1: 335. 1824. Polygala penaea L., Sp. Pl. 2:

703. 1753. Polygala domingensis Jacq., Select. Am., ed. min.: 96. 1780. Badiera

domingensis (Jacq.) DC., Prodr. 1. 335. 1824.—TYPE: (icon) Nova plantarum

americanarum genera: tab. 25. 1703.

Badiera portoricensis Britton, Bull. Torr. Bot. Club 42: 494. 1915.—TYPE: PUERTO

RICO. Guanajibo, near Mayaguez, 18 Feb 1915 (fl, veg), N.L. Britton 4349 (holotype:

NY!; isotypes: F!, GH!, MO!, UPR!, US!).

Petiole 1.2-2(-2.6) mm long, ca. 0.5-0.9 mm wide; blade obovate, to narrowly

elliptic, (11-)13.5-28(-40) mm long, (4.3-)7-20(-23) mm wide, the leaves mostly 15-25

mm long by 7-10 mm wide, usually cupped and often with whole leaf inrolled, the base acute or cuneate, rarely obtuse, the apex mostly bluntly rounded to obtuse, infrequently

acute, apiculate, or abruptly and shortly acuminate; margin often revolute along entire blade; usually with no secondary veins visible adaxially (sometimes partially visible as narrow depressions), with 1-3(-5) secondary veins per side that are generally obscure and only partially visible abaxially (broad shade leaves can be more conspicuously

181

veiny). Flowers (2.2-)2.5-3.8 mm long; pedicels 1-2.3 mm long. Outer sepals 0.7-1 mm long, 0.8-1.2 mm wide; inner lateral sepals (wings) 1.2-1.7 mm long, 0.8-1.5 mm wide.

Upper petals 2.6-3.3 mm long, 0.6-1.3 mm wide; keel petal 2.6-3.5 mm long, 1-1.5 mm wide. Gynoecium 2.5-3.1 mm long in flower; stipe 0.1-0.4 mm long; ovary ca. 0.7-1 mm long, 0.5-0.9 mm wide; style 1.2-1.5 mm long, 0.15-0.3 mm wide, ca. 0.9-1.5 mm from apex of the ovary to where upward curvature begins, the style curvature ca. 0.5-0.8 mm deep. Fruit body 4.5-7.5 mm long, 4-9 mm wide, with stipe 0.5-1.5 mm long, often wider than tall, but varying to isodiametric or taller than wide (Figs. 4-5G, 4-7A and B, 4-8A, 4-

11A and C, 4-14H, 4-18G and H, 4-21B, 4-23C, 4-32F, 4-34G).

Phenology. In the British Virgin Islands, flowering material is known from January,

March, June, and July, and fruiting material is known from January, March, June, and

November. The sporadic, scattered reproductive material is likely an artifact of limited

collecting, but it might reflect variable reproduction in response to climatic stimuli. In the

Dominican Republic, flowering and fruiting occur nearly year-round, with no flowering

specimens recorded from March and November and with no fruiting specimens from

January and March. Peak flowering is in July (also common April to June) with peak

fruiting in October (also common May to September). In Haiti, fewer collections are

known than in the Dominican Republic, with flowers collected in February, April to July,

and November and with fruits collected in February, April to August, and October. In

Puerto Rico, flowering specimens have been collected year-round, with a minor peak in

May and June, and fruiting specimens have been collected in every month but March,

with a minor peak in September and October. Overall, then, this species seems to

flower and fruit nearly year-round.

182

Distribution. British Virgin Islands (Virgin Gorda), Hispaniola (widespread in both

the Dominican Republic and Haiti), and southwestern Puerto Rico; throughout its range,

B. penaea occurs in a wide range of habitats, including limestone and serpentine

substrates, ranging from xeric to mesic; habitat on Virgin Gorda includes seasonal

deciduous forest, rocky woodland, secondary forest, and montane thicket; in the

Dominican Republic, habitats include semi-humid forest, dense broad-leaf forest, mesic

deciduous forest, riverbanks, pine woodlands, semi-arid pinelands, dry woods,

xerophytic regions, thickets, and open grassland; in Haiti, habitats include broad-leaf

evergreen forest, dry to moist woods, and scrub; habitats in Puerto Rico include

subtropical wet forest, moist montane forest, low evergreen scerlophyllous forest, dry

thorn-scrub, scrubby thickets, rocky slopes, and degraded open areas; 0-1000 m (to

1300 m on Hispaniola).

Additional specimens examined. BRITISH VIRGIN ISLANDS. Virgin Gorda,

Gorda Peak, 4 Nov 1998 (fr), P. Acevedo-Rodriguez 10497 (US); Virgin Gorda, 5 Jan

1919 (fl, fr), W.C. Fishlock 152 (GH, NY, US); Virgin Gorda, SE side of peak, 22 Jun

1969 (fl, veg), E.L. Little, Jr. 23827 (BM, NY, US); Virgin Gorda peak, 17 Mar 1972 (fl, fr), E.L. Little, Jr. 26116 & 26118 (BM, NY, US); Virgin Gorda, Gorda Peak, 19 Jul 1986

(fl), G.R. Proctor 41975 (IJ); Virgin Gorda, Jun 1969 (fr), R.O. Woodbury s.n. (NY,

UPR). DOMINICAN REPUBLIC. AZUA PROV.: Sierra Martin Garcia, along trail from

Barreras toward El Copey, 660-800 m, 18°18'44.3"N 70°56'46.9"W (WGS 84), 6 Jun

2006 (fl), J. Richard Abbott 20963 (FLAS, JBSD); Sierra de Ocoa, San Jose de Ocoa, slopes of Loma del Rancho, 22 Feb 1929 (fr), E.L. Ekman H11616 (A, C, DAV, F, G,

GH, MO, NY, S, US); ad Las Lagunas, Jul 1912 (fl), M. Fuertes 1937 (A, NY); Cordillera

183

Central, Padre las Casas, aprox. 3 km al O de Guayabal, en el lugar llamado Periquito,

18°45'N 70°50.5'W, 30 Sep 1987 (fl), R. García 2423 (MO, NY); Cordillera Central,

Padre Las Casas, aprox. 2.5 km al S de Las Lagunas, en los alrededores del cruce de la carretera Padre Las Casas-Guayabal, 18°45'N 70°53'W, 1 Oct 1987 (fr), R. García

2504 (CM, MO, NY, UPRRP); Cordillera Central (base), entre Cañada Cimarrona y Los

Quemados, 18°30-31'N 70°35-36'W, 22 Jul 1982 (fl, fr), T. Zanoni 21919 (FTG, MO,

NY). BARAHONA PROV.: La Flo bei Rincon, Oct 1911 (fr), M. Fuertes 1322 (A, NY); Road to Puerto Escondido, 22 Jul 1950 (fl), R.A. Howard 12137 (A, BM); en Janico, 17 Jun

1943 (fl, fr), J.J. Jiménez 440 (US). DISTRITO NACIONAL: Sierra Prieta, NNW de Villa

Mella, 18°39'N 69°58'W, 14 Oct 1995 (fl), F. Jiménez 1967 (F, MO); Villa Mella, en la parte N de la loma Sierra Prieta, 11 Apr 2000 (fl), B. Peguero 1069 (MO); Sierra Prieta, on the road between Villa Mella and Yamasa, 18°30'N 69°45'W, 24 Jul 1981 (fl, fr), J.

Watson 1088 (FLAS, FTG); at town of Sierra Prieta, half-way between Villa Mella and

Yamasa, 18°39'N 69°58'W, 8 Jul 1981 (fl), T. Zanoni 15323 (MO, NY). EL SEIBO PROV.:

Los Haitias, Bahia de Saneaná, 14 Apr 1965 (veg), J.J. Jiménez 5041 (NY).

INDEPENDENCIA PROV.: Sierra de Nibe, 6 km by road S of Angel Felix, 1 Jan 1983 (fl),

G.R. Proctor 39247 (IJ). LA VEGA PROV.: SW edge of Constanza, area historically referred to as Salto de Constanza, 1130-1150 m, 18°54-54.16'N 70°45.8-46.1'W (WGS

84), 9 Jun 2006 (fl), J. Richard Abbott 21022 (FLAS, JBSD); Jarabacoa, 18 May 1963

(fl), B. Augusto [= A. Lavastre] 986 (NY); Salto de Constanza, 6-7 Jul 1973 (fl), A.H.

Liogier 19549 (F, GH, NY); 13.5 km NW of Constanza, 18°46'N 70°50'W, 10 Apr 1980

(fl), M. Mejía 5021 (FTG, MO, NY); Cordillera Central, Salto de Constanza, 27 May

1992 (veg), J.D. Skean, Jr. 3251 (MSC); prope Constanza, Jun 1910 (fl, fr), H. von

184

Türckheim 3209 (BM, BR, E, F, G, GH, K, L, M, MIN, MO, NY, S, U, US, WU);

Constanza, Hotel Constanza, 6 Apr 1971 (veg), R.O. Woodbury s.n. (UPR); aprox. 2.5

km al SW del pueblo de Constanza, en la orilla del Arroyo Patunfla, en el Salto de

Constanza, en el Valle de Constanza, 18°54'N 70°46.5'W, 26 Oct 1981 (fr), T. Zanoni

17419 (MO, NY, UPRRP); Cordillera Central, aprox. 2 km SO de Constanza, en "Las

Auyamas" (de Constanza), en las orillas y las laderas del Río Grande, 18°54'N

70°45'W, 7 Oct 1984 (fr), T. Zanoni 31873 (FTG, MO, NY). MONTE CRISTI PROV.: 1.5 km

al N del poblado de Rincón, 19°50'N 71°37'W, 8 Oct 1984 (veg), R. García 205 (NY);

Loma Isabel de Torres on N side of road near town of Isabel de Torres, 19°35'N

71°34'W, 22 May 1980 (fl, fr), M. Mejía 6473 (FTG, GH, MO, NY); Cordillera

Septentrional, en la Reserva Científica "Dr. Orlando Cruz Franco," 8 km N de Villa

Elisa, 21 Aug 1985 (fr), J. Pimentel 522 (NY, U); Monción, 20 Sep 1931 (fl, fr), E.J.

Valeur 717 (A, BM, C, F, G, IJ, K, MICH, MO, NY, S, US). PEDERNALES PROV.: Hoyo de

Pelempito, 26 Feb 1971 (veg), A.H. Liogier 17931 (F, NY); Hoyo de Pelempito,

Bahoruco Mountains, 3-8 Jul 1971 (fl), A.H. Liogier 18129 (GH, NY, US); 26 km N of

Cabo Rojo, 18°6'N 71°38'W, 16 Jul 1992 (fl), S.A. Thompson 10465 (CM, NY); Sierra

de Bahoruco, 27 km N del puerto de Cabo Rojo en la carretera de Alcoa Exploration

Company a Las Mercedes y Aceitillar, 18°7'N 71°36.5'W, 26 Jul 1983 (fl), T. Zanoni

26376 (MO, NY); Península de Barahona, entre la Sabana de Algodón y Pte. Glaces (al

SO de Manuel Goya de Oviedo), 17°46'N 71°34'W, 11 Jun 1987 (fl), T. Zanoni 36579

(MO, NY). PERAVIA PROV.: Cordillera Central, Honduras, en la margen del Río

Matadero, 18°23'N 70°27'W, 2 Jul 1997 (fl, fr), R. García 6611 (F, UPRRP); along

boundary with Azua Province, along Rio Banilejos, 9-10 km N of Las Charcas, S of el

185

Pinar (of San Jose de Ocoa), along road to Las Charcas, 18°30'N 70°30'W, 23 May

1992 (fl), T. McDowell 4161 (DUKE); 16 km desde San José de Ocoa, en el camino a El

Pinar y El Cercado, en el Arroyo Demajagua, 18°34'N 70°37'W, 18 Nov 1981 (fr), T.

Zanoni 18064 (MO, NY); Cordillera Central, en el fondo del valle del Río El Canal, entre

Mogote Peparadero y Firme de Bañadero, limite NO del poblado de El Bejucal (de San

José de Ocoa), 18°37'N 70°35'W, 5 Aug 1982 (fl), T. Zanoni 22404 (FTG, MO, NY).

SAMANÁ PROV.: Seccion Las Galeras, paraje Loma Atravesada, aprox. 1.5 km de la desembocadura de Caño Frío hacia Loma Atravesada, 19°18'N 69°15.5'W, 30 Apr

1996 (fl bud), B. Peguero 262 (FLAS). SAN JOSÉ DE OCOA PROV.: 8.5 km N of San Jose

de Ocoa, 18°35'N 70°29'W, 6 Apr 1985 (fr), A. Gentry 50519 (MO). SAN JUAN PROV.:

Hato Nuevo, 9 Sep 1946 (fr), M. Canela s.n. (P); El Cercado, 31 Aug 1946 (fr), R.A.

Howard 8663 (BM, GH, NY); N of San Juan, vicinity of Rio Arriba del Norte, 9-14 Sep

1946 (fr), R.A. Howard 8840 (BM, GH, NY, US); Juan Santiago, 3 Oct 1946 (fl), R.A.

Howard 9271 (BM, GH, NY, US); 4 km N de La Presa de Sabaneta, margen E del Río

San Juan, 19°00'N 71°18'W, 24 Jun 1982 (fr), M. Mejía 20981 (FTG, MO, NY, U).

SANTIAGO RODRÍGUEZ PROV.: SW of Moncion, 0.6 km SW of La Meseta on road to La

Leonor, 450 m, 19°23'26.9"N 71°12'54.5"W (WGS 84), 13 Jun 2006 (fl, fr), J. Richard

Abbott 21040 (FLAS, JBSD); 6.7 km SW of Monción along road to El Aguacate & El

Leonor, ca. 19°25'N 71°15'W, 30 May 1992 (fl), T. McDowell 4263 (DUKE). SANTIAGO

PROV.: Vicinity of Santiago, on Mt. Palo Quemado, 11 Jan 1946 (fl), H.A. Allard 14563

(S, US); La Bosua near Janico, 29 Apr 1970 (fl), D. Burch 2509 (MO); Sierra del Palo

Quemado, 10 May 1887 (fl, fr), Eggers 1897 (A, BM, C, F, G, K, L, LD, M, NY, P, S, US,

WU); Cordillera Central, Jánico, en el Parque Botánico, 19°18'N 70°47'W, 22 Apr 1987

186

(fr), R. García 2039 (MO, NY); Cordillera Central, "Jaiquípicao," aprox. 6 km al NO del

cruce de la carretera vieja Santiago-San José de las Matas, 19°27'N 70°54'W, 28 Dec

1992 (fl, fr), F. Jiménez 728 (MAPR, U, UPR); Jaiquí Picado, 22 Jun 1969 (fr), J.J.

Jiménez 5725 (NY); Bella Vista, 26 Apr 1968 (fl, fr), A.H. Liogier 10954 (IJ, NY); Jaiquí

Picado, 20 miles W of Santiago, 6 Jun 1969 (fl, veg), A.H. Liogier 15563 (GH, IJ, NY,

US); San José de las Matas, Aug 1978 (fr), A.H. Liogier 27837 (NY, UPR); at km 10 on old road from NE side of Santiago to Puerto Plata, 19°31'N 70°38'W, 18 Jul 1980 (fr), M.

Mejía 7376 (CAS, MO, NY, S); base de la Cordillera Central, 4.9 km O de la Plaza

Central de San José de Las Matas, en la carretera a Monción, 19°20'N 70°58'W, 19

Feb 1983 (fl, fr), T. Zanoni 25373 (BRIT, MO, US); ladera N de la Cordillera Central, 3.8

km O de la Plaza Central de San José de Las Matas en la carretera a Monción, 19°20'N

70°58'W, 22 May 1983 (fl, fr), T. Zanoni 25960 (MO, NY, U); base de la Cordillera

Central, 3.4 km O de Janico en la carretera a San José de Las Matas y por el camino vecinal a Cebú, 19°20'N 70°50'W, 12 Oct 1983 (fl), T. Zanoni 27466 (FTG, MO, NY);

Cordillera Central, 3 km de San José de las Matas al NO en el camino a Monción,

19°20'N 70°57'W, 3 Oct 1984 (fr), T. Zanoni 31682 (MO, NY, S, UPRRP); Valle Cibao,

en la zona rural "Jaiqui Picado," aprox. 24-25 km al O de Santiago, 19°27'N 70°54'W,

28 Sep 1989 (fr), T. Zanoni 43375 (FLAS, FTG, MAPR, MO, S, U, UPRRP, US).

VALVERDE PROV.: Border with Santiago Prov., sobre Loma (pico) El Murazo, 19°41'N

70°58'W, 18 Dec 1984 (fr), T. Zanoni 32851 (MO, NY, US). UNCERTAIN LOCALITY: Las

Brujas del monte Folo Checo, 10 Aug 1938 (fr), M. Canela s.n. (UPR, US). HAITI.

ARTIBONITE DEPT.: Gonaives, Morne Bellance, Jul 1901, W. Buch 663 (IJ, Z); Gonaives,

Kenskoff, Oct 1903, W. Buch 963 (GH, IJ). NORD DEPT.: Marmelade, 24 Aug 1903 (fr,

187

veg), G.V. Nash 719 (F, NY); Camp #4, Marmelade, 1-2 Aug 1905 (fr), G.V. Nash 1312

(NY, US). NORD-OUEST DEPT.: Massif du Nord, Gens-Morne, Pendu, 3 May 1925 (fl),

E.L. Ekman H3982 (G, NY, S); Montagnes de Terre-Neuve, at Habit Dumirait, 9 Oct

1925 (fr), E.L. Ekman H5042 (S); vicinity of Mole St. Nicolas, Bombardopolis road S of

Mole gorge, 13-19 Feb 1929 (fl), E.C. Leonard 13232 (CM, US); vicinity of

Bombardopolis, Mole road, 21-26 Feb 1929 (fl), E.C. Leonard 13424 (A, US); road W of

Bombardopolis, 21-26 Feb 1929 (fl), E.C. Leonard 13571 (K, MO, NY, US); vicinity of

Bassin Bleu, trail to Moustique Mountains, 14-27 Apr 1929 (fl, fr), E.C. Leonard 14943 &

14953 (BM, S, US); Tortue Island, W side of La Vallée valley, 5 May 1929 (fl), E.C.

Leonard 15373 (US). OUEST DEPT.: Las Cahobas, 28 Aug 1917, O.F. Cook 94 (US);

Montagnes du Trau d'Eau, Morne-a-Cabrits, near Bois d'Orne, 16 Jul 1924 (fr), E.L.

Ekman H918 (G, GH, NY, S, US); Morne a Cabrits, 3 Jul 1927 (fl), W.J. Eyerdam 20

(GH, NY, P); Port au Prince, Morne l'Hopital, E of Turgeau spring, 17 Feb 1942 (fr), L.R.

