The Pennsylvania State University

The Graduate School

The Intercollege Graduate Degree Program in Physiology

ESTROGEN RECEPTOR BETA AND ADIPONECTIN AS TARGETS IN

CARDIOVASCULAR AND METABOLIC DISEASE

A Dissertation in

Physiology

by

Nanette J. Tomicek

 2012 Nanette J. Tomicek

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

May 2012

ii The dissertation of Nanette J. Tomicek was reviewed and approved* by the following:

Donna H. Korzick Associate Professor of Physiology and Kinesiology Chair of the Intercollege Graduate Program in Physiology Dissertation Advisor Chair of Tomicek Dissertation Committee

Charles H. Lang Distinguished Professor of Cellular and Molecular Physiology, and Surgery

Roger McCarter Professor of Biobehavioral Health

Ramesh Ramachandran Associate Professor of Neuroendocrinology and Transgenics

*Signatures are on file in the Graduate School

iii

ABSTRACT

Coronary heart disease (CHD) remains the leading cause of morbidity and mortality in aged women, with a 2- to 3-fold increase in incidence following menopause. The loss of estrogen

(E2) has been implicated as a defining factor for reduced cardioprotection, yet estrogen replacement therapy (ERT) fails to reduce cardiovascular morbidity and mortality in postmenopausal women. Moreover, the combined effects of aging and E2-deficiency contribute to

a unique high risk state for metabolic dysregulation which further drives cardiovascular disease

risk in aged women. Closer examination of both direct and indirect effects of E2 and estrogen receptor (ER) signaling in the context of aging and E2-deficiency is needed to help identify

relevant targets for therapeutic intervention in post-menopausal women. The adipokine,

adiponectin (APN), has been identified as a biomarker for CHD risk and may be influenced by

aging, adiposity, and ERβ. The series of four studies described herein was designed to investigate

ER-signaling disruptions in metabolic and cardiac tissues as well as characterize attenuations in

APN signaling capacity in a model of aging and E2-deficiency, the Fischer 344 (F344) female rat.

The aim of the first study (Chapter 3) was to determine the effects of acute ERβ activation on ischemia/reperfusion (I/R) injury in adult, aged, and aged E2-deficient female rats.

Hearts were isolated from adult (6 mo), aged (24 mo), and aged ovariectomized (OVX) rats and subjected to 47 min of global I and 60 min of R. Rats were acutely treated with the ERβ-agonist diarylpropionitrile (DPN) or vehicle 45 min prior to I/R. Acute treatment with DPN had no effect on functional recovery following I/R injury in adult, aged, or aged OVX female rats.

The aim of the second study (Chapter 4) was to determine if age-associated E2-deficiency

is associated with alterations in the ERα/ERβ ratio in visceral adipose tissue and skeletal muscle

iv of female rats. We also sought to characterize changes in intra-adipocyte and circulating APN.

Visceral adipose and skeletal muscle was isolated from adult and aged rats with and without

OVX. ERβ protein increased in adipose of aged and aged OVX rats and ERα increased in both

adipose and gastrocnemius of aged OVX rats (p<0.05). Intra-adipocyte APN was increased and circulating APN concentration decreased in aged OVX vs adult OVX rats (p<0.05). Downstream

APN targets, adiponectin receptor 2 (adipoR2), and the activated AMP-dependant kinase

(pAMPK)/total AMPK ratio all decreased with age (p<0.05). Collectively, the data described in

Chapter 4 suggests age-associated increases in ERβ in adipose, reduced circulating APN, and alterations in APN downstream effectors might conspire to create a metabolic phenotype associated with reduced cardioprotection.

In the third study (Chapter 5) we employed a direct in vitro approach to assess the effects of ERβ overexpression on APN in an adipocyte-like cell culture model, 3T3-L1 cells. Cells were transfected with ERβ plasmid construct for 24 h. Post-transfection ERβ mRNA was increased

1000-fold, yet protein levels were unchanged. In a second experiment DPN was utilized to activate ERβ in differentiated 3T3-L1 cells. However, due to lack of ER responsiveness, the effects of ERβ activation on APN production or secretion in vitro were not elucidated.

The aim of the fourth study (Chapter 6) was to determine if APN treatment is effective in conferring direct cardioprotection in the female rat heart and also to characterize changes in downstream cardiac APN targets associated with aging, E2-deficiency, and a high fat diet. Hearts

were isolated from adult, aged, and aged OVX rats as described in Chapter 3 and were infused

with 9 μg of APN or vehicle upon ischemia. APN infusion was successful in improving left

ventricular developed pressure (LVDP) and end diastolic pressure (EDP) following I/R injury in

all groups (p<0.05). No change in AMPK phosphorylation was observed in APN vs control I/R

groups. In a subset of perfused control hearts isolated from rats consuming a high fat diet for 20

v weeks total AMPK and AdipoR1 protein was decreased by 20% and increased by 50%,

respectively relative to chow fed rats (p<0.05), which suggests APN-resistance.

A summary of the key findings in the collection of four studies described follows. 1)

Cardiac ERβ does not likely play a role in cardioprotection in the female F344 myocardium. 2)

Defects in APN secretion are associated with increased ERβ in visceral adipose tissue of aged and

aged OVX female rats. Unfortunately, a causal link between ERβ and APN could not be

evaluated presently in vivo or in vitro models. 3) APN treatment improves post-ischemic function

in the F344 female rat heart and APN or downstream APN effectors may be relevant therapeutic

targets for combating CHD risk and mortality in aged women. However, high fat consumption

may negate the protective effect of APN given the APN-resistant phenotype observed in aged

female rats on a high fat diet.

vi TABLE OF CONTENTS

LIST OF FIGURES ...... x

LIST OF TABLES ...... xiv

LIST OF ABBREVIATIONS ...... xv

ACKNOWLEDGEMENTS ...... xvii

Chapter 1 INTRODUCTION TO CARDIOVASCULAR AND METABOLIC DISEASE IN AGING WOMEN ...... 1

Statement of the Problem ...... 3 Specific Aims and Hypotheses ...... 3

Chapter 2 REVIEW OF THE LITERATURE ...... 6

Introduction to Estrogen Recptors ...... 7 Estrogen Receptor Structure ...... 8 Estrogen Rector Activation ...... 10 Estrogen Recptor Activation:Genomic Mechanims ...... 11 Estrogen Receptor Activation: Non-genomic Mechanims ...... 13 Estrogen Recptor Activation: Ligand Independent Mechanisms ...... 14 Agonists, Antagonists, and SERMS ...... 15 Distribution of Estrogen Receptors and Expression ...... 16 Estrogen Receptor Knock Out Mice ...... 17 Estrogen and Metabolism ...... 19 The F344 Rat as a Model of Metabolic Disease and Aging ...... 21 Skeletal Muscle and Estrogen Receptors ...... 22 Adipose and Estrogen Receptors ...... 24 Estrogen and Obesity ...... 25 Estrogen and Heart Disease ...... 26 Estrogen Replacement Therapy and Heart Disease ...... 27 Estrogen Receptors, Knock Out Mice, and the Myocardium ...... 29 Estrogen Receptors Beta and the Myocardium ...... 30 Estrogen Receptors Beta and Cardioprotection ...... 31 Adiponectin in Cardiovascular and Metabolic Disease ...... 32 Adiponectin ...... 33 Modulation of Adiponectin Multimers by Estrogen Receptor Beta ...... 35 Adiponectin and Gender ...... 36 Adiponectin Receptors ...... 38 Adiponectin and Cardioprotection ...... 40 Adiponectin Mechanisms of Cardioprotection ...... 41 Adenosine Monophosphate-Dependent Kinase Activation Dependent Mechanisms ...... 42 Anti-Inflammatory and Anti-Nitrative Effects of Adiponectin ...... 45

vii Adiponectin Resistance ...... 45

Chapter 3 ESTROGEN RECEPTOR BETA DOES NOT INFLUENCE ISCHEMIC TOLERANCE IN THE AGED FEMALE RAT HEART ...... 51

Introduction ...... 51 Methods ...... 52 Animal Care ...... 53 Ovariectomy ...... 53 Study Design ...... 53 I/R Protocol ...... 54 RNA Extraction and Real-Time PCR ...... 54 Protein Sample Preparation and Western Blotting ...... 55 Statistical Analysis ...... 56 Results ...... 56 Baseline Characteristics ...... 56 Functional Recovery Post I/R Injury ...... 57 ER Beta mRNA Expression and Protein Assessment ...... 59 Discussion ...... 60

Chapter 4 INCREASED ESTROGEN RECEPTOR BETA IN ADIPOSE TISSUE IS ASSOCIATED WITH INCREASED INTRACELLULAR AND REDUCED CIRCULATING ADIPONECTIN PROTEIN LEVELS IN AGED FEMALE RATS .... 64

Introduction ...... 64 Methods ...... 66 Animal Care ...... 66 Ovariectomy ...... 67 Study Design ...... 67 Serum Adiponectin Levels ...... 67 Tissue Homogenization ...... 68 Western Blotting ...... 68 Non-Reducing Western Blotting for Adiponectin Mulitimers ...... 69 Statistical Analysis ...... 69 Results ...... 69 Animal Characteristics ...... 69 Estrogen Receptors, PPAR gamma and Erp44 Protein Levels ...... 70 Adiponectin, Adiponectin Receptors, and Downstream Targets AMPK and PPAR Alpha Levels ...... 74 Discussion ...... 79 Conclusions ...... 82

Chapter 5 EXAMINING THE EFFECTS OF ESTROGEN RECEPTOR ΒETA ON ADIPONECTIN IN 3T3-L1 CELLS ...... 83

Introduction ...... 83 Methods ...... 84 Cell Culture ...... 84

viii 3T3-L1 Differentiation ...... 85 Plasmid Purification and Linearization ...... 85 Determination of Optimal Transfection Conditions ...... 88 Lipofectamine LTX ...... 88 FuGene6 ...... 88 AMAXA ...... 89 Stable Transfection ...... 89 RNA Isolation and qRT-PCR ...... 89 Protein Homogenization Preperation ...... 90 Estrogen Receptor Activation ...... 90 Western Blotting ...... 91 Total and High Molecular Weight Adiponectin Assessment ...... 92 Statistics ...... 92 Results ...... 92 Estrogen Receptor Beta Overexpression in 3T3-L1 cells ...... 92 Total and High Molecular Weight Adiponectin Assessment ...... 96 Estrogen Receptor Activation ...... 97 Discussion ...... 99

Chapter 6 ADIPONECTIN IS CARDIOPROTECTIVE IN THE AGED FEMALE RAT HEART ...... 102

Introduction ...... 102 Methods ...... 104 Animal Care ...... 104 Ovariectomy ...... 104 Study Design for APN Treatment ...... 105 Dietary Intervention ...... 105 Protocol of the Isolated Heart ...... 106 Tissue Homogenization ...... 107 Western Blotting ...... 107 Adiponectin ELISA ...... 107 Statistical Analysis ...... 108 Results ...... 108 Baseline Morphological Characteristics ...... 108 Circulating Adiponectin ...... 109 Adiponectin Infusion and Left Ventricular Function ...... 110 Adiponectin Receptors and AMPK in Perfused Hearts ...... 112 Effect of High Fat Diet on Body Weight and Caloire Consumption ...... 116 Effect of High Fat Diet on Adiponectin Receptors and AMPK ...... 117 Discussion ...... 120

Chapter 7 SUMMARY AND CONCLUSIONS ...... 125

Stregnths and Limitations ...... 128 Aged OVX Female Rat Model ...... 128 Langendorff Isolated Heart Model ...... 129 Future Directions ...... 130

ix Appendix ...... 131

x

LIST OF FIGURES

Figure 2-1: Comparison of domain structures of ERα and ERβ. ERs have six domains, A–F, and the number of amino acids in these domains, as well as the functions associated with these domains, are indicated for ERα and ERβ. The activation function (AF) domains AF-1 and AF-2 are indicated in the A/B and E domains. The degree of homology between ERα and ERβ in the C and E domains is indicated; from Hewitt et al (2005)...... 9

Figure 2-2: Schematic of adiponectin intracellular assembly; from Wang and Scherer (2008)...... 34

Figure 2-3: Adiponectin signaling cascades in the myocardium; from Hui et al. (2012)...... 42

Figure 3-1: DPN treatment does not improve post-ischemic LVDP in the female rat heart. Recovery of LVDP following a 47 min ischemia in adult (Panel A), aged (Panel B), and aged OVX (Panel C). * denotes different from adult; p<0.05...... 58

Figure 3-2: DPN treatment does not improve post-ischemic +/-dP/dtmax in the female rat heart. Recovery of dP/dtmax following a 47 min ischemia in adult (Panel A and D), aged (Panel B and E), and aged OVX (Panel C and F). * denotes different from adult; p<0.05...... 59

Figure 3-3: Western blot for ERα and β with total heart homogenate and ERβ-transfected HEK293 cells. ERβ (Panel A) reprobe of stripped ERβ membrane with ERα (Panel B). Lane 1 total cardiac homogenate 30µg; lane 2 ERβ-transfected HEK293 cells 20 μg...... 60

Figure 4-1: The effects of aging and E2-deficiency on estrogen receptor α (ER) α and ERβ protein levels in adipose. Representative blots and adipose protein levels for ERα (Panel A); and ERβ (Panel B). *denotes age effect, ‡ denotes significantly different from adult OVX; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby Blot Stain...... 71

Figure 4-2: The effects of aging and E2-deficiency on estrogen receptor α (ER) α protein levels in skeletal muscle. Representative blots and adipose protein levels for ERα in soleus (Panel A); and ERα in gastrocnemius (Panel B). †denotes significantly different from adult intact, ‡ denotes significantly different from adult OVX, § denotes significantly different from aged intact; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain ...... 72

Figure 4-3: Peroxisome proliferator activated receptor γ (PPAR) γ is reduced with age and E2-deficiency while endoplasmic reticulum protein of 44 kDa (Erp44) is unchanged. Representative blots and adipose protein levels for PPARγ (Panel A)

xi and Erp44 (Panel B). * denotes age effect, † denotes OVX effect; (p < 0.05; n=5- 6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain...... 73

Figure 4-4: Total intra-adipocyte adiponectin (APN) is significantly increased with age- associated E2-deficiency while circulating APN is significantly increased with OVX and reduced with age. Adiponectin Receptor 1 (AdipoR) 1 is unchanged with age or E2-deficiency while AdipoR2 is decreased with age. Circulating APN (Panel A), representative blots and adipose protein levels for APN (Panel B), AdipoR1 (Panel C), and AdipoR2 (Panel D). * denotes age effect, † denotes significantly different from adult intact, ‡ denotes significantly different from adult OVX, § denotes significantly different from aged intact; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact. APN and AdipoR2 are corrected with Sypro Ruby Blot Stain and AdipoR1 is corrected with Ponceau S...... 75

Figure 4-5: Representative blots and adipose protein levels for adiponectin (APN) multimers processed under non-reducing conditions. High molecular weight (HWM) APN (Panel A), MMW APN (Panel B), LWM APN (Panel C), monomeric (Panel D); representative non-reducing blot (Panel E). * denotes significantly different from adult intact, † denotes significantly different from adult OVX, ‡ denotes significantly different aged; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact...... 76

Figure 4-6: Representative blots for PPARα. Values are means ± SEM; data is presented relative to adult intact and corrected with Ponceau S stain...... 77

Figure 4-7: Adenosine monophosphate-dependent protein kinase (AMPK) and activated AMPK (pAMPK) protein levels are unchanged, yet the pAMPK to total AMPK ratio is decreased with age-associated E2-deficiency. Representative blots for AMPK and pAMPK and adipose protein levels for AMPK (Panel A), pAMPK (Panel B), pAMPK to AMPK ratio (Panel C). * denotes age effect; (p < 0.05; n=5- 6/group). Values are means ± SEM; data is presented relative to adult intact, AMPK and pAMPK are corrected with Sypro Ruby Blot Stain...... 78

Figure 4-8: Proposed signaling model for effects of age-associated E2-deficiency on ERβ signaling in adipose tissue and potential links to increased obesity, metabolic, and cardiovascular disease risk through dysregulated APN signaling...... 87

Figure 5-1: Korach ERβ mouse construct...... 86

Figure 5-2: ERβ mouse construct with restriction enzyme cut sites identified...... 87

Figure 5-3: ERβ mRNA expression and protein abundance in transfected 3T3-L1 and HEK293. ERβ mRNA expression in transiently transfected 3T3-L1 cells (Panel A), stably transfected in 3T3-L1 cells (Panel B), transiently transfected HEK293 cells (Panel C), stably transfected HEK293 cells (Panel D). Representative blot of ERβ protein in transfected 3T3-L1 and HEK239 cells (Panel E); non-transfected (non) transient transfection (trans), stable transfection (stable)...... 94

xii Figure 5-4: Total and high molecular weight (HMW) adiponectin (APN) obtained from cell lysates (intracellular) and culture media (secreted) after 12 or 24 h of ERβ activation in differentiated 3T3-L1 cells. Intracellular total APN (Panel A), intracellular HMW APN (Panel B), secreted total APN (Panel C), and secreted HMW APN (Panel D) are not affected by 100pM DPN treatment. *denotes effect of time; (p<0.05; n=3 samples/group; all experiments were repeated twice). Values are means ± SEM; data is presented relative to 12 h vehicle treated control cells...... 97

Figure 5-5: Insulin increased phosphorylated Akt (pAkt) in differentiated 3T3-L1 cells. Representative blots (Panel A) and relative protein expression of the relative pAkt/Akt ratio (Panel B); *denotes significantly different from vehicle (EtOH) treated control (n=4/group; all experiments were repeated twice). Values are means ± SEM; data is presented relative to EtOH control; estrogen (E2), propyl pyrazole- triol (PPT), diarylpropionitrile (DPN)...... 98

Figure 6-1: Schematic of the isolated heart protocol and adiponectin (APN) infusion...... 106

Figure 6-2: Circulating adiponectin in adult aged and aged OVX female rats, * denotes different from adult; p < 0.05; n=7-11/group...... 110

Figure 6-3: Adiponectin delivery improves functional recovery in the female rat heart. Recovery of left ventricular developed pressure (LVDP), expressed as percent recovery of pre-ischemic LVDP. Krebs-Henseleit buffer (vehicle) or 9μg of adiponectin was infused during the first minute of a 47 min ischemia period at a flow rate of 2mL/min in adult (Panel A), aged (Panel B), aged OVX (Panel C) female rats. * denotes different from adult; ‡ denotes main effect of drug; p<0.05; n=3-6/group...... 111

Figure 6-4: Adiponectin delivery improves post-ischemic end diastolic pressure (EDP) in female rat heart. Recovery of EDP following a 47 min ischemia in adult (Panel A), aged (Panel B), aged OVX (Panel C) female rats. ‡ denotes main effect of drug; p < 0.05; n=3-6/group...... 111

Figure 6-5: Adiponectin delivery improves post-ischemic change in pressure with respect to time (+/-dP/dt max) in female rat heart. Recovery of dP/dtmax following a 47 min ischemia in adult (Panel A and D), aged (Panel B and E), aged OVX (Panel C and F) female rats. * denotes different from adult; ‡ denotes main effect of drug; p<0.5; n=3-6/group...... 112

Figure 6-6: Adiponectin Receptor 1 (AdipoR1) and AdipoR2 in isolated hearts perfused for 30 min (Perfused Control), subjected to of ischemia/reperfusion (I/R; 47/60) with control Krebs-Henseleit infusion, or subjected to I/R with adiponectin (APN) infusion (9μg/mL). Representative blots and protein levels for AdipoR1 (Panel A), and AdipoR2 (Panel B), § denotes different from adult groups; p < 0.05; n=4- 5/group). Values are means ± SEM; data is presented relative to adult perfused control and corrected with Sypro Ruby Blot Stain...... 113

xiii Figure 6-7: Adenosine monophosphate-dependent protein kinase (AMPK), activated AMPK (pAMPK), and the pAMPK/AMPK ratio in isolated hearts perfused for 30 min (Perfused Control), subjected to 47 min of ischemia and 60 min reperfusion (I/R; 47/60) with control Krebs-Henseleit infusion, or subjected to I/R with adiponectin (APN) infusion (9μg/mL). Representative blots for pAMPK and AMPK (Panel A), protein levels for pAMPK (Panel B), protein levels for AMPK (Panel C) and the ratio of pAMPK/AMPK (Panel D). * denotes different from adult perfused control, † denotes different from aged perfused control; # denotes different from adult I/R; p < 0.05; n=4-5/group). Values are means ± SEM; data is presented relative to adult perfused control and corrected with Sypro Ruby Blot Stain...... 115

Figure 6-8: Adiponectin Receptor 1 (AdipoR) 1and AdipoR2 in isolated perfused control hearts of rats consuming the Lieber-DeCarli diet. Representative blots and protein levels for AdipoR1 (Panel A), and AdipoR2 (Panel B), *denotes different from adult; p<0.05; n=3-5/group). Values are means ± SEM; data is presented relative to adult intact and corrected with Sypro Ruby blot stain...... 117

Figure 6-9: Adenosine monophosphate-dependent protein kinase (AMPK) and activated AMPK (pAMPK) protein levels in isolated perfused control hearts of rats consuming the Lieber-DeCarli diet. Representative blots for pAMPK and AMPK (Panel A), protein levels for pAMPK (Panel B), protein levels for AMPK (Panel C) and the ratio of pAMPK/AMPK (Panel D) * denotes different from adult control; p < 0.05; n=3-5/group. Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain...... 118

Figure 7-1: Summary of Key Findings from Chapters 3, 4, 5, and 6...... 128

Figure A-1: Acetyl CoA carboxylase (ACC), phosphorylated ACC (pACC), and the pACC/ACC ratio in isolated hearts perfused for 30 min (Perfused Control), subjected to 47 min of ischemia and 60 min reperfusion (I/R; 47/60) with control Krebs-Henseleit infusion, or subjected to I/R with adiponectin (APN) infusion (9ug/mL). Protein levels for pACC (Panel A), protein levels for pACC (Panel B), and the ratio of pACC/ACC (Panel C). * denotes different from adult perfused control, † denotes different from aged perfused control; $ denotes different from aged OVX perfused control; p < 0.05; n=4-5/group and values are means ± SEM ...... 124

Figure A-2: Acetyl CoA carboxylase (ACC), phosphorylated ACC (pACC), and the pACC/ACC ratio in isolated hearts perfused for 30 min (Perfused Control) from rats consuming Lieber-DeCarli diet. Protein levels for pACC (Panel A), protein levels for pACC (Panel B), and the ratio of pACC/ACC (Panel C). Values are means ± SEM ...... 125

xiv

LIST OF TABLES

Table 2-1: Changes in serum adiponectin concentrations associated with menopausal status and overweight in women. Changes are relative to normal weight premenopausal women...... 38

Table 2-2: Changes in adiponectin receptors in metabolic tissues of animal models of obesity and metabolic disease...... 47

Table 3-1: Morphological and baseline characteristics for adult, aged, and aged OVX female rats. Abbreviations: DPN, diarylpropionitrile; OVX, ovariectomy; LV, left ventricle; EDP, end diastolic pressure; LVDP left ventricular developed pressure; * main effect of age p<0.05, † main effect of OVX p<0.05...... 57

Table 4-1: Rat body and uterine weight presented in grams (g); (n=5-6/groups). Abbreviatons OVX, ovariectomy. *denotes age effect; † denotes OVX effect (p<0.05)...... 70

Table 5-1: Primers for detection of human and mouse ERβ...... 90

Table 6-1: Baseline morphological and functional characteristics; OVX, ovariectomized; LV left ventricle; EDP end diastolic pressure; LVDP left ventricular developed pressure; dP/dt first derivative of LVDP. *denotes different from adult; † denotes different from aged; p<0.05; n=7-11/group...... 109