Holdridge 1003 (BM, F, MICH, MO, NY, US); hills S of Port-au-Prince, near Rue Cay,

27 May 1984 (fl, fr), W.S. Judd 4971 (FLAS); vicinity of Pétionville, 15-28 Jun 1920 (fl),

E.C. Leonard 4851 (GH, NY); vicinity of Pétionville, 15-28 Jun 1920 (veg), E.C. Leonard

4944 (BM, F, NY, US); vicinity of Pétionville, 15-28 Jun 1920 (fl, fr), E.C. Leonard 5018

(GH, NY); Morne de l'Hopital, 12 Nov 1892 (fl), Picarda 1054 (L, S); Massif de la Selle,

Morne l'Hopital, Rue Boullier, en la loma alta, ladera frente a Port-au-Prince, 18°30'N

72°20'W, 15 Jul 1983 (fr), T. Zanoni 26217 (MO, NY); 19 km al S de Port-de-Paix, en la

carretera a Gros Morne y Gonaives, 19°49'N 72°48'W, 5 Jun 1985 (fr), T. Zanoni 34837

(MO, NY, U, US); Massif de la Selle, Morne de l'Hopital, cerca de la cima de Loma en

Boutellier, 18°30'N 72°30'W, 18 Jul 1992 (fr), T. Zanoni 46810 (MAPR). SUD DEPT.:

188

Massif de la Hotte, Parc National Pic Macaya, Bwa Formon, vicinity of Ville Formon, S

of Morne Formon, 8 June 1988 (veg), P. Paryski s.n. (FLAS). PUERTO RICO. CABO

ROJO MUN.: Sierra Bermeja, Cerro Mariquita, 15 Jan 1992 (veg), P. Acevedo-Rodriguez

4757 (US); Sierra Bermeja, upper slopes and summit of Cerro Mariquita, 21 Dec 1991

(fl), F. Axelrod 3421 (MO, NY, UPRRP); Sierra Bermeja, upper slopes and summit of

Cerro Mariquita, 21 Dec 1991 (fr), F. Axelrod 3466 (MAPR, NY, UPRRP); Barrio Llanos

Costa, Sierra Bermeja, NE side of Cerro Mariquita, ca. 18°0'6.5"N 67°6'38"W, 5 Oct

1993 (fr), G.J. Breckon 4310 (MAPR, MO); Llanos Costa, Sierra Bermeja, S-facing slope of southern Sierra Bermeja above Rancho Cabassa, 17°59'19"N 67°7'12"W, 21

Oct 2000 (fl), G.J. Breckon 6178 (MAPR); Sierra Bermeja, approaching Cerro Mariquita from the S off Rt. 303, 15 Jun 1991 (fl, fr), W.S. Judd 6037 (FLAS, FTG); Cerro

Mariquita, Sierra Bermeja, 16 Aug 1992 (veg), A.H. Liogier 37009 (UPR); Barrio Llanos

Costa, Cerro Mariquita, 20 Sep 1987 (fr), G.R. Proctor 43946 (IJ, US). GUÁNICA MUN.:

Guánica Commonwealth Forest, 2 Apr 1944 (fr), M. Cobin 1156 (MAPR); Guánica

Forest Reserve, 12 Feb 1943 (veg), H.T. Cowles 2577 (UPR); Guánica Insular Forest,

N of Camp Borinquen, 11 Oct 1940 (veg), L.E. Gregory 200 (NY, UPR, US); Guánica

Insular Forest, 12 Feb 1943 (fr), L.E. Gregory 660 (UPR); Guánica Forest, 2 Apr 1944

(fr), J.I. Oten & L.E. Gregory 755 (UPR). GUAYANILLA MUN.: near Guayanilla, 3 Feb 1923

(fr), N.L. Britton 7191 (G, GH, NY, PH, UPR); E of Guayanilla, 5 Jan 1929 (fr), N.L.

Britton 9133 (NY); E of Guayanilla, 18 Sep 1959 (fl), R.O. Woodbury s.n. (UPR).

MARICAO MUN.: Maricao State Forest, 26 Jun 1962 (fl, fr), Hno. Alain 9222 (A, IJ, MAPR,

NY, US); Maricao Forest Reserve, Rt 120, km 16.85, side dirt road and path to summit,

8 Feb 1992 (veg), F. Axelrod 3945 (UPRRP); Maricao to Monte Alegrillo, 3 Apr 1913

189

(veg), N.L. Britton 2555 (F, NY); Monte de Estado, 19 millas al SE de Mayagüez, ambos

lados carretera 120, km 16 Hm 9, 18°9'20"N 67°59'35"W, 6 May 1990 (veg), G.

Caminero 108 & 133 (MAPR); Barrio Maricao Afuera, Bosque Estatal de Maricao,

above the SW side of Hwy. 120 at km 17, 18°9'35"N 66°59'55"W, 31 May 1991 (fl), G.

Caminero 461 (MAD, MAPR); Barrio Maricao Afuera, Hwy 120 km 17.1, on hilltop SW

of road, Río Maricao drainage, 18°9'34"N 66°59'54"W, 29 Oct 1994 (fr), J.A. Cedeño

365 (MAPR, NY, UPR, UPRRP); Barrio Maricao Afuera, Río Maricao drainage, E of

Hwy 120, km 17.9, 18°9'49"N 66°59'41"W, 2 May 1995 (veg), J.A. Cedeño 561 (MAPR,

UPR); Maricao Insular Forest, near La Somanta, 24 Oct 1940 (fl), L.E. Gregory 316

(UPR, US); Maricao Insular Forest, 28 Sep 1939 (fr), L.E. Gregory 386 (UPR); Indiera

Fria, 8 Oct 1913 (fr), W.E. Hess 3327 (NY); Maricao Forest, 28 Sep 1939 (fr), L.R.

Holdridge 162 (A); Maricao Forest, near La Somante, 24 Oct 1940 (fl), L.R. Holdridge

316 (A); Maricao State Forest, 17 Jun 1980 (fl), A.H. Liogier 30713 (NY, UPR); Maricao

State Forest, 27-29 May 1989 (fl), A.H. Liogier 36793 (BRIT, F, NY, UPR); Bosque

Estatal de Maricao, Carretera 120, km 17.2-17.3, 20 Feb 1984 (veg), S. Molina Colon

138 (MAPR); Maricao Insular Forest, Alto de Descanso, 28 Nov 1982 (fr), G.R. Proctor

39206 (FTG, IJ); Maricao Forest, km 9.5 on route 120, 16 Jul 1968 (fl, fr), R.J. Wagner

1585 (DUKE, IJ, MO, U, UPS, WIS); Maricao Forest, km 10.4 on route 120, 10 Oct

1969 (fr), R.J. Wagner 1909 (A, DUKE); Monte del Estado, 14 Jun 1960 (veg), R.O.

Woodbury s.n. (UPR); Monte del Estado, 29 Apr 1963 (fl), R.O. Woodbury s.n. (UPR);

Monte del Estado, 18 Jul 1971 (fr), R.O. Woodbury s.n. (NY, UPR). MAYAGÜEZ MUN.:

Mayagüez and vicinity, Monte Mesa, 8-9 Apr 1913 (veg), N.L. Britton 2809 (F, GH, MO,

NY); Monte Mesa, 6 Feb 1915 (veg), N.L. Britton 3877 (NY, UPR, US); Cerro de las

190

Mesas, 15 Dec 1943 (fl), L.E. Gregory 721 (UPR); Cerro Las Mesas, 2 km al SE de la interseccion de la calle Liceo y la carretera 349, 18°10'5"N 67°6'W, 5 Sep 1987 (fr), M.

Mejia 2114 (MAPR). PONCE MUN.: El Tuque, W of Ponce, 11 Feb 1923 (veg), N.L.

Britton 7356 (NY, US). SABANA GRANDE MUN.: Maricao Forest Reserve, along Rt 362 beyond Campamento and Sendero Santana (trail along ridge), 16 Jan 1992 (veg), F.

Axelrod 3705 (UPRRP); Maricao Forest Reserve, Rt 362 beyond campamento and

Sendero Santana (trail along ridge), 8 Feb 1992 (fr), F. Axelrod 3975 (UPRRP); Maricao

Forest Reserve, along Rt 362 beyond Campamento and along Sendero Santana (up ridge), 6 Jun 1992 (fl), F. Axelrod 4608 (UPRRP); Barrio Santana, Maricao Forest

Reserve, along 2 km stretch of disused Rt 362 (S of Rt 120), 18°8'N 67°58'W, 15 Jan

1996 (fl), F. Axelrod 9575 (UPRRP, US); Barrio Santana, Maricao State Forest, above

W fork of Rio Cruces along Carretera 362 S of Campanento Santana, 18°8'23"N

66°58'5"W, 26 Aug 1993 (fl, fr), G.J. Breckon 4291 (FTG, MAPR, MO, UPRRP); Barrio

Susua Alta, Bosque Estatal de Susúa, 18°4'30"N 66°55'30"W, 29 Mar 1990 (fl), R.

García 2861 (MAPR); Susua Commonwealth Forest, 26 Jun 1948 (veg), A. Gonzalez

Mas 131 (MAPR); along Hwy 120, 3 miles N of Sabana Grande, 30 Nov 1981 (fl, fr), B.

Hansen 9535 (FTG, MO, NY, UPR); 2 mi. N of Sabana Grande, Hwy. 120, km 4.0, 4

Aug 1966 (fl, fr), E.L. Little, Jr. 21728 (BM, F, GH, NY, UPR, US); Sabana Grande, 11

May 1935 (fl, fr), F.H. Sargent 656 (US); along highway 120, N of Sabana Grande and a few miles S of the Maricao Insular Forest, just above km 3 Hm 9, 19 Jun 1965 (fl), W.R.

Stimson 1231 (DUKE, GH, LL, MAPR, MICH, MIN, MO, MSC, NY, RSA, UC, US). SAN

GERMÁN MUN.: San Germán, 10 Apr 1931 (fl), N.L. Britton 9751 (NY, UPR); San

Germán, 27 Dec 1943 (fl), L.E. Gregory 743 (TENN, UPR); Maricao State Forest, Road

191

362, along E side of ridge between Río Caín & Río Cupeyes, 17 Apr 1986 (fl), G.R.

Proctor 41552 (IJ, NY); Barrio Cain Alto, ridge E of Quebrada Piedras, 14 May 1986 (fl),

G.R. Proctor 41673 (IJ, NY). YAUCO MUN.: Barrio Susúa Alta, Bosque Estatal de Susúa,

on E side of Quebrada Peces, 18°4'20"N 66°54'35"W, 4 Dec 1990 (veg), G.J. Breckon

3682 (MAD, MAPR); Susúa, 26 Jun 1948 (fl), A. Gonzalez Mas 132 (MAPR); Susúa, 31

Jul 1980 (fl, fr), A.H. Liogier 30778 (NY, UPR); Susúa Alta, Susúa Forest Reserve, trail

parallel to Río Loco, 18°5'N 66°55'W, 31 Jul 1997, J. Vélez-Gavilán 447 (MAPR);

between Yauco and the Susúa Forest, km 6.9 on route 371, 16 Nov 1968 (fr), R.J.

Wagner 1768 (A); Susúa, 4 May 1960 (fl), R.O. Woodbury s.n. (UPR). UNCERTAIN

LOCALITY: from Sabana Grande to Maricao, 8 Jun 1984 (fl), A.H. Liogier 35118 (MO,

NY, UPR, US).

Although only weakly supported as a clade (Fig. 4-1), Badiera penaea is strongly supported as not closely related to the two other Hispaniolan taxa, from which it can

readily be distinguished based on the scabrous adaxial leaf surface. The only other

species of Badiera that can sometimes have scabrous leaves is B. virgata, which can

readily be separated on the basis of its fasciculate leaves and glabrous pedicels.

Sometimes, broad shade leaves can appear rather atypical for the species (e.g.,

Thompson 10465 and Zanoni 26376), as their veins are more conspicuous and the blades are neither inrolled nor strongly revolute. However, the leaves are still scabrous

(unlike the regionally sympatric B. fuertesii and B. subrhombifolia) and the pedicel is still relatively short (unlike B. fuertesii). The ovary wall of B. penaea is typically more densely pubescent at maturity than in any other species.

192

One specimen, Wagner 1760, is reportedly from the Luquillo Mountains in extreme

northeastern Puerto Rico. Badiera penaea is otherwise only known in Puerto Rico from

several municipios in the southwestern part of the island. This locality is tentatively

treated as an error in need of verification. Overall, Badiera penaea is rivaled only by B.

oblongata in terms of total range, which, when coupled with its proclivity to occur in

open disturbed areas and the fact that there are more collections of this species alone

than almost all other species combined, suggests that this species is not of immediate

conservation concern.

7. Badiera propinqua Britton, Bull. Torrey Club 42: 495. 1915. Polygala

propinqua (Britton) S.F. Blake, Contr. Gray Herb., ser. 2, 47: 16. 1916.—TYPE: CUBA.

Pinar del Río. Los Palacios to San Juan de Zayas, 17 Jan 1912 (fl), J.A. Shafer 11818

(holotype: NY!; isotypes: A!, F!, GH!, MO!, NY!, S!, US!).

Petiole (1.6-)2-3 mm long, ca. 0.6-0.8 mm wide; blade broadly elliptic to slightly ovate or slightly obovate, infrequently strongly ovate, rarely strongly obovate, (18-)24-

57(-65) mm long, (9-)12-35(-38) mm wide, the leaves mostly 25-45 mm long by 15-30 mm wide, usually uniformly large or small, rare for a single collection to have the large and small extremes intermixed, the base broadly cuneate, acute, or obtuse, the apex mostly obtuse, sometimes bluntly rounded, infrequently acute, infrequently slightly and bluntly short-acuminate, i.e., one to a few leaves on most specimens with the apex appearing pinched in (asymmetrically compressed) a few millimeters below the tip; margin plane to thinly revolute; venation more or less obscure, usually with 3-5 veins per side at least partially visible. Flowers 3-4 mm long; pedicels 1.5-2 mm long. Outer sepals 0.9-1.2 mm long, 1.2-1.3 mm wide; inner lateral sepals (wings) 1.4-1.5 mm long,

193

1.1-1.5 mm wide. Upper petals 2.5-3.3 mm long, 0.9-1.2 mm wide; keel petal 2.6-3 mm

long, 1-1.3 mm wide. Gynoecium 3-3.3 mm long in flower; stipe 0.1-0.6 mm long; ovary

ca. 0.7-0.8 mm long, 0.5-1 mm wide; style 1.7-2 mm long, 0.2-0.4 mm wide, ca. 0.9-1.4

mm from apex of the ovary to where upward curvature begins, the style curvature ca.

0.3-0.9 mm deep. Fruit body 5-7 mm long, 9-10(-11) mm wide), with stipe 1-3 mm long

(Figs. 4-5H, 4-8B, D, and E, 4-10G, 4-13F, 4-14I and J, 4-15I, 4-17E and F, 4-24B, 4-

29, 4-32G, 4-33E, 4-34H).

Phenology. The Cayman Island material was fruiting in August. Flowering Cuban

material has been collected from August to January and in March, with fruits known

from November to March.

Distribution. Cayman Islands and western Cuba; in xeromorphic thickets near the

coast and in semideciduous mesophyllous forest on limestone; 0-600 m.

Additional specimens examined. CAYMAN ISLANDS. LITTLE CAYMAN ISLAND:

0.5 mile N of Head of Bay, 9 Jul 1967 (veg), G.R. Proctor 28104 (IJ); near W end of

Charles Bight, 4 Aug 1975 (fr), G.R. Proctor 35087 (BM, IJ, MO, NY, US). CUBA. ISLA

DE LA JUVENTUD PROV.: Boquerón, Ensenada de Siguanea, 18 Feb 1916 (veg), N.L.

Britton 14501 (NY) & 14502 (CM, F, GH, NY, US). LA HABANA PROV. [ALL FROM SAN JOSÉ

DE LAS LAJAS MUN.]: Sierra de Tapaste, 30 Dec 1921 (fl, fr), E.L. Ekman 13590 (G, K,

LL, MICH, NY, S, US); Mendoza, Tapaste, 2 Jan 1922 (fl, fr, veg), Hno. León 10657

(GH, HAC, HAJB, IJ, NY, S, US); on top of Loma la Jaula, Tapaste, Feb 1926 (fr), Hno.

León 12564 (GH, IJ, NY, US). PINAR DEL RÍO PROV.: Viñales, 2 km al E de Pons,

22°33'7.6"N 83°52'13.9"W (WGS 84), 7 May 2004 (fl, fr), J. Richard Abbott 18869

(FLAS, HAJB); Viñales, Carretera Viñales a Moncada, Sendero Maravillas de Viñales,

194

22°33'34.6"N 83°49'59.5"W (WGS 84), 7 May 2004 (fl, fr), J. Richard Abbott 18871

(FLAS, HAJB); Viñales, Ensenada de la Bandera, 30 Mar 1953, Hno. Alain 2885 (HAC);

Viñales, base of a Mogote, 31 Mar 1953 (fr, veg), Hno. Alain 2910 (IJ, US); Sandino,

Península Corrientes, Guanahacabibes, 20 Dec 1959 (fl, fr, veg), Hno. Alain 6925 &

6938 (HAC); Viñales, Sierra del Sitio Santo Tomás, on top of one of the highest peaks,

12 Jun 1923 (veg), E.L. Ekman 16690 (MICH, S); San Cristóbal, Taco-taco, Charco del

Toro, 15 Oct 1923 (fl), E.L. Ekman 17671 (G, K, NY, S, US); Las Palmas, Sierra de las

Guacamayas, top of Mogote de la Baliza, 8 Nov 1923 (fl, fr), E.L. Ekman 17981 (G, K,

MICH, NY, S); Viñales, Sierra de Viñales, Loma de la Bandera, 9 Mar 1924 (veg), E.L.

Ekman 18670 (G, NY, S); Viñales, Mendoza, at Boquerón, 16 Mar 1924 (fl, fr), E.L.

Ekman 18747 (K, MICH, S, US); Sandino, S of María la Gorda, Península of Cabo

Corrientes, 12 Nov 1995 (fl), G.R. Proctor 50273 (FTG); Viñales, Mogote de la Jagua near the top, Consolación del Norte, 10 Sep 1923 (fl), J.T. Roig y Mesa 2715 (NY);

Minas de Matahambre, vicinity of Sumidero, 24 Aug 1912 (fl), J.A. Shafer 13819 (A, F,

GH, MO, NY, US).

Preliminary phylogenetic analyses of DNA sequence data support the monophyly of Badiera propinqua, and thus it may be a cladospecies (Fig. 4-1); the species likely

also has morphological synapomorphies (see those characters stressed in the key

above). The specimens Ekman 18747 and Wright 3496 have very small leaves and

approach some broad-leaf individuals of B. oblongata, especially some of the

specimens that were traditionally identified as B. montana. But they are not as strongly

emarginate as the leaves of B. oblongata, and the fruits are conspicuously wider than

long.

195

Conservation status is difficult to assess for this species because the size of the populations is largely unknown. From a global perspective, B. propinqua is obviously highly endemic and very restricted, but it is relatively widespread on a regional level.

Thus, given the widespread habitat degradation over much of its range, if most of the populations do have few individuals, then B. propinqua could be considered as

“endangered” according to the guidelines of the IUCN red data book categories (Lucas and Synge, 1978). Since this species can grow in disturbed areas, however, it may not be under any immediate threat.

8. Badiera subrhombifolia J.R. Abbott, see Chapter 2.—TYPE: HAITI. Dept. Sud:

Massif de la Hotte, Jeremie, on the ridge between Lopineau and Morne Pain-de-Sucre, ca. 1100 m, 22 July 1928 (fl), E.L. Ekman H10398 (holotype: S!; isotypes: IJ!, K!, NY!).

Petiole 1.4-3 mm long, ca. 0.8 mm wide; blade elliptic to somewhat oblong, slightly obovate, slightly ovate, or rarely ovate and tapering for the upper 1/2-2/3 of the leaf, often rhomboidal and somewhat asymmetric with a slightly different distance to the widest part on each side, 11-24 mm long, 10-15 mm wide, the base acute, the apex acute, sometimes abruptly apiculate (with apiculus 1-1.5 mm long); margin slightly revolute, inrolled portion 0.2-0.3 mm wide basally and medially, to ca. 0.1 mm or plane apically; venation mostly obscure, the midvein visible to apex (at least abaxially), often with a prominent lateral secondary vein from the base on each side of the midvein (i.e., triplinerved), with 1-3 additional secondary veins per side that are generally relatively obvious when fresh, when dried mostly not visible adaxially (if so, very slightly sunken) and inconspicuous abaxially on most leaves (when visible, flush with the blade to slightly raised). Flowers 3-4.5 mm long; pedicels 1.5-2.2 mm long. Outer sepals 1-1.8

196

mm long, 0.8-1.1 mm wide; inner lateral sepals (wings) 1.4-2.4 mm long, 1.1-1.5 mm

wide. Upper petals 2.1-3.8 mm long, 0.6-1.3 mm wide; keel petal 2.6-4.2 mm long, 1.2-2

mm wide. Gynoecium 2-2.5 mm long in flower; stipe 0.15-0.3 mm long; ovary ca. 0.6-

0.9 mm long, 0.5-0.6 mm wide; style 1.2-1.5 mm long, 0.15-0.3 mm wide, ca. 0.7-0.9

mm from apex of the ovary to where upward curvature begins, the style curvature to ca.

0.65-1 mm deep. Fruit 7.5-11 mm long, 8.5-12 mm wide; stipe 1.6-2.7 mm long. Figs. 2-

1 and 2-2 (Figs. 2-1, 2-2, 4-5I, 4-6C, 4-13A and B, 4-15J, 4-16F and H, 4-18G and H, 4-

19B and J, 4-22B, 4-31F, 4-32I, 4-33G and H, 4-34I, 4-35).

Phenology. Flowering material has been collected in February and from June to

September in both Haiti and the Dominican Republic. The only fruiting specimens also

have flowers and were collected in February (Hilaire 2442, Haiti). Three other

collections were made in February, two have flowers and one is vegetative, so no clear

phenological pattern is evident.