Table 6-2: Body weight and food consumption in chow and Lieber-DeCarli fed rats. OVX, ovariectomized; *denotes different from adult chow; † denotes different from adult Lieber-DeCarli; p<0.05 ...... 116 .

xv

LIST OF ABBREVATONS

ACC ...... acetyl-CoA carboxylase

AdipoR1 ...... Adiponectin Receptor 1

AdipoR2 ...... Adiponectin Receptor 2

AF ...... activation function

AMPK ...... adenosine monophosphate-activated kinase

AP-1 ...... activator protein 1

APN; acrp30; apM1; GBP 28 ...... adiponectin

APNKO ...... adiponectin knock out

APPL1 …………………………………………………………………...adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif 1

Ar ...... aromatase

ArKO ...... aromatase knock out

ATCC ...... American Type Culture Collection

BPA ...... bisphenol A

C1q ...... compliment 1q

CDE ...... clatherin dependant endocytosis

CEE ...... conjugated equine estrogen

CHD ...... coronary heart disease

COX ...... cyclooxygenase

DBD ...... DNA binding domain

DsbA-L ...... disulfide oxidoreductase A-like protein

xvi DPN ...... diarylpropionitrile

E2 ...... estrogen

ECL ...... enhanced chemiluminescence

EDL ...... extensor digitorum longus

eNOS ...... endothelial nitric oxide synthetase

ER ...... estrogen receptor

ERE ...... estrogen response element

ERKO...... estrogen receptor knock out

ERT ...... estrogen replacement therapy

Ero1-lα ...... endoplasmic oxidoreductin-1-like

Erp44 ...... endoplasmic reticulum protein of 44KDa

Erp46 ...... endoplasmic reticulum protein of 46KDa

EtOH ...... ethanol

F344 ...... Fischer 334

FCS ...... fetal calf serum

GAPDH ...... gylceraldehyde 3 phosphate dehydrogenase

GLM ...... general linearized model

GLUT1 ...... glucose transporter1

GLUT4 ...... glucose transporter4

gp91phox ...... superoxide generating subunit of NADPH oxidase

GPCR ...... G-protein coupled receptor

HEK293 ...... human embryonic kidney 293

HERS ...... Heart and Estrogen/Progestin Replacement Study

HMW ...... high molecular weight adiponectin

xvii HRP ...... horseradish peroxidase

Hsp ...... heat shock protein

ICI ...... anti-estrogen

I/R ...... ischemia/reperfusion

IT ...... ischemic tolerance

KEEPS ...... Kronos Early Estrogen Prevention Study

LBD ...... ligand binding domain

LKB1 ...... AMPK kinase

LMW ...... low molecular weight adiponectin

LPL ...... lipoprotein lipase

LV ...... left ventricle

LVDP ...... left ventricular developed pressure

MAPK ...... mitogen-activated protein kinase

MMW...... medium molecular weight adiponectin

MPP ...... methyl-piperidinyl-pyrazole-dihydrochloride

NADPH ...... nicotinamide adenine dinucleotide phosphate

N-CoR ...... nuclear receptor corepressor

NFΚB ...... nuclear factor Κ B

NHR ...... nuclear hormone receptor

NO ...... nitric oxide

OVX ...... ovariectomy/ovariectomized

PAGE ...... polyacrylamide gel electrophoresis pAMPK ...... (active) phosphorylated adenosine monophosphate-activated kinase

PAQR ...... progestin, and adipoQ receptor

xviii PEPI ...... Postmenopausal Estrogen/Progestin Interventions Trial

PG ...... prostaglandin

PGC1α ...... peroxisome proliferator activated receptor γ co-receptor α

PI3K ...... phosphoinosityl-3 kinase

PKA ...... protein kinase A

PKB/Akt ...... protein kinase B/Akt

PKC ...... protein kinase C

PPAR ...... peroxisome proliferator activated receptor

PPT...... propyl-pyrazole-triol

PTM ...... posttranslational modification

PVDF ...... polyvinylidene difluoride

RACK ...... receptor for activated C kinase

RIP140 ...... receptor interacting protein140

RXR ...... retinoic acid receptor

SAS ...... statistical analysis software

SDS ...... sodiumdodecyl sulfate

SERM...... selective estrogen receptor modulator

SMRT...... silencing mediator for retinoic acid and thyroid hormone

Sp1 ...... stimulating protein

SRC ...... steroid receptor coactivator

TIF ...... transcriptional intermediary factor

TNFα ...... tumor necrosis factor α

WHI ...... Women’s Health Initiative

WT ...... wild type

xvii

ACKNOWLEDGEMENTS

I would like to recognize the following individuals for their help and support:

My Doctoral Dissertation Committee

Donna H. Korzick Roger McCarter

Charles H. Lang Ramesh Ramachandran

Past and Present Members of the Korzick Lab

J. Craig Hunter

Jennifer (Novotny) Buchanan Amy (Simpson) Bucher

Timothy S. Lancaster Sarah J. Jefferson

Richard Ball Mary Hutchinson

Jason Tartagni Jennifer Miller-Lee

Daniel Sharda Stephanie Eldred

Gregory Kanski Nicole Arigemma

Veronica Lopez Alexandra (Bobbie) Machikas

Copyright Information

Chapters 3 and 4 are versions of previously published manuscripts which have been reprinted with permission from Blackwell Publishing and Elsevier, respectively.

• N. J. Tomicek, J. L. Miller-Lee, J. C. Hunter, and D. H. Korzick, Estrogen receptor Beta does not influence ischemic tolerance in the aged female rat heart. Cardiovas. Ther. 2011. May:31. • N. J. Tomicek, T. S. Lancaster, and D.H. Korzick, Increased estrogen receptor Beta in adipose tissue is sssociated with increased intracellular and reduced circulating adiponectin protein levels in aged female rats. Gend. Med. 2011. Oct;8(5):325-33.

1

CHAPTER 1

INTRODUCTION TO CARDIOVASCULAR AND METABOLIC DISEASE

IN AGING WOMEN

Ischemic heart disease remains the leading cause of morbidity and mortality in aged women, and incidence is increased 2- to 3-fold following menopause (1). The prevalence of CHD

increases with aging, and it is clear that post-menopausal women experience greater CHD

mortality vs age-matched men (2-7). That E2-deficient post-menopausal women are more vulnerable to myocardial I/R injury vs men suggests a role for E2 in cardioprotection.

Concurrently, the prevalence of obesity and metabolic syndrome also increase with age and post-

menopausal status which conspire to increase CHD risk in aging women (8-14). Animal models of E2-deficiency provide direct evidence that E2 modulates body weight, adiposity, and cardioprotection (15-18). Moreover, ERT reverses adiposity, weight gain, and the loss of cardioprotection in OVX animal models (15, 17-26). However, while ERT also staves off weight

gain in postmenopausal women, clinical trials have failed to demonstrate the cardioprotective

benefit observed in adult OVX animals (27-34). ERT is currently contraindicated as a therapy for

postmenopausal women not only due to lack of efficacy, but also because some studies indicate

ERT increases the incidence of adverse cardiovascular events (30-34). Given that most animal

models utilized in ERT studies are adult, and not aged, suggests the adult OVX animal does not

properly model menopausal E2-deficiency. The combined effects of aging and E2-deficiency

2 together increase metabolic and cardiovascular disease risk in aging women and further study is

needed to elucidate adequate therapies to treat CHD in the aged E2-deficient heart.

ERs are distributed throughout the body, and positively regulate metabolism in adipose and skeletal muscle in response to E2 (16, 20, 21, 35-49). Moreover, ER polymorphisms are

linked to metabolic and CHD risk in women indicating that systemic ER signaling disruptions

may contribute to the development of metabolic and cardiovascular disease states (50-54).

Studies in animal models have directly shown ERs impact adiposity, metabolism, and promote

tolerance to I/R injury in the myocardium (16, 20, 21, 24, 42-47, 55-59). In vivo, E2 mediates the

majority of its effects via two receptors, ERα and ERβ. While ERα is relatively well studied, the specific functions of ERβ are not completely understood. ERβ acts in adipose tissue and may play a role in modulating metabolism and CHD risk (60, 61). Furthermore it has been proposed that

ERβ, like ERα, can act directly at the myocardium to confer cardioprotection (55, 57, 58, 62).

Gaining a better understanding of the function(s) of ERβ in metabolism and cardioprotection in a

setting of aging and E2-deficiency may lead to the development of relevant therapies for postmenopausal women.

In addition to being E2 responsive, adipose tissue is known to secrete hormonal factors known as adipokines that modulate metabolism and cardioprotection (63-65). APN, is an adipokine that promotes metabolism, and cardioprotection via its anti-diabetic, anti-inflammatory, anti-atherogenic, and anti-apoptotic effects on the body (66-86). However, aging women have paradoxically high APN levels, yet are not protected from ischemic injury (87-92). In animal models of metabolic disease and aging, APN-resistance has been observed and is attributed to both reduced receptor presence and attenuated downstream signaling capacity (93-95). Currently, it is unknown if the tendency toward metabolic dysregulation and reduced ischemic tolerance (IT) observed in aged women is linked to and exacerbated by APN-resistance in cardiac tissue. In the studies contained within Chapters 3, 4, 5, and 6 ERβ and APN are examined in a female rat

3 model of aging and OVX to elucidate potential disturbances associated with cardiac and metabolic disease.

Statement of the Problem

The incidence of and mortality due to ischemic heart disease is increased in women following menopause implicating the loss of E2 as a major cause of reduced ischemic tolerance.

The failure of ERT to reduce cardiovascular risk in postmenopausal women, however, necessitates investigation into alternative therapeutic strategies for the treatment of ischemic heart disease in aged women. A greater understanding of the causative alterations surrounding age- associated E2-deficiency and the loss of cardioprotective reserves is necessary to generate effective therapies for postmenopausal women. Aging women gain weight secondary to increased adiposity with menopause and it is thought that altered metabolism in metabolic tissues may be a

driving force in increasing CHD risk in postmenopausal women. The combined effects of aging

and E2-deficiency contribute to a unique high risk state for metabolic dysregulation and

cardiovascular mortality in aged women. CHD risk and mortality may be mediated through

adverse changes in adipose metabolism associated with ER-signaling disruptions as well as

attenuated responses to the cardioprotective adipokine, APN. Targeted studies are needed to

better understand the impact of metabolic dysregulation and adipose metabolism on CHD

morbidity and mortality.

Specific Aims and Hypotheses

Specific Aim 1. To determine the effects of acute ERβ activation on I/R injury in adult, aged, and aged OVX female rats.

4 Hypothesis 1.1 ERβ is present in the adult and aged female F344 rat myocardium.

Hypothesis 1.2 Acute ERβ activation will improve cardiac functional recovery following

I/R injury in adult, aged, and aged OVX female F344 rats via non-genomic signaling

mechanisms.

Specific Aim 2. To determine the singular and combined effects of aging and E2-

deficiency on ER isoform distribution in visceral adipose tissue and skeletal muscle isolated from

female rats. Also, to characterize alterations in the downstream ER target APN in adipose tissue.

Hypothesis 2.1 ERβ protein abundance is increased, and ERα protein abundance is decreased in the skeletal muscle of F344 female rats with age- and OVX- related weight gain relative to adult ovary-intact controls.

Hypothesis 2.2 ERβ protein abundance is increased, and ERα protein abundance is decreased in the adipose tissue of female F344 rats with age and OVX-related weight gain relative to adult OVX and adult ovary-intact controls. Also the downstream target APN is reduced in aged OVX female F344 rats relative to adult OVX and adult ovary-intact controls.

Hypothesis 2.3 Overexpression of ERβ in vitro will directly reduce APN expression in differentiated 3T3-L1 adipocytes thus providing a mechanistic link between ERβ and APN.

Hypothesis 2.4 AdipoR1 and AdipoR2, and AMPK will be reduced in the adipose tissue of aged

OVX rats relative to adult ovary-intact controls thus providing an additional mechanism for metabolic derangement.

Specific Aim 3. To determine if aging and E2-deficiency is associated with APN resistance in the female rat myocardium.

Hypothesis 3.1 APN treatment will improve functional recovery following I/R injury in aged OVX female F344 rats relative to adult ovary-intact controls.

5 Hypothesis 3.2 Aging and OVX will be associated with compensatory increases in cardiac AdipoR1 and AdipoR2 protein levels in order to promote APN signaling relative to adult ovary-intact controls.

Hypothesis 3.3 Downstream AdipoR target AMPK will be reduced in the aged myocardium relative to adult ovary-intact controls thus suggesting alternative modes of APN action in the aged myocardium.

6

CHAPTER 2

REVIEW OF THE LITERATURE

The leading cause of death in aged women is CHD, and mortality is greater in post-

menopausal women vs age-matched men (1-7). That E2-deficient post-menopausal women are particularly vulnerable to ischemic injury suggests a role for E2 in cardioprotection. Concurrently, the prevalence of obesity and metabolic syndrome also increases following menopause and these co-morbidities conspire to increase CHD risk in aging women (8-14). However, aging and E2- deficiency interact in a complex fashion in aging women and development of adequate therapies

to treat CHD has been both challenging and unsuccessful. Case in point, while ERT staves off

weight gain and reverses metabolic complications in post-menopausal women, CHD risk is not

improved (27-34).

The failure of ERT and lack of alternative therapies has spurred a more detailed

investigation of the ERs: ERα and ERβ. Both ERs are directly implicated in modulating

metabolism and cardioprotection and often function to antagonize one another. The function of

ERβ in the heart is not well understood and targeted activation may reveal a role for ERβ in

cardioprotection. The role of adipose and its secreted factors, like the adipokine APN, has also

garnered recent attention in modulating CHD risk and may be an additional target for therapeutic

intervention. Circulating APN is negatively correlated with CHD risk and confers

cardioprotection (66-86). Interestingly, APN and ERβ may be linked via a common signaling

pathway in adipocytes. Current evidence indicates both ERβ and APN can act directly at the

myocardium to promote IT as well as indirectly modulate CHD risk by impacting metabolism and

associated adiposity in peripheral tissues. The efficacy of ERβ activation and APN treatment in

7 protecting the aging female myocardium is addressed in subsequent chapters. The current body of

literature implicating ERβ and APN in cardiac and metabolic disease is reviewed herein.

Introduction to Estrogen Receptors

The lack of cardioprotection afforded by ERT has forced a more thorough examination of

downstream E2 signaling mechanisms. To date, extensive research has been conducted on ERs

and their roles in metabolism and cardiac function. ERs were originally described as ligand-

inducible transcription factors belonging to the family of nuclear hormone receptors (NHR)s (96).

Two predominant ER isoforms exist, ERα, the original ER, characterized in 1986 and ERβ which

was discovered in 1996 (97, 98). ERα and β have overlapping, yet unique roles in E2 signaling.

Both ERα and β have similar binding affinity for E2 and are capable of direct transcriptional regulation of target genes containing E2 response elements (ERE)s as well as modulation of

transactivation/repression activity of secondary transcription factors like activator protein-1 (AP-

1) and stimulating protein 1 (Sp1) (99-103). In addition to classical nuclear transcriptional

regulation, ERs have been shown to exert effects via novel mechanisms including ligand-

independent signaling and rapid non-genomic signal transduction (24, 60). The differential

expression of ERs in target tissues also explains the wide variety of responses evoked by E2 in target tissues. In many instances ERβ antagonizes the effects of ERα, however some genes are controlled solely by ERβ (104). For example, while most tissues express both ERs in varying proportions, prostate tissue only expresses ERβ (105). However, despite a clear characterization of its structure and relative tissue distribution, the specific functions of ERβ are not well understood. To date, theories on functional activity of ERβ are derived from insights on ERα, and

our knowledge is therefore limited and in some cases flawed. The lack of reliable commercially

available antibodies for ERβ in rodent tissue and absence of a dependable ERβ expressing cell

8 culture model has made ERβ study challenging. Nevertheless, transgenic animal models and

highly selective ER agonists have paved the way for ERβ study which has helped us to begin to

understand the function of ERβ in health and disease. Herein we have utilized the selective ERβ

agonist, DPN, to acutely activate ERβ in female rats and 3T3-L1 cells. In Chapter 3 we assess the

cardioprotective effects of acute ERβ activation prior to I/R injury in the adult, aged, or aged

OVX female rat heart. In Chapter 5 we assess the effects of ERβ activation on APN production in

adipose-like 3T3-L1 cells.

Estrogen Receptor Structure

ERs share a common structure with members of the NHR family. The basic ER protein

structure is divided into six domains designated A-F from N-terminus to C-terminus, respectively

(106, 107), see Figure 2-1. ERα has two activation function (AF) domains which are designated

AF-1 (A/B domain) and AF-2 (E domain), whereas ERβ contains the AF-2 domain only. The AF-

1 domain in ERα is constitutively active and involved in transactivation function, while the

corresponding region in ERβ shares less than 20% homology and can function weakly in

activation (106). Conversely, some have described the function of A/B domain in ERβ as a

repressor eluding to the antagonistic activities of ERα and β observed in some tissues/cell types

(108). For both ERα and ERβ the AF-2 is activated via a ligand-dependent mechanism and is

important for the recruitment of ER coactivators and/or corepressors. The DNA binding domain

(DBD; contained within the C domain) is the most highly conserved region (>90%) between both

ERs and thereby explains the overlap in E2-responsive gene regulation (109). The D domain is

also known as the hinge domain, and is not well conserved with only 30% homology, while the E

domain contains the aforementioned AF-2/ligand binding domain (LBD) and is moderately

9 conserved at 60%. Finally, the function of the F domain has yet to be defined and the sequence

homology between ERs is less than 20% (104).

Figure 2-1: Comparison of domain structures of ERα and ERβ. ERs have six domains, A–F, and the number of amino acids in these domains, as well as the functions associated with these domains, are indicated for ERα and ERβ. The activation function (AF) domains AF-1 and AF-2 are indicated in the A/B and E domains. The degree of homology between ERα and ERβ in the C and E domains is indicated; from Hewitt et al (2005).

Additionally, human ERβ has 5 known splice variants which are the result of alternative splicing at the C-terminus affecting exons 7 and 8 (110, 111). The molecular weight of the each

ERβ splice variant (1-5) is 59, 56, 54, 54, and 53 kDa, respectively; ERα is 67 kDa. ERβ1 is also

known as the long form, or original ERβ, and has full activity. ERβ2 also known as ERβcx, has

been shown to act as a dominant negative of ERα (108, 112). ERβ3 expression appears to be limited to the testis (105, 111). The short forms of ERβ4 and ERβ5 are present in great abundance

and are as widely distributed throughout the body as ERβ1 (105). However, due to the truncation

at the C-terminus, the ER splice variants ERβ2, ERβ4, and ERβ5 lack complete AF-2/LBDs and

therefore cannot function alone or as homodimers (105). Instead, to exert their effects the splice

variants must partner with full length ERβ1 to form functional heterodimers (105). Similar splice variants have also been reported in rodent tissues. Just as in humans, the classical or long form is known as ERβ1 in rodents and rat ERβ2 has an insertion in the ligand binding domain which

10

differs from the C-terminal deletion in human ERβ2 (113). Two additional rat splice variants have

been reported which have deletions in the DNA binding domain and are denoted ERβ1 –δ3, and

ERβ2 –δ3 (113). Rat ERβ1 and ERβ2 have similar tissue distributions throughout the body and are

likely fully functional, although ERβ2 has a slightly lower binding affinity for E2. ERβ1 –δ3 and

ERβ2 –δ3 have lower DNA binding affinity as a result of their deletions, yet like the human splice

variants, the rat ERβ1 –δ3, and ERβ2 –δ3 may still be capable of activity if they heterodimerize with the full length rat ERβ1 or ERβ2 (113).

Estrogen Receptor Activation

ERs belong to the NHR family and are further sub classified as type I nuclear receptors

(96). Upon ligand binding, type I receptors translocate from the cytosol to the nucleus and subsequently modulate transcription of genomic DNA. ER activation modulates a wide array of genomic responses in target tissues and cells. To date, at least eight distinct mechanisms have been described that contribute to the widely diverse function of ERs including: 1) epigenetic events modulating available EREs; 2) expression of coregulators and corepressors; 3) the relative

ERα/β ratio; 4) the presence of splice variants; 5) the relative availability of circulating E2; 6) the

relative composition of the E2 milieu (i.e. estradiol, vs estrone, or estriol); 7) presence of non-E2

ER agonists/antagonists; and 8) complexity of various ER promoters. Thus, the numerous

mechanisms governing ER function partially explain the diverse potential for regulation of ER

target genes and also underscores the difficulty associated with the study of ERs. Moreover,

following their initial characterization as classical nuclear receptors, ERs have been discovered to

signal in additional unpredicted ways atypical of most NHRs. ERs can activate rapid non-

genomic signaling cascades and in some cases can signal in the absence of ligand. That ERs are

11 capable of both genomic and non-genomic signaling with and without ligand adds additional

complexity and diversity to the array of responses elicited by E2 in target tissues.

Estrogen Receptor Activation: Genomic Mechanisms

Genomic ER activation is the classical mode of NHR activation and results in the

transcription or repression of target genes. Specifically, genomic activation is initiated by

ligand/agonist binding followed by receptor dimerization. Dimerization triggers ER release from

stabilizing heat shock proteins (hsp)70 and hsp90 and nuclear corepressors, nuclear receptor

repressor (N-COR), silencing mediator for retinoic acid and thyroid hormone (SMRT), and nuclear receptor interacting protein (RIP140) (114). A variety of coactivator proteins including members of the steroid receptor coactivator (SRC) family SRC1, SRC3, and transcriptional intermediary factor 2 (TIF2), take the place of exiting corepressors and enable ERs to become fully activated. ERβ interacts with both SRC and TIF2 in adipose tissue to modulate transcriptional activity of metabolic regulatory genes (60). Activated ERs translocate from the cytosol to the nucleus and target EREs containing DNA promoters. To complete classical genomic activation, ERs directly up or downregulate target genes containing EREs.

To date, over 30 coregulators (activators and repressors) have been observed to interact with ERs. Commonly associated cofactors include the aforementioned TIF2 and SRC proteins, as well as members of the p160 family. Proteins belonging to the p160 family bind ER AF-1 and

AF-2 domains and bring ERs into contact with other cofactor proteins, thereby leading to

enhancement or repression of DNA binding/transcriptional activity (115, 116). Repressors of the

AF-2 domain include RIP140 and TIF1 (115). Peroxisome proliferator-activated receptor γ

coactivator-1α (PGC-1α) is a tissue-specific coactivator that strongly enhances the activity of

many NHRs including both ERs. Differential cofactor binding is responsible for much of the

12 temporal and tissue-specific diversity observed with ER activation. In many tissues ERα and β

antagonize one another and often ERα upregulates while ERβ downregulates gene expression.

For example, approximately 90% of genes downregulated by E2 are ERβ-dependant in murine aorta (117).

Alternatively, ERs can also genomically regulate transcription of genes that do not

contain EREs through a process called transcription factor cross-talk. Ligand-bound ERs can

couple with c-fos, c-myc, and c-jun adaptor molecules to regulate a broad range of genes

including those containing AP-1 or Sp1 sites (101, 103, 118-120). The E2-mediated suppression of lipoprotein lipase (LPL) expression observed in adipose tissue is mediated by an AP-1

dependent mechanism (121).

E2 can also regulate levels of ERs per se. ERs do not have EREs in their promoter regions and they too are regulated by transcription factor cross-talk via stimulation of AP-1 and Sp1 sites

(103, 115). In general, E2 upregulates ER expression, but depending on the collective

transcription factor milieu and proteosomal degradation rates in a given tissue, the ER response to

E2 can vary (40). Specifically, E2 upregulates ER expression in liver and adipose, but can

downregulate expression in the uterus and cerebral cortex (40, 122-124). In the heart, short-term

(4-5 h) exposure to E2 downregulates ER expression, yet chronic exposure delivered via daily injections increases myocardial ER expression (125, 126).