Distribution and habitat (Fig. 2-3). Badiera subrhombifolia is an endemic to high montane areas of Hispaniola (Haiti and the Dominican Republic). It is known from four disjunct regions: the Massif de la Hotte and Massif de la Selle, both in Haiti, the north side of the Sierra de Bahoruco and the southern edge of the Cordillera Central, both in the Dominican Republic. There appears to be an elevational cline from west to east: ca.

960-1200 m in the Massif de la Hotte, ca. 1300 m in the Massif de la Selle, 1670-1875 m in the Sierra de Bahoruco, and 1500-1600 m in the southern edge of the Cordillera

Central, although it is not clear what underlying environmental or climatic factors, if any, might be involved. The species fairly consistently occurs in broad-leaf forests, often in pockets of such forest surrounded by more arid regions or pine forests, and often in

197

disturbed or degraded thickets, indicating that it may be somewhat tolerant of

environmental disturbance.

Additional specimens examined. DOMINICAN REPUBLIC. AZUA PROV.:

Cañada Miguel Martín, between Sabana de Miguel Martín and Sabana de San Juan, [N

of Azua], 1500-1600 m, 18°39'N 70°43'W, 18 Sep 1980 (fl), M. Mejía 8247 (FTG, IJ).

INDEPENDENCIA PROV. [all on the N edge of the Sierra de Bahoruco]: N of Cabo Rojo on

old Alcoa road to Aceitillar, then N on Sendero Bahoruco (jeep trail to Puerto

Escondido), ca. 300 m SSW of Caseta #2, 1670 m, 18°12'22.2"N 71°32'3.5"W (WGS 84

map datum), 3 Jun 2006 (fl), J.R. Abbott 20914 (DUKE, F, GA, GH, FLAS, JBSD,

MICH, MO, NY, S, US, other duplicates to be distributed); Monte Jo, 26 km S of Puerto

Escondido, S of Caseta #2 de Foresta, 1800 m, 18°12'23"N 71°32'2"W, 28 July 2006

(fl), T. Clase 4305 (FLAS, JBSD); Pueblo Viejo, above Puerto Escondido, 1850 m, 19

Feb 1969 (fl), A. Liogier 14071 (NY, US); 30.5 km S of Puerto Escondido on the road to

Aceitillar, 3.9 km S of Caseta #2 de Foresta, 1875 m, 18°14'N 71°30'W, 17 Mar 1985

(fl), T. Zanoni 33765 (JBSD). HAITI. DEPARTMENT DU OUEST: Massif de la Selle, Croix-

des-Bouquets, Badeau, slope towards Camp-Franc, ca. 1300 m, 22 Feb 1927 (fl), E.L.

Ekman H7656 (A, F, S). DEPARTMENT DU SUD [all from Massif de la Hotte]: Macaya

Biosphere Reserve, Bwa Deron, 1100-1200 m, 9 Aug 1989 (fl), J.D. Skean 2500

(FLAS); W of Kay Michel, 1120 m, 18°19'51"N 74°1'46.4"W, 3 Feb 2006 (fl, fr), J.V.

Hilaire 2442 (FLAS, JBSD); Parc National Pic Macaya, Bwa Formon, in vicinity of Ville

Formon, S of Morne Formon, 960-1010 m, 2 Feb 1984 (fl), W.S. Judd 4006 (EHH,

FLAS, GH); Parc National Pic Macaya, Bwa Formon--Bwa Deron, S of Morne Formon,

1130-1150 m, 10 Jun 1993 (veg), W.S. Judd 6924 (EHH, FLAS); Macaya Biosphere

198

Reserve, Bwa Deron (Bois Durand), S of Morne Formon, ca. 0.5 km W of Tila Robert's

house, 1000-1100 m, 26 Jul 1989 (fl), J.D. Skean 2419 (FLAS).

Preliminary DNA-based phylogenetic analyses do not support Badiera

subrhombifolia as a cladospecies (Fig. 4-1); however, the populations share the putative

morphological apomorphies of subrhomboidal, subtriplinerved leaves. Badiera subrhombifolia could be thought of as being characterized by putative plesiomorphies, because the leaf features are not entirely fixed, with many leaves lacking one or both features. The leaves are actually quite variable across this species.

Some of the variation in the leaves of B. subrhombifolia appears to be correlated

with populational differences. The Massif de la Selle collection (Ekman 7056) has the

smallest leaves and the highest percentage of suborbicular leaves. The Azua collection

(Mejía 8247) has the most B. penaea-like leaves, although most of them are apically

acute to apiculate (relatively rare, but not unknown, conditions in B. penaea) and the

leaf bases are not as cuneately narrowed as typical in B. penaea. Most importantly,

none of the leaves of the Azua collection have the hairs of B. penaea, and while some

peduncles of this collection are as long as 2.8 mm (getting into the infrequent low end of

the range for B. fuertesii), others are less than 1.5 mm on the same specimen. The

Sierra de Bahoruco and Massif de la Hotte populations show certain vegetative

similarities to B. fuertesii that are not seen in the Azua collection or the Massif de la

Selle collection, although they lack the conspicuous venation and the long peduncles of

B. fuertesii. However, by using leaf scabrosity and peduncle length as the most

diagnostic reference characters, all specimens of B. subrhombifolia are easily

distinguished from both B. penaea and B. fuertesii.

199

The species is restricted to montane areas over 960 m elevation, where it is often further restricted to small pockets of broad-leaf forest surrounded by apparently unsuitable habitat. Given the widespread habitat degradation in much of its range

(especially in Haiti), B. subrhombifolia could be considered as “endangered” according to the guidelines of the IUCN red data book categories (Lucas and Synge, 1978). Since the Sierra de Bahoruco National Park populations are protected and at least some of the Haitian populations are in the U.N. Biosphere reserve centered around Pic Macaya

(in the Massif de la Hotte), and given the ability of this species to grow in disturbed areas, Badiera subrhombifolia may best be considered as “threatened.”

9. Badiera virgata Britton, Bull. Torrey Bot. Club 37: 361. 1910. Polygala guantanamana S.F. Blake, Contr. Gray Herb., Ser. 2, 47: 12. 1916. Polygala penaea L. ssp. guantanamana (S.F. Blake) Gillis, Phytologia 32: 38. 1975.—TYPE: CUBA.

Guantánamo, Caimanera, Guantánamo Bay, United States Naval Station, 17-30 March

1909 (fl), Britton 2086 (holotype: NY!; isotypes: NY!, US!).

Badiera virgata Britton var. scabridula (S.F. Blake) R. Rankin, Fl. Rep. Cuba, Ser.

A. Pl. Vasc. 7(1): 12. 2003.—TYPE: CUBA. Villa Clara, Corralillo, Loma Polverosa,

Sabana de Motembo, 9-10 Aug 1920 (fl bud, fr), Hno. León 9333 (holotype: NY!; isotypes: HAC, NY!).

Petiole 0.5-1.6(-2.5) mm long, ca. 0.3-0.5(-0.6) mm wide; blade obovate, sometimes varying to elliptic or slightly narrowly ovate, sometimes scabrous, 5.5-17(-

26) mm long, (1-)3.5-9(-16) mm wide, the narrowest leaves are typically strongly involute and revolute, the leaves mostly 10-15 mm long by 5-9 mm wide, the base mostly cuneate or acute, sometimes slightly obtuse, the apex mostly bluntly rounded,

200

sometimes subtruncate or obtuse, infrequently emarginate; margin revolute, often appearing as a thickened rim, often most pronounced distally (i.e., often grading to plane basally); venation relatively obscure, the midvein usually visible as a dark line to the apex (often only partially visible adaxially, where flush with the blade to slightly sunken), flush with the blade to slightly raised abaxially, sometimes with 1-3 secondary veins per side faintly visible abaxially. Flowers 3.2-4.8 mm long; pedicels 0.8-2.1 mm long. Outer sepals 0.9-1.1 mm long, 0.8-1.1 mm wide; inner lateral sepals (wings) 1.2-

1.4 mm long, 1.1-1.3 mm wide. Upper petals 2.8-4 mm long, 0.9-1.1 mm wide; keel petal 2.9-4.4 mm long, 1.1-1.5 mm wide. Gynoecium 2-3 mm long in flower; stipe ca.

0.2 mm long; ovary ca. 0.7-0.8 mm long, 0.7-0.8 mm wide; style 1.8-1.9 mm long, 0.2-

0.3 mm wide, ca. 1-1.5 mm from apex of the ovary to where upward curvature begins, the style curvature ca. 0.5 mm deep. Fruit body 4.5-6 mm long, 5.5-9 mm wide; stipe

0.5-1 mm long (Figs. 4-3C, 4-5J to L, 4-6B to D, 4-11F, 4-15A, 4-18E and F, 4-23A, 4-

30, 4-31C, 4-32J, 4-34J).

Phenology. Flowering material has been collected in every month but December.

Fruiting material is known from all months but May, October, and December.

Reproductive collections are scattered evenly throughout the year, with no apparent peak season.

Distribution. Endemic to Cuba; throughout in subspiny and spiny thickets on serpentine and on coastal limestone; 0-200 m.

Additional specimens examined. CUBA. CAMAGÜEY PROV.: Minas, Carretera de

Camagüey a Nuevitas, cerca km 25, Los Orientales, al S de al Entrada de los

Canjilones de Río Máximo, 21º28'34.9"N 77º40'41.9"W (WGS 84), 28 May 2004 (fl), J.

201

Richard Abbott 19050 (FLAS, HAJB); al N de Camigüey, al S de Acueducto, camino

Camigüey a la Meseta de San Felipe, entre la Cantera y la meseta, 21º33'7.8"N

77º58'25.8"W (WGS 84), 29 May 2004 (fl), J. Richard Abbott 19055 (FLAS, HAJB);

Camagüey to Santayana, 4 Apr 1909 (fl), N.L. Britton 2398 (NY, US); near Camagüey,

2-7 Apr 1912 (fl, fr, veg), N.L. Britton 13168 (F, MO, NY, US); Maragaoa (Reserve

naturelle), 21°20'N 77°58'W, 10 Nov 1992 (veg), R. Dechamps 12728 (BR, MO);

Santayana (5 km E of Camagüey City), 4 Oct 1922 (fl), E.L. Ekman 15348 (IJ, S);

Santayana, 23 Jun 1924 (fl), E.L. Ekman 19034 (IJ, S); Camagüey, S of Sierra Cubitas,

20-21 Feb 1909 (veg), J.A. Shafer 1834 (NY); N of Camagüey, in Savana de Cromo, 20

Jan 1953 (fl), J.W. Thieret 860 (F); N of Camagüey, Savana de Cromo, 1 Feb 1953 (fr),

J.W. Thieret 879 (F). CIENFUEGOS PROV.: Abreus, Yaguaramas, 8 Feb 1924 (fl, veg),

E.L. Ekman 18404 (G, NY, S, US); Cienfuegos, shore of small bay (Caletón de Don

Bruno) N of Castillo de Jagua, 9 Jul 1936 (fr), L.B. Smith 3073 (F, NY, S, US).

GUANTÁNAMO PROV.: Maisí, entre El Diamante y Jauco, Terrazas de Maisí, 20º5'12.8"N

74º15'12.9"W (WGS 84), 23 May 2004 (fl), J. Richard Abbott 19034 (FLAS, HAJB);

Caimanera, U.S. Naval Base, Guantánamo Bay, 19°54'43.4"N 75°6'6.4"W, 9 Oct 1996

(fl), A.E. Areces-Mallea 6631 (MAPR); Caimanera, Guantánamo Bay, United States

Naval Station, 17-30 Mar 1909, N.L. Britton 2086 (NY, US); Caimanera, Guantánamo,

the old naval station, 25 Sep 1914 (veg), E.L. Ekman 2927 (G, K, NY, S); Caimanera,

24 Nov 1922 (fl), E.L. Ekman 15769 (C, LL, S); Maisí, Jauco, 17 Jul-4 Aug 1924 (fl,

veg), Hno. León 11835 (GH, HAC), 12030 (HAC, NY); Caimanera, Guantánamo Bay,

Icacos beach, 27 Jun 1936, Hno. León 16710 (US); Maisí, Jul 1938 (fl), Hno. León

18117 (GH, HAC, HAJB, IJ, US); Maisí, Mesa del Chivo, Aug 1939 (veg), Hno. León

202

17115 (GH); Maisí, Mesa del Chivo, Jan 1940 (fl, fr, veg), Hno. León 17550 (GH, HAC,

IJ, US); Maisí, on the road between Jauco and Montecristo, 15-16 Jan 1956 (fl), C.V.

Morton 9165 (US). HOLGUÍN PROV.: Calixto García, Camagüey, Estrella de Aguará, 12

May 1915 (fl), J.T. Roig y Mesa 848 (NY). MATANZAS PROV.: Cárdenas, Ponce, Los

Botinos, 14 Aug 1923 (fr), E.L. Ekman 17184 (MICH, NY, S, US). SANCTI SPÍRITUS

PROV.: Jatibonico, comunidad de San Felipe, al N del poblado de Arroyo Blanco,

22º4'5.1"N 79º00'51.7"W (WGS 84), 30 May 2004 (fl), J. Richard Abbott 19058 (FLAS,

HAJB); Trinidad, Santa Clara, Casilda, 16 Mar 1910 (veg), N.L. Britton 5590 (NY);

Trinidad, Casilda, 28 Mar 1924 (fl, fr), E.L. Ekman 18868 (C, IJ, LL, S); Romero, near

Zaza, Jul 1931 (fr), Hno. León 15005 (GH, US). SANTIAGO DE CUBA PROV.: al E de la ciudad de Santiago, W del Cayo Granma, carretera de Ciudad Mar al Morro,

19º58'41.5"N 75º51'45.1"W (WGS 84), 27 May 2004 (fl), J. Richard Abbott 19047

(FLAS, HAJB); vicinity of Santiago, Níspero, 10-25 Mar 1912 (veg), N.L. Britton 12834

(NY); Aguadores, 4 May 1852 (fl), G.C. Bucher 311 (HAC, NY); near El Morro,

Santiago, 17 Feb 1938 (veg), Hno. Clemente 2350 (GH); Aguadores, Oct 1940 (veg),

Hno. Clemente 2436 (GH); near Santiago, Nov 1946 (fl), Hno. Clemente 5133 (GH);

Santiago de Cuba, new airport, Jun 1947 (fl), Hno. Clemente 5363 (GH); Santiago de

Cuba, Siboney, Mar 1948 (fl, fr), Hno. Clemente 5993 (GH); between the town of

Santiago de Cuba and El Morro, 25 Sep 1916 (fl, fr), E.L. Ekman 7707 (MICH, NY, S);

Daiquirí, at Papaya, 18 Nov 1916 (fr), E.L. Ekman 8390 (G, K, NY, S, US); Aguadores,

4 Nov 1917 (fl, fr), E.L. Ekman 8706 (S); Santiago de Cuba, near El Morro, 9 Jun 1918

(fl, fr), E.L. Ekman 9192 (S); Santiago de Cuba, behind Morro Castle, Jun-Aug 1941 (fl),

R.A. Howard 5795 (GH, MO, MT, NY, U, US); Santiago de Cuba, 1844 (veg), J. Linden

203

2054 (BM, P); alrededores del Aeropuerto de Santiago de Cuba, 10 Jul 1954 (fl, fr), M.

López Figueiras 1534 (HAC, US). VILLA CLARA PROV. [ALL FROM CORRALILLO MUN.]:

Motembo, 27 Jun 1923 (fr), E.L. Ekman 16838 (G, NY, S); Motembo, 10 Aug 1918 (fl),

Hno. León 7818 (GH, HAC, NY), 8214 (NY); Loma Polverosa, Sabana de Motembo, 9-

10 Aug 1920 (fr), Hno. León 9333 (NY).

My preliminary phylogenetic analyses of DNA sequence data do not support this taxon as a cladospecies (Fig. 4-1), i.e., the populations do not form a group that is reciprocally monophyletic with respect to some populations of other taxa, notably

Badiera oblongata. When the leaves of B. virgata are broad they can be very similar to those of B. oblongata, but they are only infrequently slightly emarginate, often with at least some leaves at least slightly scabrous, the midvein is not strongly sunken above

(usually more or less flush and inconspicuous). In addition, the leaves of B. virgata are mostly strongly obovate and broadly rounded apically, and the petiole is shorter, thinner, and more densely and conspicuously hairy, with the hairs often slightly raised above the surface, rather than tightly appressed as in most species. Overall, flowers of this species are often smaller than in other species, despite the large variation in floral details, such as the shape of the upper petal and keel.

The entity recognized as var. scabridula (S.F. Blake) R. Rankin, although geographically restricted to central and western Cuba, co-occurs with var. virgata over its entire range. Thus, it does not merit nomenclatural recognition at any rank. It merely represents a morphological extreme in polymorphic leaf features, probably reflecting an underlying difference in allele frequencies in these populations. Overall, this species

204

seems widespread and common enough to not be in any immediate danger with respect to conservation issues.

205

Table 4-1. List of taxa, vouchers, and provenance for specimens included in DNA-based phylogenetic analyses of Badiera. HFC is a collection series related to the Cuban Flora Project (= PFC in earlier literature). taxon collection provenance Badiera alternifolia Abbott 19025 (FLAS) Cuba Badiera alternifolia Bécquer HFC 81095 (HAJB) Cuba Badiera cubensis Abbott 18894 (FLAS) Cuba Badiera cubensis Bécquer HFC 81696 (HAJB) Cuba Badiera fuertesii Abbott 20901 (FLAS) Dominican Republic Badiera fuertesii Abbott 21093 (FLAS) Dominican Republic Badiera fuertesii Thompson 11218 (FLAS) Dominican Republic Badiera jamaicensis Abbott 19735 (FLAS) Mexico Badiera jamaicensis Abbott 19776 (FLAS) Guatemala Badiera jamaicensis Álvarez 347 (MO) Mexico Badiera jamaicensis Contreras 5878 (MO) Guatemala Badiera oblongata Abbott 18927 (FLAS) Cuba - Holguín, Santa Lucia Badiera oblongata Abbott 18947 (FLAS) Cuba - Holguín, Nipe Badiera oblongata Abbott 18967 (FLAS) Cuba - Holguín, Nipe Badiera oblongata Abbott 18977 (FLAS) Cuba - Holguín, Mayari Badiera oblongata Abbott 19038 (FLAS) Cuba - Santiago de Cuba, Gran Piedra Badiera oblongata Abbott 19058 (FLAS) Cuba - Sancti Spíritus, Jatibonico Badiera oblongata Abbott 19061 (FLAS) Cuba - Santa Clara Badiera oblongata Abbott 14363 (FLAS) Cuba (cultivated in Miami) Badiera oblongata Abbott 18900a (FLAS) Cuba - Sancti Spíritus, Sierra de Banao Badiera oblongata Abbott 18900b (FLAS) Cuba - Sancti Spíritus, Sierra de Banao Badiera oblongata Abbott 18900c (FLAS) Cuba - Sancti Spíritus, Sierra de Banao Badiera oblongata Bécquer HFC 24770 (HAJB) Cuba Badiera oblongata Bécquer HFC 81657 (HAJB) Cuba Badiera oblongata Bécquer HFC 82244 (HAJB) Cuba Badiera oblongata Bécquer HFC 82253 (HAJB) Cuba Badiera oblongata Bécquer HFC 82259 (HAJB) Cuba Badiera oblongata Bécquer HFC 83865 (HAJB) Cuba - Sierra Maestra Badiera penaea Abbott 20963 (FLAS) Dominican Republic Badiera penaea Abbott 21022 (FLAS) Dominican Republic

206

Table 4-1. Continued taxon number provenance Badiera penaea Abbott 21040 (FLAS) Dominican Republic Badiera penaea Jiménez 1967 (MO) Dominican Republic Badiera penaea Carlsward 325 (FLAS) Dominican Republic Badiera penaea Judd 6037 (FLAS) Puerto Rico Badiera penaea Thompson 9763 (FLAS) Dominican Republic Badiera propinqua Abbott 18869 (FLAS) Cuba Badiera propinqua Abbott 18871 (FLAS) Cuba Badiera propinqua Proctor 35087 (MO) Cayman Islands Badiera subrhombifolia Abbott 20914 (FLAS) Dominican Republic Badiera subrhombifolia Judd 6924 (FLAS) Haiti Badiera subrhombifolia Skean 2419 (FLAS) Haiti Badiera subrhombifolia Skean 2500 (FLAS) Haiti Badiera virgata Abbott 19034 (FLAS) Cuba - Guantánamo, Maisí Badiera virgata Abbott 19047 (FLAS) Cuba - Santiago de Cuba, Ciudad Mar Badiera virgata Abbott 19050 (FLAS) Cuba - Camagüey, Nuevitas Badiera virgata Abbott 19052 (FLAS) Cuba - Camagüey, Nuevitas Badiera virgata Abbott 19055 (FLAS) Cuba - Camagüey, San Felipe Badiera virgata Dechamps & Carrera 12728 (MO) Cuba Bredemeyera floribunda AA03 (voucher unknown) Brazil Polygala barbeyana Abbott 14637 (FLAS) USA - New Mexico Polygala glandulosa Abbott 19579 (FLAS) USA - Texas Polygala macradenia Abbott 14566 (FLAS) USA - Texas Polygala obscura Abbott 14583 (FLAS) USA - Texas

207

Table 4-2. DNA primers used in this study. ITS forward CGAGAAGTCCACTGAACCTTATC ITS reverse TCTTYTCCTCCGCTTATTGATATGC ITS internal reverse GCGTTCAAAGACTCGATGGTTC ITS internal forward GACTCTCGGCAACGGATATCTCGGC ITS 101 (forward) ACGAATTCATGGTCCGGTGAAGTGTTCG ITS 102 (reverse) TAGAATTCCCCGGTTCGCTCGCCGTTAC trnL forward CGAAATCGGTAGACGCTACG trnL-F reverse ATTTGAACTGGTGACACGAG trnL internal forward GGTTCAAGTCCCTCTATCCC trnL internal reverse GGGGATAGAGGGACTTGAAC psbM-ycf6 forward ATGGATATAGTAAGTCTYGCT psbM-ycf6 reverse ATGGAAGTAAATATTCTCGC trnC-ycf6 forward CCAGTTCAAATCTGGGTGTC trnC-ycf6 forward GCCCAAGCRAGACTTACTATATCCAT matK forward GTATCGCACTATGTATCATTTGA matK reverse ACCTAGTCGGATGGAGTAG matK internal forward CCTTCGCTACTGCTTCAAAGAT

208

Figure 4-1. Synopsis of phylogenetic analysis of combined nuclear and plastid data for multiple populations of Badiera, with bootstrap values (BS) and branch lengths (mapped onto an arbitrarily chosen phylogram of the 4790 most parsimonious trees).

209

Figure 4-2. Flowers. A. Badiera fuertesii, flower, head-on view, the Dominican Republic, Barahona Province, Monteada Nueva region, Loma Trocha de Pey (Abbott 20901). B. Badiera oblongata, portion of branch with several flowers, central Cuba, Sancti Spíritus, in the Banao Mountains (Abbott 18900). C. Badiera alternifolia, portion of branch with several flowers, eastern Cuba, Holguín, Moa, southeast of Yamanigüey (Abbott 19025). D. Badiera fuertesii, inflorescence with one open flower, the Dominican Republic (see A; Abbott 20901). E. Badiera oblongata, critical point dried flower and bud progression (Abbott 18900).

210

Figure 4-3. Close-up of flower parts, all alcoholized. A. Badiera virgata, upper nectar disk, lower portion obscured by ovary, with adaxial sepals (Abbott 19034). B. Badiera penaea, adaxial sepals and nectar disk, with gynoecium, androecium, and corolla removed (Caminero 461). C. Badiera virgata, adaxial upper petal (Abbott 19034). D. Badiera virgata, adaxial upper petal (Britton 13168). E. Badiera alternifolia, adaxial lateral (outer) sepals (Abbott 19025). F. Badiera fuertesii, adaxial lateral (outer) sepals (Abbott 20901). G. Badiera propinqua, androecium and upper petals, adaxial view, note the misshapen, non-functional anthers (Abbott 18869). H. Badiera oblongata, androecium, adaxial view, note the open, functional anthers (Zomlefer 727).

211

Figure 4-4. Floral features (scanning electron micrographs), Badiera oblongata (Abbott 18900). A. Whole flower, head-on view. B. Sepals, abaxial view, with pedicel removed. C. Gynoecium. D. Sepals, adaxial view, with gynoecium removed. E. Gynoecium, younger than the one in C. F-H. Adaxial surface of cells of upper petal.

212

Figure 4-5. Alcoholized gynoecia (except I, which is dried), lateral view, with most sepals removed for visibility of nectar disk, stipe, and ovary. A. Badiera alternifolia (Abbott 19025). B. Badiera cubensis (Ekman 17521). C. Badiera fuertesii (Abbott 20901). D. Badiera jamaicensis (Lundell 16249). E. Badiera oblongata (Abbott 18900). F. Badiera oblongata (Zomlefer 727). G. Badiera penaea (Carlsward 325). H. Badiera propinqua (Ekman 13590). I. Badiera subrhombifolia (Clase 4305). J. Badiera virgata (Abbott 19047). K. Badiera propinqua, note the atypical strongly upcurved stipe with oblique attachment to the ovary base (Abbott 18869). L. Badiera virgata, note the sigmoidally curved style, atypical in being down-curved near base (Abbott 19034).

213

Figure 4-6. Dried pedicels, all with persistent bracts at the base. A. Badiera alternifolia, mostly glabrous, but with a few small patches of hairs (Abbott 19025). B. Badiera virgata, glabrous except for one or two scattered hairs, note the three persistent bracts at the base of a pedicel scar, with main bract pointing to the right and the prophyllar bracts pointing up and down (Abbott 19055). C. Badiera subrhombifolia, densely hairy (Skean 2419). D. Badiera virgata, glabrous (Britton 13168).

214

Figure 4-7. Inflorescence bracts. A. Badiera penaea, inflorescence, with green or brown bracts persistent along axis, the Dominican Republic, San Juan Province, along road from Guanito to Gajo Frio (Carlsward 325). B. Badiera penaea, dried inflorescence, with green or brown bracts persistent along axis (Carlsward 325). C. Badiera fuertesii, dried inflorescence, with caducous bracts, note the pale scars left by the basal bract and two lateral prophylls (Abbott 21093).

215

Figure 4-8. Badiera penaea, B. propinqua, and B. cubensis. A. Badiera penaea, flowering branch, the Dominican Republic, Santiago Rodriguez Province, Cordillera Central, SW of Monción (Abbott 21040). B. Badiera propinqua, dried fruiting branch (Abbott 18869). C. Badiera cubensis, sterile branch, western Cuba, Provincia Pinar del Rio, Municipio de Bahia Honda, Pan de Guajaibón (Abbott 18894). D-E. Badiera propinqua (Abbott 18869), fruits from western Cuba: D. View from top of dehisced fruit, apex of aril seen on each seed (one per locule). E. Lateral view, fruit on left unopened, fruit on right with one locule dehisced.

216

Figure 4-9. Badiera oblongata, central Cuba, Sancti Spíritus, in the Banao Mountains (Abbott 18900). A. Arching, virgate habit. B. Leaves folded down (nyctinastic) on a rainy day. C-E. Dehisced fruits, usually erect but some of these pendent. F. Flowering branch.

217

Figure 4-10. Badiera fruits, part 1, all from dried material. Scale bars = 2 mm. A-B. Badiera cubensis, part of the fruit wall was cut away in B (Ekman 10666). C-D. Badiera oblongata, one locule is abortive in C, a very common condition in most species (Correll 43856). E. Badiera jamaicensis (Lundell 17287). F. Badiera fuertesii (Liogier 18018). G. Badiera propinqua (Abbott 18869).

218

Figure 4-11. Badiera fruits, part 2, all from dried material. Scale bars = 2 mm. A. Badiera penaea (Judd 6037). B. Badiera alternifolia, immature (Abbott 19025). C. Badiera penaea (Woodbury s.n. June 1969). D. Badiera subrhombifolia, immature (Hilaire 2442). E. Badiera oblongata (Abbott 18900). F. Badiera virgata (Ekman 17184).

219

Figure 4-12. Seeds, part 1. Scale bars = 1 mm. A. Badiera oblongata (Abbott 18900). B. Badiera jamaicensis (Lundell 17287). C. Badiera cubensis (Ekman 10666). D-F. Badiera oblongata: D. Abbott 14363. E. Ekman 3172. F. Correll 43856. G-I. Badiera penaea: G. Woodbury s.n. June 1969. H. Judd 6037. I. Ekman H11616.

220

Figure 4-13. Seeds, part 2. Scale bars = 1 mm. A-B. Badiera subrhombifolia (Hilaire 2442): A. Nearly mature. B. Atypically angled seed. C. Badiera fuertesii (Zanoni 28293). D. Badiera alternifolia, immature (Abbott 19025). E. Badiera virgata (Ekman 17184). F. Badiera propinqua (Abbott 18869).

221

Figure 4-14. Aril surface texture detail (scanning electron micrographs). A-C. Badiera cubensis (Ekman 10666). D. Badiera fuertesii (Zanoni 28293). E-F. Badiera jamaicensis (Lundell 17287). G. Badiera oblongata (Abbott 18900). H. Badiera penaea (Judd 6037). I-J. Badiera propinqua (Abbott 18869).

222

Figure 4-15. Anatomical cross sections of leaves. A. Badiera virgata (Abbott 19034). B. Badiera alternifolia (Abbott 19025). C. Badiera penaea (Carlsward 325). D. Badiera oblongata (Abbott 18927). E. Badiera cubensis (Abbott 18894). F. Badiera fuertesii (Abbott 20901). G-H. Badiera jamaicensis (Abbott 19735). I. Badiera propinqua (Abbott 18869). J. Badiera subrhombifolia (Abbott 20914).

223

Figure 4-16. Anatomical leaf features, transverse sections, part 1. A-B. Badiera alternifolia (Abbott 19025), scale bars = 100 μm: A. Margin, 100x. B. Midrib, 100x. C-D. Badiera fuertesii (Abbott 20901), scale bar = 100 μm: C. Margin, 50x. D. Midrib, 100x. E. Badiera fuertesii, close-up of midrib vascular bundle, 400x, scale bar = 50 μm (Abbott 20901). F-H. Badiera subrhombifolia (Abbott 20914), scale bars = 100 μm: F. Close-up of lamina to show palisade layers and spongy mesophyll, 100x. G. Margin, 50x. H. Midrib, 50x.

224

Figure 4-17. Anatomical leaf features, transverse sections, part 2. All scale bars = 100 μm. A-B. Badiera cubensis (Abbott 18894): A. Margin, 50x. B. Midrib, 100x. C-D. Badiera jamaicensis (Abbott 19735), 100x: C. Margin. D. Midrib. E-F. Badiera propinqua (Abbott 18869), 100x: E. Margin. F. Midrib.

225

Figure 4-18. Anatomical leaf features, transverse sections, part 3. All scale bars = 100 μm. A-B. Badiera oblongata (Abbott 18900): A. Margin, 50x. B. Midrib, 100x. C-D. Badiera oblongata (Abbott 18927): C. Margin, 50x. D. Midrib, 100x. E-F. Badiera virgata (Abbott 19034), 100x: E. Margin. F. Midrib. G- H. Badiera penaea (Carlsward 325), 50x: G. Margin. H. Midrib.

226

Figure 4-19. Anther details (scanning electron micrographs). A. Badiera oblongata, misshapen non-functional anthers (Abbott 18900). B-J. Badiera subrhombifolia (Abbott 20914): B. Anther, adaxial view. C. Half the androecium, with the upper half of the filament sheath, abaxial view. D. Anther, lateral view. E. Apex of three stamens, adaxial view. F. Close-up of anther pore. G. Two anthers, adaxial view. H. Pollen strew. I. Pollen grain, equatorial view. J. Pollen grain, polar view.

227

Figure 4-20. Root and stems, anatomical transverse sections. A. Badiera alternifolia, root, 50x, scale = 100 μm (Abbott 19025). B. Badiera fuertesii, petiole, 50x, scale = 100 μm (Abbott 20901). C. Badiera alternifolia, young stem, note the bluntly triangular pith, 100x, scale = 100 μm (Abbott 19025). D. Badiera cubensis, young stem, note the oblong pith, 100x, scale = 100 μm (Abbott 18894). E. Badiera alternifolia, young stem, polarized light, note the x- shaped starch grains, 400x, scale = 50 μm. F. Badiera cubensis, older stem, 50x, scale = 100 μm (Abbott 18894). G-H. Badiera jamaicensis (Abbott 19735), scale = 100 μm: G. Young stem, note the circular pith, 100x. H. Older stem, 50x.

228

Figure 4-21. Anatomical view of leaf hairs and epidermis, in transverse section except for A, which is a surface view. All scale bars = 100 μm. A. Badiera oblongata, leaf clearing, abaxial surface, note the stomata, the jigsaw-like shape of the epidermal cells, and that the cells subtending the hair are in the same plane as the rest of the epidermis, i.e., they are not in a pit (Bécquer HFC 82253). B. Badiera penaea, adaxial margin, note that the cuticle is thicker than the epidermis and is even thicker around the base of the hair, sometimes appearing pustular (Abbott 20963). C. Badiera alternifolia, adaxial margin, note that the cuticle is much thicker than the epidermis and the hair is in a cuticular pit (Abbott 19025). D. Badiera cubensis, adaxial margin above the midvein, note the thin cuticle and the rounded cells of the bundle sheath extension (Abbott 18894). E. Badiera jamaicensis, abaxial margin, note that the cuticle is much thinner than the epidermis (Abbott 19735). F. Badiera alternifolia, adaxial margin, note the smooth to irregularly roughened to minutely ridged cuticle (Abbott 19025).

229

Figure 4-22. View of various leaf features (scanning electron micrographs). A. Badiera oblongata, wax-covered stomata on abaxial leaf, note the fungal hypha, scattered debris, and uneven cuticular deposition (Abbott 18900). B. Badiera subrhombifolia, wax-covered stoma on abaxial leaf surface (Abbott 20914). C-H. Badiera alternifolia (Abbott 19025): C. Leaf margin, adaxial above, abaxial below, note the appearance of a thickened rim abaxially. D. Abaxial leaf apex. E. Stomata, hairs, and cuticle on abaxial leaf, note the variation from minutely ridged to somewhat smooth to scurfy. F. Adaxial leaf surface, note the faint, obscure midvein and the discolored sunken cuticular pits at the base of the hairs. G. Adaxial leaf hairs and associated cuticular pits. H. Abaxial petiole.

230

Figure 4-23. Macroscopic leaf features. A. Badiera virgata, abaxial petiole, note the raised peg at the base (Abbott 19058). B. Badiera oblongata, adaxial petiole (Abbott 14363). C. Badiera penaea, pustular-based hairs on adaxial leaf (Abbott 21022). D. Badiera alternifolia, pits on adaxial leaf, associated with base of hairs (Abbott 19025).

231

Figure 4-24. Druse crystals. A. Badiera cubensis, non-polarized light at 50x magnification, scale bar = 100 μm (Abbott 18894). B. Badiera propinqua, polarized light at 400x magnification, scale bar = 50 μm (Abbott 18869). C. Badiera oblongata, polarized light at 100x magnification, scale bar = 100 μm (Abbott 18927). D. Badiera oblongata, polarized light at 400x magnification, scale bar = 50 μm (Bécquer HFC 82253). E. Badiera fuertesii, polarized light at 100x magnification, scale bar = 100 μm (Abbott 20901). F. Badiera oblongata, non-polarized light at 400x magnification, scale bar = 50 μm (Bécquer HFC 82253).

232

Figure 4-25. Badiera alternifolia, at the type locality, eastern Cuba, Holguín, Moa, southeast of Yamanigüey (Abbott 19025). A. Close-up of a flowering branchlet. B. Habitat; Badiera alternifolia is the low shrub just behind the man (Pedro A. González) in the photo. C. Shrub ca. 1 m tall.

233

Figure 4-26. Badiera fuertesii. A. Dried infructescence (Woodbury s.n., UPR 1465). B- C. Abbott 20901, the Dominican Republic, Barahona Province, Monteada Nueva Region, Loma Trocha de Pey: B. Close-up of flowering branchlet. C. Habit, sterile branch.

234

Figure 4-27. Badiera jamaicensis. A-B. Abbott 19776, Guatemala, Petén, near Aldea La Rote: A. habit, sterile branch. B. sterile branch. C. bark. D. Abbott 19735, sterile branch from Mexico, Quintana Roo, west of Cancún.

235

Figure 4-28. Badiera oblongata, variation in leaves. A. Ekman 3120, dried sterile branch. B. Smith 3144, dried sterile branch. C. Abbott 14363, flowering branch from cultivated shrub in Miami, Florida. D. Abbott 19061, dried sterile branch; the leaves were tightly appressed downwards when living. E. Webster 45, dried flowering branch. F. Abbott 14363, dried flowering branch.

236

Figure 4-29. Badiera propinqua, western Cuba, Pinar del Río, Viñales, 2 km east of Pons (Abbott 18869). A. Habitat and habit, Badiera propinqua is the 2.5 m tall shrub in the center of the photo, just to the right of the trail. B. Fruiting branch. C. Bark, stem ca. 8 cm diameter, the blotches are crustose lichens.

237

Figure 4-30. Badiera virgata. A. Abbott 19050, fruiting branch, Cuba, Camagüey, Minas, Carretera de Camagüey a Nuevitas. B. Abbott 19034, flowering branch, eastern Cuba, Guantanamo, Maisí, between El Diamante and Jauco. C. Abbott 19047, flowering branch, eastern Cuba, Santiago de Cuba, Ciudad Mar to Morro highway.

238

Figure 4-31. Floral features. A. Badiera oblongata, dried flower, lateral view (Leon 6677). B. Badiera fuertesii, dried flower, partially opened, lateral view (Abbott 20901). C. Badiera virgata, alcoholized flower, partially opened, lateral view (Howard 5795). D. Badiera virgata, alcoholized upper petals and androecium, lateral view (Abbott 19034). E. Badiera oblongata, alcoholized androecium with pollen covering styles (Howard 5795). F. Badiera subrhombifolia, alcoholized androecium, adaxial view, with upper petals (Hilaire 2442). G. Badiera oblongata, alcoholized keel, adaxial view (Abbott 21022). H. Badiera oblongata, alcoholized flower, opened along the upper slit to expose the ovary and the styles closely surrounded by the anthers (Abbott 18977).

239

Figure 4-32. Alcoholized floral keels (lower petal), lateral view. A. Badiera alternifolia (Abbott 19025). B. Badiera cubensis (Ekman 17521). C. Badiera fuertesii (Abbott 20901). D. Badiera jamaicensis (Lundell 16249). E. Badiera oblongata (Zomlefer 727). F. Badiera penaea (Abbott 21022). G. Badiera propinqua (Ekman 13590). H. Badiera propinqua (Abbott 18869). I. Badiera subrhombifolia (Clase 4305). J. Badiera virgata (Abbott 19034).

240

Figure 4-33. View of various hairs and epidermal features (scanning electron micrographs). A. Badiera cubensis, surface of young twig (Abbott 18894). B-D. Badiera oblongata (Abbott 18900): B. Wax-covered stomata and epidermal cells of fruit. C. Abaxial surface of leaf. D. Papillae on hair on fruit surface. E. Badiera propinqua, fruit margin, note how wax trapped the apex of a hair (Abbott 18869). F. Badiera alternifolia, petiole surface (Abbott 19025). G-H. Badiera subrhombifolia (Abbott 20914): G. Hairs on the filament, note the compressed, flattened shape (only found on the anthers; cylindrical elsewhere). H. Wax-covered abaxial leaf surface, note the fungal hyphae.

241

Figure 4-34. Leaf venation, near mid-leaf, polarized light, 5x. All scale bars = 200 μm. A. Badiera alternifolia (Abbott 19025). B. Badiera cubensis (Abbott 18894). C. Badiera fuertesii (Abbott 20901). D. Badiera jamaicensis (Abbott 19735). E. Badiera oblongata (Bécquer HFC 82253). F. Badiera oblongata, leaf base (Abbott 18927). G. Badiera penaea (Carlsward 325). H. Badiera propinqua (Abbott 18869). I. Badiera subrhombifolia (Abbott 20914). J. Badiera virgata (Abbott 19034).

242

Figure 4-35. Floral measurements for species of Badiera (diagrammatic, from B. subrhombifolia). A. Gynoecium, lateral view. a. Style curvature. b. Style length. c. Ovary length. d. Stipe length. B. Androecium and upper petals, adaxial view. a. Androecium. b. Filament sheath (measured to base of uppermost free filament). c. Upper petal width. d. Anther length. e. Free filament length. f. Upper petal length.