Finally, phosphorylation status of the ER also modulates transcriptional activity both independent of and in response to ligand activation (127, 128). In the case of classical genomic ligand-dependant activation, enhanced phosphorylation of ERα can occur in response to physiological doses of E2 (127, 129-131). The enzymes responsible for E2-dependent phosphorylation of ER are diverse and include an E2-dependent tyrosine kinase as well as unspecified kinases (129, 132-134).

13 Estrogen Receptor Activation: Non-genomic Mechanisms

In addition to classical genomic signaling, ERs have also been shown to rapidly activate

intracellular signal transduction pathways in cardiac, vascular, skeletal muscle, and adipose

tissues (135-137). Rapid, or non-genomic, ER signaling starts with ER activation at the plasma

membrane (137-145). Surprisingly, both “nuclear” ERα and β proteins can localize to the plasma

membrane and participate in signaling cascades (146-149). For plasma membrane targeting ERα

and β both require palmitoylation before anchoring to the membrane protein, cavelolin-1 (137,

140, 142, 150). Stimulation of membrane bound ERs with E2 activates calcium ion channels, nitric oxide (NO) production and protein kinases (151, 152). Specifically, ERs non-genomically activate the phosphoinositol-3 kinase (PI3K) and mitogen-activated protein kinase (MAPK) signaling cascades and promote protein kinase A (PKA) and protein kinase C (PKC) activation

(99, 153). In the heart, rapid ERα activation activates and preserves PKC signaling associated with cardioprotection from I/R injury (24). It has been speculated, but it is unknown, if rapid activation of ERβ in the rat heart can similarly confer cardioprotection via non-genomic signaling. Both ERs were demonstrated capable of rapid non-genomic signaling in the in vitro neonatal rat ventricular myocyte model (154). However, findings are at odds with data from in vivo murine and rabbit models demonstrating no cardioprotective benefit of acute ERβ activation prior to I/R injury (55, 155). Thus it is necessary to determine if there are developmental/species differences regarding the non-genomic signaling capacity of ERβ in the adult myocardium. This issue will be addressed in Chapter 3 utilizing the F344 female rat model.

In addition to the classic ERs, an E2-responsive G-protein coupled receptor (GPCR) 30 has also been described. While GPCR30 was discovered in 1996, it was not until 2005 when its role in E2 signaling was first realized. Studies on GPCR30 are still limited, but like ERα and β

GPCR30 is capable of rapid activation of kinases including PI3K and MAPK cascades (156,

14 157). GPCR30 has been identified in cardiac and skeletal muscle and has been implicated in

cardioprotection in rat models and therefore adds additional complexity to studying the independent and combined effects of each ER (158, 159).

Estrogen Receptor Activation: Ligand Independent Mechanisms

ERs are also capable of ligand-independent signal transduction. Microarray studies have revealed that in the absence of ligand, ERβ either stimulated or suppressed the activity of a

number of genes that were normally only regulated by ERα in the presence of E2 (160). Both posttranslational modifications (PTM)s as well as transcription factor availability appear to be two main modulators of ligand independent ER activity. Specifically, PTMs, like phosphorylation, can be an impetus for ER/ERE binding and transcriptional activity (161, 162).

Both ERs have multiple PTM sites which modulate ER activity. ERα sites include: serines 102,

104, 106, 118, 154, 167, 236, 305, 559; threonine 311; and tyrosines 52, 219, 537 (128, 129, 134,

161-180). In general, serine phosphorylation is associated with enhanced transcription factor binding (165, 181, 182). Tyrosine 537 phosphorylation on ERα has been implicated in ligand- independent signaling via a MAPK-dependant mechanism (183, 184). ERβ has fewer known

PTM sites which include: serines 94, 106, 124, 225 (161, 181, 185, 186). Acetylation and methylation also modulate ER activity by enhancing and suppressing activity, respectively (116,

187).

Transcription factors also influence ER activity independent of ligand binding. In adipocytes, unbound ERβ interacts with the factors SRC and TIF2 promoting downregulation of peroxisome proliferator-activated receptor (PPAR)γ transcriptional activity (60, 188, 189). Along these lines the retinoic acid receptor (RXR) and PPARγ can also work to downregulate ER activity by binding and blocking EREs from ERs (188, 189). Collectively these findings indicate

15 transcription factor availability differentially modulates NHR activity in adipose tissue. In

Chapter 4 ERβ and PPARγ are assessed in adipose tissue of F344 female rats to characterize

alterations in NHR signaling capacities associated with aging and OVX.

Agonists, Antagonists, and SERMS

Upon discovery of ERβ it became clear that estrogen (17-β estradiol) and the synthetic

anti-estrogen (ICI; Fulvestrant) alone would not be sufficient to study the individual effects of each ER. The discovery of the GPCR30 has also reinforced the need for additional ER specific modulators. 17-β estradiol is the major physiological E2, but it has a similar affinity for both ERs.

Thus, a number of selective ERα and β agonists have been created and described; however, only a

minority have been evaluated extensively in vivo. ERα targeting compounds include the agonists propyl-pyrazole-triol (PPT) (21, 190) and 16α-LE2 (191), and the antagonist methyl piperidinylethoxyphenol-pyrazole dihydrochloride (MPP). ERβ specific compounds include the agonists DPN (192), ERB-041 (193), WAY-202196 (194), WAY-200070 (193), and 8β-VE2

(191). Currently, ERβ agonists and antagonists are a heavily utilized tool in ER research given the

lack of reliable commercially available antibodies for ERβ in rodent tissue and lack of dependable

cell culture models.

Selective estrogen receptor modulators (SERMs) are also of great utility and act

differentially as agonists and antagonists in a given tissue. Tamoxifen and raloxifene are the most

widely used SERMS. Tamoxifen, for example, is an antagonist in breast tissue, but an agonist in

bone and thus has utility in treating breast cancer and/or osteoporosis. In skeletal muscle

tamoxifen antagonizes ERβ and may be useful in treating metabolic disease in the future (46). An

adipose- or cardiac-specific SERM has yet to be developed.

16 A number of natural compounds also have affinity for ERs and have been utilized in ER

research. Phytoestrogens are plant derived estrogens; genistein, an isoflavone, for example has

great affinity for ERβ and has been widely utilized (195). Xenoestrogens, also known as environmental estrogens, are found in plastics. Bisphenol A (BPA) is found in polycarbonate plastic used for consumer products and has been suggested as a potential driving force for promoting obesity and diabetes via ER-dependant mechanisms (196). In the heart, BPA is pro-

arrhythmic and signals via ERβ in mice (197). Phytoestrogens, E2, SERMs, and the ERα agonist,

PPT, but not ERβ agonists positively impact metabolism by modulating energy balance leading to improved lipid profiles and insulin sensitivity (18, 198-203). Chronic DPN administration has

been implicated in improving the response to trauma hemorrhage, and reducing hypertension and ischemic damage in rodent models (55, 204-206). In Chapter 3 DPN is utilized to acutely activate

ERβ systemically in the F344 female rat. The purpose of the DPN treatment is to characterize

ERβ-mediated cardioprotection in the myocardium.

Distribution of Estrogen Receptors and Expression

Although ERs were first characterized in both male and female reproductive tissues (97,

98), it is now known that ER expression is distributed throughout the body including, but not

limited to the gonadal tract, breast, testis, bone, skeletal muscle, liver, adipose tissue,

myocardium, vascular endothelium, smooth muscle, and the central nervous system (35-41, 207).

Most tissues express both ERs, but relative levels of each vary thus contributing to the diversity

of E2 responses described in target tissues. ERα predominates in the gonadal tract, kidney, bone, adipose, skeletal muscle, and liver. In contrast, ERβ expression is more pronounced in the ovary,

prostate, testis, salivary glands, vascular endothelium, smooth muscle, lung, gastrointestinal tract,

bladder, immune system, and central and peripheral nervous system (208, 209). Sex, aging, and

17

menopausal status are associated with varied ER expression, and E2 is a known modulator of both

ER expression as well as tissue distribution (40, 210-214). Myocardial ERα, but not ERβ, is

reduced with aging in female spontaneously hypertensive rats (126). Epidemiological data is

conflicting, but reduced ERα gene expression in the myocardium of female coronary artery

bypass patients has been documented (187). In adipose tissue, ERα is reduced with both E2-

deficiency and diet-induced obesity in both animal models and obese women (215, 216). ERβ

increases in adipose with aging in both women and animal models (40, 207, 217, 218). Tipping

the ERα/β balance in favor of ERβ is hypothesized to elicit detrimental consequences affecting

weight gain, metabolic disease and cardiovascular risk with aging linked to dysregulated

signaling in adipose and other tissues.

Estrogen Receptor Knock Out Mice

Transgenic whole body knockout mice null for ERα and/or ERβ have provided additional insight regarding ER tissue localization and key functions. From the phenotypes of the ER null mice, it is clear that ERs play a significant role in metabolism and adiposity as well as impact the myocardial response to I/R injury. Currently, there are four independently constructed and utilized ERα and ERβ knock out (αERKO and βERKO) mice. The models developed include the

αERKOCH and βERKOCH mice were produced in Chapel Hill by Krege et al. (219); βERKOKI

mice which were established at the Karolinska Institute; αERKOST and βERKOST mice were produced by Dupont et al. in Strasbourg, France (220); and βERKOWYE mice generated by Wyeth

(221). Dupont has also produced a double ERKO model, (α/βERKOST) (220, 222). Slight disagreements in ERKO characterizations exist and most are due to the fact that αERKOCH mice are incomplete KOs whereas the other αERKO models are completely null for ERα (220).

However, the bulk of cardiac functional studies have been conducted in the Chapel Hill KO mice

18 so the cardiac phenotypes and responses discussed herein are consistent. βERKO mice generated

in Chapel Hill, Strasbourg, and by Wyeth are completely null for ERβ and descriptions are in

agreement (219-221).

In addition to the expected reproductive derangements and infertility experienced by male and female ERKO mice, there are also metabolic derangements. αERKO mice exhibit profound insulin resistance, impaired glucose tolerance, and adipocyte hyperplasia and hypertrophy which worsens with aging (61, 223, 224). In contrast, βERKO mice have a similar body weight and equal fat distribution, as well as normal circulating lipid and insulin levels (60,

225). These findings indicate ERα signaling is critical for maintaining normal metabolic balance.

However, a more thorough investigation of the βERKO phenotype has revealed that ERβ acts to maintain a basal level of adiposity and both ERs antagonistically regulate adiposity (61, 224). A detailed description of the role of ERs in regulating metabolism and adiposity is described in the

Estrogen and Metabolism section.

ERKO mice have also implicated both ERs in cardioprotection. αERKOCH mice subjected to I/R injury show increased damage compared to wild type (WT) mice (59, 226).

Similarly, βERKOCH mice also experience greater I/R injury and additionally develop

hypertension and cardiac hypertrophy (55, 57, 227). However, it is important to note that ERKO

models are whole body and not tissue specific so developmental abnormalities may confound

observations made herein about the integrative function of ERs on metabolism or the

cardiovascular system under ischemic stress. Thus, although we have gleaned much from ERKO

models, careful interpretation and additional studies are needed to tease apart the specific effects of each ER in a given tissue/system.

19 Estrogen and Metabolism

It is well established that E2 has a profound effect on food intake, energy balance, body weight, and adiposity and that E2-deficiency predisposes postmenopausal women to weight gain and increased adiposity associated with changes in metabolism (228-232). The metabolic syndrome is a constellation of risk factors including hypertension, impaired fasting glucose, dyslipidemia, and central obesity which all have their own negative implications on health as well as collectively conspire to increase CHD risk. Currently, 25% of the U.S. population is afflicted with metabolic syndrome and the incidence increases with aging such that prevalence is 44% for those 50 years of age and over (233). Moreover, like CHD risk, E2-deficient postmenopausal women are predisposed to metabolic syndrome and more women are afflicted vs age matched men. It is now clear the loss of E2 at the time of menopause has profound implications on whole body health and clearly drives metabolic and cardiovascular disease states.

The first evidence of the effects of E2 on metabolism came from aromatase knockout

(ArKO) mice which have a compromised ability to produce E2 from androgens and therefore have whole body E2-deficiency (229-231, 234). ArKO mice exhibit marked glucose intolerance accompanied by increased adiposity and pronounced insulin resistance, but do not demonstrate hyperphagia or reduced energy expenditure (229-231). In addition to ArKO mice, OVX rodent models are utilized to study the effects of E2-deficiency/ERT on metabolism. Postmenopausal E2-

deficiency, resulting from reproductive senescence is better modeled by OVX rodents because

they retain the capacity to interconvert androgens to E2 in the peripheral tissues, adipose and

adrenals. ArKO mice lack any capacity to produce E2 (231, 235). Noteworthy, most rodent chow

contains phytoestrogens which may allow for low levels of ER activation and ArKO mice on a

phytoestrogen-free diet experience more severe metabolic phenotypes (236). In line with these

findings, OVX rodents have less severe metabolic complications vs ArKO mice, but do display

20 increased body weight secondary to increased fat mass (237, 238). Over time, OVX rats develop

dyslipidemia, impaired glucose tolerance, and impaired insulin-mediated glucose uptake which can be improved with ERT (17, 239, 240). Interestingly, increased food intake is sufficient, but not necessary for OVX-induced weight gain; OVX rats pair-fed to match ERT-treated OVX rats still gain as much body weight as ad libitum fed controls (241, 242). The control E2 exerts on

body weight and composition appears to be more closely tied to fatty acid metabolism and inhibition of lipid storage, compared to hyperphagia per se. The fact that ArKO mice do not demonstrate hyperphagia with metabolic derangements further supports this idea (230). E2

clearly plays a crucial role in glucose and lipid metabolism in metabolic tissues, yet the molecular

mechanisms underlying this protective role of E2 remain incompletely understood. Both ERs are

found in adipose and skeletal muscle and their roles in modulating metabolism are discussed

herein.

Regarding insulin sensitivity, it is well established that physiological concentrations of E2

preserve normal insulin responses while deficiency results in insulin resistance. The most

conclusive evidence of the effects of E2on insulin actually comes from men with aromatase and

ERα polymorphisms. Afflicted men have no capacity to signal via ERα and display insulin

resistance and/or glucose intolerance (243, 244). The same insulin resistance is observed in OVX

and αERKO animal models (223, 230, 245). Transgenic αERKO mice have a phenotype marked

by skeletal muscle insulin resistance, skeletal muscle lipid accumulation, and impaired hepatic

glucose regulation (223, 246). Consistent with these findings, ERα activation has been implicated

in reversing insulin resistance in both dietary and genetically obese mice via suppression of lipid

accumulation (198, 199, 240, 247). OVX in αERKO mice improves insulin signaling by ablation

of detrimental unopposed ERβ signaling (61). Although some studies are conflicting, evidence

from the Women’s Health Initiative (WHI) trial and other cross-sectional studies indicate that the

prevalence of early insulin resistance and glucose intolerance increases with menopausal E2-

21 deficiency (248-251). ERT given in physiological doses improves metabolic complications in

postmenopausal women; curiously though, supraphysiological or high E2 levels are associated with increased risk of metabolic disease and even diabetes in aged women (252-254).

The F344 Rat as a Model of Metabolic Disease and Aging

The F344 rat is characterized as a model of chronic insulin resistance and appropriate for studying aging in a setting of mild metabolic disease (255). In Chapters 3, 4, and 6 we utilize the

F344 rat to model aging and postmenopausal E2-deficiency with intact and OVX rats. Relative to the Sprague-Dawley strain, the F344 rat gains more adipose mass/g body weight with maturity

and significant differences in adiposity are observed as early as 4 months of age (256, 257).

Increased adiposity is attributable to both increased caloric consumption and more efficient

caloric storage of energy as fat relative to Sprague-Dawley rats (257). The capacity to efficiently

store fat with comparatively less weight gain relative to Sprague-Dawley rats is likely the reason

F344 rats have been previously described as weight stable. However, with advancing age at 12

and 26 mo weight gain and adiposity is significantly increased vs rats aged 6 mo in both male and

female F344 rats (258, 259). Life expectancy of F344 rats is 29 mo, with maximal survival

expectancy 36 mo (260, 261).

The metabolic F344 phenotype is observed as early as 4 mo in rats consuming a standard

chow diet. Rats demonstrate increased lipid accumulation in skeletal muscle and liver, reduced

expression of liver fatty acid oxidation enzymes, and a 15% increase in gonadal fat pad size, vs

age-matched Sprague-Dawley rats (256). Moreover, at both 2 and 4 mo F344 rats have 2-3 fold

elevations in insulin, glucose, and free fatty acid concentrations during both fasted and fed states

relative to Sprague-Dawley rats (256). Interestingly, glucose-stimulated insulin release in whole

perfused pancreas is not exacerbated with aging in either gender (258). Thus although F344 rats

22 are considered an insulin-resistant model relative to other rat strains aging does not exacerbate

their condition. The F334 rat is a unique model for studying aging in conjunction with a

consistent metabolic phenotype.

Skeletal Muscle and Estrogen Receptors

Glucose disposal in response to postprandial insulin secretion is mainly mediated by

skeletal muscle. Derangements driving metabolic syndrome and CHD risk may stem from defects

promoting aberrant signaling in skeletal muscle glucose handling. Both ERs are present in

skeletal muscle and E2 signaling impacts glucose handling and metabolism. ERα activation in skeletal muscle mediates protective actions while ERβ activation is diabetogenic. In addition to metabolic complications linked to skeletal muscle fiber dysfunction at the time of menopause, aging women experience a striking decline in total muscle mass and strength (262, 263). The decline in skeletal muscle function occurs at an earlier age than in men and is reversed with ERT, thereby linking skeletal muscle dysfunction to the menopausal transition. The loss of muscle mass and contractile strength accompanied with aging is associated with decreased fiber size and apoptotic cell death. Apoptosis seems to be greater in glycolytic fibers given that senescent muscle is characterized by a transition to a greater population of oxidative vs glycolytic fibers

(264, 265). Loss of individual muscle fibers as well as total muscle mass results in reduced exercise and metabolic capacity and represents an additional risk factor for CHD (266).

At the cellular level both ERs modulate glucose transporter 4 (GLUT4) by regulating its expression and translocation to the cell membrane (267). Defects in GLUT4 translocation, anchoring, or trafficking to the plasma membrane impacts whole body glucose metabolism and directly links ER signaling to insulin sensitivity and metabolism in muscle (268). In skeletal muscle, ERs regulate GLUT4 in an antagonistic fashion; ERα induces whereas ERβ inhibits

23 GLUT4 expression (41, 46). The loss of functional ERα signaling in αERKO mice markedly

reduces GLUT4 expression. However, GLUT4 abundance can be rescued in αERKO mice with

tamoxifen treatment (46). Conversely, tamoxifen antagonizes ERβ in skeletal muscle. Along these lines targeted ERβ activation in E2-deficient ArKO mice also decreases GLUT4 expression

(41). Collectively, these studies indicate that basal ERα signaling is needed to maintain GLUT4 expression, but also emphasizes the dramatic diabetogenic effects of unopposed ERβ action in skeletal muscle. The specific mechanism governing ER modulation of GLUT4 expression depends on interactions with the transcription factors SP1and nuclear factor κB (NFκB) (269,

270). ERα augments SP1 activity thereby promoting GLUT4 expression, while ERβ antagonizes

(99, 103). With regard to NFκB, a repressor of GLUT4 in skeletal muscle, ERα sequesters NFκB

allowing disinhibition of GLUT4 (271, 272). To summarize, ERα-deficiency and or unopposed

ERβ activation decreases GLUT4 expression in skeletal muscle which is linked to impaired

skeletal muscle glucose utilization. Unopposed ERβ signaling is thought to be the driving force

promoting diabetogenic effects leading to metabolic derangements in skeletal muscle.

Regarding ER distribution in skeletal muscle, studies in mice indicate ERα predominates

and its abundance is greatest in glycolytic muscle fibers (273). However data are limited and

often ER gene expression, but not total protein abundance is reported. In OVX mice, ERα gene expression is upregulated in skeletal muscle, yet OVX rats demonstrate no change in ERα (215,

273). Interestingly, however, diet- and OVX- induced obesity decreased ERβ protein abundance in soleus, but not the extensor digitorum longus (EDL) (215). Aging in general is associated with a loss of fast glycolytic fibers and maintenance of oxidative fibers. Thus, the expression of ERs in soleus and other slow twitch muscles may be the most relevant in metabolism in aging humans.

ERα predominates in glycolytic fibers and with aging it is presumable that the decline in glycolytic muscle is also associated with a decline in ERα. A shift in the ERα/β balance in

skeletal muscle could explain increased metabolic syndrome incidence in aged E2-deficient

24 postmenopausal women as well as further link metabolic disease states to CHD risk. In Chapter 4

ERα protein content is assessed in the skeletal muscle of adult and aged F344 female rats with

and without OVX to elucidate the independent and combined effects of E2-deficency on ER

abundance.

Adipose and Estrogen Receptors

The sexually dimorphic pattern of fat distribution observed in men vs women has long

implicated a role for sex hormones in adipose biology. OVX/ERT studies in rodent models have clearly shown E2 controls the relative distribution of adipose between subcutaneous vs visceral

depots. E2-replete premenopausal women have more subcutaneous fat whereas aging E2-deficient postmenopausal women and men accumulate more visceral fat (248, 249, 274, 275). The mechanism by which E2 controls fat partitioning is not completely understood. Wade and Gray provided the first evidence of ERs in adipose tissue in 1978 by demonstrating E2-binding in cytosolic extracts from OVX rats (276). This work was corroborated by several studies demonstrating E2 binding in both whole tissue and isolated adipocytes, then was expanded by the identification of both ERα and β in adipose tissue (20, 40, 44, 49, 61, 277-281). Studies in humans indicate women have a higher concentration of ERs in adipose tissue than men and it is

ERβ that accounts for this difference. The sexually dimorphic variability in ERβ concentration may explain some of the divergence in E2 responses and distribution of adipose observed between

the sexes (214, 279). Moreover, human adipose tissue contains all five ERβ splice variants and

abundance increases with aging which may provide for additional variability in E2 signaling in adipose of aging women (40, 111, 279). However, ERα predominates over ERβ in adipose tissue and OVX influences ERα, but not ERβ expression in adipose (40, 199). Investigations regarding the combination of aging plus E2-deficiency on ERs, however, is unfortunately lacking in much

25 of the animal literature. We address this issue in Chapter 4 and additionally attempt to characterize changes downstream ERβ targets in adipose associated with metabolism and CHD.

The abundance of ERα in adipose paired with the enhanced adiposity observed in

αERKO mice suggests ERα plays an important role in basic adipocyte physiology (223).

Interestingly, it was originally thought that ERβ played no significant function in adipose tissue.

That βERKO mice appear identical to WT mice in terms of weight and adiposity supported this notion (224). However, when metabolically challenged with a high fat diet, βERKO mice are resistant to weight gain and adiposity compared to WT mice (224). Moreover, OVX in αERKO mice attenuates adiposity which indicates unopposed signaling via ERβ, thereby contributing to increases in adipose mass (61). Collectively, these studies not only confirm functional ERβ signaling in adipose tissue, but link enhanced ERβ signaling to adiposity. A clearer indication of the ERβ mechanism of action in adipose was established following the discovery that ERβ

negatively regulates PPARγ, a key regulator of metabolism and adipogenesis (60, 188, 189).

Disruption of the normal ER balance in favor of augmented ERβ signaling has clear implications

for promoting adiposity and should be investigated further in obesity and aging models.

Estrogen and Obesity

Ovarian E2-deficiency in OVX animals, like ER dysfunction, is associated with enhanced lipid accumulation, adiposity, and weight gain (17, 20, 238, 241, 282). According to epidemiological reports in humans, E2-deficient postmenopausal women are predisposed to accrue additional weight and adiposity with aging (283). Interestingly, it is visceral fat which predominates in men and E2-deficient postmenopausal women that is most closely tied to risks for adipocyte pathology, obesity, and metabolic disorders (284, 285). Left unchecked, enhanced adiposity and associated weight gain can progress to overweight and obesity which is currently a

26 serious global health problem (286, 287). In the U.S. alone, 60% of the population are overweight

and 30% are obese (288). Obesity is not only characterized by increased adiposity and fat mass,

but also pathophysiological changes in adipose tissue. Closer characterization of obesity models

indicates that ERα levels are reduced in adipose tissue in association with both OVX-induced

weight gain and diet-induced obesity (40, 207, 215, 217, 218).

E2 signaling at the cellular level has a profound impact on adipose metabolism and lipid storage. E2 suppresses the expression and catalytic activity of lipoprotein lipase (LPL), the rate limiting enzyme controlling lipid storage in adipocytes (121, 282, 289). Reducing lipid storage likely prevents excessive adiposity and weight gain in E2-replete women and it has been similarly

shown that ERT in postmenopausal women specifically reduces LPL activity (290).

Changes in adipose and other metabolic tissues due to E2-deficiency induced weight gain

can drive metabolic disease and has also been linked to increased CHD disease risk. CHD is a

leading cause of mortality associated with obesity and better understanding the links between the

obesity, associated adipocyte pathology, and CHD may lead to therapies for those at risk. In

postmenopausal women, ERT reverses abdominal obesity which is also associated with

improvements in insulin sensitivity and staving off metabolic disease (248). However, ERT use

as a therapeutic has been limited in postmenopausal women due to controversy surrounding its

potential to increase the risk of heart disease.

Estrogen and Heart Disease

Like its risk factors, obesity and associated metabolic disease, CHD is also clearly linked

to E2-deficiency. Prior to menopause the female heart is protected from CHD risk and associated

mortality (2-7). However, CHD mortality rates in aged women actually surpass that observed in men following the menopausal transition (2-7, 291). According to the American Heart

27 Association, since 1984 more women than men have died of heart disease in the US and 53% of total cardiovascular disease deaths occur in women. Thus, endogenous E2 not only functions to

limit CHD risk by promoting normal metabolism and adipocyte function, but also directly

protects the heart from fatal ischemic injury. Studies in rodent models have indicated that ERα

and possibly even ERβ are present and functional in the myocardium. Acute E2 treatment or ERα activation augments IT in adult animals (292-298). Studies utilizing OVX rodents have confirmed that the E2-deficient female heart is more vulnerable to ischemic injury than gonad-intact controls. In line with these findings, ERT or a high phytoestrogen diet can rescue the E2-deficient

heart from ischemic damage (17, 22, 297, 299-303).

Estrogen Replacement Therapy and Heart Disease

Encouraging results from animal studies as well as initial epidemiological reports from

the Nurses’ Health Study and The Postmenopausal Estrogen/Progestin Interventions (PEPI) Trial

indicated ERT as a therapeutic treatment for decreasing CHD risk and acute myocardial

infarction in aged women (31, 291, 304-308). In contrast, mid-stage analysis of two randomized clinical trials, the WHI and the Heart and Estrogen/Progestin Replacement Study (HERS), revealed that conjugated equine estrogens (CEE) alone or CEE plus progesterone did not protect postmenopausal women from infarction, but increased stroke risk (32, 33). Currently, ERT is contraindicated for the treatment of heart disease in postmenopausal women as a consequence of the untoward outcomes of the WHI and HERS trials.

The disparity between the outcomes of the ERT clinical trials prompted a secondary analysis of the WHI trial by partitioning subjects into perimenopausal and aged postmenopausal categories. These data indicate ERT may serve as a cardioprotective agent for women at the menopausal transition, but not aged women (31, 309, 310). The utility for ERT as a CHD therapy

28 in perimenopausal women is under current investigation in The Kronos Early Estrogen

Prevention Study (KEEPS) (34, 311, 312). Regardless of the outcome of this trial, prior evidence

for diminished efficacy and the possible detrimental effects of ERT on CHD risk in aged women

demands the need for alternative therapies.

Part of the failure for ERT to protect the aged E2-deficient myocardium is confounded by the fact that aging occurs concurrently with the menopausal transition. It is well known that the prevalence of CHD increases with aging in both men and women and even normal ‘healthy’ aging is associated with reduced IT. Animal models have revealed the senescent myocardium is more vulnerable to ischemic damage and demonstrates compromised recovery following an insult which is attributed to greater cell death and damage than seen in the adult heart (313-321).

Morphological, biochemical and genetic changes manifest in the aged heart and collectively

compromise the capacity to tolerate ischemic insult including, myocyte cell loss, fibrosis, hypertrophy, impaired intracellular calcium handling, and alterations in contractile protein isoforms (322, 323). The changes in the myocardium associated with aging render the senescent heart refractory to treatments proven efficacious in improving function or IT in adult animals.

ERT, for example, reverses hypertrophy, a risk factor for CHD mortality, in adult OVX, but not aged OVX spontaneously hypertensive rats (126). Ischemic preconditioning is also ineffective in rescuing the aged heart from I/R injury despite its beneficial effects on the adult myocardium

(315, 324-326). Most concerning, however, is that animal models of menopause, like the aged

OVX female rat, experience even greater ischemic damage and worsened functional recovery following an ischemic insult than aged gonad-intact animals (24, 299). Congruent with animal models, aged women also experience increased damage following acute myocardial infarction. A better understanding of specific E2 signaling mechanisms in heart is clearly needed to properly

understand and protect the aged female heart and reduce CHD mortality.

29 Estrogen Receptors, Estrogen Receptor Knock Out Mice and the Myocardium

ER polymorphisms have been linked to increased CHD risk in aged women, demonstrating that ERs and not just E2-deficiency are associated with disease risk (50-54, 327,

328). Given the links to ERs and heart disease paired with the disappointing failure of ERT, the study of ERs has emerged as the new focus for developing CHD therapies. Although there is no cardiac-specific ERKO model, use of whole body ERKO mice have greatly increased

understanding of ER signaling in the myocardium and their roles in cardioprotection (55, 61, 226,

227, 301).

ERα is clearly implicated in modulating ischemic tolerance in both male and female

animal models. Following I/R injury male αERKO mice experience greater ischemic damage and

lose more viable myocytes than WT mice (59). Although female αERKO mice similarly

experience reduced recovery following I/R injury, damage is associated with reduced levels of

cardioprotective signaling proteins (226). However, preserving ERα signaling is critical for

maintaining IT in adult animals of both sexes, although, the mechanisms of action are clearly

divergent. The apparent sex differences in ER signaling underscore the importance in utilizing

appropriate models to address ER signaling derangements in the aged female myocardium. In

Chapter 3 the F344 female rat model is utilized to assess the effects of aging and OVX on the

myocardial response to acute ERβ activation prior to I/R injury.

Acute ERα activation in aged OVX female rats rescues IT via activation of the

cardioprotective protein, PKCε (24). Although studies in aging models are limited, other models

of cardiac disease including the spontaneously hypertensive rat have also responded with

increased IT following ERα activation (155, 329). Collectively, current evidence from transgenic

mouse and ERα agonist studies strongly support a role for ERα in cardioprotection; the role of

ERβ is less clear, and discussed herein.

30 Like αERKO mice, female βERKO mice experience greater cardiac damage following

I/R injury than WT mice (55, 57). However, these results must be interpreted with caution as they

were conducted under the stress of hyper-contractile conditions and may not reflect normal

physiological responses (55, 57). One study indicated that ERβ activation with E2 in αERKO

mice limited ischemic damage following I/R, however hypertrophy and associated mortality was

also increased thus negating the cardioprotective benefit (330). Adding to the uncertainty

surrounding the capacity of ERβ to directly protect the myocardium, no improvement in IT was

observed after acute ERβ activation in a rabbit model (155). Moreover conflicting reports

question the presence of ERβ in rodent myocardium (38, 98, 300, 331)(227).

Estrogen Receptor Beta and the Myocardium

It has been 16 years to date since the discovery of ERβ in 1996, and there is still no consensus regarding ERβ presence in the myocardium. Kuiper, who is credited with cloning ERβ, demonstrated weak ERβ mRNA signal with PCR and in situ hybridization detection methods in the rat heart (98). Saunders corroborated the presence of ERβ by demonstrating localization with immunohistochemistry in male rat ventricles (38). In 2000 and 2004 ERβ presence was confirmed in the human heart with both immunohistochemical and proteomic approaches (332).

These findings were later discounted by Schwend and Gustafsson in 2006 who demonstrated

Yang et al. had over-interpreted mass spectrometry data (333). Specifically, mitochondrial hydrogen-ATPase peptide fragments with mass to charge ratios similar to ERβ had been misidentified (332). Replication of experimental conditions and a more stringent analysis confirmed ERβ is not detectable in mitochondrial lysates (333). Unfortunately, Schwend and

Gustafsson utilized murine, not human tissue to challenge the previous report (333). Thus as of

2006 ERβ presence in the human and rat myocardium is still questionable (334). Additional

31 studies providing compelling evidence of ERβ expression in the human heart are lacking.

Moreover, inconsistencies in later studies on rodent myocardium have spurred a reevaluation of

past data and more stringent requirements for confirmation of ERβ detection in animal models.

Non-specific antibodies demonstrating ERα cross reactivity are partially to blame. While multiple groups have confirmed ERβ existence in neonatal rat ventricular myocytes (36, 332, 335) there is

equal evidence confirming and refuting ERβ presence in adult and aged rodent hearts (300) (36,

37, 62, 155, 227). In Chapter 3 we add to the current body of literature by assessing ERβ mRNA

and protein presence in the aged female F344 rat myocardium.

Estrogen Receptor Beta and Cardioprotection

Regardless of the presence of ERβ in the myocardium, human ERβ gene polymorphisms and βERKO knockout mice indicate a clear role for ERβ in cardioprotection. By five months of age βERKO mice become hypertensive and develop cardiac hypertrophy by eight months (227,

336). In a model of heart failure βERKO mice also experience greater hypertrophy than either both WT or αERKO mice (330, 337, 338). Taken together, these data indicate the presence of

ERβ does impact the myocardium although the mechanism of cardioprotection may be via

indirect vascular mechanisms. Multiple studies have confirmed ERβ presence in vascular tissue

(117, 139, 339-343). In further support of indirect ERβ cardioprotection, chronic ERβ activation

studies demonstrate improved IT in OVX mice and amelioration of hypertension in salt sensitive

rats (62, 155, 344). Central delivery of ERβ agonists to the autonomic cardiovascular control

center in the brain also reduces systemic arterial pressure in rats (345). Thus, if ERβ is indeed

absent from the myocardium, a likely explanation for its role in cardioprotection may occur via

indirect modulation of neural and vascular mechanisms associated with hypertension resulting in

reduced complications and risk factors for ischemic heart disease (227). Further studies are

32 needed to determine if acute or chronic ERβ activation will prove to be a viable therapy for CHD

risk reduction or treatment in the aged female heart. The capacity of the F344 female rat heart to

mount a cardioprotective response following acute ERβ activation is assessed in Chapter 3.

Adiponectin in Cardiovascular and Metabolic Disease

It is well established that CHD is linked to metabolic disease given that the symptoms of

metabolic syndrome- hypertension, dyslipidemia, impaired glucose tolerance, and central obesity-

are all factors which increase heart disease risk (346, 347). Moreover, the severity of metabolic

syndrome complications correlates with worsened myocardial infarction outcomes (348, 349).

APN is a hormone produced in adipose tissue which circulates in plasma at concentrations of 3-

30 μg/mL and has anti-diabetic, anti-atherogenic, anti-inflammatory, and cardioprotective effects

(66-86). Low APN, or hypoadiponectinemia, is thought to play a role in the etiology of metabolic

disease given that patients with reduced circulating APN concentrations are at increased risk for

insulin resistance, glucose intolerance, type II diabetes, obesity-linked inflammation, and CHD

(67-86, 350). Additionally, APN receptors are downregulated with obesity and metabolic disease,

and downstream signaling activity is reduced with aging (83, 93-95, 351-353). Reduced receptor availability and/or signaling capacity can lead to APN resistance, thus further propagating metabolic disease progression and increasing CHD disease risk. Therapeutic interventions aimed at increasing circulating APN concentrations and/or APN receptors/downstream targets may reverse symptoms of metabolic syndrome and reduce CHD morbidity and mortality in at risk populations. Currently, APN supplementation shows promise as a new therapy for patients with ischemic heart disease. A bolus injection of APN reduces infarct size and limits the decline in functional recovery following ischemic insult in animal models (354-356). However, diabetic rodents consuming a western diet display APN-resistance, and APN treatment is less efficacious

33 in attenuating ischemic injury in these models (93, 353). Thus, the relevance of APN as a cardioprotective agent is questionable given the prevalence of metabolic co-morbidities, like diabetes in CHD patients. However, whereas metabolic and CHD incidence increases with aging,

APN efficacy in an aged population has yet to be assessed. Aging women represent a unique population which demonstrates increased adiposity, reduced IT, and progression toward metabolic dysregulation following the onset of E2-deficiency at the menopausal transition.

Elucidating APN efficacy in treating CHD morbidity and mortality in models of aging and E2-

deficiency could help develop relevant therapies for postmenopausal women. In Chapter 6 we

assess the efficacy of acute APN treatment on the isolated female rat myocardium in the context

of both aging and OVX.

Adiponectin

APN is an adipokine secreted from adipose tissue that has profound implications in

cardiovascular and metabolic health. APN was independently characterized in 1995 by four

groups, and is therefore also known as adipose most abundant gene transcript 1 (apM1),

adipocyte complement–related protein of 30 kDa (acrp30), adipoQ, and gelatin-binding protein of

28kDa (GBP28) (63, 69, 357, 358). APN has been classified as a member of the complement 1q

(C1q) family based on common structural properties (359, 360). APN and other C1q family members also have structural homology with tumor necrosis factor (TNF) proteins (361).

Members of the TNF family are involved in a range of biological processes such as inflammation, adaptive immunity, apoptosis, and energy homeostasis and tissue regeneration (360, 362). APN

has been described as an anti-diabetic, anti-atherogenic, anti-apoptotic, and anti-inflammatory cytokine and thus not only shares structural homology, but also functional commonality with C1q and TNF families. The paradoxical downregulation of APN with increased fat mass and obesity

34 in conjunction with TNFα upregulation has been attributed to complex cross-regulatory interactions between APN and its inflammatory TNF cytokine relatives (363-366). The specific structure of APN consists of a signal peptide at the N-terminus followed by a short variable region, a collagenous domain with 22 triple-helical Gly-X-Y repeats and a globular head at the C- terminus (361, 362); see Figure 2-2. Individual units of C1q family members can assemble and multimerize into higher-order levels of organization. APN homomultimerizes into three forms: trimers, hexamers, and multimers (18 or more units) of low, medium, and high molecular weight

(LMW, MMW, and HMW), respectively (76, 79, 367-369). Multimerization occurs intra- cellularly and all forms of APN, have been detected in human and animal serum (70, 76, 367,

370, 371) .

Figure 2-2: Schematic of adiponectin intracellular assembly; from Wang and Scherer (2008).

Adipocyte processing and assembly of APN into LMW, MMW, and HMW forms is relatively complex, involves multiple posttranslational modifications, and requires numerous cofactors and chaperones. The initial APN assembly steps are achieved via hydrophobic interactions between monomers which unite to form trimers (LMW APN) (367, 368). Two trimers then can associate to produce a heximer (MMW APN) (76, 367). This process requires disulfide bond formation which is achieved with support from several endoplasmic reticulum

chaperones: disulfide oxidoreductase A-like protein (DsbA-L), endoplasmic reticulum

oxidoreductase 1-Lα (Ero1-Lα) and endoplasmic reticulum protein of 44kDa (Erp44) (368, 370,

35 372, 373). Specifically, Erp44, a member of the thioredoxin family, localizes to the endoplasmic reticulum and Golgi intermediate compartments where it binds thiol-containing residues of Ero1-

Lα or APN (370, 372). Erp44 can bind and retain APN for posttranslational processing at the endoplasmic reticulum until Ero1-Lα displaces APN from Erp44 (370, 372, 374). HMW assembly requires at least three heximers to come together to make an 18 unit complex.

Hydroxylation and glycosylation on conserved lysines is critical for HMW assembly, yet the specifics of this process have not yet been elucidated (372, 375, 376); see figure 2-2. Finally, the expression of DsbA-L is correlated with secretion of HMW APN in 3T3-L1 adipocytes which suggests DsbA-L is required for the completion of HWM assembly/secretion into the circulation

(368). Relative imbalances in APN chaperones could impact the intra-cellular production/secretion of L, M, and HMW APN as well as change the APN profile in circulation.

Imbalances could have serious implications on metabolic health given that it is HMW APN, not total APN that best correlates with disease risk (76, 79, 350, 367, 377-383).

Modulation of Adiponectin Multimers by Estrogen Receptor β

Adipose tissue is E2 responsive and expresses both ERs (40, 44, 49, 61, 278-281, 384). In adipose tissue ERβ interacts with the APN regulatory protein PPARγ (60, 188, 189). PPARγ is a master regulator of metabolism and upregulates transcription of numerous genes involved in APN processing and secretion, including APN (385-388). ERβ negatively regulates the activity of

PPARγ via competition for common transcriptional cofactors like TIF2 and SRC (60). Relative changes in ERβ/PPARγ balance in favor of ERβ may attenuate APN expression resulting in an insufficient intracellular APN protein supply for the support maintenance of normal circulating

APN concentrations. Moreover, ERβ regulation of PPARγ can additionally impact the intracellular assembly of existing intracellular APN affecting multimer distribution. PPARγ also

36 transcriptionally regulates the APN processing chaperones Erp44, Ero1-Lα, and DsbA-L (368,

370, 372, 373, 389). Lack of sufficient assembly chaperones impacts the relative distribution of

APN multimers favoring production of LMW vs the more complex MMW and HMW APN (368,

370, 372, 373, 389). It is important to note, much of this work has been conducted in vitro and it is unknown if physiological changes in ER expression in vivo can similarly impact APN

intracellular assembly and/or the relative distribution of APN multimers in circulation. ER

expression is known to change with adiposity and E2 status. Specifically, ERβ increases in visceral adipose of obese and aging women (40, 390). Theoretically, postmenopausal changes in

ER expression may alter APN processing in aged women, which could impact total/HMW APN levels, thus providing an additional link explaining changes in E2 status and CHD risk factors. In

Chapter 4 we characterize changes in ERβ protein abundance in association with alterations in downstream signaling proteins associated with APN processing and secretion in adipose tissue. In

Chapter 5 we attempt to discern a direct link between ERβ overexpression and APN assembly/secretion in the adipose-like 3T3-L1 cell culture model.

Adiponectin and Gender

Gender differences in circulating APN concentrations indicate that estrogens and androgens may play a role in APN regulation (11, 74, 78, 80, 82, 391-401). Testosterone has been shown to negatively correlate with circulating APN, and men consistently have reduced circulating levels vs women (86, 393, 395, 399, 400, 402). Men with very low APN (< 4 μg/mL) are at greatest risk for CHD (74, 75). Lower APN concentrations in men in general, may in part explain the sexual dimorphism observed with protection from CHD in premenopausal women vs age-matched men. Postmenopausal women have similar or even greater APN concentrations than premenopausal women (11, 363, 391, 393, 396, 397, 399, 403-407); see table 2-1. This similarly

37

may indicate that E2, like testosterone, may also have an inhibitory effect on APN, albeit a lesser

one. OVX rodent models demonstrate increases circulating APN, which further supports that E2

may have a negative effect on APN concentration (408, 409). However, data are conflicting

regarding the direct relation between circulating APN concentrations and E2. Circulating APN

does not vary with normal menstrual cycling in premenopausal women and few studies exist

which show a compelling E2 and APN correlation (392, 393, 398, 410). It has been proposed that

the effects of sex hormones on APN are indirect. Testosterone has been shown to inhibit HMW

APN secretion (400). However, Horenburg et al. showed no effect of direct application of testosterone or E2 on APN production in vitro (411). Currently, it is hypothesized that testosterone and estrogens exert the majority of their suppressive effects on APN by preventing adipocyte proliferation and maturation. Testosterone directly inhibits adipocyte differentiation and E2

stimulates LPL and adipocyte catabolism (412).

That the sexual dimorphism in APN concentration persists even following reproductive

senescence in aged individuals is curious (399, 413, 414). Sex hormones clearly play a role in

maintaining the balance between adequate adiposity for APN production, and obesity mediated

suppression of APN. However, the exact tipping point where E2-deficency promotes appropriate

adiposity for enhanced APN production vs excessive adiposity in postmenopausal women is

unclear; see Table 2-1.

Greater concentrations of APN in non-overweight and non-obese aged women suggests

that they should be protected from metabolic and CHD, yet as heart disease is the number one

killer of women, a significant proportion are still afflicted. A possible explanation for these findings is that although total APN increases with age the relative APN multimer distribution may be altered. Relative to total APN, HMW APN is a better predictor of disease risk in men (78).

However, circulating total and HMW APN remain closely correlated in aged women and

assessment of both provides no greater insight to predicting disease risk (415, 416). Finally, it

38 may be that APN-resistance rather than hypoadiponectinemia is more relevant issue in aged

women. Compromised signaling at the receptor level could explain increased disease risk in the

presence of adequate or even overabundant APN. Further studies are needed to address the

complex control that sex hormones, reproductive senescence, and aging exert on APN.

Table 2-1: Changes in serum adiponectin concentrations associated with menopausal status and overweight in women. Changes are relative to normal weight premenopausal women. Decreased Increased No Change Premenopausal overweight or obese (363)

Postmenopausal normal weight (11) (393, 396, 397, (391, 417, 418) 399, 403-407)

Postmenopausal overweight or obese (396, 404, 407, 417)

Adiponectin Receptors

While the specifics of APN intra-cellular assembly are in part elucidated, the details regarding APN/receptor interactions are not yet clearly understood. APN associates with multiple receptors: adiponectin receptor (AdipoR)1, AdipoR2, AdipoR3, and T-cadherin (378, 419-422).

AdipoR1, R2, and R3 belong to the progestin and adipoQ family of receptors (PAQR) (423).

AdipoR1 and R2 were cloned in 2003, and are integral membrane proteins with 7-transmembrane spanning domains which are functionally and structurally distinct from GPCRs (421).

Specifically, the AdipoR N-terminus is internal and C-terminus is external and this topology is converse to GPCRs (421). AdipoR3 was not characterized until 2011. Little is known about this receptor other than it binds APN and is structurally homologus to PAQR family members (422).

T-cadherin was identified as an APN receptor in 2004, and is found in endothelial and smooth muscle cells, yet as peripheral membrane protein it likely cannot independently transduce APN

39 signals and has been redefined as a co-receptor (378, 419).. AdipoR1 and AdipoR2 knockout animals display severe metabolic phenotypes indicating the majority of the effects of APN are

mediated via AdipoR1 and AdipoR2 (424). AdipoR1 KO mice demonstrate increased adiposity, insulin resistance, and glucose intolerance, while AdipoR2 KO mice are insulin resistant, but glucose tolerant (424). This compelling evidence is further strengthened by the fact that both

AdipoR1 and R2 are ubiquitously expressed throughout the body (85, 421, 425-430).

Elucidating the unique and overlapping functions of each receptor and APN/receptor interaction is a current area of research. T-cadherin responds only to MMW and HMW APN

(378). AdipoR1 and R2 can bind monomeric or even cleaved globular LMW APN; AdipoR1 has high affinity for globular domains and AdipoR2 has high affinity for full length uncleaved monomeric, or L, M, and HMW multimeric APN (379, 420). That AdipoR1 and AdipoR2 can be activated with individual monomers or even APN cleavage products still has yet to be reconciled with the fact that greater concentrations of multimeric HMW APN are predictive of and protective against the development of metabolic and cardiovascular disease (431, 432).