243

CHAPTER 5 RESULTS AND CONCLUSIONS

Ten years of work in the field, herbarium, and molecular laboratory have allowed

me to develop a robust hypothesis of relationships amongst species of Polygalaceae,

especially Polygaleae. As a result, a phylogenetically accurate, generic-level

classification of the Polygaleae has been proposed. My results are largely congruent

with other preliminary studies, with the minor incongruencies all related to taxon

sampling. I can now speak more confidently about relationships within the family, and

future research should focus on better taxon sampling in order to further resolve poorly

sampled clades and to strengthen support for existing classification schemes.

As part of my revisionary work with Badiera, I described a new species from

Hispaniola, which sorts out decades of misidentification. Overall, my revision of Badiera

will be a valuable and long-lasting contribution to other workers, providing a modern

reference point against which future work can be compared, especially as there are several unresolved, population-level issues that will require detailed population genetics studies. Species limits have been resolved, integrating field observations, study of herbarium material, and a phylogenetic assessment of DNA sequence data.

In the process of conducting field work, I visited more than a dozen countries, broadening my experience base as a neotropical field botanist. In addition, I was able to study and collect all of the species of Badiera, as well as many other species of

Polygalaceae. In my travels, many other unresolved basic biological questions were

encountered, providing direction for future research, primarily relating to the need to

resolve various species complexes that are currently poorly understood, e.g., the

244

Polygala floribunda Benth. complex in northern Central America and the Microthrix subgroup of the Hebecarpa group in Mexico.

245

APPENDIX A VOUCHER TAXA USED IN THIS STUDY

246

ITS trnL intron trnL-F taxon provenance voucher (herbarium) genbank genbank genbank Atroxima afzeliana (Oliv.) Stapf Ivory Coast Jongkind 4281 (WAG) GQ888877 GQ889056 Atroxima liberica Stapf Liberia Adams 24834 (MO) GQ888878 GQ889057 Dominican Badiera fuertesii Urban Republic JRA 20901 (FLAS) GQ888879 GQ889058 GQ888769 Badiera oblongata Britton Cuba JRA 18947 (FLAS) GQ888880 GQ889059 GQ888770 Dominican Thompson 9763 Badiera penaea DC. Republic (FLAS) GQ888881 GQ889060 GQ888771 Badiera virgata Britton Cuba JRA 19034 (FLAS) GQ888882 GQ889061 GQ888772 Bredemeyera floribunda Willd. Bolivia JRA 16366 (FLAS) GQ888883 GQ889062 GQ888773 Bredemeyera lucida (Benth.) Klotzsch ex Hassk. Belize JRA 19637 (FLAS) GQ888884 GQ889063 Carpolobia alba G. Don Cameroon Cable 747 (K) GQ888885 GQ889064 GQ888774 D.J. Goyder et al. Carpolobia goetzei Gürke Tanzania 3722 (K) GQ888886 GQ889065 Comesperma aphyllum Benth. Australia Craven 5832 (MO) GQ888887 GQ889066 Comesperma calymega Labill. Australia Donner 10317 (MO) GQ888888 GQ889067 Comesperma esulifolium (Gand.) Prain Australia Telford 12350 (CANB) GQ888889 GQ889068 GQ888775 Comesperma flavum DC. Australia Strid 21496 (MO) GQ888890 GQ889069 Eriandra fragrans P. Royen and Steenis New Guinea Pullen 7234 (K) GQ888891 GQ889070 Guibourtia hymenaefolia (Moric.) J. Léonard Cuba JRA 18979 (FLAS) GQ888892 GQ889071 GQ888776 Monnina cestrifolia (Bonpl.) Kunth Ecuador Blanco 2508 (FLAS) GQ888893 GQ889072 GQ888777 Monnina crassifolia (Bonpl.) Kunth Ecuador Whitten 2357 (FLAS) GQ888894 GQ889073 GQ888778

247

Monnina denticulata Ruiz and Pav. ex Chodat Ecuador Blanco 2478 (FLAS) GQ888895 GQ889074 GQ888779 Monnina hirta ssp. hirta (Bonpl.) B. Eriksen Ecuador Blanco 2529a (FLAS) GQ888896 GQ889075 GQ888780 Monnina leptostachya Benth. Ecuador Blanco 2505 (FLAS) GQ888897 GQ889076 GQ888781 Monnina ligustrina (Bonpl.) B. Eriksen Ecuador Blanco 2504 (FLAS) GQ888898 GQ889077 GQ888782 Monnina parasylvatica C.M. Taylor Panama Blanco 2858 (FLAS) GQ888899 GQ889078 Monnina phillyreoides (Bonpl.) B. Eriksen Ecuador Blanco 2465 (FLAS) GQ888900 GQ889079 GQ888783 cultivated (N Monnina revoluta (Bonpl.) Kunth Andes) JRA 25290 (FLAS) GQ888901 GQ889080 GQ888784 Monnina speciosa Triana and Planch. Ecuador Whitten 2326 (FLAS) GQ888902 GQ889081 GQ888785 Irwin et al. 22408 Monnina stenophylla A. St.-Hil. Brazil (MO) GQ888903 GQ889082 Monnina subspeciosa Chodat Ecuador Whitten 2356 (FLAS) GQ888904 GQ889083 GQ888786 Monnina tenuifolia Chodat Ecuador Whitten 2327 (FLAS) GQ888905 GQ889084 GQ888787 Monnina tristaniana A. St.-Hil. Paraguay Zardini 15958 (MO) GQ888906 GQ889085 Monnina wrightii A. Gray Mexico JRA 19532 (FLAS) GQ888907 GQ889086 Solomon and Nee Monnina wrightii A. Gray Bolivia 18157 (MO) GQ888908 GQ889087 Monnina xalapensis Kunth Costa Rica Blanco 3047 (FLAS) GQ888909 GQ889088 GQ888788 Moutabea cf. chodatiana Huber Brazil Tavares 294 (MO) GQ888910 GQ889089 GQ888789 cultivated (seed from Muraltia ericaefolia DC. South Africa) no voucher GQ888911 GQ889090 Muraltia ericoides Chodat South Africa Forest 315 (NBG) GQ888912 GQ889091 GQ888790 Muraltia heisteria (L.) DC. South Africa Forest 160 (K) GQ888913 GQ889092 GQ888791

248

Nylandtia scoparia (Eckl. and Zeyh.) Goldblatt Goldblatt and and J.C. Manning South Africa Manning 10992 (MO) GQ888914 GQ889093 Phlebotaenia cuneata Griseb. [= Polygala cuneata (Griseb.) S.F. Blake] Cuba JRA 18929 (FLAS) GQ888915 GQ889094 GQ888792 Pictetia marginata C. Wright Cuba JRA 18943 (FLAS) GQ888916 GQ889095 Polygala acanthoclada A. Gray Utah JRA 14653 (FLAS) GQ888917 GQ889096 GQ888793 Bell and Wiser 88-231 Polygala acuminata Willd. Peru (L) GQ888918 GQ889097 Polygala adenophora DC. Belize JRA 19607 (FLAS) GQ888919 GQ889098 GQ888794 Polygala alba Nutt. Mexico JRA 19547 (FLAS) GQ888920 GQ889099 GQ888795 Polygala albicans (A.W. Benn.) Grondona Brazil Agra et al. 4416 (MO) GQ888921 GQ889100 GQ888796 Polygala albowiana Chodat Mexico Flores 1072 (MO) GQ888922 GQ889101 England Kew 2000-3244 (K - Polygala alpicola Rupr. (cultivated) living collection) GQ888923 GQ889102 Wallnöfer 13832 Polygala amara L. ssp. amara Austria (FLAS) GQ888924 GQ889103 Polygala amara L. ssp. brachyptera Wallnöfer 13936 Hayek Austria (FLAS) GQ888925 GQ889104 Wallnöfer 13842 Polygala amarella Crantz Austria (FLAS) GQ888926 GQ889105 GQ888797 Polygala ambigua Nutt. Kentucky JRA 13658 (FLAS) GQ888927 GQ889106 GQ888798 Polygala aparinoides Hook. and Arn. Guatemala JRA 19751 (FLAS) GQ888928 GQ889107 GQ888799 Polygala asperuloides Kunth Ecuador Blanco 2493 (FLAS) GQ888929 GQ889108 GQ888800 Polygala balduinii Nutt. Florida JRA 14789 GQ888930 GQ889109 GQ888801 Polygala cf. barbeyana Chodat New Mexico JRA 14637 (FLAS) GQ888931 GQ889110 GQ888802

249

Polygala boykinii Nutt. Florida JRA 13676 GQ888932 GQ889111 GQ888803 Polygala bracteolata L. South Africa Forest 152 (K) GQ888933 GQ889112 Brunner et al. 945 Polygala brasiliensis L. Paraguay (MO) GQ888934 GQ889113 GQ888804 Polygala brevifolia Nutt. Florida JRA 13675 (FLAS) GQ888935 GQ889114 GQ888805 England Kew 1981-1444 (K - Polygala calcarea F.W. Schultz (cultivated) living collection) GQ888936 GQ889115 GQ888806 Polygala californica Nutt. California JRA 13010 (FLAS) GQ888937 GQ889116 GQ888807 Aparecida da Silva et Polygala celosioides A.W. Benn. Brazil al. 2099 (MO) GQ888938 GQ889117 GQ888808 Wallnöfer 13860 Polygala chamaebuxus L. Austria (FLAS) GQ888939 GQ889118 GQ888809 Polygala chapmanii Torr. and A. Gray Florida JRA 17738 (FLAS) GQ888940 GQ889119 GQ888810 Wallnöfer 13839 Polygala comosa Schkuhr Austria (FLAS) GQ888941 GQ889120 Polygala cornuta Kellog ssp. fishiae (Parry) Munz California JRA 14678 (FLAS) GQ888942 GQ889121 GQ888811 Harrison 14516 Polygala costaricensis Chodat Guatemala (FLAS) GQ888943 GQ889122 Polygala crenata C.W. James Florida JRA 20108 (FLAS) GQ888944 GQ889123 GQ888812 Dominican Polygala crucianelloides DC. Republic JRA 20911 (FLAS) GQ888945 GQ889124 GQ888813 Polygala cruciata L. Florida JRA 13835 (FLAS) GQ888946 GQ889125 GQ888814 Polygala cymosa Walter Florida JRA 13823 (FLAS) GQ888947 GQ889126 GQ888815 Polygala cyparissias A. St.-Hil. and Carvalho et al. 1238 Moq. Brazil (MO) GQ888948 GQ889127 Polygala dolichocarpa S.F. Blake Mexico JRA 19507 (FLAS) GQ888949 GQ889128 GQ888816 Polygala duarteana A. St.-Hil. and Paraguay Zardini and Velazquez GQ888950 GQ889129 GQ888817

250

Moq. 23393 (MO) Polygala ephedroides Burch. South Africa JRA 24129 (FLAS) GQ888951 GQ889130 Polygala erioptera DC. Saudi Arabia Gasperetti 409 (MO) GQ888952 GQ889131 Zardini and Velasquez Polygala extraaxillaris Chodat Paraguay 12506 (MO) GQ888953 GQ889132 Polygala floribunda Benth. Mexico JRA 19659 (FLAS) GQ888954 GQ889133 GQ888818 Polygala fruticosa Berg. South Africa Forest 254 (K) GQ888955 GQ889134 Galapagos Polygala galapageia Hook. f. Islands Adsersen 1732 (C) GQ888956 GQ889135 GQ888819 Polygala garcinii DC. South Africa Forest 161 (K) GQ888957 GQ889136 GQ888820 Polygala glandulosa Kunth Texas JRA 19579 (FLAS) GQ888958 GQ889137 GQ888821 Polygala glochidiata Kunth Cuba JRA 18850 (FLAS) GQ888959 GQ889138 GQ888822 Dominican Polygala grandiflora Walter Republic JRA 20869 (FLAS) GQ888960 GQ889139 GQ888823 Polygala hebeclada DC. Bolivia Daly et al. 6338 (MO) GQ888961 GQ889140 GQ888824 Polygala hemipterocarpa A. Gray Texas JRA 14622 (FLAS) GQ888962 GQ889141 GQ888825 Polygala heterorhyncha T. Wendt Nevada JRA 14672 (FLAS) GQ888963 GQ889142 GQ888826 Forest and Nannï 302 Polygala hispida Burch. and DC. South Africa (NBG) GQ888964 GQ889143 GQ888827 Polygala hookeri Torr. and A. Gray Mississippi JRA 13870 (FLAS) GQ888965 GQ889144 GQ888828 Polygala hottentotta C. Presl South Africa JRA 24133 (FLAS) GQ888966 GQ889145 GQ888829 Polygala hygrophila Kunth Mexico JRA 19716 (FLAS) GQ888967 GQ889146 GQ888830 Heringer et al. 6077 Polygala ilheotica Wawra Brazil (MO) GQ888968 GQ889147 GQ888831 Polygala illepida E. Mey. ex Harv. and Sond. South Africa Phillipson 269 (MO) GQ888969 GQ889148

251

Polygala incarnata L. Mexico JRA 19734 (FLAS) GQ888970 GQ889149 GQ888832 Polygala intermontana T. Wendt Utah JRA 14670 (FLAS) GQ888971 GQ889150 GQ888833 Polygala japonica Houtt. Taiwan Liao et al. 1297 (MO) GQ888972 GQ889151 de Nevers et al. 3179 Polygala kilimandjarica Chodat Tanzania (MO) GQ888973 GQ889152 Polygala klotzschii Chodat Brazil Silva 638 (MO) GQ888974 GQ889153 Polygala leptocaulis Torr. and A. Gray Cuba JRA 18851 (FLAS) GQ888975 GQ889154 GQ888834 Polygala leptostachys Shuttlew. Florida JRA 20513 (FLAS) GQ888976 GQ889155 GQ888835 Polygala lewtonii Small Florida JRA 14191 (FLAS) GQ888977 GQ889156 GQ888836 Harley et al. 20751 Polygala ligustroides A. St.-Hil. Brazil (K) GQ888978 GQ889157 GQ888837 Polygala lindheimeri A. Gray Texas JRA 19556 (FLAS) GQ888979 GQ889158 GQ888838 Windham 90-407 Polygala longa S.F. Blake Arizona (MO) GQ888980 GQ889159 Polygala longicaulis Kunth Belize JRA 19606 (FLAS) GQ888981 GQ889160 GQ888839 Polygala lutea L. Florida JRA 24570 (FLAS) GQ888982 GQ889161 GQ888840 Polygala macradenia A. Gray -- ITS data Mexico JRA 19498 (FLAS) GQ888983 Polygala macradenia A. Gray -- chloroplast data Mexico JRA 19546 (FLAS) GQ889162 GQ888841 Polygala mariana Mill. Louisiana JRA 14706 (FLAS) GQ888984 GQ889163 GQ888842 Leadlay and Petty 420 Polygala microphylla L. Spain (MO) GQ888985 GQ889164 Polygala monspeliaca L. Spain Gomez 15281 (MO) GQ888986 GQ889165 Polygala monticola Kunth Mexico JRA 19717 (FLAS) GQ888987 GQ889166 GQ888843

252

cultivated (seed from Polygala myrtifolia L. South Africa) JRA 14768 (FLAS) GQ888988 GQ889167 Polygala nana DC. Florida JRA 8942 (FLAS) GQ888989 GQ889168 GQ888844 Polygala nudata Brandegee Mexico JRA 19551 (FLAS) GQ888990 GQ889169 GQ888845 Polygala nuttallii Torr. and A. Gray North Carolina JRA 14373 (FLAS) GQ888991 GQ889170 GQ888846 Polygala cf. obovata A. St.-Hil. and Zardini and Aquino Moq. Paraguay 28464 (MO) GQ888992 GQ889171 Polygala obscura Benth. Texas JRA 14583 (FLAS) GQ888993 GQ889172 GQ888847 Krapovickas and Polygala oxyrhynchos Chodat Paraguay Cristobal 44902 (MO) GQ888994 GQ889173 Polygala paniculata L. Guatemala JRA 19614 (FLAS) GQ888995 GQ889174 GQ888848 Polygala paucifolia Willd. Kentucky JRA 25292 (FLAS) GQ888996 GQ889175 GQ888849 Polygala peduncularis Burch. ex DC. South Africa Liede 16975A (MO) GQ888997 GQ889176 Rwaburindone 3767 Polygala persicariifolia DC. Uganda (MO) GQ888998 GQ889177 Polygala pinifolia Poir. South Africa Goldblatt 7985 (MO) GQ888999 GQ889178 Plowman et al. 9438 Polygala planellasii Molinet Brazil (MO) GQ889000 GQ889179 Harling and Stahl Polygala platycarpa Benth. Ecuador 26396 (MO) GQ889001 GQ889180 Polygala polygama Walter Florida JRA 24378 (FLAS) GQ889002 GQ889181 GQ888850 Polygala purpusii Brandegee Mexico JRA 19689 (FLAS) GQ889003 GQ889182 GQ888851 Polygala ramosa Elliott Florida JRA 13640 (FLAS) GQ889004 GQ889183 GQ888852 Balkwill et al. 2378 Polygala refracta DC. South Africa (MO) GQ889005 GQ889184 Polygala rhinostigma Chodat South Africa Forest and Nannï 295 GQ889006 GQ889185

253

(NBG) Polygala rivinifolia Kunth Mexico Torres et al. 41 (MO) GQ889007 GQ889186 Polygala rugelii Shuttlew. ex Chapm. Florida JRA 22481 (FLAS) GQ889008 GQ889187 GQ888853 Wendt et al. 987 Polygala rusbyi Greene Arizona (TEX) GQ889009 GQ889188 GQ888854 Hatschbach 49863 Polygala salicina Chodat Brazil (MO) GQ889010 GQ889189 Galapagos Polygala sancti-georgii L. Riley Islands Adsersen 1897 (C) GQ889011 GQ889190 GQ888855 Polygala sanguinea L. Kentucky JRA 13655 (FLAS) GQ889012 GQ889191 GQ888856 Polygala scoparia Kunth Mexico JRA 19548 (FLAS) GQ889013 GQ889192 GQ888857 Polygala scoparioides Chodat Texas JRA 14575 (FLAS) GQ889014 GQ889193 GQ888858 Polygala securidaca Chodat Honduras Hernandez 5256 (MO) GQ889015 GQ889194 Polygala senega L. Canada Naczi 9785 (FLAS) GQ889016 GQ889195 GQ888859 Germishuizen 5139 Polygala senensis Klotzsch South Africa (MO) GQ889017 GQ889196 Polygala sericea A.W. Bennett Brazil Harley 26663 (MO) GQ889018 GQ889197 Polygala setacea Michx. Florida JRA 13520 (FLAS) GQ889019 GQ889198 GQ888860 Polygala sibirica L. China Ho et al. 2764 (MO) GQ889020 GQ889199 Polygala smallii R.R. Sm. and D.B. Ward Florida not vouchered GQ889021 GQ889200 GQ888861 Solomon and Kuijt Polygala spectabilis DC. Bolivia 11596 (MO) GQ889022 GQ889201 Polygala sphaerospora Chodat Guatemala JRA 19752 (FLAS) GQ889023 GQ889202 GQ888862 Polygala squamifolia Griseb. Cuba JRA 18847 (FLAS) GQ889024 GQ889203 GQ888863 Polygala subalata S. Watson Mexico JRA 19511 (FLAS) GQ889025 GQ889204 GQ888864

254

Polygala subandina Phil. Chile Zöllner 15148 (MO) GQ889026 GQ889205 Polygala subspinosa S. Watson Utah JRA 14667 (FLAS) GQ889027 GQ889206 GQ888865 Polygala tamariscea Mart. ex A.W. Benn. Brazil Pereira 287 (MO) GQ889028 GQ889207 1980 Sino-Amer. Polygala tatarinowii Regel China Exped. 1688 (MO) GQ889029 GQ889208 Irwin et al. 10233 Polygala tenuis DC. Brazil (MO) GQ889030 GQ889209 GQ888866 Polygala teretifolia L.f. South Africa Forest 200 (K) GQ889031 GQ889210 Republic of Polygala transcaucasica Tamamsch. Georgia Antonelli 348 (GB) GQ889032 GQ889211 Polygala trichosperma L. Brazil Harley 15604 (MO) GQ889033 GQ889212 Polygala tuberculata Chodat Brazil Harley 16046 (MO) GQ889034 GQ889213 Polygala umbellata L. South Africa Vlok et al. 26 (MO) GQ889035 GQ889214 cultivated (seed from Polygala uncinata E. Mey. ex Meissn. South Africa) JRA 19062 (FLAS) GQ889036 GQ889215 GQ888867 Polygala variabilis Kunth Belize JRA 19609 (FLAS) GQ889037 GQ889216 GQ888868 Polygala venulosa Sibth. and Sm. Greece Antonelli 362 (GB) GQ889038 GQ889217 Polygala verticillata L. North Carolina JRA 14378 (FLAS) GQ889039 GQ889218 GQ888869 D'Arcy and D'Arcy Polygala violacea Aubl. Panama 6036 (MO) GQ889040 GQ889219 cultivated (seed from Polygala virgata Thunb. South Africa) JRA 18628 (FLAS) GQ889041 GQ889220 Wallnöfer 13828 Polygala vulgaris L. Austria (FLAS) GQ889042 GQ889221 GQ888870 Polygala vulgaris L. ssp. oxyptera Austria Wallnöfer 13840 GQ889043 GQ889222 GQ888871

255

Lange (FLAS) Polygala wurdackiana W.H. Lewis Panama Blanco 2846 (FLAS) GQ889044 GQ889223 GQ888872 Bidgood et al. 3350 Polygala xanthina Chodat Tanzania (MO) GQ889045 GQ889224 Salomonia cantoniensis Lour. China Zhanuo 91-450 (MO) GQ889046 GQ889225 Callejas et al. 2159 Securidaca diversifolia (L.) S.F. Blake Columbia (MO) GQ889047 GQ889226 Securidaca elliptica Turcz. Cuba JRA 19008 (FLAS) GQ889048 GQ889227 GQ888873 cultivated (seed from Securidaca longepedunculata Fresen. South Africa) no voucher GQ889049 GQ889228 GQ888874 Securidaca ovalifolia A. St.-Hil. and Zardini and Ortez Moq. Paraguay 3137 (MO) GQ889050 GQ889229 Gentry and Zardini Securidaca retusa Benth. French Guiana 50334 (MO) GQ889051 GQ889230 Securidaca rivinifolia A. St.-Hil. Peru Solomon 3481 (MO) GQ889052 GQ889231 Dominican Securidaca virgata Sw. Republic JRA 20961 (FLAS) GQ889053 GQ889232 GQ888875 Malaysia Gentry and Tagi Xanthophyllum hypoleucum Merr. (Sarawak) 34065 (MO) GQ889054 GQ889233 Chan RC 195 (KEP, Xanthophyllum wrayi King Malaysia FLAS) GQ889055 GQ889234 GQ888876

256

APPENDIX B DISCUSSION OF SPECIES CONCEPTS AND DELIMITATION ISSUES

Since species are the basic taxonomic unit used in my phylogenetic analyses

and are the basic units within genera, and since species-level nomenclatural

combinations are being made here, a brief discussion of species concepts seems in

order. In attempting to discuss the species of Polygalaceae in North America, the

fundamental problem is ‘what is a species?’ Species concepts are discussed in depth

elsewhere, e.g., Mishler and Theirot, 2000; Wheeler and Platnick, 2000; Wiens and

Servedio, 2000; Helbig et al., 2002; Lee, 2003; De Queiroz, 2007, so only a brief overview is provided here. Two of the main issues for species recognition, shared

across most species concepts, even though they are often not directly addressed, are

the concept of species as diagnosable entities, and the appreciation that species are likely to retain genetic and phenotypic integrity in the future (Hellbig et al., 2002).

Related issues for separating species involve looking for intrinsic isolating mechanisms, geographical isolation, and ecological differentiation. Insisting that a species should be

seen as a lineage or a series of populations, rather than as a taxonomic category (e.g.,

Rapini, 2004), is a distinction that emphasizes the biological reality of speciation actually occurring at the level of populations. Thus, species are often discussed as if they were populations or processes. I do believe that, if well-delineated, they represent evolutionary lineages. Generally, any assumptions about gene flow and/or environmental selection are untested, so that talk of species along these lines is actually misleading, as people are confusing species with populations. Also, as a named group of organisms, species are a logical construct, but they should not be confused with the names that represent them, nor the organisms included in their intention (Rapini, 2004).

257

Even if slightly misleading from a process-based perspective, all species concepts, at least implicitly, share the idea that species are segments of metapopulation lineages, evolving independently from other such lineages, whether from reproductive isolation or ecological niche differentiation (De Queiroz, 2007), i.e., species are a taxonomic rank but they reflect groups of populations, even if the diagnostic details sometimes make for fuzzy defining lines ecologically, morphologically, or evolutionarily.

In Polygalaceae, there are several species complexes in North America and adjacent

Mexico with documented populational morphological variants that either have been or, perhaps, should be treated as distinct species. Truthfully, our knowledge is almost always incomplete, with the reality being that we typically just assume an underlying reproductive isolating mechanism in the presence of morphological or genetic differences. Species are seen as clusters of varying distinctiveness, with the lines between them subjective. Of course, the above discussion somewhat blurs the lines between biological, phylogenetic, and phenetic approaches to species, which is exactly the point here, i.e., a focus on what various approaches to the species problem have in common. Most species concepts will result in congruent groupings most of the time, and many workers do not even clearly state a particular species concept, even when describing a new species. Convenience is a necessary ingredient for drawing these subjective lines, but workers should not let convenience and practicality (based on arbitrary standards) become more important than reflecting phylogenetic relationships supported by data analysis (e.g., Clayton, 1983). But what is to be done if DNA analysis is not congruent with interpretations of morphological variation and subsequent study of

258

morphology does not yield insight? Or if attempting to sort out phylogenetic

relationships reveals unresolved species issues?

One of the problems with the application of species concepts, as pointed out by

Lee (2003), whether based on similarity, cohesion, monophyly, or interbreeding, is that

inferences are typically based on interpretation of character distribution, often with

incomplete data and with no direct or full test of the species concept, so that mentioning

a species concept is hardly a guarantee that it truly fits all taxa under study. Wiens and

Servedio (2000) pointed out that the basic methodology for most taxonomic workers is

to compare character distributions between geographical samples (for botanists, largely

based on herbarium material) and then to determine which sets of populations are

delimited by seemingly fixed diagnostic differences that may indicate an absence of

gene flow, i.e., processes and speciation issues are presumed, based on morphological

patterns. A problem with this approach is that many populations are represented only by

a single herbarium collection, so a character may appear fixed while fuller sampling

might show it to be polymorphic. Ideally, of course, knowledge gained by field work

shapes how workers interpret patterns of variation. Even if a population has an

apparently fixed character, that does not mean that it is worthy of recognition as a

species, despite a traditional focus on naming anything that was diagnosably different.

This could be especially problematic with species-based phylogenetic analyses using molecular DNA data; some species may be indistinguishable from each other, while others may have a moderate amount of infra- and inter-specific variation in the DNA region(s) being used. There are no fixed guidelines, nor should there be, on how much variation is tolerable within a species. But, what is to be done if two or more samples of

259

an apparently morphologically cohesive species do not form a clade (and errors are ruled out)? Even if two populations do appear to be subtly different morphologically and there is a correlated genetic difference, at what point could or should they be treated as distinct lineages?

As scientists, we accept populational variation and polymorphic features as a theoretical norm and a requisite for natural selection, but it is also common, especially traditionally, to name morphological variants, even if other workers, perhaps operating under a different paradigm, conclude that they are conspecific or not worth recognizing

at any taxonomic rank. The desire to name recognizable entities is understandable, but,

sometimes, distinctive polymorphic forms or variants should just be named informally,

with formal nomenclatural ranks being reserved for discrete evolutionary lineages.

Modern genetic analyses also have shown it to be fairly common for two or more cryptic lineages to be ‘hiding’ within a traditional, morphologically defined species. In a way, it is a matter of scale -- how finely should formal names reflect variation? If molecular data demonstrate the existence of separate lineages that are not morphologically distinctive, should they be nomenclaturally recognized or just discussed as informal taxa? Cryptic species vs. incipient speciation or infraspecific polymorphism can be very difficult to sort out. In the absence of detailed populational studies, it is up to each specialist to come up with their own answers. Yet modern researchers routinely work with species without being specialists in the group or without addressing species delimitation issues, and the rest of us routinely go along with these hypotheses. There are several species complexes in North American Polygalaceae that need to be carefully revised

260

(addressed below), but it is my belief that any changes in species delimitation will not fundamentally change any of the generic clades proposed here.

List of Unresolved, Potentially Problematic Species Complexes in North America

1) The entire Microthrix subgroup of Hebecarpa is in need of revision. Polygala barbeyana Chodat, P. longa S.F. Blake, P. obscura Benth., P. orthotricha S.F. Blake, P. piliophora S.F. Blake, P. racemosa S.F. Blake, P. rectipilis S.F. Blake, and P. reducta

S.F. Blake are particularly problematic and may not all represent entities worthy of recognition as species. Nonetheless, for now they seem distinct and should be transferred to Hebecarpa to make them nomenclaturally available for the Flora North

America treatment. Tom Wendt (unpublished Chihuahuan Desert flora) lumps P. orthotricha into P. obscura, and he lumps P. longa, P. racemosa, and P. reducta into P. barbeyana, although all six of these species are maintained as distinct in the flora of

Arizona treatment (Kearney and Peebles, 1951), which also recognizes P. piliophora.

Wendt maintains P. rectipilis as distinct (although pointing out that at least the northern populations in NM intergrade with P. barbeyana) and makes no mention of the extra- limital P. piliophora. In the Texas flora (Correll and Johnston, 1979), P. longa and P. obscura are recognized, with all other species in this complex being extra-limital, although the suggestion is made that P. racemosa and P. reducta are probably conspecific with P. longa. DNA of P. longa suggests that it is distinct from P. barbeyana, casting doubt on the idea of combining the taxa. While all of these have been morphologically defended in the past, S.F. Blake, who described most of them, was notorious for basing names on one or a few samples, and, sometimes, he described new species for which he admitted he had seen no material whatsoever! My limited study of herbarium material suggests that some of these are distinct, but they may just

261

be populational morphs best included within the polymorphic variation of other taxa.

Even genetic variation does not mean they should be distinct species. In the absence of

monographic work, species limits will remain in doubt. How should such problems dealt

with in floristic treatments, such as FNA?

2) The Polygala boykinii Nutt. complex includes the southern Florida, P. flagellaris

Small, which reportedly has a different chromosome number than other populations of

P. boykinii. While it is rather different morphologically from north Florida P. boykinii, it

intergrades with Caribbean forms (many of which also carry their own names, perhaps

erroneously). Given that Polygala is known to have several karyologically variable taxa

(i.e., with polyploid and aneuploid series), quite possibly with gene flow across some of

the ploidy levels, species limits cannot be determined without careful work involving

population genetic and phylogenetic methods. My plan is to treat this complex broadly,

since I’ve seen several of these entities, and I think much of this variation could just be

a classic case of populational polymorphism, confounded by variation in ploidy level.

3) The Polygala grandiflora Walter complex is a huge mess -- morphologically, it’s easy to see how this may be a single polymorphic complex from Brazil to the U.S., especially as variation within species may be greater than that between some species!

However, based on my unpublished sequence data, the P. grandiflora complex seems

to be a distinct lineage from P. violacea Aubl., into which it is currently subsumed by

many workers. I don’t think the named variants (and segregated species) have any

biological meaning in Florida, but some of the names have been applied widely to

entities in the Caribbean and all the way down to Ecuador, some of which might be

recognizable (even if erroneously synonymized with Florida material). Brazilian workers

262

are maintaining some species as distinct that, based on my preliminary phylogenetic

analyses are more closely related to P. grandiflora than P. grandiflora is to P. violacea.

This would seem to indicate that the latter two should not be synonymized. To resolve

these problems will require a detailed populational study across 20 or so countries, and

is obviously beyond the scope of any floristic treatment.

4) Polygala mariana Mill. currently includes P. harperi Small (sympatric from

Georgia to Louisiana, suggesting the morphological feature of wings clawed and much

longer than capsule at maturity is polymorphic, rather than useful in delimiting a discrete

geographical variant). However, DNA material of P. mariana from eastern Louisiana

was different from P. harperi from northeastern Florida. I don’t have a baseline for how much variation is normal within a species of this group of Polygala, so I’m not sure if the genetic variation means anything more than standard polymorphism. However, it is possible that these accessions represent two cryptic species. The complex needs to be carefully studied.

5) The Polygala verticillata L. complex includes up to five named varieties, one or

two of which may be consistently diagnosable, including what I recognize as P. ambigua

Nutt., as it is morphologically and genetically distinct despite sharing most of its range

with P. verticillata. The other named variants also occur over most of the range of the

species (but there do not appear to be any meaningful geographical patterns), making

me think that they’re probably just morphological extremes scattered throughout the

range, and as such do not merit nomenclatural recognition.

263

Discussion of Historical Infrageneric Classification of Polygala, in Part Provided as a Guide for Taxon Selection for Future Phylogenetic Analyses

If you are a taxonomist looking for clear and well supported conclusions, do not read this discussion! What is presented here is an overview of historical classification

within Polygala and then a brief discussion of how existing phylogenetic analyses are

too premature, primarily from inadequate taxon sampling, to fully address the

applicability of these names to particular clades. Previous workers were not always

clear about the rank of names, nor was there clarity or consistency about

circumscription of the groups intended by their names. Ultimately, much more

phylogenetic and nomenclatural work is needed before these names can be applied

with certainty. So, rather than engaging in pointless, premature nomenclatural

discussion, I use some of the existing names informally (i.e., without implicit rank, with

unclear circumscription, merely to avoid getting bogged down in the nomenclatural

implications of differential name usage) because there is value to discussing what is

known in order to clearly define issues to be resolved by future work. In referring to my

own analyses, I discuss first the North American groups, then other New World groups,

then African groups, followed by Australasian groups. I then provide a very brief

synopsis of morphology and karyology across some of the named infrageneric clades.

Detailed morphological studies have not yet been conducted, nor can I speak with

certainty about all of the clades within Polygaleae, especially Polygala s. str. (as here

circumscribed).

Infrageneric classification of Polygala, prior to this dissertation, was dated and problematic, with no comprehensive phylogeny-based system that adequately samples

taxa on a world-wide basis. Now that most of the distinctive, traditional subgroups have

264

been shown not to be part of Polygala, we are still left with a problematic understanding

of the infrageneric classification of Polygala s.str. Cladistic analyses to-date (including those presented in Chapter 3) have focused primarily on the groups proposed as segregate genera, i.e., sorting out the sections and subgenera of traditional

classification systems. Prior to this dissertation, the last global attempt to address in

detail groupings within Polygala s.str. was made by Chodat (1896), with more

information provided in his earlier treatments (1891a and b, 1893). Within his sect.

Polygala, Chodat recognized 14 subsections: subsect. Apterocarpae (including the vast

majority of New World modern Polygala s.str., with a few African species putatively

forming a subclade), subsect. Hemipterocarpae (New World), and the remaining 12

subsections informally coalesced into the unranked Pterocarpae group (a “super-

subsection”?), subsect. Brasiliensis (South America), subsect. Australes (South

America), subsect. Rupestres (Europe and North Africa), subsect. Buxiformes (Asia),

subsect. Migratores (Africa, Asia, E Europe), subsect. Forficatae (Asia, Australia),

subsect. Leptaleae (Asia), subsect. Deltoideae (Africa, Asia, Australia), subsect.

Virgatae (South Africa), subsect. Formosae (South Africa), subsect. Macropterae

(Madagascar), and subsect. Vulgares (Asia, Europe, North Africa), which includes the

type species and is, thus, nomenclaturally equivalent to subsect. Polygala. Within

subsect. Apterocarpae, he recognized 11 unranked subgroups (presumably, but not

directly called, series): Decurrentes, Ericoideae, Galioideae, Glochidiatae, Incarnatae,

Linoideae, Nudicaules, Senegae, Tenues, Timoutoideae, and Trichospermae. Within

subsect. Migratores, he recognized six series: ser. Arenariae, ser. Asiaticae, ser.

Eriopterae, ser. Persicariaefoliae, ser. Sphenopterae, and ser. Tinctoriae. Within

265

subsect. Deltoideae, he recognized three series: ser. Chloropterae, ser. Chromopterae,

and ser. Tetrasepalae. Within subsect. Vulgares, he recognized two series: ser.

Papilionaceae and ser. Vulgares [the latter, again, corresponding to ser. Polygala].

Taxon sampling to-date, including my study, has been inadequate to address the

monophyly of all these groups, but preliminary work does suggest that they are not all

monophyletic, at least not as traditionally circumscribed.

Blake (1916), elevating Chodat’s sect. Polygala to subgen. Polygala in his treatment of Polygala in Mexico, Central America, and the West Indies, recognized two sections, sect. Monninopsis and sect. Timutua, further delimiting six series within sect.

Timutua: ser. Galioideae, ser. Glochidiatae, ser. Incarnatae, ser. Tenues, ser.

Timoutoideae, and ser. Trichospermae. Section Monninopsis corresponds to Chodat’s

sect. Hemipterocarpae, although there is no mention of the extra-limital taxa Chodat

had included. The series all correspond to Chodat’s groups, although Blake opined that

ser. Incarnatae should be restricted to P. incarnata and P. setacea and that the other

species included by Chodat should be treated as a different series, an opinion

supported by my analyses (Fig. 3-11). In his treatment of North American Polygalaceae,

Blake (1924) did not clearly state whether or not the subgroups he recognized

corresponded to his (or Chodat’s) subgenera or (sub)sections, nor did he delimit any

series groups; so the most comprehensive treatment of North American taxa did not

explicitly provide ranked names for any subgroups of Polygala s.str.

Previous floristic treatments of Polygala for the North American flora, both

predating Blake’s (1924) treatment, did not recognize any subgroups at all (Torrey and

Gray, 1838) or did not recognize subgroups within Polygala s.str. (Robinson, 1897).

266

There have been numerous regional or state-level floristic treatments within North

America, some of which have proposed subgroupings, e.g., Small (1933), in which the

Decurrentes group was segregated as the genus Pilostaxis, P. incarnata as the genus

Galypola, P. senega as the Senegae group (here and with the following names, exact rank was not specified, and the “-ae” ending has been used for subgenera, sections, subsections, and series, so the word “group” is used to indicate a lack of precise rank), the P. polygama complex as the Polygamae group, P. leptocaulis as the Leptocaules group, P. setacea as the Setaceae group, six taxa as the Marianae, four taxa as the

Cruciatae, and seven taxa as the Boykinianae, with none of these names overtly cross- referenced to groups recognized by others. By tracking the type species of each group, one could cross-reference the names, but circumscribing the groups would still be rather subjective. There is simply no modern, comprehensive guide to the various subgroups of North American Polygala s.str., so attempting to map names onto a cladogram is premature, especially since it has been shown that the North American species of Polygala are scattered across several subclades and greater taxon sampling is needed before we can decisively apply names to clades.

It seems clear from my analyses (Figs. 3-6 and 3-11, Appendix 3) that the closest relatives to most North American Polygala s.str. are other New World taxa. A partial taxonomic synthesis of New World species of Polygala was provided by Bernardi

(2000), who deviated from previous treatments, creating some of his own new subgenera and series. Neither of his new subgeneric groups, subgen. Ecristatae and subgen. Procerae, have been supported as clades in any phylogenetic analyses, while the third corresponds to Polygala s.str. Bernardi recognized seven series within his

267

subgen. Polygala: ser. Asperuloides, ser. Caudatae, ser. Clinclinia, ser. Cneorum, ser.

Pulchellae, ser. Tenellae, and ser. Tenues. Some of these names may ultimately be

shown to be applicable to clades, at least in part, with fuller sampling of South American

taxa, but my preliminary analyses indicate that some of them are not monophyletic,

especially given Bernardi’s novel delimitations, e.g., his series Pulchellae, based on P.

paniculata, includes some species from the series Densifoliae, Linoideae, Tenues, and

Timoutoideae of Marques (1989), such as P. brasiliensis which was shown by my analyses not to be a member of the same clade as P. paniculata. Bernardi (2000) also took a novel approach to delimiting many of the species recognized by him, somewhat undermining the value of an otherwise beautiful body of work in terms of composition, descriptions, and information content. Generally, the biggest problem is that many

distinctive entities are lumped by Bernardi (2000) into widespread, polymorphic species.

Given the arbitrariness of species delimitation, it is possible that some of his lumping decisions may ultimately be shown to be the best way to handle some of the complexes. As it is, Bernardi’s work is at best a broad-scale map that somewhat obfuscates infrageneric relationships and detailed species-level relationships, especially since his lumping is not the result of detailed monographic work or field-based populational studies.