Nevertheless, following ligand binding AdipoR1 and R2 interact with several intracellular proteins including: adaptor protein containing pleckstrin homology domain, phosphotyrosine binding domain and leucine zipper motif 1 (APPL1), endoplasmic reticulum protein of 46KDa

(Erp46), receptor of activated C kinase protein 1 (RACK1) and protein kinase CK2β subunit

(433-435). It is likely these proteins act as internal scaffolding for signaling cascades; however

the specific interactions have not yet been determined. Finally, it is well established that the fatty

acid oxidation regulators, PPARα and AMPK, as well as the modulator of inflammation, cyclooxygenase (COX)2, are the end effectors following AdipoR1 and R2 activation in metabolically active tissues such as liver, adipose, skeletal vascular, and cardiac muscle (354,

420, 421, 436). Specifically in the heart, APN protects the ischemic myocardium by limiting

40 inflammation, apoptotic cell death, and nitrative cytotoxicity via COX2- , AMPK- , and NO- dependent mechanisms (95, 354).

Finally, cessation of APN/AdipoR signaling is mediated by clatherin-dependent endocytosis (CDE) via a Rab5 dependant mechanism (437). Rab5 is a small GTPase which regulates early endosome fusion and has been reported to associate with APPL1, a potential

AdipoR scaffolding protein (435, 438). Rab5 and its other family members regulate the intracellular trafficking of endocytosed membrane proteins including a number of transmembrane receptors (439-441). It is well established that GPCRs are known to internalize via Rab5-positive vesicles, recycle to the membrane via Rab4-positive vesicles, or are sorted for degradation via

Rab7-positive vesicles. It remains to be determined whether AdipoRs cycle through the endosomal pathways in a similar fashion. It has been shown that CDE inhibition not only increases AdipoR levels at the plasma membrane, but also enhances APN binding and downstream activation of AMPK (437). Thus, it is likely that AdipoR receptor internalization may be a critical determinant in attenuation of APN signaling the subsequent development APN- resistance in at risk populations. The mechanisms at work are still being investigated and regulation of AdipoR membrane localization poorly understood. AdipoR1 internalizes both in response-to and independent-of APN stimulation (437).

Adiponectin and Cardioprotection

It is well established that hyperglycemia and hyperlipidemia accompanying metabolic disease consequently cause vascular injury and complications in the myocardium. Thus, it was originally thought that the links between hypoadiponectinemia and CHD were secondary to the fact that obesity and the symptoms resultant of metabolic disease also promote CHD risk. While metabolic disease does link APN and CHD, studies utilizing APN knockout mice (APNKO) have

41 revealed APN has direct effects on the myocardium. APNKO mice have reduced IT as evidenced

by greater infarct size and increased apoptotic damage relative to wild type controls following I/R

injury (354, 442, 443). Supplementing APNKO mice with APN attenuates injury due to I/R in a

dose-dependent manner (354, 443). These data further strengthen the conclusion that circulating

APN concentration not only correlates with CHD risk, but is also predictive of I/R injury severity.

APN supplementation in wild type rodents and pigs also improves IT following I/R injury (354-

356, 444). Moreover, APN treatment is effective in reducing infarct size when administered before, during, or post ischemia (354, 356). APN accumulates in the infarcted heart following I/R

injury and binding during injury may be a critical adaptation of the myocardium to promote

protective APN signaling. (355, 356, 445-449).

Although these data suggest APN therapy is promising, studies in diabetic mice have

revealed APN efficacy is substantially reduced in models of metabolic disease (93, 94, 353).

Three times the dose (6 μg/g) of APN was required to elicit the same degree of cardioprotection

in very high fat diet-induced diabetic mice vs controls (93). Streptozotocin-induced diabetes blocks APN-mediated cardioprotection in early, but not late, phases of disease progression linked

to fluctuations in AdipoR1 protein levels (94). Clearly, APN-resistance is a potential issue

further limiting the treatment for metabolic disease. Careful characterization of each disease state

to determine the extent of hypoadiponectinemia and/or APN-resistance will be necessary to

provide adequate therapy for afflicted individuals.

Adiponectin Mechanisms of Cardioprotection

APN acts on both the myocardium and vascular endothelium to modulate

cardioprotection. In the vasculature, APN phosphorylates and activates endothelial nitrous oxide

synthetase (eNOS) and prostaglandin (PG) I2 which prevents systolic hypertension as well as

42 pressure overload induced hypertrophy (434, 450-454). APN acts directly on the myocardium to

limit inflammation, apoptotic cell death, and cytotoxic nitrate production following I/R injury via

COX-2- , AMPK-, and anti-nitrative mechanisms (95, 354, 434, 455-457); see Figure 2-3.

Noteworthy, cardiomyocytes also produce APN, however it is unclear if the quantity (10% of that

produced in adipocytes) is sufficient to elicit significant physiological effects on the myocardium

(428, 458).

NO + SO·

Figure 2-3: Adiponectin signaling cascades in the myocardium; from Hui et al. (2012).

Adenosine Monophosphate-Dependent Kinase Dependent Mechanisms

APN directly increases AMPK activity in perfused hearts resulting in cardioprotection characterized by reduced infarct size and limited apoptosis (95, 351, 354, 377, 433, 459-462). In

43 conjunction with increased apoptotic cell death both basal and post-ischemic AMPK phosphorylation is reduced in APN-resistant diabetic rats (93, 94). Similarly, APN-KO mice have reduced cardiac AMPK phosphorylation (354). Moreover, expression of dominant negative

AMPK directly blocks APN-mediated cardioprotection and confirms a critical role for AMPK

(354, 436). The downstream mechanisms linking APN-mediated AMPK activation and reduced apoptotic damage have not been fully elucidated. A description of APN-AMPK signaling and cardioprotection is reviewed herein.

In general, AMPK is activated by phosphorylation on Thr172 in response to a shift in the

AMP/ATP ratio in favor of AMP. Activated AMPK, or pAMPK directly acts to enhance fatty acid oxidation via phosphorylation and inhibition of ACC activity as well as enhance insulin- independent glucose uptake via GLUT1 (463, 464). Specifically, in the healthy heart under aerobic conditions, the majority of energy required for contractile function is derived from fatty acids while the remainder ( 30%) is obtained via metabolism of glucose (465). Controlled fatty acid metabolism prevents triglyceride∼ accumulation and associated lipotoxic effects like apoptosis and insulin resistance (466). Under normoxic conditions, APN-AMPK signaling promotes normal cardiac function by enhancing fatty acid and glucose uptake and utilization in isolated working hearts (433, 467, 468).

In response to APN, AMPK is phosphorylated on Thr172 by LKB1 (an AMPK kinase), which additionally is associated with anti-apoptotic signaling pathway activation (469, 470).

LKB1 primarily resides in the nucleus and translocates to the cytosol via an APN-dependant mechanism (433, 471). Specifically, APN binding to AdipoR1 promotes binding of APPL1, a scaffolding protein which then recruits LKB1 to the plasma membrane (433, 471). Although

APPL1 also binds AdipoR2, AMPK phosphorylation in the myocardium is thought to be exclusive to AdipoR1 activation (433, 435, 472).

44 Initially in cardiomyocytes, APN-treatment directs glucose metabolism, but by 24 h of treatment glucose oxidation levels are reduced (468). Fatty acid oxidation then increases as

glucose oxidization wanes at 24 and 48 h of APN treatment in vitro (468). Long term control of fatty acid metabolism does prevent triglyceride accumulation and lipotoxicity associated apoptosis and insulin resistance (466). These findings indicate that transient administration of

APN may be effective in improving glucose oxidation, and prolonged treatment effective in enhancing fatty acid utilization and reducing chronic lipotoxicity.

The stress of ischemia also independently triggers AMPK activation and subsequent glucose and fatty acid utilization (354, 473, 474). Interestingly, AMPK stimulated glucose utilization maintains energy homeostasis and confers protection following I/R injury (462, 475).

However, in the presence of high fatty acid concentrations following I/R, AMPK activation results in increased cardiac damage (476-480). It is now accepted that following ischemia switching from the prevailing excessive fatty acid metabolism toward glucose oxidation is indeed beneficial (465, 481). The dual role of activating both glucose and fatty acid metabolism makes

AMPK an important target in the ischemic myocardium. In Chapter 6 the APN-mediated activation of AMPK is characterized in female rat hearts isolated from adult, aged, and aged

OVX rats and subjected to I/R injury.

Ablation of AMPK signaling with expression of dominant negative AMPK prevents

APN-mediated cardioprotection and results in greater apoptotic damage following I/R injury

(354). Currently, it is unknown if anti-apoptotic APN-AMPK signaling is linked to glucose oxidation, fatty acid oxidation, or a completely novel pathway. Enhanced AMPK and ACC phosphorylation is observed in vivo coronary artery ligation experiments at 3, 24, and 48 h following APN-treatment relative to vehicle treated animals (93, 354). It is unknown if ACC activation and associated fatty acid metabolism is critical for anti-apoptotic APN effects or if events are simply coincident. That transient APN treatment is associated with glucose oxidation,

45 suggests that acute APN administration may be an effective therapy linked to AMPK glucose utilization. Indeed as soon as 60 min following ischemia, AMPK phosphorylation is increased by

60% and associated with cardioprotection in isolated APN-treated Langendorff-perfused male rats vs controls (482).

Anti-Inflammatory and Anti-Nitrative Effects of Adiponectin

Independent of AMPK, COX-2 also activates cardioprotective signaling pathways in response to APN treatment during I/R injury (354, 483). COX-2 is a key enzyme in regulating the production of PGs and inflammation. In the ischemic myocardium, COX-2-mediated synthesis of

PGE2 reduces inflammation via TNFα suppression in response to APN treatment (354, 483).

Several in vivo models have confirmed APN-mediated suppression of inflammation (354, 355,

483, 484). APN also confers protection by suppressing cytotoxic peroxynitrite production (93,

443). APN inhibits, the nicotinamide adenine dinucleotide phosphate (NADPH)–oxidase responsible for producing super oxide during I/R injury, (gp91phox) in the myocardium see Figure

2-3 (443). Super oxide combines with NO produced from iNOS to yield the cytotoxic

peroxynitrite (443). Anti-nitrative actions of APN are active in the presence of dominant negative

AMPK and thus clearly mediated via a divergent signaling pathway (93, 436, 443). Finally, it is

important to note APN can promote production of eNOS derived NO in the vasculature which is

both cardioprotective and distinct from the cytotoxic iNOS derived NO/peroxynitrite (482).

APN Resistance

Similar to patients presenting with hypoadiponectinemia, patients with gene

polymorphisms of AdipoR1 and AdipoR2 have increased risk for diabetes and CHD (424, 485-

46 488). Moreover, AdipoR1/2 double knockout mice actually exhibit more severe metabolic

complications than APNKO mice and overexpression of both AdipoR1 and AdipoR2 reverses

adiposity and improves metabolic markers in mice (424, 485-488). Taken together these findings underscore the importance of AdipoR1 and AdipoR2 in mediating APN signaling. Interestingly, reductions in AdipoRs in skeletal muscle are observed prior to pathological lipid accumulation and insulin resistance in diet induced obese/hyperlipidemic rats. These findings suggest AdipoRs are not only associated with, but may be a causal agent for metabolic dysregulation (92). Reduced receptor abundance has recently been proposed as a potential cause of APN-resistance. In Chapter

6 AdipoR1 and AdipoR2 protein levels are characterized in the F344 female rat myocardium.

Curiously, animal models of obesity and metabolic disease demonstrate varied AdipoR expression levels in adipose, skeletal muscle, liver, heart, and the aorta. Variability has been attributed to timing of sample collection, length of dietary interventions, and the relative age of animals. In normal fasted and fed states, AdipoRs fluctuate inversely with insulin levels (83).

Consistent timing of sample collection is critical for accurately characterizing relative AdipoR changes (489). Disagreements reported in AdipoR abundance in obese and metabolically challenged animal models where time of sample collection is controlled is likely a function of disease progression on AdipoR regulation. A pattern of characteristic changes in APN and

AdipoRs in metabolic tissues occurs in high fat diet-induced obese mice, diabetic Zucker rats, and streptozotocin-induced diabetic rodents over time (Table 2-2). At the onset of metabolic disease, reduced AdipoR levels in conjunction with attenuated downstream signal activation have been observed in liver, adipose tissue, aorta, heart, and skeletal muscle (83, 353, 426, 460, 489-491).

While reductions in AdipoR2 in adipose tissue appear to be stable over time, AdipoR1 increases in cardiac, liver and skeletal muscle in diabetic animal models after 7 weeks and obese animal models after 16 weeks of treatment (94, 425, 489, 491-493). APN also fluctuates and often increases in early stages of metabolic disease before decreasing (83, 94, 489).

47 Table 2-2: Changes in adiponectin receptors, and total adiponectin in metabolic tissues in animal models of obesity and metabolic disease

Adipose Skeletal Muscle Liver Heart Circulating Reference Adiponectin c57BL6/6J mice consuming AdipoR1 mRNA ↑ AdipoR1 mRNA ↔ Increased (489) chow (13% fat) for 10 weeks AdipoR2 mRNA ↔ c57BL6/6J mice consuming AdipoR1 mRNA ↑ AdipoR1 mRNA ↑ No Change (489) chow (13% fat) for 18 weeks c57BL6/6J mice consuming AdipoR1 mRNA ↓ AdipoR1 mRNA ↑ Increased (489) high fat (42%) for 10 weeks AdipoR2 mRNA ↑ c57BL6/6J mice consuming AdipoR1 mRNA ↑ AdipoR1 mRNA ↑ Reduced (489) high fat (42% ) for 18 weeks AdipoR2 mRNA ↑ c57BL6/6J mice consuming AdipoR1 mRNA ↓ AdipoR2 mRNA ↓ Increased (460) high fat high sucrose for 16 weeks

A/J (obesity resistant) mice AdipoR1 mRNA ↑ AdipoR1 mRNA ↔ No Change (489) consuming chow (16% fat) for AdipoR2 mRNA ↔ 10 weeks

A/J (obesity resistant) mice AdipoR1 mRNA ↑ AdipoR1 mRNA ↑ Increased (489) consuming high fat (42%) for 10 weeks AdipoR2 mRNA ↑

Ob/ob (leptin deficient) 15 AdipoR1 mRNA↓ (83) weeks of age AdipoR2 mRNA↓

48 Obese Zucker 18 weeks of age AdipoR1 mRNA↓ Increased (490)

AdipoR2 mRNA↓

Obese Zucker consuming HF AdipoR1 mRNA ↑ (425) diet for 6 weeks AdipoR2 mRNA ↑

Obese Zucker 7 weeks of age AdipoR1 mRNA↓ AdipoR1 mRNA↔ AdipoR1 mRNA ↑ (426)

AdipoR2 mRNA↓ AdipoR2 mRNA↔ AdipoR2 mRNA ↑

Db/db (leptin resistant) mice 13 AdipoR1 mRNA↓ AdipoR2 mRNA↔ (492) weeks of age

Diabetic mice (streptozotocin AdipoR1 mRNA ↑ AdipoR2 mRNA↔ (492) induced)

Diabetic mice (streptozotocin AdipoR1 protein ↓ Increased (94) induced) diabetic for 1 week

Diabetic mice (streptozotocin AdipoR1 protein ↑ Reduced (94) induced) diabetic for 7 weeks

Diabetic rats (streptozotocin AdipoR1 protein ↓ Reduced (493) and high fat/sugar induced) AdipoR2 protein ↓

Diabetic rats (streptozotocin AdipoR1 protein ↑ (491) induced) diabetic for 8 weeks AdipoR2 protein ↓

Wistar rats (42% fat) diet for 3 AdipoR2 protein↓ AdipoR1 mRNA ↑ AdipoR2 mRNA ↑ (494) weeks AdipoR2 mRNA ↑

49 The APN decrease often precedes the AdipoR1 increase in metabolic tissues, yet the specific

mechanism governing these events is unknown. Whereas reduced AdipoR1 abundance may

contribute to APN-resistance in early stages of obesity and metabolic disease progression,

hypoadiponectinemia or downstream signaling defects are a more likely cause in later stages.

The F344 rat is characterized as a model of chronic insulin resistance (255). By 4 mo of

age F344 rats have 2-3 fold elevations in insulin, glucose, and free fatty acid concentrations

during both fasted and fed states which is sustained throughout their lifespan. (257). Although

insulin resistance does not worsen with age, weight gain and adiposity does increase in female

F344 rats (258). Currently, it is unknown if the F344 phenotype becomes severe enough to evoke

changes in cardiac AdipoR1 and AdipoR2. In Chapter 6 AdipoR1 and AdipoR2 abundance is

characterized in aged F344 female rats on both a chow and a high fat diet.

Alternatively, attenuations in downstream APN targets could contribute to APN-

resistance. Diabetic mice and rats demonstrate reduced AMPK phosphorylation in response to

APN treatment both under basal and ischemic conditions (94, 495). Reduced basal pAMPK

translates to a reduced capacity to upregulate pAMPK during I/R injury and these animals

experience greater infarct size and ischemic damage (95, 351). Aging also reduces basal AMPK phosphorylation in cardiac and skeletal muscle of male rats (95, 351, 352, 496, 497). It remains to be tested, but it is likely aging animals also demonstrate APN-resistance. In Chapter 6 alterations in total and phosphorylated AMPK are assessed in the myocardium of F344 rats both on a chow and high fat diet.

Currently, it is unknown if the tendency toward metabolic dysregulation and reduced IT observed in aged women is linked to APN-resistance in cardiac tissue. Normal weight aging women demonstrate normal or even elevated circulating APN concentrations, yet are not protected from I/R injury (11, 363, 391, 393, 396, 397). High APN levels in conjunction with reduced IT in aging women superficially resembles the APN resistance state preceding

50 hypoadiponectinemia during metabolic disease progression in rodent models (93, 94, 353).

Further investigation is needed to determine if APN resistance in association with a moderate metabolic phenotype truly explains CHD risk and reduced IT in aged women. In Chapter 6 we assess IT in the in adult, aged, and aged OVX F344 female rat with an APN infusion. Moreover we also assess the downstream APN target phosphorylated AMPK in the myocardium following

I/R injury.

51

CHAPTER 3

ESTROGEN RECEPTOR BETA DOES NOT INFLUENCE ISCHEMIC

TOLERANCE IN THE AGED FEMALE RAT HEART

Introduction

Ischemic heart disease remains the leading cause of morbidity and mortality in aged women, with a 2- to 3-fold increase in incidence following menopause (1). Postmenopausal women are less likely to survive a myocardial infarction compared to age matched men and clinical trials have failed to demonstrate a cardioprotective benefit from chronic ERT (33, 498).

Protective effects of E2 in the myocardium have been demonstrated in adult animal models and

are mediated, in part, by ERα and ERβ (24, 36, 55-59). Mouse ER knockout models have

provided further insight into the apparent links between ERs and cardiovascular disease.

Specifically, βERKO mice become hypertensive by five months of age and develop cardiac

hypertrophy (336). Furthermore, female βERKO mice experience greater cardiac damage

following I/R injury relative to wild type female mice indicating that ERβ also impacts IT in the

female heart (55, 57). Moreover, chronic activation with the ERβ-specific agonist DPN

upregulates proteins associated with cardioprotection and improves IT in adult female mice

rendered E2-deficient by OVX (62). These data indicate that chronic ERβ signaling can promote

genomic upregulation of cardioprotective proteins over time and contribute to the maintenance of

IT in females.

52 In addition to classical genomic ER signaling, ER subtypes are also capable of rapid,

non-genomic signaling following acute activation. Non-genomic signaling through membrane ER

subtypes does not require classical nuclear transcription of proteins, but can rapidly activate

signaling cascades by triggering kinase activation and increasing Ca2+ or NO levels (152). Acute activation of ERα has been shown to improve cardiac IT in aged female rats with varying degrees of E2-deficiency following I/R injury (24, 152). Existence of non-genomic, ERβ-mediated,

cardioprotective signaling mechanisms in the female heart have yet to be confirmed. A single

study in adult OVX rabbits failed to demonstrate any reduction in infarct size following I/R with

acute ERβ activation (155). Furthermore, while both ER subtypes have been observed in neonatal

rat cardiac myocytes (36), conflicting reports exist on the presence of ERβ in the adult or aged rat

myocardium (38, 98, 300, 331). Therefore, the purpose of the present investigation was to

examine the effects of acute ERβ activation on IT in the adult, aged, and aged OVX female F344

rat heart. Here, we tested the hypothesis that acute ERβ activation with the agonist DPN would

improve cardiac functional recovery following I/R injury in aged rats.

Methods

Animal Care

Certified specific pathogen free female adult (5–6 months, n = 18) and aged (23 months,

n = 40) F344 rats were obtained from Harlan Sprague Dawley (Indianapolis, IN). Rats were singly housed in filter-top cages containing corn-cob bedding and provided with a nylabone or wood block for enrichment. Rats were maintained on a 12 h light/dark cycle in an environment maintained at 22 °C with 20% humidity. Water and chow were supplied ad libitum and chow consisted of a standard laboratory rodent diet, LabDiet 5001 (PMI Nutrition International, St.

53 Louis, MO) with a caloric breakdown of 28.5% protein, 13.5% fat, and 58% carbohydrate.

Noteworthy, the LabDiet 5001 chow is soy- based and contains 810 μg/g of phytoestrogens,

which are compounds known to have weak estrogenic activity in vivo. All animal experimentation described was conducted in accordance with accepted standards of the

Institutional Animal Care and Use Committee of the Pennsylvania State University.

Ovariectomy

To yield a significantly controlled level of E2-deficiency, a subset of aged F344 rats underwent surgical OVX (n=20). Remaining aged and adult rats underwent sham surgery and all surgeries were performed by the supplier. Following surgery animals were transferred to the

Pennsylvania State University and were allowed to recover for four weeks prior to experimental use. Uterine weight was used to confirm E2-deficiency. We have previously documented significantly reduced circulating E2 concentrations in aged (14.6 ±1.4 pg/mL), and aged OVX

(7.6 ± 1.1 pg/mL) vs adult intact rats (21.4 ± 1.0 pg/mL) through radioimmuno-assay (24, 499).

Study Design

Animals were randomly assigned to receive either the ERβ agonist, DPN (Tocris,

Ellisville, MO; 5 µg/kg body weight; n=9 adult, n=10 aged and aged OVX) or vehicle (10% dimethylsulfoxide; n=9 adult, n=10 aged and aged OVX) in corn oil subcutaneously 45 min prior

to euthanasia. The DPN dose was chosen based on efficacy demonstrated in past studies utilizing

a trauma-hemorrhage model (206). Study of adult, aged, and aged OVX rats was alternated each

day. DPN- and vehicle treated-rats of the same group (adult, aged, and aged OVX) were paired such that n=2 experiments were completed per day. Order of DPN and vehicle treatments were

54 alternated to control for any influence of circadian rhythm on cardiac function and all

experiments were conducted between 9:00am and 2:00pm.

I/R Protocol

Animals were anesthetized with pentobarbital (40 mg/kg body weight; intraperitoneal)

and hearts were excised via midline thoracotomy. Pentobarbital does not interfere with

cardioprotective cell signaling pathways and was thusly chosen for euthanasia. Hearts were

secured to a modified Langendorff perfusion apparatus via the aorta, perfusion pressure was set at

85 millimeters of mercury (mmHg), and hearts were paced at 260 beats/min. LVDP, and positive and negative developed pressure with respect to time (+/- dP/dtmax; indices of contractility and relaxation, respectively), were assessed utilizing a pressure transducer attached to a water-filled latex balloon inserted into the left ventricle. EDP was adjusted to 5–6 mmHg according to

established procedures in our laboratory (24, 299, 500). After 30 minutes of equilibration, hearts were subjected to 47 min global, isothermic, ischemia as described previously (24). Pacing was re-initiated 1.5 min after the start of reperfusion and hearts were reperfused for 60 min. After

reperfusion, left ventricle (LV) tissue was isolated, weighed, halved, and snap frozen in liquid N2.