Marques (1989) delimited the Brazilian species of sect. Polygala into ten series:

ser. Sedoideae (monotypic, untested in any phylogenetic analysis), ser. Ericoideae

(untested in my analyses; my P. cf. obovata is likely a misidentification), ser.

Trichospermae (supported as monophyletic, Fig. 3-11), ser. Galioideae (supported as monophyletic, Fig. 3-11, but exact circumscription needs clarification), ser. Australes

268

(our analyses have only P. cyparissias, which appears to be an isolated lineage, Fig. 3-

11), ser. Timoutoideae (P. celosioides and P. hygrophila do not form a clade in my

analyses, Fig. 3-11), ser. Linoideae (P. brasiliensis and P. duarteana do not form a

clade in my analyses, Fig. 3-11), ser. Tenues (P. paniculata, P. tamariscea, P. leptocaulis, and P. tenuis are not well-supported as a clade and can only be seen as a clade in my analyses if the next two series are included, Fig. 3-11), ser. Glochidiatae (P. glochidiata and P. oxyrhnchos [= Polygala minima Pohl ex A.W. Benn. var. oxyrhynchos

(Chodat) M.C.M. Marques] form a clade that may be nested within the Tenues s.l. group, Fig. 3-11), and ser. Densifoliae (P. sericea and P. tuberculata form a weakly supported clade that may also be nested within the Tenues s.l. group, Fig. 3-11). Thus, of the ten infrageneric names applied to Brazilian taxa, four are preliminarily supported as monophyletic, three are preliminarily supported as non-monophyletic, and three have not been included in phylogenetic analyses (or have had inadequate taxon sampling to address monophyly). Attempting to discuss all other infrageneric names proposed by other workers would be premature and rather pointless, as taxon sampling is simply inadequate.

Core components of many of the above-mentioned groups delimited by Chodat

(1893, 1896), Blake (1916, 1914), Small (1933), Marques (1989), or Bernardi (2000) are

supported as monophyletic in phylogenetic analyses, but most of the groups that have

been tested are not monophyletic as traditionally circumscribed. For example, subsect.

Hemipterocarpae, here referred to as the Monninopsis group, was described by Chodat

(1893) to include taxa from SW North America and Mexico that form a clade in my analyses (Fig. 3-11) and also taxa from Brazil, Paraguay, and Uruguay, including P.

269

duarteana, which was shown by my analyses not to be part of the Monninopsis clade.

Polygala duarteana was strongly supported as sister to the North American P. senega,

which was treated by Chodat as part of ser. Senegae, in which he also included the

North American P. polygama complex, shown by my analyses not to be closely related to the Monninopsis group or the Senegae group. Nonetheless, most of Chodat’s subsect. Hemipterocarpae does correspond to a very well-supported clade, and the

Senegae group also forms a clade (Fig. 3-11). Many of the named groups will likely not be maintained. For instance, the Tenues group (P. leptocaulis, P. paniculata, P. tamariscea, P. tenuis), if recognized as a clade (Fig. 3-11), would need to include members of the Glochidiatae group (P. glochidiata, P. oxyrhynchos) and the

Tuberculatae group (P. sericea and P. tuberculata). Thus, for now, I use a few of these names informally (see Fig. 3-11), without authors and without implications of rank or

included taxa, with the realization that much more work is needed, building on the framework I provide, before infrageneric classification of Polygala s.str. can be nomenclaturally formalized. As suggested by my analyses, sorting out the relationships between the subgroups of Polygala s.str. in North America needs to take place with an even greater and world-wide sampling of species. It is clear that homoplasy in the morphological features used to delimit the groups led to some taxa not being classified with their closest relatives, and no cladistic analyses have included sufficient numbers of taxa to adequately address all of the existing named groups. This is equally true for

Old World taxa, as briefly discussed below.

For the African taxa of Polygala s.l., a recent, comprehensive classification

system has been proposed, which can be used to assess my preliminary phylogenetic

270

results. Paiva (1998) classified the 203 African species of Polygala subgen. Polygala

(part of my Polygala s.str.) into 11 sections and 14 subsections. My analyses include

four (of the 11) sections and nine (of the 14) subsections, several represented by only a

single species. My analyses do not include any of the African species of Chamaebuxus or Heterosamara, the former treated as a subgenus by Paiva, the latter as a genus. The

22 African species of Polygala s.str. in my analyses are all part of the Old World

Polygala clade and fall into three main subgroups. Although the exact relationship between the subgroups is not resolved, it is clear that there are at least two separate lineages of Polygala s.str. that occur natively in Africa. Polygala sect. Polygala subsect.

Glumaceae McNeil, represented in Africa (and here) by the widespread P. monspeliaca, is sister to subsect. Polygala (the primarily European group that includes the type species, Fig. 3-11), thus it is not directly related to other African species. My analyses include ten taxa (eight species and two distinctive subspecies that do not associate with the nominant subspecies in all analyses) of sect. Polygala subsect. Polygala, which includes an additional five African species untested by us. Section Timutua DC., primarily a New World group, has ten African species, including the naturalized, neotropical P. paniculata. The other nine species of sect. Timutua are phylogenetically untested, but it is likely that they represent an African subclade within the otherwise neotropical Tenues s.l. group (Fig. 3-11).

The phylogenetic hypotheses supported by my analyses of the remaining 21

African species sampled by me (of the 187 remaining species recognized by Paiva,

1998) do not contradict the possibility that they could actually be each other’s closest relatives, as they fell into two poorly supported groups of unresolved relationship (Fig. 3-

271

11): 1) sect. Chloropterae (P. illepida) [sect. Tetrasepalae subsect. Tetrasepalae (P. uncinata) + sect. Tetr. subsect. Ecristatae (P. xanthina)], and 2) sect. Blepharidium subsect. Tinctoriae (P. kilamandjarica and P. senensis) + [sect. Bleph. subsect.

Blepharidium (P. erioptera) + sect. Bleph. subsect. Arenariae (P. persicariifolia)]] +

[sect. Megatropis subsect. Psychanthus [[sect. Mega. subsect. Megatropis + sect.

Mega. subsect. Heterolophus (P. hottentota)] + [sect. Bleph. subsect. Sativae (P. hispida and P. rhinostigma)]] (Fig. 3-11). Section Megatropis subsect. Psychanthus includes P. bracteolata, P. fruticosa, P. garcinii, P. myrtifolia, P. peduncularis, P. pinifolia [= P. myrtifolia L. var. pinifolia (Lam. ex Poir.) Paiva], P. refracta, P. teretifolia, and P. umbellata. Polygala virgata, although nested within subsect. Psychanthus in my analyses, is classified by Paiva (1998) as belonging to subsect. Megatropis. Polygala ephedroides is also classified by Paiva (1998) as sect. Megatropis subsect. Megatropis, but it does not form a clade with P. virgata. None of the topologies suggesting a lack of monophyly for sect. Blepharidium and sect. Megatropis are well-supported (Fig. 3-11).

Additional taxon sampling is needed to robustly test the monophyly of all the groups named by Paiva (1998) related to the infrageneric classification of African Polygala s.str.

Asian and Australian taxa are very poorly represented in my analyses (Fig. 3-11).

Of course, all geographical lines are somewhat arbitrary and there are a few widespread taxa shared between two or more of the major regions of Africa, Asia,

Australia, and Europe, e.g., P. persicariifolia. Some of the untested Asian taxa are classified as part of segregate genera such as Chamaebuxus or Heterosamara, but many species are clearly part of Polygala s.str. Of the taxa included in my analyses,

Polygala japonica was included in Chodat’s subsect. Forficatae and P. sibirica was

272

included in ser. Asiaticae of subsect. Migratores. The fact that P. persicariifolia, treated

by Chodat (1896) as part of ser. Persicariifoliae of subsect. Migratores, was not

supported as sister to P. sibirica suggests that subsect. Migratores is not monophyletic.

Paiva (1998) transferred P. persicariifolia to his subsect. Arenariae (partially equivalent to Chodat’s ser. Arenariae of subsect. Migratores) of sect. Blepharidium, illustrating the traditional problem of differing opinions about which morphological features to stress for group delimitation. When the named groups are not based on phylogeny, the stressed features are not known to be synapomorphies, and, in fact, the group descriptions are vague, strongly overlapping with other group descriptions, or not clear in comparison with the features of other groups, it can be very difficult to sort out morphology based on existing literature. Especially when workers use the same names, but with different circumscriptions, it can be very difficult to ascertain which features are actually constant, noteworthy, or diagnostic. For example, Chodat (1893) described ser. Arenariae as: racemes densely-flowered, capitate, often with surrounding leaves; wings more ovate than elliptic, obtuse, often pilose, and he described ser. Persicariifoliae as: racemes for the most part terminal, not densely-flowered; wings elliptic, obtuse, glabrescent or ciliate. Paiva (1998) lumped both series together, citing Chodat’s ser. Arenariae as the basionym for his subsect. Arenariae, which he described as: annual herbs, di- or trichotomously branched; flowers in more or less compact terminal and axillary racemes; external sepals keeled; wings obliquely elliptic, concolorous. Ultimately, better global sampling is needed before we can assess the monophyly of these groups in order to develop a robust nomenclature based on a phylogenetic understanding of morphological patterns of variation.

273

Morphological features traditionally used to separate the groups (whether treated

as subgenera or as sections within “Polygala” s.l.) can now be understood as either

putative synapomorphies or retained ancestral features for the clades supported by

molecular data, yet a full assessment is beyond the scope of this dissertation. Most

north temperate botanists are familiar with Polygala (whether traditional s.l. or modern s.str.) as herbs with a crested keel, yet herbaceousness and having a crested keel are actually derived specializations within the subfamily, and many species of traditional

“Polygala” s.l. are woody and lack a crested keel. Woodiness and the lack of a crested keel are basal conditions in the family and in tribe Polygaleae, with several reductions to herbaceousness and, possibly, even some reversals back to woodiness, e.g., many basal species of Monnina are herbs (including annuals) while the more derived members of the genus are shrubs. Many species, in many different groups, of traditional

“Polygala” s.l. are clearly woody, while others are suffrutescent or have thick subterranean perennating lignified structures, illustrating the continuum of variation between woody and herbaceous habits, with many species blurring the line as subshrubs or suffrutescent herbs. Many of the segregate genera are characterized by having some woody or suffrutescent species, e.g., Acanthocladus, Badiera, and

Phlebotaenia are entirely woody, while Chamaebuxus, Hebecarpa, Hebeclada,

Heterosamara, and Rhinotropis all have some species that are clearly suffrutescent subshrubs or even shrubs to small trees. Most species of Polygala s.str. are herbs, but many are perennials with lignified bases, some are low subshrubs, and several species are clear shrubs, especially in Africa. Until we have fully resolved the monophyly of

Polygala s.str. and determined the relationships between all of the generic clades, the

274

exact level of universality for any morphological feature cannot be addressed, so this

discussion of woodiness and crested keel is of necessity preliminary. Of the segregate

genera, Acanthocladus, Badiera, Hebecarpa, Hebeclada, Polygala subgen. Ligustrina,

and Phlebotaenia have no crest or beak on their keel. Heterosamara has a bilobed crest

(lacking in H. tatarinowii), a feature shared with the genus Muraltia (sometimes fimbriate). Rhinotropis has a conical beak on the non-crested keel (sometimes contorted to reduced, lacking in two species). Chamaebuxus and Polygala s.str. have a crested keel, usually multi-lobed to fimbriate (lacking in a few species). Among the other, traditionally-recognized genera, Comesperma and Securidaca keels are sometimes appendaged. Thus, having a crested keel is a feature restricted to the Polygaleae 2 group, but whether it has been lost or modified several times or has evolved independently several times is unknown because the exact phylogeny is not yet well understood.

The Polygaleae are typically characterized by the presence of a falsely papilionoid flower (two petals forming a ‘standard,’ one conduplicate petal forming a

‘keel,’ and two petaloid lateral sepals forming ‘wings’), a bicarpellate, bilocular ovary

(sometimes pseudomonomerous), and, often, bifurcated styles. But even in these

features there are exceptions, e.g., species of Hebeclada and Rhinotropis typically have

five petals, with the two lateral ones reduced and rather inconspicuous. Having five

petals is likely a derived reversal (basal members of the family, i.e., non-Polygaleae, are

five merous), since the reduction to three petals is a putative synapomorphy for the

Polygaleae. Most of the traditionally-recognized genera were segregated based on

distinctive fruits. Some of the specific features known to be useful for separating various

275

subgroups of traditional Polygala s.l. include (with the caveat that the level of

universality is unknown for most of these characters because the phylogeny is not yet

robustly known and because, in many cases, the character states have not been

studied across all clades): 1) intrastaminal disc, which may be a synapomorphy uniting

Chamaebuxus and Polygala subgen. Chodatia with Heterosamara, as well as

Hebeclada with Polygala subgen. Ligustrina, and, perhaps, Rhinotropis with Monnina

and Securidaca, but its presence in Xanthophyllum could indicate that it is a

plesiomorphic feature, the loss of which could be synapomorphic for other groups; 2)

variability in stamen number may be restricted to a few groups, plus the anthers are

bilocular in most Polygala (a synapomorphy? variability across all Polygala s.str. not

known), but 4-locular in Xanthophyllum, Monnina, Securidaca and 3-4-locular in at least

some species of Chamaebuxus, Polygala subgen. Chodatia, Heterosamara,

Rhinotropis; 3) style and stigmatic lobe differences are often stressed (see Chodat,

1893), e.g., Holm (1929) noted that P. senega (an isolated lineage within Polygala s.str.) and P. paucifolia (Chamaebuxus) are very distinct from the few other North

American taxa included in his study (all Polygala s.str., i.e., Hebecarpa, Hebeclada, and

Rhinotropis groups not included) and Marques and Peixoto (2007) suggested that subgen. Ligustrina has a distinctive, diagnostic style terminated by a pre-stigmatic funnel-shaped cavity with hairs along the edges (but the variation within this feature has simply not been studied across most species of Polygaleae); 4) pollen was shown to be diagnostic for various groups within Polygalaceae (Paiva, 1998; Banks et al., 2008), including Heterosamara and Polygala subgen. Ligustrina; and 5) many other floral, fruit, seed, and aril features also have been reported in the literature as diagnostic for various

276

groups (e.g., Chodat, 1893, 1896; Blake, 1916, 1924; Marques, 1989; Paiva, 1998;

Bernardi, 2000). In addition, a few vegetative features have been reported, including a)

leaf texture, e.g., Paiva (1998) separates subcoriaceous leaves (Chamaebuxus) from

papery or membranaceous leaves (Polygala s.str.); b) phyllotaxy, e.g., whorled leaves

are used to diagnose some subgroups of Polygala s.str. (e.g., the Galioideae group)

and several species of Acanthocladus have opposite leaves; c) bract persistence is used to separate some subgroups of Polygala s.str.; d) secretory cavities (“glands”) in the leaves is diagnostic for the Adenophora subgroup of Hebecarpa; e) nodal glands are present in many genera of Polygalaceae, including some clades traditionally included in Polygala s.l. such as the Ligustrina group that usually has cylindrical glands at the base of the petiole and often also on the rachis (Marques and Peixoto, 2007), with some debate in the literature about the homology of these structures with respect to stipules. Ultimately, all of these characters (and many more) need to be studied in light of a global phylogenetic understanding in order to assess homology of the various states and lead to an improved understanding of patterns of character change in

Polygalaceae.

Within a phylogenetic context, even strongly homoplasious characters and seemingly obscure features can be informative. For example, Wendt (1978) characterized Rhinotropis, along with the principal diagnostic character of a conical beak on the keel (reduced or lost in a few species), as having laxly-flowered racemes, upper sepal insertion basipetally displaced, and the intrastaminal disc posteriorly enlarged and glandular. He also discussed that the saccate portion of the keel in many species of Rhinotropis has well-developed interlocking lobes that hold the sac closed

277

and that both ovary locules are always well-developed. Other species of Polygaleae can

have undulate lobes along the saccate portion of the keel (perhaps homologous to the

interlocking lobes that hold the sac closed in Rhinotropis?), and at least some clades,

such as Badiera and Phlebotaenia , routinely have one of the ovary locules not develop.

Ultimately, morphology needs to be better studied to determine the exact level of

universality for the characters, so that once the phylogeny is more robustly known we

can determine which features are synapomorphic and at what level.

A tremendous amount of cytological and karyological variation has been

documented in the very small percentage of Polygalaceae that has been studied (Lewis and Davis, 1962; Sharma and Mehra, 1978; Index to plant chromosome numbers, 1979;

Paiva, 1998; Eriksen et al., 2000; and other citations therein). It is clear that some species have several different chromosome numbers, and there are some discrepancies and uncertainties with respect to the base number for many groups. Even if some reported discrepancies are dismissed as errors, there is clear evidence of polyploid and aneuploid series, as well as widespread hybridization in a few species, although there are relatively few reports of documented hybridization in the family, e.g.,

Lack (1995). As pointed out by Wendt (1978), all examined species of Polygala shed their pollen in a trinucleate state, while other genera, such as Salomonia and

Securidaca, shed their pollen in a binucleate state, so it could turn out to be a useful character for some of the generic segregates. Base chromosome number or haploid number could also prove useful, e.g., Rhinotropis is reported to have x = 9, a condition not reported elsewhere in Polygaleae (Wendt, 1978).

278

Wendt (1978) reported irregular meiotic behavior and unreduced pollen

(sometimes in high percentages) and pointed out that these are factors involved in the

production of polyploids. Presumably, such issues must be relatively common within the

Polygaleae as there are more reports of polyploids than there are of apparent diploids, as well as several reports of apparent aneuploidy. It is not clear just how much gene flow is possible between ploidy levels, but it is obviously happening and even a small amount could be enough to maintain tokogenesis, precluding or interfering with

cladogenetic events and seriously obfuscating our attempts to delimit populations into

species. Issues such as these could easily account for observed populational

polymorphisms and confusing species complexes. That said, DNA data did not yield

any surprising or suspicious results, such as obviously paralagous ITS sequences.

As with any homoplasious, non-monothetic characters, there may still be

diagnostic value and even phylogenetic information in the cytological and karyological

data. For example, Paiva (1998) pointed out that Chamaebuxus species have an

interphase nucleus very rich in chromatin, with polymorphic (some long, others short)

chromosomes larger than those in Polygala s.str. (as Polygala subgen. Polygala), with

many chromocenters and poorly differentiated satellites without filaments; while

Polygala s.str. species have an interphase nucleus with little chromatin, uniform

chromosomes smaller than in Chamaebuxus, with few chromocenters and satellites

with long filaments. As with macro-morphology, any attempts to incorporate cytological

or karyological data into a phylogenetic analysis would be premature, as these data are

simply unknown for most taxa. Clarity is further stymied by contradictory karyological

279

reports in the literature, some of which undoubtedly reflect real variation. Nonetheless, a

few basic patterns are suggested by existing data on chromosome numbers:

Polygaleae not part of traditional Polygala s.l. -- Epirixanthes (x = 12;

mycoparasites related to Salomonia), Monnina (x = 10; perhaps 9 in some of the basal

members), Securidaca (x = 16);

New World groups no longer part of Polygala s.str. -- Hebecarpa (x = 7, 8, 10, 15,

17, 28-30), Hebeclada (x = 7), Rhinotropis (x = 9; reports of 7 and 19 likely reflect

abnormalities or errors);

Old World groups no longer part of Polygala s.str. -- Chamaebuxus (x = 6, mostly

7, 8, 11, 19, 23; the New World P. paucifolia with x = 17), Heterosamara (x = 7);

New World subgroups of Polygala s.str. (Fig. 11) -- Monninopsis group (x = 8, 10,

17), miscellaneous basal taxa (P. senega; x = 17), Tenues group (P. paniculata; x = 7,

13; there is a small group of untested African species taxonomically within this clade),

Galioideae group (x = 6, 7, 8, 9, 13, 17), SE U.S. non-Decurrentes group (x = 6, 7, 9,

10, 12, 17, 23), Decurrentes group (x = 17), other unplaced Mexican taxa not included in my phylogenetic analyses (x = 6, 9);

Old World subgroups of Polygala s.str. -- Vulgares group (primarily European taxa closely related to P. vulgaris, represented by ca. 10 taxa in Fig. 11; x = 7, 8, mostly

17, 19, with the more basal species x = 15, 16, 19), Asian taxa (x =6, 7, 16, 17, 19),

African taxa (x = 6, 7, 11, 13, mostly 19), with the understanding that some taxa have a

range that includes more than one of these areas, in which case their base number was

included in the region from where the voucher was collected.