Due to the duration of the isolated heart protocol, LV weights are necessarily increased due to

time-dependent edema. All hearts were treated similarly and therefore would not be expected to

affect group comparisons. All LV sections were stored at -80ºC until tissue preparation.

RNA Extraction and Real-Time PCR

RNA was obtained from frozen LV tissue through acid guanidinium thiocyanate-phenol-

chloroform extraction with TriReagent (Sigma Chemical Co., St. Louis, MO) as described by

55 Chomczynski and Sacchi (501). Extracted RNA was reverse transcribed to cDNA and subjected

to quantitative real-time-PCR using the TaqMan 2x Universal Mix (Applied Biosystems, Foster

City, CA) according to the manufacturer’s protocol (ABI 7300 Real-Time Sequence Detection

System). Gene expression levels of ERβ were analyzed by three different sets of primers. Two

sets of ERβ primers were manually designed by the Penn State Genomics Core Facility (forward

and reverse primers 5'-CACTGCACTTCCCAGGAGTCA -3' and 5'-

AACTTGGCATTCGGTGGTACAT-3' as well as forward and reverse primers 5'-

TCCCGGCAGCACCAGTAA-3’ and 5’-CCATAGCACATTTGGGCTTGT-3’). A third primer and probe sequence was obtained from Applied Biosystems. The PCR cycling parameters were as follows: 95 °C for 10 min, and 45 cycles of 95 °C for 15 s, 60 °C for 1 min and 25 °C for 2 min.

Each sample was analyzed in triplicate and normalized to the housekeeping gene, cyclophilin, using the following equation: ΔCtERβ = CtERβ – Ctcyclophilin where Ct is the linear part of the curve.

The fold change in mRNA expression was calculated using the following equation: 2(ΔΔCt) where

ΔΔCt = mean ΔCt of ERβ in F344 heart or ovary tissue homogenates.

Protein Sample Preparation and Western Blotting

ERβ-transfected human embryonic kidney 293 (HEK293) cells were produced using

HEK293 cells obtained from ATCC and transfected using lipofectamine (Invitrogen) with a

mouse-ERβ plasmid obtained from the Korach laboratory (502). Total cardiac and ERβ-

transfected HEK293 protein lysates were separated using sodium dodecyl sulfate -

polyacrylamide gel electrophoresis (SDS-PAGE; 10%). Samples were transferred to

polyvinylidene fluoride (PVDF) membranes and blocked in 5% non-fat dry milk for 2 hours at

room temperature as described, by us, previously (24, 503). Membranes were probed overnight

at 4ºC with ERβ (54 kDa, 1:1000; Millipore 07-359). Membranes were then incubated with

56 horseradish peroxidase (HRP)-linked anti-rabbit secondary antibody 1:20,000 for 1 h at room temperature and visualized using Enhanced Chemiluminescence (ECL; GE Healthcare).

Membranes were then stripped in a buffer containing 100 mM β-mercaptoethanol, 2% SDS, and

62.5 mM Tris-HCl and reprobed with ERα (67 kDa, Santa Cruz sc-542; 1:1000). Membranes were then re-processed with HRP-linked anti-rabbit secondary and visualized with ECL.

Representative films were scanned using an Epson V700 scanner.

Statistical Analysis

All data are presented as means ± SE and analyzed using the Statistical Analysis System

(SAS) General Linear Model (GLM) procedure. Because DPN treated animals did not differ from untreated animals, data were pooled and a one-way ANOVA was used to analyze morphological characteristic data for adult, aged, and aged OVX animals. A one-way ANOVA was also used to analyze all functional and mRNA data for adult, aged, and aged OVX animals with and without

DPN treatment. The Tukey test was used for post hoc analysis. An α-level of p < 0.05 was considered statistically significant.

Results

Baseline Characteristics

Rats with baseline LVDP below 130 mmHg, unstable EDP (> 6 mmHg), or notable pathology/weight loss were excluded from the study and subsequent analysis. Final data analysis was conducted on n=4 adult, n=7 aged, and n=8 aged OVX rats treated with vehicle and n=5 adult, n=6 aged, and aged OVX treated with DPN.

57 Morphological and baseline characteristics for adult, aged, and aged OVX animals are

displayed in Table 3-1. Characteristics did not differ between DPN and vehicle treated rats and

baseline data were pooled. Body and LV weight was significantly greater in aged and aged OVX

animals compared with adults (p < 0.05 and p < 0.0001, respectively). A difference in body weight between aged and aged OVX groups was not observed. Uterine weight was significantly reduced with OVX (p < 0.0001). No significant group differences were observed in LV weight to

body weight ratio, LVDP, end diastolic pressure (EDP), or +/- dP/dt.

Table 3-1: Morphological and baseline characteristics for adult, aged, and aged OVX female rats. Abbreviations: DPN, diarylpropionitrile; OVX, ovariectomy; LV, left ventricle; EDP, end diastolic pressure; LVDP left ventricular developed pressure. * different from adult p<0.05, † effect of OVX p<0.05.

Characteristic Adult Aged Aged OVX

200 ± 3 274 ± 5* 282 ± 6* Body weight (g) 546 ± 19 752 ± 14* 758 ± 14* LV weight (mg) 2.73 ± 0.09 2.76 ± 0.07 2.70 ± 0.05 LV weight/Body weight (mg/g) 0.44 ± 0.04 0.52 ± 0.02 0.28 ± 0.03† Uterine weight (g) 5.6 ± 0.1 5.7 ± 0.1 5.7 ± 0.1 EDP (mmHg) 136.3 ± 1.6 139.1 ± 1.2 140.2 ± 1.5 LVDP (mmHg) 3917 ± 131 3741 ± 88 3848 ± 54 +dP/dt (mmHg/s) 2484 ± 24 2421 ± 54 2441 ± 43 -dP/dt (mmHg/s)

Functional Recovery Post I/R Injury

Significant reductions in LVDP functional recovery were observed following ischemic

insult in both aged and aged OVX groups relative to adult intact rats (LVDP (p < 0.0001). Post-

hoc analysis revealed significant differences occurred during early reperfusion at min 1-3 in both

58 aged and aged OVX rats (p < 0.05; Figure 3-1). Importantly, acute DPN treatment (5μg/kg) 45 min prior to heart isolation had no effect on LVDP during 60 minutes of reperfusion following ischemia in adult, aged, or aged OVX animals (Figure 3-1). Although not significant, DPN has a tendency to attenuate rather than improve LVDP recovery in adult rats (Figure 3-1 Panel A).

A. B. C. Adult Aged Aged OVX

140 140 140

120 120 120

100 100 100

80 80 80

60 60 * 60 * 40 40 * 40 Ctrl (vehicle) * 20 DPN 20 20 Absolute LVDP (mmHg) LVDP Absolute (mmHg) LVDP Absolute Absolute LVDP (mmHg) AbsoluteLVDP * * 0 0 0 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min) Figure 3-1: DPN treatment does not improve post-ischemic LVDP in the female rat heart. Recovery of LVDP following a 47 min ischemia in adult (Panel A), aged (Panel B), and aged OVX (Panel C). * denotes different from adult; p<0.05.

Similar to LVDP, ± dP/dt during reperfusion was significantly reduced in aged and aged

OVX female rats (Figure 3-2). Significant differences were observed at min 1-3 of reperfusion for both positive and negative dP/dt. Also in line with LVDP recovery DPN had no significant effect on ±dP/dt recovery during 60 min of reperfusion. The tendency for DPN to attenuate functional recovery in adult, but not aged or aged OVX female rats is also apparent in ±dP/dt recovery

(Figure 3-2 Panel A and D).

To bolster our findings indicating no effect of DPN on the F344 female rat heart we assessed an additional 1 mg/kg dose of DPN. Even at 200 times the 5 μg/kg concentration, DPN still had no effect on LV functional recovery in the female rat heart (data not shown).

59

A. B. C. Adult Aged Aged OVX

4000 4000 4000

3000 3000 3000

2000 2000 2000 * * Ctrl (vehicle) 1000 DPN 1000 1000 +dP/dt (mmHg/s) +dP/dt (mmHg/s) +dP/dt (mmHg/s) * * * * 0 0 0 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min)

D. E. F. Adult Aged Aged OVX

2500 2500 2500

2000 2000 2000

1500 1500 1500

1000 1000 1000 * * -dP/dt (mmHg/s) 500 (mmHg/s) -dP/dt 500 * (mmHg/s) -dP/dt 500 * * * 0 0 0 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min)

Figure 3-2: DPN treatment does not improve post-ischemic +/-dP/dtmax in the female rat heart. Recovery of dP/dtmax following a 47 min ischemia in adult (Panel A and D), aged (Panel B and E), and aged OVX (Panel C and F). * denotes different from adult; p<0.05.

ERβ mRNA Expression and Protein Abundance

A total of three primer sets were used to assess ERβ mRNA levels in adult and aged female rat myocardium. Ovary highly expresses ERβ mRNA (504-506), and rat ovary homogenate served as a positive control for ERβ mRNA expression. Independent of the primer set utilized, ERβ mRNA was detected in ovary homogenates, but not in cardiac samples. Also,

ERβ protein in total LV homogenates could not be detected with western blotting (Figure 3-3).

60

Figure 3-3: Western blot for ERα and β with total heart homogenate and ERβ-transfected HEK293 cells. ERβ (Panel A) reprobe of stripped ERβ membrane with ERα (Panel B). Lane 1 total cardiac homogenate 30 µg; lane 2 ERβ-transfected HEK293 cells 20 μg.

Discussion

Current evidence suggests that the ischemic adult myocardium may be protected, in part,

by activation of ERβ signaling pathways (55, 57, 62). We sought to determine the efficacy of

acute ERβ activation on IT in the aged female rat heart following I/R injury. Ischemic heart

disease remains the primary cause of morbidity and mortality in post-menopausal women in

North America and we hypothesized that acute ERβ activation (via engagement of non-genomic signaling pathways) would improve cardiac functional recovery following ischemic insult in aged female rats. Notably, IT was not augmented by acute treatment with the ERβ-activator, DPN, in hearts isolated from either adult or aged rats. Furthermore, we were unable to confirm the presence of ERβ mRNA or protein, which suggests that ERβ is not expressed in the F344 female rat myocardium.

61 Body weight increased significantly in aged and aged OVX rats vs adult intact controls,

but there was no significant weight gain in aged vs aged OVX female rats. The lack of OVX-

induced weight gain was surprising given that we and others have previously documented

contrary findings (24, 299). Noteworthy, the particular cohort of rats studied in this investigation

has a greater frequency of cardiac tumors than previously observed in our laboratory. Although

animals with obvious pathology, neoplastic tumor growth, and associated weight loss ( > 10

g/week) were excluded (7 aged, and 6 aged OVX rats) it is possible OVX-induced weight gain

was masked by confounding asymptomatic diseases in the cohort of rats studied.

Consistent with previous findings from our laboratory (500), we observed attenuated

functional recovery following I/R injury in aged hearts, with greatest impairment occurring

immediately upon reperfusion when activation of cell death programs are known to occur.

Contrary to our hypothesis, however, we observed no significant effects of acute ERβ activation

on IT in either adult or aged rats with varying degrees of E2-deficiency. Booth and colleagues

(155) were also unable to demonstrate improved IT in E2-deficient rabbits with DPN doses as

high as 3 mg/kg. Collectively, these findings are at odds with studies utilizing βERKO mice or

chronic DPN treatment which suggest that ERβ is a mediator of cardioprotection (55, 57, 58, 62).

A logical interpretation of our results is that while classical genomic ERβ activation via chronic

stimulation is possible, rapid, non-genomic signaling mechanisms downstream of ERβ may not

be operative in the female rodent myocardium. Upon further examination, however, we were

unable to detect ERβ mRNA levels in either the adult or aged F344 rat myocardium. Although

this is the first study examining ERβ in the F344 female rat, two studies in Sprague Dawley rats have provided evidence indicating ERβ may be present in the myocardium (38, 300). In this

regard, ERβ expression in the rodent myocardium remains controversial (38, 98, 227, 300, 331-

333). Here, we utilized both commercially available and manually designed ERβ mRNA primer

sets to assess ERβ mRNA in the female F344 rat myocardium. Manually designed primers were

62 based on previously reported sequences (98, 507, 508), and truncated to increase stringency and

limit PCR product size to 70-80 base pairs in length. Several ERβ antibodies including those

used by Xu (300). were also utilized to substantiate the absence of ERβ in our model. We

determined that the signal produced by ERβ antibodies in cardiac homogenates was likely due to

cross-reactivity with ERα (see Figure 3-2).

The lack of measureable ERβ in the F344 rat myocardium was surprising given results gleaned from past studies utilizing the βERKO mouse model (55, 57, 58). Combined with these previous findings, our results suggest that either ERβ signaling varies substantially between rat, rabbit and murine models or, more likely that cardioprotection observed in mouse models may be mediated indirectly through extra-cardiac ERβ signaling. Interestingly, DPN injection at the rostral ventrolateral medulla, an area associated with autonomic cardiovascular control, has been shown to reduce systemic arterial pressure in rats (345). That ERβ activation can reduce systemic arterial pressure via autonomic influence indicates that additional autonomic cardioprotective mechanisms attributed to E2 may be mediated through ERβ. Indeed, E2-linked cardioprotection

has been associated with reduced sympathetic input to the heart and vasculature during ischemia

in female rats, resulting in reduced heart rate, mean arterial pressure, arrhythmia frequency, and

overall improved IT vs males (509, 510). Therefore, it is plausible that hypertension and vascular

dysfunction observed in whole body βERKO mice as well as cardioprotection observed in

chronic DPN treated mice may be explained by indirect ERβ effects on autonomic cardiac control

and not direct effects on the myocardium (56, 62). Future studies are indicated to address this

important issue.

In conclusion, acute ERβ activation had no impact on functional recovery following I/R

injury in our model. That we were unable to discern detectable ERβ mRNA or protein in either

the adult, aged, or aged OVX female rat heart suggests that direct cardioprotective ERβ signaling

is not operative in the female rat heart. Future studies examining extra-cardiac effects of chronic

63 ERβ stimulation, including vascular and neural mechanisms, may prove useful in elucidating possible therapeutic interventions with aging.

64 CHAPTER 4

INCREASED ESTROGEN RECEPTOR ΒETA IN ADIPOSE TISSUE IS

ASSOCIATED WITH INCREASED INTRACELLULAR AND REDUCED

CIRCULATING ADIPONECTIN PROTEIN LEVELS IN AGED FEMALE

RATS

Introduction

The prevalence of obesity and associated metabolic risk in women increases significantly

after menopause, such that 40-50% of women aged 50-59 develop metabolic complications

according to the most recent report from the National Health and Nutrition Examination Survey

(511). However, the signaling alterations by which E2-deficiency increases obesity risk with

aging are poorly understood, and development of therapeutic interventions have been stalled by

the detrimental effects of hormone replacement on CHD morbidity and mortality in women (33,

498). Interestingly, ER polymorphisms have been linked to increased metabolic and

cardiovascular risk in post-menopausal women, indicating a potential important role for ER

isoforms α and/or β in regulating adiposity, metabolic derangements and cardiovascular risk (51,

53, 54). In this regard, both ERα and ERβ are present in adipose tissue and appear to reciprocally regulate adiposity (375).

Increased adiposity associated with the development of metabolic derangements such as

insulin resistance are observed in αERKO mice (41, 223, 224, 246), thus indicating that ERα

plays an important role in positively regulating adipose metabolism. In contrast, selective

activation of ERβ exacerbates metabolic phenotypes (41), and ovariectomy of αERKO mice

65 ameliorates increases in adiposity and development of insulin resistance (61). Thus it is plausible that alterations in ER levels, specifically reductions in ERα and increases in ERβ, not only contribute to increased adiposity with advancing age, but may also play a critical role in increasing metabolic and cardiovascular disease risk in post-menopausal women.

Although the specific mechanisms by which ERs regulate adiposity and adipocyte metabolism are incompletely understood, however, it is known that ERβ inhibits transcriptional activity of PPARγ, a master regulator of insulin sensitivity (60). PPARγ mediates its effects, in part, by regulating the intracellular processing and secretion of APN. Low plasma levels of APN are associated with obesity and metabolic syndrome and predictive of CHD risk (70, 71, 512). It is unknown whether and to what extent age-associated E2-deficiency disrupts the balance of ERα and β in adipose tissue and if APN is the causal link between dysregulated ER signaling and disease.

Similarly, skeletal muscle also expresses both ERα and ERβ and compromised metabolism observed in ERKO mice may also stem from derangements in skeletal muscle.

Targeted ERα activation in skeletal muscle has been deemed protective while ERβ activation is

pro-diabetogenic (41, 46). Studies describing relative changes in ER content in skeletal muscle

are conflicting and one study indicates an increase in ERα with OVX-induced E2-deficiency in mice (273). However, in female rats both the independent and combined effects of diet- and

OVX-induced obesity resulted in no change in ERα (215). ERβ protein levels are decreased in soleus, a primarily oxidative muscle, but not in glycolytic muscles in OVX female rats (215).

Further studies are clearly needed to better characterize potential changes in ERs associated with aging and E2-deficiency.

Accordingly, the purpose of the present study was to determine the singular and combined effects of aging and E2-deficiency on ER isoform distribution in visceral adipose tissue and skeletal muscle isolated from female rats. We also sought to characterize alterations in the

66

downstream adipose ER targets PPARγ and APN, which are likely to influence metabolic and

cardiovascular disease risk in this model. We hypothesized that increased ERβ protein in the

adipose tissue of aged animals would not only be associated with age, and E2-deficiency related weight gain, but also reduced protein levels of PPARγ and circulating APN. As similarly

hypothesized in adipose tissue, alterations in the ERα/β balance in skeletal muscle may also point

to a mechanism for the development of metabolic and cardiovascular disease risk in association

with aging and E2-deficiency. Finally, to gain an appreciation of adipocyte autocrine signaling

derangements in a setting of aging-associated E2-deficiency, we assessed AdipoR1 and AdipoR2,

as well as downstream regulators of lipid metabolism PPARα and AMPK in adipose tissue.

Methods

Animal Care

Certified specific pathogen free female adult (5–6 months, n = 11) and aged (23 months,

n = 11) F344 rats were obtained from Harlan Sprague Dawley (Indianapolis, IN). Rats were singly housed in filter-top cages containing corn-cob bedding and provided with a nylabone or wood block for enrichment. Rats were maintained on a 12 h light/dark cycle in an environment maintained at 22 °C with 20% humidity. Water and chow were supplied ad libitum and chow consisted of a standard laboratory rodent diet, LabDiet 5001 (PMI Nutrition International, St.

Louis, MO) with a caloric breakdown of 28.5% protein, 13.5% fat, and 58% carbohydrate.

Noteworthy, the LabDiet 5001 chow is soy- based and contains 810 μg/g of phytoestrogens,

which are compounds known to have weak estrogenic activity in vivo. All animal

experimentation described was conducted in accordance with accepted standards of the

Institutional Animal Care and Use Committee of the Pennsylvania State University.

67 Ovariectomy

To yield a significantly controlled level of E2-deficiency, a subset of adult (4 mo, n=6) and aged (22 mo, n=6) F344 rats underwent OVX. All OVX surgeries were performed by the supplier. Following surgery animals were transferred to the Pennsylvania State University and were allowed to recover for four weeks prior to experimental use and thus were age-matched to intact animals. Uterine weight was used to confirm E2-deficiency. We have previously

documented significantly reduced circulating E2 concentrations in aged (14.6 ±1.4 pg/mL), and

aged OVX (7.6 ± 1.1 pg/mL) vs adult intact rats (21.4 ± 1.0 pg/mL) through radioimmuno-assay

(24, 499).

Study Design

Rats were anesthetized using a sodium pentobarbital intra-peritoneal injection, sacrificed, and tissue collected. Perimetrial and retroperitoneal adipose depots were pooled and utilized for adipose studies. The left gastrocnemius and soleus muscle were utilized for skeletal muscle studies. All tissues were collected between 9:00am and 2:00pm and study of adult, adult OVX, aged, and aged OVX rats were alternated each day. Tissue was snap frozen in liquid N2 and stored at -80˚C until further analysis.

Serum Adiponectin Levels

Serum concentration of total APN was assessed using an enzyme-linked immunosorbent assay (ELISA) (EZRADP-62K; Millipore) according to manufacturer’s instructions.

68 Tissue Homogenization

Adipose and skeletal muscle tissue (~1 gm) was homogenized with a Polytron

(Kinematica) in 3.5 volumes of buffer containing (in mM): 40 HEPES, pH 7.4; 4 EGTA; 100

NaF; 50 KCl; 1 EDTA; 100 β-glycerol phosphate; 2 benzamidine; 1 Na-orthovanadate; 0.4

aminoethyl benzenesulfonyl fluoride; 6.5 CHAPS; 1% Triton X-100, and 0.2ug/ml of

microcystin. Homogenates were centrifuged at 4oC for 10 min at 10,000 X g and the supernatant

was assessed for protein concentration using the method of Bradford (513).

Western Blotting

Protein lysates were subject to separation using SDS-PAGE, transferred to PVDF

membranes and blocked in 6% non-fat dry milk for 2 hours at room temperature as described, by

us, previously (24, 500, 514). Membranes were probed overnight at 4oC with primary antibodies purchased from Santa Cruz Biotechnology Inc. at a concentration of 1:1000 for APN (30 kDa, sc-

26497), ERα (66 kDa, sc-542), ERβ (56 kDa, sc-8974), PPARγ (67 kDa, sc-7196); and 1:300 for

PPARα (55 kDa, sc-9000). Cell Signaling antibodies were used at a concentration of 1:500 for

Thr-172 phosphorylated AMPK (pAMPK) (62 kDa, 2531) and 1:1000 for Erp44 (44 kDa,

2886S). A concentration of 1:1000 was used for both AdipoR2 (42 kDa, AdipoR2-1; α-

Diagnostics) and AMPK (63 kDa, 07-350; Millipore). AdipoR1 (42 kDa), a gift from R.

Ramachandran, was used at a concentration of 1:1000. Membranes were then incubated with either HRP-linked anti-rabbit 1:20,000 for ERα, PPARα, PPARγ, Erp44, AMPK, pAMPK,

AdipoR1, and AdipoR2 or HRP-linked anti-goat at 1:25,000 for ERβ and APN for 1 h at room temperature and visualized using ECL (GE Healthcare). Densitometry was performed using

Scion Image (NIH). To correct for potential protein loading errors all membranes were stained

69 with SYPRO Ruby Blot Stain or Ponceau S (100 μg protein/lane) and densitometry performed as

previously described (24, 299, 500, 514).

Non-Reducing Western Blotting for Adiponectin Multimers

Protein lysates were subject to separation under non-reducing conditions. Electrophoresis

was performed on a gradient gel 4-20% (BioRad) without the reducing agent, β-mercaptoethanol in the sample buffer, and without SDS in the sample and electrophoresis buffers. Samples were transferred and blotted for APN as indicated in standard western protocol.

Statistical Analysis

All data are presented as means ± SE and analyzed using the SAS GLM procedure. A

two-way ANOVA was used to analyze all western data with age x E2 status as the interaction term. Post hoc analysis was performed on significant interactions using a Tukey test. An α-level

of p<0.05 was used for all comparisons and considered statistically significant.

Results

Animal Characteristics

As demonstrated by us previously (24), rat weight was significantly increased with age

(Table 4-1; p<0.01). OVX resulted in a significant weight gain (14%) in aged OVX, animals

Adult OVX rats experienced a 5% increase in body weight, but the change failed to reach

70 significance. Uterine weight decreased significantly with OVX in both adult and aged groups

(Table 4-1; p<0.0001), confirming successful OVX surgery and relative E2-deficiency.