280

These numbers were taken from Lewis and Davis (1962), Sharma and Mehra

(1978), Index to plant chromosome numbers (1979-), Paiva (1998), Eriksen et al.

(2000), and other citations in those reports. With the sampling of more taxa, especially with the assessment of infraspecific variation given that much of the range within these groups has been reported within single taxa, tracking the haploid numbers, in addition to the more theoretical base numbers might prove phylogenetically useful, once we have more robust phylogenetic hypotheses.

281

APPENDIX C CLADOGRAMS NOT INCLUDED IN THE PRIMARY CHAPTER, WITH FOCUS ON NORTH AMERICAN TAXA

Object C-1. Cladograms Not Included.pdf , 8MB

282

LIST OF REFERENCES

Aguiar, A.C. A., M.C.M. Marques, and K. Yamamoto. 2008. Taxonomia das espécies de Polygala L. subg. Hebeclada (Chodat) Blake (Polygalaceae) ocorrentes no Brasil. Revista Brasileira de Biociências 6: 81–109.

Backlund, A. and K. Bremer. 1998. To be or not to be: Principles of classification and monotypic plant families. Taxon 47: 391–400.

Balkwill, M.J. and K. Balkwill. 1996. Problems with generic delimitation and subdivision in a large genus, Barleria (Acanthaceae). Pp. 393–408. In L. J. G. van der Maesen, X. M. van der Burgt and J. M. van Medenbach de Rooy (eds.), The biodiversity of African plants: Proceedings XIV AETFAT congress, 22-27 August 1994, Wageningen, The Netherlands. Kluwer Academic, Dordrecht.

Banks, H., B.B. Klitgaard, F. Claxton, F. Forest, and P.R. Crane. 2008. Pollen morphology of the family Polygalaceae (Fabales). Bot. J. Linn. Soc. 156: 253– 289.

Benton, M.J. 2000. Stems, nodes, crown clades, and rank-free lists: is Linnaeus dead? Biol. Rev. 75: 633–648.

Bernardi, L.F. 2000. Consideraciones taxonómicas y fitogeográficas acerca de 101 Polygalae Americanas. Cavanillesia Altera 1: 1–456.

Berry, P.E. 2002. Biological inventories and the phylocode. Taxon 51: 27–29.

Blake, S.F. 1916. A revision of the genus Polygala in Mexico, Central America, and the West Indies. Contr. Gray Herb. 47: 1–122.

Blake, S.F. 1924. Polygalaceae. North American Flora 25: 305–379.

Blattner, F.R. 1999 Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. Biotechniques 27: 1180–1186.

Bremer, B., R.K. Jansen, B. Oxelman, M. Backlund, H. Lantz, and K. Kim. 1999. More characters or more taxa for a robust phylogeny-case study from the coffee family (Rubiaceae). Syst. Biol. 48: 413–435.

Britton, N.L. 1910. Studies on West Indian plants -- III. Bull. Torrey Bot. Club 37: 359– 363.

Britton, N.L. 1915. Studies on West Indian plants -- VII. Bull. Torrey Bot. Club 42: 493– 517.

Castro, S., P. Silveira, A.P. Coutinho, and J. Paiva. 2007. Heterosamara sect. Villososperma comb. nov. (Polygalaceae) from eastern Asia. Nordic J. Bot. 25: 286–293.

283

Chase, M.W. and H.H. Hills. 1991. Silica gel: an ideal material for field preservation of leaf samples for DNA studies. Taxon 40: 215–220.

Chodat, R.H. 1891a. Monographia polygalacearum, 1. Mémoires de la Société de Physique et d’Histoire Naturelle de Genève 31, suppl. 7: 1–143.

Chodat, R.H. 1891b. Sur la distribution et l’origine de l’espèce et des groupes chez les polygalacées. Arch. Sci. Physique et d’Histoire Naturelle de Genève, sér. 3, 25: 695–714.

Chodat, R.H. 1893. Monographia polygalacearum, 2. Mémoires de la Société de Physique et d’Histoire Naturelle de Genève 31: 1–500.

Chodat, R.H. 1896. Polygalaceae. In A. Engler and K. Prantl (eds.), Die natürlichen Pflanzenfamilien 3(4): 323–345.

Clayton, W.D. 1983. The genus concept in practice. Kew Bull. 38: 149–153.

Correll, D.S. and M.C. Johnston. 1979. Manual of the vascular plants of Texas. Univ. of Texas at Dallas, Richardson, Texas.

de Candolle, A.P. 1824. Prodromus systematis naturalis regni vegetabilis, sive enumeratio contracta ordinum, generum, specierumque plantarum hucusque cognitarum, juxta methodi naturalis normas digesta. Paris.

De Queiroz, K. 2007. Species concepts and species delimitation. Syst. Biol. 56: 879– 886.

De Queiroz, K. and P.D. Cantino. 2001. Phylogenetic nomenclature and the PhyloCode. Bull. Zool. Nom. 58: 254–271.

Demesure, B., N. Sodzi, and R.J. Petit. 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology 4: 129–131.

Donoghue, M. J. 1985. A critique of the biological species concept and recommendations for a phylogenetic alternative. Bryologist 88: 172–181.

Doyle, J.J. and J.L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bull. 19: 11–15.

Dubois, A. 2007. Naming taxa from cladograms: some confusions, misleading statements, and necessary clarifications. Cladistics 23: 390–402.

Duchartre, P. 1847. Polygale. Pp. 381–383 in Orbigny, M.C., Dictionnaire Universel D’Histoire Naturelle, vol. 10. Paris.

284

Entwisle, T.J. and P.H. Weston. 2005. Majority rules, when systematists disagree. Austral. Syst. Bot. 18: 1–6.

Eriksen, B. 1993a. Phylogeny of the Polygalaceae and its taxonomic implications. Pl. Syst. Evol. 186: 33–55.

Eriksen, B. 1993b. A revision of Monnina subg. Pterocarya (Polygalaceae) in northwestern South America. Ann. Missouri Bot. Gard. 80: 191–207.

Eriksen, B. and C. Persson. 2007. Polygalaceae. Pp. 345-363 in Kubitzki, K. (ed.), The Families and Genera of Vascular Plants, vol. 5. Springer, Berlin.

Eriksen, B., B. Ståhl, and C. Persson. 2000. Polygalaceae. In Harling, G. and L. Andersson (eds.), Flora of Ecuador, 65. Botanical Institute, Göteborg University, Göteborg.

Felsenstein, J. 1978. Cases in which parsimony and compatibility methods will be positively misleading. Syst. Zool. 27: 401–410.

Fitch, W.M. 1971. Toward defining the course of evolution -- minimum change for a specific tree topology. Syst. Zool. 20: 406–416.

Forest F., M.W. Chase, C. Persson, P.R. Crane, and J.A. Hawkins. 2007. The role of biotic and abiotic factors in evolution of ant-dispersal in the milkwort family (Polygalaceae). Evolution 61: 1675–1694.

Forey, P.L. 2002. Phylocode -- pain, no gain. Taxon 51: 43–54.

Graybeal, A. 1998. Is it better to add taxa or characters to a difficult phylogenetic problem? Syst. Biol. 47: 9–17.

Halanych, K.M. 1998. Lagomorphs misplaced by more characters and fewer taxa. Syst. Biol. 47: 138–146.

Helbig, A.J., A.G. Knox, D.T. Parkin, G. Sangster, and M. Collinson. 2002. Guidelines for assigning species rank. Ibis 144: 518–525.

Hendy, M.D. and D. Penny. 1989. A framework for the quantitative study of evolutionary trees. Syst. Zool. 38: 297–309.

Hillis, D.M. 1998. Taxon sampling, phylogenetic accuracy, and investigator bias. Syst. Biol. 47: 3–8.

Hillis, D.M., D.D. Pollock, J.A. McGuire, and D.J. Zwickl. 2003. Is sparse taxon sampling a problem for phylogenetic inference? Syst. Biol. 52: 124–126.

Holm, T. 1929. Morphology of North American species of Polygala. Bot. Gaz. 88: 167– 185.

285

Holmes, W.C., K.L. Yip, and A.E. Rushing. 2008. Taxonomy of Koeberlinia (Koeberliniaceae). Brittonia 60: 171–184.

Index to plant chromosome numbers. 1979-- . Goldblatt, P. and D.E. Johnson (eds.), Missouri Botanical Garden, St. Louis. [http://mobot.mobot.org/W3T/Search/ipcn.html; accessed 9 June 2009].

Johnson, L.A. and D.E. Soltis. 1994. MatK DNA sequences and phylogenetic reconstruction in Saxifragaceae s.st. Systematic Botany 19: 143–156.

Judd, W. S. 2007. Revision of Miconia sect. Chaenopleura (Miconieae, Melastomataceae) in the Greater Antilles. Syst. Bot. Monogr. 81: 1–235.

Judd, W.S., C.S. Campbell, E.A. Kellogg, P.F. Stevens, and M.J. Donoghue. 2007. Plant Systematics: A Phylogenetic Approach, 3rd ed. Sinauer Associates, Inc., Sunderland, Maryland.

Judd, W.S. and J.D. Skean, Jr. 1987. Floristic study of Morne la Visite and Pic Macaya National Parks, Haiti. Bulletin of the Florida State Museum, Biological Sciences 32: 1–136.

Judd, W.S., J.D. Skean, Jr., and C. K. McMullen. 1990. The flora of Macaya Biosphere Reserve: Additional taxa, taxonomic and nomenclatural changes. Moscosoa 6: 124–133.

Judd, W.S., J.D. Skean, Jr., and D.G. Griffin, III. 1998. The flora of Macaya Biosphere Reserve: Additonal taxa, taxonomic and nomenclatural changes, II. Moscosoa 10: 114–120.

Kearney, T.H. and R.H. Peebles. 1951. Arizona flora. Univ. of California Press, Berkeley, California.

Knapp, S., G. Lamas, E.N. Lughadha, and G. Novarino. 2004. Stability or stasis in the names of organisms: the evolving codes of nomenclature. Philos. Trans., Ser. B 359: 611–622.

Lack, A.J. 1995. Relationships and hybridization between British species of Polygala -- evidence from isozymes. New Phytologist 130: 217–223.

Langer, M.C. 2001. Linnaeus and the "PhyloCode": where are the differences? Taxon 50(4): 1091–1096.

Lee, M.S.Y. 2003. Species concepts and species reality: salvaging a Linnaean rank. J. Evol. Biol. 16: 179–188.

Lewis, W.H. and S.A. Davis. 1962. Cytological observations of Polygala in eastern North America. Rhodora 64: 102–113.

286

Lucas, S. and H. Synge. 1978. The IUCN plant red data book. International Union for the Conservation of Nature and Natural Resources, Morge, Switzerland.

Lüdtke, R., T. Teixeira de Souza-Chies, and S.T.S. Miotto. 2008. Bredemeyera Willd. e Securidaca L. (Polygalaceae) na região sul do Brasil. Revista Brasileira de Biociências 6: 69–79.

Marques, M.C.M. 1979. Revisão das espécies do gênero Polygala L. (Polygalaceae) do estado do Rio de Janeiro. Rodriguésia 31: 69–339.

Marques, M.C.M. 1989. Polígalas do Brasil V. Seção Polygala (Polygalaceae). Arq. Jard. Bot. Rio de Janeiro 29: 1–114.

Marques, M.C.M. and A.L. Peixoto. 2007. Estudo taxonômico do gênero Polygala L. subgênero Ligustrina (Chodat) Paiva (Polygalaceae). Rodriguésia 58: 95–146.

McNeill, J., F.R. Barrie, H.M. Burdet, V. Demoulin, D.J. Hawksworth, K. Marhold, D.H. Nicolson, J. Prado, P.C. Silva, J.E. Skog, J.H. Wiersema, and N.J. Turland. 2006. International Code of Botanical Nomenclature (Vienna Code), adopted by the Seventh International Botanical Congress Vienna, Austria, July 2005. A.R.G. Gantner Velag, Ruggell, Liechtenstein.

Mishler, B.D. and E.C. Theirot. 2000. The phylogenetic species concept (sensu Mishler and Theirot): monophyly, apomorphy, and phylogenetic species concepts. Pp. 44–54 in Wheeler, Q.D. and R. Meier (eds.), Species concepts and phylogenetic theory: a debate. Columbia Univ. Press, New York, New York.

Mitchell, A., C. Mitter, and J.C. Regier. 2000. More taxa or more characters revisited: combining data from nuclear protein-encoding genes for phylogenetic analyses of Noctuoidea (Insecta: Lepidoptera). Syst. Biol. 49: 202–224.

Moore, G. 2003. Should taxon names be explicitly defined? Bot. Rev. 69: 2–21.

Morrell, P.L., J.M. Porter, and E.A. Friar. 2000. Intercontinental dispersal: the origin of the widespread South American plant species Gilia laciniata (Polemoniaceae) from a rare California and Oregon coastal endemic. Pl. Syst. Evol. 224: 13–32.

Nieuwland, J.A. 1914. Critical notes on new and old genera of plants. I. American Midland Naturalist 3: 170–197.

Nixon, K.C., J.M. Carpenter, and D.W. Stevenson. 2003. The phylocode is fatally flawed, and the “Linnaean” system can easily be fixed. Bot. Rev. 69: 111–120.

Paiva, J.A.R. 1998. Polygalarum Africanarum et Madagascariensium prodromus atque gerontogaei generis Heterosamara Kuntze, a genere Polygala L. segregati et a nobis denuo recepti, synopsis monographica. Fontqueria 50: 1–346.

287

Persson, C. 2001. Phylogenetic relationships in the Polygalaceae based on plastid DNA sequences from the trnL-F region. Taxon 50: 763–779.

Pfeil, B.E. and M.D. Crisp. 2005. What to do with Hibiscus? A proposed nomenclatural resolution for a large and well known genus of Malvaceae and comments on paraphyly. Austral. Syst. Bot. 18: 49–60.

Pickett, K.M. 2005. The new and improved PhyloCode, now with types, ranks, and even polyphyly: a conference report from the First International Phylogenetic Nomenclature Meeting. Cladistics 21: 79–82.

Rambaut, A. 1996. Se-Al: sequence alignment editor, Ver. 2.0a11. Website http://tree.bio.ed.ac.uk/software/seal/ [accessed August 2007].

Rankin R., R. 2003. Polygalaceae. Pp. 1–52. In W. Greuter and R. Rankin R. (eds.), Flora de la República de Cuba, Ser. A. Plantas Vasculares, Fasc. 7. Gantner Verlag, Ruggell, Liechtenstein.

Rapini, A. 2004. Classes or individuals? The paradox of systematics revisited. Stud. Hist. Phil. Biol. and Biomed. Sci. 35: 675–695.

Raven, P.H. 1963. Amphitropical relationships in the floras of northern and southern America. Quart. Rev. Biol. 38: 151–177.

Robinson, B.L. 1897. Polygalaceae. Pp. 448–460 in Synoptical flora of North America, vol. 1, fascicle 2. Cambridge University Press, Cambridge, Massachusetts.

Robinson, B.L. 1906. The generic concept in the classification of the flowering plants. Science 23: 81–92.

Schrire, B.D. and G.P. Lewis. 1996. Monophyly: a criterion for generic delimitation, with special reference to Leguminosae. Pp. 353–370. In L.J.G. van der Maesen, X.M. van der Burgt and J.M. van Medenbach de Rooy (eds.), The biodiversity of African plants: Proceedings XIV AETFAT congress, 22-27 August 1994, Wageningen, The Netherlands. Kluwer Academic, Dordrecht.

Scotland, R.W., R.G. Olmstead, and J.R. Bennett. 2003. Phylogeny reconstruction: the role of morphology. Syst. Biol. 52: 539–548.

Sharma, M.L. and P.N. Mehra. 1978. Chromosome numbers in some north west Indian species of Polygala. Cytologia 43: 589–593.

Shaw, J, E.G. Lickey, J.T. Beck, S.B. Farmer, W. Liu, J. Miller, K.C. Siripun, C.T. Winder, E.E. Schilling, and R.L. Small. 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92: 142–166.

288

Small, J.K. 1933. Manual of the southeastern flora, 1972 facsimile. Hafner, New York, New York.

Solbrig, O.T. 1972a. The floristic disjunction between the "Monte" in Argentina and the “Sonoran desert" in Mexico and the United States. Ann. Missouri Bot. Gard. 59: 218–223.

Solbrig, O.T. 1972b. New approaches to the study of disjunctions with special emphasis on the American amphitropical desert disjunctions. Pp. 85–100 in Valentine, D.H. (ed.), Taxonomy, phytogeography, and evolution. Academic Press, New York, New York.

Soltis, D.E. and P.S. Soltis. 2004. Amborella not a “basal angiosperm”? Not so fast. Amer. J. Bot. 91: 997–1001.

Soltis, D.E., P.S. Soltis, M.E. Mort, M.W. Chase, V. Savolainen, S.B. Hoot, and C.M. Morton. 1998. Inferring complex phylogenies using parsimony: An empirical approach using three large DNA data sets for angiosperms. Syst. Biol. 47: 32– 42.

Spach, E. 1839. Histoire naturelle des végétaux. Phanérogames. 7. Librairie Encyclopédique de Roret, Paris.

Stevens, P.F. 1985. The genus concept in practice: but for what practice? Kew Bull. 40: 457–465.

Swofford, D.L. 2003. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sinauer, Sunderland, Massachusetts.

Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17: 1105–1109.

Torrey, J. and A. Gray. 1838. Pp. 125–133, 670–671 in A flora of North America, vol. 1 (1969 reprint). Hafner Pub. Co., New York. [the last 2 pages were originally published in 1840]

Urban, I. 1912. Symbolae antillanae seu fundamenta Florae Indiae occidentalis. 7:161– 304.

van der Meijden, R. 1988. Polygalaceae. Pp. 455–539 in van Steenis, C.G.G.J. (ed.), Flora Malesiana, series 1, 10(3).

Wendel, J.F. and J.J. Doyle. 1998. Phylogenetic incongruence: Window into genome history and molecular evolution. Pp. 265–296 in Soltis, D.E., P.S. Soltis, and J.J. Doyle (eds.), Molecular systematics of plants II: DNA sequencing. Kluwer Academic Publishers, Boston, Massachusetts.

289

Wendt, T.L. 1978. A systematic study of Polygala section Rhinotropis (Polygalaceae). Dissertation, University of Texas, Austin, Texas.

Wendt. T. 2005. Two new species of Polygala (Polygalaceae) from western Mexico. Lundellia 8: 17–27.

Wheeler, Q.D. and N.I. Platnick. 2000. The phylogenetic species concept (sensu Wheeler and Platnick). Pp. 55–69 in Wheeler, Q.D. and R. Meier (eds.), Species concepts and phylogenetic theory: a debate. Columbia Univ. Press, New York, New York.

Wiens, J.J. 2003. Incomplete taxa, incomplete characters, and phylogenetic accuracy: is there a missing data problem? J. Vert. Paleo. 23: 297–310.

Wiens, J.J. 2005. Can incomplete taxa rescue phylogenetic analyses from long-branch attraction? Syst. Biol. 54: 731–742.

Wiens, J.J. and M.R. Servedio. 2000. Species delimitation in systematics: inferring diagnostic differences between species. Proc. Roy. Soc. London, Ser. B, Biol. Sci. 267: 631–636.

Withgott, J. 2000. Is it “So long, Linnaeus”? Bioscience 50: 646–651.

Zwickl, D.J. and D.M. Hillis. 2002. Increased taxon sampling greatly reduces phylogenetic error. Syst. Biol. 51: 588–598.

290

BIOGRAPHICAL SKETCH

Richard Abbott was born in 1968 in the relatively flat state of Indiana. A

subsequent move resulted in many memorable, formative years exploring in the foothills

of the Appalachians in Virginia, where he graduated in 1986 from Amherst County High

School. After several soul-searching years in and out of academia, Richard received a

Bachelor of Arts in Liberal Arts (double-majoring in biology and German) in 1994 from

Berea College. After a year wandering around South America on a Watson Fellowhip,

Richard completed a Master of Science in botany in 1998 at the University of Florida,

where he later returned to earn a Doctor in Philosophy in botany in 2009. Long-term

plans remain open but will, hopefully, include many years studying plants in the wild.

Richard is currently an Instructor in the Department of Biological Sciences at Eastern

Illinois University.

291