Table 4-1: Rat body and uterine weight presented in grams (g); (n=5-6/group). Abbreviations: OVX, ovariectomy; * denotes age effect; † denotes OVX effect (p<0.05). Characteristic Adult Adult OVX Aged Aged OVX N 5 6 5 6

Rat Weight (g) 202.7 213.3 270.8 * 307.8 *† Uterine Weight (g) 0.6 0.1 † 0.6 0.3 †

Estrogen Receptors, PPARγ, and Erp44 Protein Levels

Immunoblotting for ERα, ERβ, PPARγ, and Erp44 was performed in visceral adipose

tissue isolated from gonadal and retroperitoneal depots of adult and aged rats and group differences were expressed relative to levels in adult ovary-intact animals. ERα was additionally

examined in skeletal muscle. ERα levels showed no significant change with age or E2-deficiency

relative to adult control in adipose or soleus tissue (Figures 4-1A and 4-2A). However, aged OVX

animals demonstrated a significant increase in ERα relative to adult OVX (Figure 1A). In

gastrocnemius muscle there is a significant increase in ERα in aged OVX samples only (Figure 4-

2B). We were unable to detect ERβ in skeletal muscle, but we did observed a two-fold increase in

ERβ with age when compared to both adult intact and OVX animals (Figure 4-1B).

71

Figure 4-1: The effects of aging and E2-deficiency on estrogen receptor α (ER)α and ERβ protein levels in adipose. Representative blots and adipose protein levels for ERα (Panel A); and ERβ (Panel B). *denotes age effect, ‡ denotes significantly different from adult OVX; (p < 0.05; n=5- 6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain.

72

Figure 4-2: The effects of aging and E2-deficiency on estrogen receptor α (ER)α protein levels in skeletal muscle. Representative blots and adipose protein levels for ERα in soleus (Panel A); and ERα in gastrocnemius (Panel B). †denotes significantly different from adult intact, ‡ denotes significantly different from adult OVX, § denotes significantly different from aged intact; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain.

73

Interestingly, PPARγ, which plays a significant role in adipose metabolism, decreased

with age and OVX (Figure 4-3A). Finally, there was a tendency for Erp44 protein levels to

increase with E2-deficiency in adipose tissue isolated from both adult and aged female rats

(p=0.09; Figure 4-3B).

Figure 4-3: Peroxisome proliferator activated receptor γ (PPAR)γ is reduced with age and E2- deficiency while endoplasmic reticulum protein of 44 kDa (Erp44) is unchanged. Representative blots and adipose protein levels for PPARγ (Panel A) and Erp44 (Panel B). * denotes age effect, † denotes OVX effect; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby blot stain.

74 Adiponectin, Adiponectin Receptors, and Downstream Targets AMPK and PPARα Protein Levels

To investigate potential dysregulated autocrine signaling related to ERs in adipose tissue with advancing age and E2-deficiency, we assessed serum APN, intra-adipocyte APN, and its receptors, AdipoR1 and AdipoR2. Circulating APN levels increased by 50 percent with OVX in adult, while reductions of 35 percent and 40 percent were observed in aged and aged OVX, respectively, relative to adult and adult OVX (Figure 4-4A; p<0.05). In contrast, immunoblotting

revealed that total APN protein levels were increased in aged OVX animals (Figure 4-4B;

p<0.05). AdipoR1 levels increased in aged OVX (Figure 4-4C p=0.056). AdipoR2 levels were

significantly decreased with age (Figure 4-4D; p<0.05).

75

Figure 4-4: Total intra-adipocyte adiponectin (APN) is significantly increased with age-associated E2-deficiency while circulating APN is significantly increased with OVX and reduced with age. Adiponectin Receptor 1 (AdipoR) 1 is unchanged with age or E2-deficiency while AdipoR2 is decreased with age. Circulating APN (Panel A), representative blots and adipose protein levels for APN (Panel B), AdipoR1 (Panel C), and AdipoR2 (Panel D). * denotes age effect, † denotes significantly different from adult intact, ‡ denotes significantly different from adult OVX, § denotes significantly different from aged intact; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact. APN and AdipoR2 are corrected with Sypro Ruby Blot Stain and AdipoR1 is corrected with Ponceau S.

76 Under non-reducing conditions we assessed the relative abundance of each APN multimer (Figure 4-5). HMW APN increased in all groups relative to adult controls (Figure 4-5;

Panel A). MMW, LWM and monomeric APN is increased in aged OVX animals only (Figure 4-

5; Panels B-D).

A. E. 6 ∗ 5 ∗ 4 3 † 2 HMW 1 HMW Adiponectin (Relative to Adult Intact)

0 Adult Aged B. 250 6 MMW 5 ‡ 150 4

3 † 100 2 ∗

1 MMW Adiponectin MMW (Relative to Adult Intact) 75 LMW 0 C. Adult Aged 6

5 ‡ 4 * 50

3

2

1

LMW Adiponectin 37 (Relative to Adult Intact)

0 D. Adult Aged mono 6 ‡ 5 † 4 25 +Ctrl 3 *

2 Intact OVX Intact OVX Adult Aged 1 (Relative to (Relative Adult Intact)

Monomeric Adiponectin 0 Adult Aged Figure 4-5: Representative blots and adipose protein levels for adiponectin (APN) multimers processed under non-reducing conditions. High molecular weight (HWM) APN (Panel A), MMW APN (Panel B), LWM APN (Panel C), monomeric (Panel D); representative non-reducing blot (Panel E). * denotes significantly different from adult intact, † denotes significantly different from adult OVX, ‡ denotes significantly different aged; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact.

77

Figure 4-6: Representative blots for PPARα. Values are means ± SEM; data is presented relative to adult intact and corrected with Ponceau S stain.

PPARα was unchanged with age or E2-deficiency (Figure 4-6). Similarly, AMPK and pAMPK levels were unchanged with age-associated E2-deficiency (Figure 4-7A and B; p=0.39 and p=0.29, respectively). However, the ratio of active pAMPK to AMPK was significantly

decreased with age (Figure 4-7C; p<0.05)

78

A. AMPK

pAMPK

Sypro

Intact OVX Intact OVX Adult Aged

2.5 Intact OVX 2.0

1.5

1.0 TotalAMPK 0.5 (Relative to Adult Intact) Adult to (Relative 0.0 Adult Aged

B.

2.5

2.0

1.5

1.0

0.5 pAMPK(Thr-172) (Relative to Adult Intact) Adult (Relative to 0.0 Adult Aged C.

2.5

2.0

1.5 / Total AMPK Total /

1.0 * *

(Thr-172) 0.5 (Relative to Adult Intact) Adult to (Relative 0.0 pAMPK Adult Aged Figure 4-7: Adenosine monophosphate-dependent protein kinase (AMPK) and activated AMPK (pAMPK) protein levels are unchanged, yet the pAMPK to total AMPK ratio is decreased with age-associated E2-deficiency. Representative blots for AMPK and pAMPK and adipose protein levels for AMPK (Panel A), pAMPK (Panel B), pAMPK to AMPK ratio (Panel C). * denotes age effect; (p < 0.05; n=5-6/group). Values are means ± SEM; data is presented relative to adult intact, AMPK and pAMPK are corrected with Sypro Ruby Blot Stain.

79 Discussion

The primary focus of the current investigation was to examine, for the first time, links

between increased adiposity known to occur with age-associated E2-deficiency, ER protein levels

and APN processing and secretion signaling in visceral adipose tissue of female rats. We also

characterized ERα protein changes associated with aging and estrogen in skeletal muscle. Given

the interesting increases in ERβ protein observed in adipose with aging we further investigated

potentially linked APN autocrine signaling derangements in aged and E2-deficient adipose tissue, including downstream regulators of lipid metabolism PPARα and AMPK. Collectively, the

results presented herein suggest increased ERβ protein levels are associated with compromised

APN secretion, as well as reduced AdipoR2 levels thus providing potentially important

observations regarding increased metabolic risk in aged women.

Evidence from αERKO models indicate that unopposed ERβ signaling promotes weight

gain and a metabolic phenotype in adult mice (61, 224, 246). Previous data also show that ERα is

reduced with OVX induced E2-deficiency in adipose of adult rats, and we observed a similar phenomenon in the current study (Figure 4-1A) (515). We also observed a significant increase in

ERα in adipose of aged OVX vs adult OVX animals which underscores the importance of using

an aging model to elucidate the combined effects of age and E2-deficiency to study metabolic phenotypes. ERα was increased in aged OVX animals in gastrocnemius, but not soleus muscle.

ERα is known to be more abundant in muscles containing glycolytic muscle fibers like the

gastrocnemius, and likely plays a more important role in regulating metabolism here rather than

in oxidative muscle like the soleus where we observed no significant change in ERα. With aging,

a decline in glycolytic fibers (and presumably ERα protein) occurs (264, 265). However, as

demonstrated by our model as well as others, OVX exerts a significant effect on ERα and the

overall result is an increase in relative protein (273). Regardless of changes in ERα, the most

80 striking finding we observed was a two-fold increase in ERβ in adipose of both aged and aged

OVX rats. That we observe greatest weight gain in aged E2-deficient animals co-incident with a

robust increase in ERβ suggests that ERβ alone, or perhaps the shift in the ERα/β ratio favoring

ERβ, may play a role in the development of age-associated increases in adiposity. We were

unable to detect ERβ in either soleus or gastrocnemius muscle.

Because ERβ is known to negatively regulate PPARγ transcriptional activity in 3T3-L1

cells and PPARγ activity is also enhanced in βERKO mice (60), we assessed PPARγ levels as a potential indicator of aberrant ERβ signaling in adipose. Indeed, we observed significant reductions in PPARγ protein levels with age-associated E2-deficiency, which may limit the

downstream signaling capacity of PPARγ. Because PPARγ can upregulate APN, and in turn,

positively affect glucose and lipid metabolism in insulin sensitive tissues (388, 516-518), we also

assessed a PPARγ-responsive protein associated with intra-adipocyte APN retention, Erp44

(Figure 4-2B).

In this regard, we observed increased levels of circulating APN in OVX rats which are

similar to findings observed in adult mice (408). Previous findings also indicate reduced

circulating APN levels with aging in association with metabolic and cardiovascular disease status

(70, 71, 512). Here, reduced circulating APN levels in aged OVX rats were associated with

elevated intra-adipocyte APN protein levels. In fact, HMW, MMW, LMW, and monomeric APN

were all increased in aged OVX animals relative to adult animals in adipose tissue (Figure 4-5

Panel E). Collectively, these findings suggest the possibility of APN retention in adipocytes of

aged E2-deficient animals, thereby providing a mechanism to increase metabolic risk. Indeed,

Erp44, which acts to retain and prevent secretion of APN during post-translational processing

(370), showed a tendency to increase in both adult and aged OVX animals (p=0.09). It is also

noteworthy that Erp44 is transcriptionally downregulated by PPARγ in adipocytes (370). The

observed reductions in PPARγ protein levels and/or negative regulation by ERβ in aged OVX rats

81 could promote disinhibition of Erp44 and subsequently increase APN retention. Although

speculative at this time, our results provide evidence for an ERβ-driven mechanism explaining

APN retention and/or secretion failure in aged and E2-deficienct female rats (summarized in

Figure 4-8), although additional studies are indicated to investigate this important issue.

Finally, reduced autocrine signaling in adipose may also play a role in further exacerbating adiposity and metabolic disease in aged E2-deficient animals. Thus we examined protein levels for both AdipoR1 and 2 in adipose tissue. While no group differences were observed for AdipoR1, AdipoR2 was significantly decreased with age. Reduced AdipoR2, with unchanged R1 levels has also been observed in diabetic rats indicating, as expected, aged E2-

deficient animals are likely progressing to a metabolic phenotype (519). Metabolic dysregulation

associated with age and E2-deficency in our model is further evidenced by the significant

decrease in the pAMPK/AMPK ratio in aged and aged OVX animals, and while speculative, may

result in impaired pAMPK-driven processes like glucose uptake and fatty acid mobilization in

adipocytes (424, 520) (model summarized in Figure 4-8).

Dysregulated Lipid metabolism Cardiovascular Age-associated E2 deficiency Disease Risk

PPARα pAMPK Metabolic ERβ Disease Risk AdipoR2 AdipoR1 PPARγ Obesity

Erp44

Adiponectin Circulating Retention Adiponectin

Figure 4-8: Proposed signaling model for effects of age-associated E2-deficiency on ERβ signaling in adipose tissue and potential links to increased obesity, metabolic, and cardiovascular disease risk through dysregulated APN signaling.

82 Conclusions

We have demonstrated that the unique state of E2-deficiency in aged rats is associated with an altered ERα/β ratio in favor of ERβ in adipose tissue. In skeletal muscle we observed significantly increased ERα in gastrocnemius of aged OVX rats relative to aged intact, adult

OVX, and adult intact controls. In adipose tissue with increased ERβ protein levels we also observed decreased PPARγ and decreased circulating APN levels which set the stage for increased adiposity and subsequent metabolic dysregulation in aged E2-deficient animals.

Compromised APN processing and/or secretion to the circulation may be driven by reductions in

PPARγ signaling and subsequent disinhibition of Erp44, thus providing a potential explanation for the apparent disconnect between increased intra-adipocyte and reduced circulating APN protein levels in aged E2-deficient rats. In conjunction with decreased circulating APN levels we also observed decreases in AdipoR2 and the pAMPK/AMPK ratio. Decreased autocrine signaling in adipose tissue mediated by APN and its downstream targets may result in a reduced capability to metabolize lipids in adipose and may, in part, explain increased weight gain in aged animals.

Further studies within the context of aging and E2-deficiency are required to determine if post-

menopausal weight gain, metabolic syndrome, and CHD risk are linked through reduced APN secretion, and ERβ-driven derangements in adipose tissue.

83

CHAPTER 5

EXAMINING THE EFFECTS OF ESTROGEN RECEPTOR BETA ON

ADIPONECTIN ON 3T3-L1 CELLS

Introduction

Aberrant ER β signaling has been implicated in promoting adiposity and indirectly increasing obesity-associated CHD risk (46, 51, 55, 60, 61, 245, 289, 328, 521). Previously we have shown ERβ protein abundance is increased in adipose tissue of aged female rats, a model demonstrating reduced myocardial ischemic tolerance (409). However, the functional implication of ERβ abundance and/or activation in adipocytes on CHD risk is not completely understood.

Interestingly, APN, a cardioprotective protein produced in adipose tissue is reduced in aging female rats. We propose that increased ERβ expression and/or ligand-dependant activation reduces APN in adipose tissue, thereby contributing to CHD risk in association with increased

adiposity.

The interaction between ERβ and APN in adipose tissue has been linked through the

master regulator of metabolism, PPARγ (60, 522). ERβ overexpression negatively regulates

PPARγ transcriptional activity, which in turn likely prevents positive regulation of PPARγ’s

downstream target, APN (60). While the relation between ERβ overexpression and PPARγ

suppression has been clearly established, the exact impact of ERβ on APN remains unstudied.

The purpose of this study was to determine the role of ERβ on intracellular APN

synthesis and secretion mechanisms. APN is a complex protein and undergoes multiple

84 posttranslational modifications prior to intra-adipocyte assembly into its three biologically active forms: LMW, MMW, and HMW APN (361). PPARγ upregulates APN via several mechanisms including direct transcriptional activation as well as regulation of APN processing and assembly via modulation of the APN chaperone proteins, Erp44 and Ero1-Lα (369, 370, 372, 374, 389). In order to directly determine a mechanism by which ERβ suppresses APN we selected the adipocyte-like 3T3-L1 cell line to overexpress ERβ in vitro. The 3T3-L1 cell line is a well established model for studying adipocyte maturation and function (523). Herein, we sought to develop a suitable model to characterize the effects of ERβ overexpression and activation on

APN.

Methods

Cell Culture

Mouse 3T3-L1 fibroblasts and HEK293 cells were purchased from American Type

Culture Collection (ATCC). Cells were maintained in 10 cm plates (3X105 cells/plate) in a

o humidified atmosphere with 5% CO2 at 37 C. Phenol red is a weak ER agonist, therefore cells were maintained in phenol-free basal culture media (high glucose Dulbecco’s Modified Eagle

Media; Invitrogen) supplemented with 10% fetal calf serum (FCS; ATCC), 10 µg/mL ciprofloxacin (Sigma), 1 mM sodium pyruvate (Invitrogen), and 1X non-essential amino acids

(Invitrogen). Ciprofloxacin was utilized to prevent mycoplasma and bacterial infection in cultures (524).

85 3T3-L1 Differentiation

Three days post-confluence, differentiation was induced in 3T3-L1 cells with basal

medium supplemented with 500 μM 3-isobutyl-1 methylzantine, 250 nM dexamethasone, and

330 nM insulin (differentiation medium) as previously described (525). Cells were maintained with differentiation medium for 48 h, and then treated with basal medium supplemented with 330 nM insulin for an additional 48 h. To complete the differentiation process, cells were maintained with basal medium and differentiated for an additional 6-8 days; total differentiation time was 10-

12 days. To confirm 3T3-L1 cell differentiation, representative samples from each experiment were stained with Oil Red O staining and assessed for lipid accumulation (0.5% Oil Red O in

60% isopropanol).

Plasmid Purification and Linearization

Human and mouse ERβ plasmids (Figure 5-1) were a gracious gift from Dr. Kenneth

Korach, (NIEHS, Research Triangle Park, NC). Plasmids were prepared using the Qiagen

Plasmid Purification Maxi kit according to manufacturer’s instructions (526, 527). Following purification, an aliquot of both mouse and human ERβ plasmids were digested with restriction enzymes (New England Biolabs) for 1 h at 37oC to yield linearized plasmid products see Figure

5-2 for restriction enzyme cut sites. To generate potentially easier to transfect products, circular plasmids were digested with ScaI (R0122S) to yield a linearized plasmid 7 kb in size. SSpI and

PciI (R0132S; R0655S) were used to excise the ampicilin sequence and yield a 5 kb product.

BciVI (R0596S) was used to digest and separate the ERβ encoding region and promoter containing sequence to yield a 3 kb product. Digested plasmid products were separated electrophoretically using 1.5% agarose gel, and stained with ethidium bromide to visualize bands.

86 Linearized plasmid products were excised and isolated with Qiaex II Gel extraction kit (Qiagen) per manufacturer’s instructions.

Figure 5-1: Korach ERβ mouse construct.

87

Figure 5-2: ERβ mouse construct with restriction enzyme cut sites identified.

88 Determination of Optimal Transfection Conditions

Lipofectamine LTX

3T3-L1 and HEK293 cells were plated in 6-well plates (1X105 cells/well) in basal

medium. After 24h, cells were 70-80% confluent and transfected with either mouse or human

ERβ constructs. A pcDNA3 vector without an ERβ insertion was utilized as a negative control.

Intact circular construct as well as linearized plasmid products of 7, 5, and 3 kb were utilized for

all transfection studies and 50-200 ng (for HEK293 cells) or 1-1.5 μg (for 3T3-L1 cells) of DNA construct was transfected. On the day of transfection, plasmids were incubated for 30 min with

Lipofectamine LTX (Invitrogen) in serum free media according to manufacturer’s instructions.

Basal medium was changed immediately prior to addition of plasmid/Lipofectamine mixture to

3T3-L1 and HEK293 cells. Basal media was changed 6 h post-transfection. Cells were assayed for mRNA expression or protein abundance 24-48 h post transfection with q-RT PCR and western blotting, respectively. Detailed methods describing mRNA isolation and protein homogenate preparation are described in the respective sections contained herein.

FuGene6

A subset of 3T3-L1 cells was transfected with FuGene6 reagents according to manufacturer’s instructions. Cells and plasmids were prepared in the same conditions and concentrations as described in the Lipofectamine LTX section, but FuGene6 reagents were substituted for Lipofectamine LTX reagents.

89 AMAXA

A subset of 3T3-L1 cells (1 × 106 cells / well) was transfected with 2 μg of plasmid DNA using AMAXA nucleofactor solution (Lonza) following manufacturer’s instructions. Cells were assayed 24-48 h following transfection for mRNA expression.

Stable Transfection

The Lipofectamine protocol was utilized for all stable transfection assays. However, in place of basal media, media supplemented with 500 μg/mL neomycin (G418; Sigma) was added to cells 6 h post transfection. 3T3-L1 cells were maintained on G418 containing selection media for four weeks until 80% confluence was achieved. Cell lysates were assayed immediately for

ERβ mRNA and protein abundance.

RNA Isolation and qRT-PCR

Following two washes in ice cold PBS mRNA was isolated from 3T3-L1 and HEK293 cells using an RNeasy kit (Qiagen) per manufacturer’s instructions. RNA concentration was determined spectrophotometrically (Beckman DU60) using the 260/280 ratio method.

Complementary DNA (cDNA) was synthesized from mRNA using a high capacity cDNA reverse

transcription kit (Applied BioSystems) under the following conditions; 25oC for 10 min, 37oC for

120 min, then 85oC for 5 min using an iCycler (BioRad). From this reaction, 100 μg of cDNA

and 25 ng of mouse or human ERβ primers were used per qRT-PCR reaction with SensiMix

SYBR master mix (Bioline). Primers were designed for mouse and human ERβ using Geneious

Basic software version 5.0 and targeted to the conserved n-terminal domain to detect all splice

variants. Primers were generated by the Penn State genomics core facility (Table 5-1). The

90 amplification conditions were 95oC for 10 min, then 40 cycles of 95oC, 55oC, and 72oC for 15 sec

using the BioRad iCycler.

Table 5-1 Primers for detection of human and mouse ERβ

Forward (5’→3’) Reverse (5’→3’) ERβ mouse primer GAAGCTTGGCGGGAGCGGTT TGCAGACGGCGCAGAAGTGA ERβ human primer CTGCCAGGCCTGCCGACTTC CGCACAAGGCGGTACCCACA

Protein Homogenate Preparation

Cells were washed with ice cold phosphate buffered saline and homogenized in lysis

buffer (150 mM NaCl, 40 mM HEPES (pH 7.4), 1 mM EDTA, 1 mM NaF, 0.5 μg/mL pepstatin

A, 5 μg/mL aprotinin, 5 μg/mL leupeptin, 1 mM PMSF, 1mM sodium ortho-vanadate, and 1%

Trition X100; Sigma). Cells were lysed during one freeze/thaw cycle (-80oC/4oC) and then

centrifuged at 10,000Xg at 4oC for 10 min. The supernatant was assessed for protein concentration using the method of Bradford prior to western blotting (513).

Estrogen Receptor Activation

For all ER activation studies, differentiated 3T3-L1 cells were treated with PPT, DPN

(Tocris Bioscience), 17-β estradiol (E2; Sigma), or vehicle (0.01% ethanol). To control for any

non-specific ER activation, cells were maintained in basal media containing charcoal stripped

FBS (Invitrogen) for 12 h prior to ER agonist treatment. Charcoal stripping not only reduces E2 –

content, but also the concentration of all other hormonal/growth factors in serum. Pre-incubation

of 3T3-L1 cells in serum-free media resulted in notable cell death during experimentation and

91 cells were thusly maintained in the low-hormone, low-growth factor containing charcoal-stripped

FBS for the duration of the experiment. Cells were then dosed with 10μM PPT, DPN, E2 or

vehicle for 24 h, and then acutely activated for 3 minutes with 100 nM insulin. Cells were

immediately harvested in ice cold lysis buffer, and assessed for protein kinase B (Akt)

phosphorylation with western blotting.

Western Blotting

Protein lysates were subject to separation using SDS-PAGE, transferred to PVDF

membranes and blocked in 5% non-fat dry milk for 2 h at room temperature as previously

described (24, 500, 514). Membranes were incubated overnight at 4oC with primary antibodies at a dilution of 1:1000. For ERβ detection three commercially available antibodies were used: ERβ

H-150 (Santa Cruz; sc-8974), and ERβ Y-19 (Santa Cruz; sc- 6831); and ERβ clone 68-4

(Millipore; 05-824). For ER activation studies, Akt (Cell signaling; 9272) and serine 473 phosphorylated Akt (pAkt; Cell Signaling 9271) antibodies were assessed. All membranes were then incubated with either HRP-linked anti-rabbit secondary antibody at a dilution of 1:20,000 except for ERβ Y-19 which was incubated with HRP-linked anti-goat secondary antibody at a dilution of 1:25,000 for 1 h at RT and proteins visualized by ECL (GE Healthcare). To control for loading errors membranes were then stripped and reprobed with a glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Sigma) primary antibody and HRP-linked anti-mouse secondary antibody at a dilution of 1:20,000. Densitometry was performed using Scion Image (NIH) as previously described (24, 299, 500, 514).

92 Total and HMW Adiponectin Assessment

Differentiated 3T3-L1 cells were treated with DPN or ethanol vehicle for 12 and 24 h.

Time points were chosen based on previous ER activation studies (528-530). Cells were immediately homogenized in lysis buffer and assessed for APN content utilizing a total/HMW

APN ELISA kit (47-ADPHU-E01; ALPCO) according to manufacturer’s instructions. Culture media was also assessed for total and HMW adiponectin. APN abundance was assessed at a range of DPN doses (100 pM to 1 µM) at both 12 and 24 h time points; n=3/treatment/time point.

Statistics

For ER activation and APN assessment studies a two way ANOVA was conducted for time, drug, and time X drug interactions. A Tukey test was used for all post hoc analysis and a P- value < 0.05 was considered statistically significant.

Results

Estrogen Receptor β Overexpression in 3T3-L1 Cells

ERβ mRNA increased 1000-fold in 3T3-L1 cells 24 h following transfection with ERβ constructs compared with non-transfected controls (Figure 5-3A). However, induction of mRNA did not result in concomitant increase in ERβ protein abundance. In an attempt to optimize transfection efficiency in 3T3-L1 cells, three transfection reagents were utilized Lipofectamine

LTX, FuGene6, and AMAXA. The lipid-based transfection reagents Lipofectamine LTX and

FuGene6 did not differ in transfection efficacy in 3T3-L1 cells (data not shown). The AMAXA electroporation system resulted in substantial cell death and was deemed too harsh a transfection

93 method for 3T3-L1 cells. Lipofectamine LTX reagents were utilized for the remainder of

transfection studies presented herein. Finally, excluding ciprofloxacin from the culture media

during transfection did not improve efficiency.

To further optimize transfection efficiency, both mouse and human ERβ plasmids were

linearized with restriction enzymes prior to transfection. The circular human and mouse ERβ

plasmids are 7 kb in size and intact constructs may be too large to transfect into 3T3-L1 cells.

Three different digests were completed to yield a full length 7 kb plasmid, a 5 kb product lacking

ampicilin resistance genes, and a 3 kb fragment containing only the ERβ coding sequence and

promoter for both mouse and human ERβ constructs. No difference was observed in relative

transfection efficiency between mouse and human ERβ constructs in 3T3-L1 cells (data not

shown). Moreover, linearizing plasmids prior to transfection did not improve transfection

efficiency in 3T3-L1 cells; ERβ mRNA expression was not different in linearized vs circular

plasmid transfected (Figure 5-3A).

To determine if it was indeed possible to achieve concomitant increases in mRNA

expression and protein abundance following ERβ transfection, we additionally utilized HEK293

cells. HEK293 cells are a readily transfectable cell line and following transfection ERβ mRNA

expression was increased 20,000 fold relative to non-transfected controls. More importantly we

successfully demonstrated ERβ protein presence in transfected HEK293 cells with western

blotting (Figure 5-3 B). The migration pattern of ERβ did differ between transfected HEK293

cells and the F344 rat ovary homogenate positive control. The transfected ERβ construct derived from murine ERβ has a predicted Mr of 53 kDa and rat ovary contains three ERβ splice variants with predicted Mr of 54.2, 59.2 and 61 kDa (506, 531, 532). We also determined that 100 ng of plasmid DNA was sufficient for ERβ mRNA overexpression in HEK293 cells, which is 10-fold less than the 1 µg necessary for maximal transfection 3T3-L1 cells.

94

A. B.

2500 25000 non-transfected circular plasmid 2000 linearized plasmid (7 kb) 20000 linearized plasmid (5kb) linearized plasmid (3kb) 1500 15000

1000 10000 mRNA expresssion mRNA expresssion

500 HEK293 cells (Relative to Ctrl) to (Relative (Relative to Ctrl) to (Relative 5000 ER Beta undifferentiated 3T3-L1 cellsundifferentiated 0 ER Beta 0 Ctrl 1000 1250 Ctrl 50 100 200 ng of plasmid DNA utillized for transfection ng of plasmid DNA utilized for transfection C. D.

2500 25000

2000 20000

1500 15000 1000 mRNA expresssion mRNA expresssion 10000 500 HEK293 cells

50 Ctrl) to (Relative (Relative to Ctrl) to (Relative

25 undifferentiated 3T3-L1 undifferentiated 5000 ER Beta ER Beta 0 0 Non-transfected Transient Stable Non-transfected Transient Stable

E. 75-

ERβ 50-

37- Non Trans Non

Trans Stable

3T3-L1 HEK293 Ovary

95

Figure 5-3: ERβ mRNA expression and protein abundance in transfected 3T3-L1 and HEK293. ERβ mRNA expression in transiently transfected 3T3-L1 cells (Panel A), stably transfected in 3T3-L1 cells (Panel B), transiently transfected HEK293 cells (Panel C), stably transfected HEK293 cells (Panel D). Representative blot of ERβ protein in transfected 3T3-L1 and HEK239 cells (Panel E); non-transfected (non) transient transfection (trans), stable transfection (stable).

96 We additionally explored stable transfection to increase ERβ expression in 3T3-L1 cells.

However, instead of increasing transfection efficiency, stable transfection reduced mRNA

expression in both 3T3-L1 and HEK293 cells (Figure 5-3C and D). Moreover no ERβ protein

could be detected in either 3T3-L1 or HEK293 cells (Figure 5-3E).

Total and High Molecular Weight Adiponectin Assessment

Based on our inability to significantly overexpress ERβ we explored an alternative approach examining ligand-dependant ERβ activation. Differentiated 3T3-L1 cells express endogenous ERs. We activated ERβ with the agonist DPN in differentiated 3T3-L1 cells to examine ligand-dependant ERβ activation on APN intracellular processing and secretion. To determine if ERβ could affect the relative distribution of APN multimers, HMW and total APN were assessed in cell lysates and culture media. Neither total nor HMW APN abundance changed in DPN treated cells relative to vehicle treated control cells. DPN doses ranging from 100 pM to 1

µM did not affect APN protein secretion; representative data for the 100 pM DPN dose is shown in Figure 5-4. HMW APN did decrease in cell lysates and increase in media after 24 vs 12 h in both control and DPN treated cells.

97

A. B.

1500 1500 12 h 24 h 1200 1200

900 900 ng/mL 600 ng/mL 600

Total Intracellular APN * 300 Intracellular APN HMW 300 *

0 0 Ctrl DPN Ctrl DPN

C. D.

60 60

45 45

30 30 ng/mL ng/mL * * Total Secreted APN 15 APN Secreted HMW 15

0 0 Ctrl DPN Ctrl DPN

Figure 5-4: Total and high molecular weight (HMW) adiponectin (APN) obtained from cell lysates (intracellular) and culture media (secreted) after 12 or 24 h of ERβ activation in differentiated 3T3-L1 cells. Intracellular total APN (Panel A), intracellular HMW APN (Panel B), secreted total APN (Panel C), and secreted HMW APN (Panel D) are not affected by 100pM DPN treatment. *denotes effect of time; (p<0.05; n=3 samples/group; all experiments were repeated twice). Values are means ± SEM; data is presented relative to 12 h vehicle treated control cells.

Estrogen Receptor Activation

Finally, we assessed activation Akt in 3T3-L1 cells to determine ER responsiveness.

Lack of APN response to DPN treatment in 3T3-L1 cells may be due to a defect in endogenous

ER signaling. As a positive control for ER responsiveness we repeated the ER activation

experiments of Muraki et al (530). As previously shown, we did observe insulin-activated Akt

98 phosphorylation in differentiated 3T3-L1 cells (530). However, unlike Muraki et al, treatment of

differentiated 3T3-L1 cells with supraphysiological concentrations of DPN, PPT, or E2 prior to

insulin treatment did not yield expected E2- mediated attenuation of Akt phosphorylation (Figure

5-5).

A.

pAkt Akt Drug=E2 GAPDH

pAkt Akt Drug=PPT GAPDH

pAkt Akt Drug=DPN GAPDH

Insulin EtOH Insulin Drug + Drug B.

10 E2 * PPT * DPN 8

6 / total / Akt

Ser473 4 pAkt

2 (Relative to Vehicle TreatedControl) Vehicle to (Relative

0 Ehtanol (Ctrl) Insulin Drug Insulin + Drug

Figure 5-5: Insulin increased phosphorylated Akt (pAkt) in differentiated 3T3-L1 cells. Representative blot and protein levels for pAkt, Akt, and GAPDH. Representative blots (Panel A) and relative protein expression of the relative pAkt/Akt ratio (Panel B); *denotes significantly different from vehicle (EtOH) treated control (n=4/group; all experiments were repeated twice). Values are means ± SEM; data is presented relative to EtOH control; estrogen (E2), propyl pyrazole-triol (PPT), diarylpropionitrile (DPN).

99 Discussion

The purpose of this study was to determine the effect of ERβ on intracellular APN

synthesis and secretion mechanisms utilizing an in vitro model. We encountered numerous

challenges attempting to overexpress ERβ in 3T3-L1 cells and were unsuccessful in stimulating

endogenous ER activation in differentiated 3T3-L1 cells. It is still unknown if ERβ plays a role in

modulating APN in adipocytes.

In our efforts to maximize ERβ overexpression we gleaned valuable information regarding the 3T3-L1 cell line. We determined that transiently transfected 3T3-L1 cells overexpress ERβ mRNA. However, increased mRNA expression was independent of ERβ protein presence in 3T3-L1 cells. Similarly transfected HEK293 cells demonstrated both increased ERβ mRNA expression and protein was detected thus confirming that the ERβ construct utilized can yield detectable ERβ protein in vitro. We attempted to optimize transfection in 3T3-L1 cells by using lipid based transfection reagents, Lipofectamine LTX and FuGene6, which resulted in the most successful ERβ mRNA induction in 3T3-L1 cells. Electroporation was unsuccessful because it resulted in extensive cell death. It is unknown why 3T3-L1 cells were unable to produce detectable quantities of ERβ protein following transfection. Others have had success transfecting the 3T3-L1 cell line with various plasmid constructs using Lipofectamine LTX (60, 368, 530,

533). It may be that ERβ protein in transfected 3T3-L1 cells is just under the detection limits of western blotting. Differentiated 3T3-L1 cells do express endogenous ERs and expression increases during the differentiation process (530) (533). The upper band detected in 3T3-L1 cells may represent endogenous ERβ (Figure 5-3). A faint signal at the same molecular weight appears in ovary homogenates providing further evidence that the signal is likely a larger ~60 kDa ER splice variant. HEK293 cells do not express endogenous ERs and the ~55 kDa signal is likely the

result of non-specific binding.

100 We further attempted to modify transfection conditions to enhance transfection in 3T3-L1

cells via plasmid linearization and stable selection. The ERβ construct utilized in the current

investigation was large (7 kb; Figure 5-1) relative to other ERβ constructs (4 kb) used in 3T3-L1 transfection studies (60). Using a restriction enzyme digest regime, we modified the ERβ plasmid construct to yield linearized (7 kb), smaller (5 and 3 kb), and potentially easier to transfect ERβ encoding products. The smaller ERβ linearized plasmids (5 and 3 kb) did not increase mRNA expression compared with non-linearized circular constructs. After determining plasmid size was not a limiting factor for ERβ expression, we attempted stable transfection techniques. Cell proliferation was reduced 10-fold during stable selection, suggesting proliferation of non-transfected cells was successfully inhibited. Curiously, after four weeks of stable selection both 3T3-L1 and HEK293 cells demonstrated reduced mRNA expression vs transiently transfected cells. Stable transfection was determined to be ineffective toward improving transfection efficiency.

In lieu of ERβ overexpression, we attempted an alternative approach to assess ERβ activation on APN processing and secretion in differentiated 3T3-L1cells. Following differentiation 3T3-L1 cells endogenously express ERs (121, 530). In the current investigation

HMW APN decreased in cell lysates and increased in culture medium at 24 vs 12 h in both control and DPN-treated cells which suggests APN secretion. Similar to our findings HMW APN secretion has been reported to occur between 12-17 h in rat adipocytes (400). The culture medium change prior to DPN treatment may have provided an impetus for HMW APN secretion.

Regarding ERβ activation, others have shown no effect on APN, or APN regulatory proteins in

3T3-L1 cells (60, 530). At odds with these findings, another study demonstrated ERβ activation reduces APN regulatory proteins in adipose tissue (522). After 12 and 24 h of ERβ activation in differentiated 3T3-L1 cells, neither total nor HMW APN abundance changed in cell lysates or culture medium relative to vehicle treated controls. These data indicate ERβ activation does not

101 inhibit total APN production, HMW assembly, or secretion. However, these findings must be

interpreted with caution as we were unable to confirm ER responsiveness in differentiated 3T3-

L1 cells following E2 treatment. Pretreatment with supraphysiological E2 concentrations for 24 h

is known to reduce insulin-mediated Akt phosphorylation in differentiated 3T3-L1 cells (533).

This response is also observable in clinical studies in individuals with high concentrations of E2

such as pregnancy, trans-sexuality, and irregular menstrual cycling (534-537). Lack of response

to E2 casts doubt on the validity of ERβ activation studies conducted herein.

In conclusion it is still unknown if ERβ overexpression or ligand-dependent activation regulates APN in adipocytes. A limitation of the study is that we only used one adipose-like cell line. The human Simpson-Golabi-Behmel syndrome (SGBS) pre-adipocyte cell is not as widely used as the 3T3-L1 cell line, but is an alternative model which similarly develops an adipose-like phenotype following differentiation (411, 538). Also, a more aggressive method of transfection, like adenoviral infection, was not attempted. Future studies should include assessing the SGBS cell line, or primary adipocyte cultures as well as employ adenovirus-mediated transfection methods.

102

CHAPTER 6

ADIPONECTIN IS CARDIOPROTECTIVE IN THE AGED FEMALE RAT

HEART

Introduction

Postmenopausal E2-deficiency is clearly linked to the loss of IT in the female heart.

Moreover, the aged female heart is refractory to many cardioprotective interventions proven

efficacious in rescuing the adult heart from I/R injury (315-317, 319, 321). The lack of available treatments is of great concern given that heart disease is the number one killer of women (7).

Recently APN has garnered attention as a new treatment to limit the infarct size and ischemic damage following myocardial I/R injury (93, 94, 354-356, 443, 444, 482).

APN is a factor secreted from adipose tissue and in addition to directly acting at the myocardium to promote IT, reduced circulating levels are predictive of adverse cardiac events associated with CHD risk (80, 350, 354, 383, 442, 443, 512). Moreover, APN is particularly promising as a treatment since delivery prior to, during, and following ischemia all result in enhanced cardioprotection (354-356). APN acts directly on the myocardium to limit inflammation, apoptotic cell death, and nitrate production following I/R injury via three independent mechanisms (95, 354, 434, 455-457). Specifically, in the ischemic myocardium,

APN treatment promotes COX2–mediated, suppression of TNFα thereby reducing inflammation

(354, 483). APN also inhibits peroxynitrite formation via inhibition of the superoxide producing subunit of NADPH, gp91phox in the ischemic myocardium (443). Additionally, APN also reduced

apoptotic cell death via and AMPK-dependant mechanism (354).

103 AMPK is of particular interest in the ischemic myocardium given its dual role in

promoting cardioprotection and damage. When activated by phosphorylation on site Thr172,

AMPK promotes both fatty acid and glucose utilization. Following I/R injury AMPK stimulated glucose utilization confers protection, yet enhanced fatty acid utilization associated with ACC phosphorylation promotes damage (462, 475-480).

Transient APN treatment is associated with glucose oxidation in vitro which suggests that cardioprotective effects may be linked to AMPK-associated glucose utilization. However, enhanced AMPK and ACC phosphorylation is also observed in vivo coronary artery ligation experiments at 3, 24, and 48 h following APN-treatment relative to vehicle treated animals in association with improved cardiac function (93, 354). Currently, it is unknown if anti-apoptotic

APN-AMPK signaling is linked to glucose oxidation, fatty acid oxidation, or simply coincident and mediated via a completely novel pathway.

Cardioprotection conferred by APN has been demonstrated in multiple species including mice, rats, and pigs; however, animal models of diabetes show resistance to APN treatment (93,

94, 354, 355, 482). The dose of APN necessary for cardioprotection from I/R injury in diet- induced Type II diabetic rats is three times that required in wild type controls (93). In streptozotocin-induced diabetic rats, APN efficacy is differentially modulated by transient reductions in AdipoR1 during early (1 week), but not late stages (7 weeks) of disease progression

(94). While F344 female rats are not diabetic, they are characterized at insulin resistant and with aging do demonstrate increased adiposity and reduced IT similar to diabetic animal models (24,

93, 255, 499, 539)

The primary focus of this investigation was to determine if APN treatment is efficacious in protecting the female rat myocardium from I/R injury in aged and aged OVX rats. Also, given the phenotype of AdipoR1 expression associated with obese/diabetic states (94, 489), we also sought to characterize AdipoR1 and AdipoR2 protein abundance in cardiac muscle of the aged

104 and aged OVX female rat both on a standard chow as well as a high fat diet. Finally, to elucidate

potential therapeutic targets for CHD in postmenopausal women we examined a downstream

modulator of APN signaling, AMPK in aged APN treated hearts.

Methods

Animal Care

Certified specific pathogen free female adult (6-7 mo; n = 14) and aged (23 mo; n =14)

F344 rats were obtained from Harlan Sprague Dawley (Indianapolis, IN). Rats were singly housed in filter-top cages containing corn-cob bedding and provided with a nylabone or wood block for enrichment. Rats were maintained on a 12 h light/dark cycle in an environment maintained at 22

°C with 20% humidity. Water and chow were supplied ad libitum and chow consisted of a standard laboratory rodent diet, LabDiet 5001 (PMI Nutrition International, St. Louis, MO) with a caloric breakdown of 28.5% protein, 13.5% fat, and 58% carbohydrate. Noteworthy, the LabDiet

5001 chow is soy- based and contains 810 μg/g of phytoestrogens, which are compounds known to have weak estrogenic activity in vivo.

Ovariectomy

To yield a consistent level of E2-deficiency, a subset of F344 rats were ovariectomized by

Taconic (n=11 at 22 mo). Following surgery animals were transferred to the Pennsylvania State

University and were allowed to recover for four weeks prior to experimental use or start of dietary intervention. Uterine weight was used to confirm E2-deficiency as previously validated in

105 our laboratory (24, 499). All animal experimentation was conducted with approval from the

Institutional Animal Care and Use Committee of the Pennsylvania State University.

Study Design for APN Treatment

Animals were randomly assigned to receive a 9 µg infusion of either APN (Biovendor;

adult n=5, aged n=7, aged OVX n=5) or vehicle (Krebs-Henseleit buffer) delivered in 2mL during the isolated heart protocol. The APN dose and timing of delivery was chosen based on efficacy demonstrated in past studies with male Sprague-Dawley rats (482). Study of adult, aged, and aged

OVX rats was alternated each day. Vehicle and APN treated-rats of the same group (adult, aged, and aged OVX) were paired such that n=2-3 experiments were completed per day. Order of APN and vehicle treatments were alternated to control for any influence of circadian rhythm on cardiac function and all experiments were conducted between 9:00am and 2:00pm.

Dietary Intervention

A second group of F344 female rats were subjected to a 20 week dietary intervention.

Adult ( n=9), aged (n=12), and aged OVX (n=8) rats were assigned to receive either the standard laboratory rodent diet, LabDiet 5001 or the Lieber-DeCarli liquid diet (Bio-Serv, Frenchtown,

NJ) for 20 weeks. The Lieber-DeCarli diet is considered to be a high fat diet and has a caloric

breakdown of 15.1% protein, 35.9% fat, and 49% carbohydrate. Rats were obtained at 3 and 18

months of age at the start of the dietary intervention and were thus age-matched to rats utilized for I/R studies.

106 Protocol of the Isolated Heart

Female adult, aged, and aged OVX F344 rats were anesthetized with pentobarbital (40 mg/kg body weight; intraperitoneal), and hearts were excised via midline thoracotomy. Isolated hearts were secured to a modified Langendorff perfusion apparatus via the aorta, perfusion pressure was set at 85 mmHg, and hearts were paced at 260 beats/min. LVDP, and positive and negative developed pressure with respect to time (+/- dP/dtmax; indices of contractility and

relaxation, respectively), were assessed by a pressure transducer attached to a water-filled latex

balloon inserted into the left ventricle. EDP was adjusted to 5–6 mmHg according to established procedures in our laboratory (24, 299, 500). After 30 minutes of equilibration, all Lieber-DeCarli

fed rat hearts and a subset of chow fed rat hearts (n=4/group) were isolated, LV tissue weighed, halved, and snap frozen in liquid N2.

All other hearts were subjected to 47 min global, isothermic, ischemia as described

previously (24). Animals received either 9 µg dose of APN ( Biovendor) or vehicle (Krebs-

Henseleit buffer) infused in a volume of 2 mL for 1 min upon initiation of global ischemia (see

Figure 6-1). Pacing was re-initiated 1min 30 sec after the start of reperfusion and hearts were reperfused for 60 min. After reperfusion, LVs were isolated weighed, halved, and snap frozen in liquid N2. All LV sections were stored at –80ºC until tissue preparation.

APN 1 min Reperfusion

Ischemia 60min

Equilibration 47min

30 min

Figure 6-1: Schematic of the isolated heart protocol and adiponectin (APN) infusion.

107 Tissue Homogenization

LV tissue was minced and homogenized by glass-glass grinding in buffer containing :

250 mM sucrose; 10 mM Tris-HCl, pH 7.4; 1 mM EDTA, pH 7; 1 mM ortho-vanadate; 1 mM

NaF; 0.3 mM PMSF; 5 µg/ ml each of leupeptin and aprotinin; 0.5 µg/ml pepstatin A, and 1%

Triton-X100. LV tissue was then subjected to a 100,000 X g centrifugation for 60 minutes. The

supernatant was assessed for total protein concentration using the Bradford method (513).

Western Blotting

Protein lysates were subject to separation using SDS-PAGE, transferred to PVDF

membranes and blocked in 5% non-fat dry milk for 2 hours at room temperature as described,

previously (24, 500, 514). Membranes were probed overnight at 4oC with primary antibodies at a

dilution of 1:1000 for AdipoR1 (42 kDa, AdipoR1-2; Alpha Diagnostics), 1:2000 for AdipoR2

(42 kDa, AdipoR2-1; Alpha Diagnostics), 1:500 for phosphorylated AMPK (pAMPK, Thr-172;

62kDa; 2535; Cell Signaling), and 1:1000 for AMPK (63 kDa, 07-350; Millipore). Membranes

were then incubated with HRP-linked anti-rabbit secondary antibody at a dilution of 1:20,000 for

1 h at RT and visualized using ECL (GE Healthcare). Densitometry was performed using Scion

Image (NIH). To correct for potential protein loading errors all membranes were stained with

Sypro Ruby blot stain (Invitrogen) and densitometry was performed as previously described (24,

299, 500, 514).

Adiponectin ELISA

Rat serum was assessed for total APN concentration utilizing a kit (EZRADP-62K;

Millipore) per manufacturer instructions.

108 Statistical Analysis

All data are presented as means ± SE and analyzed using the SAS GLM procedure. A one-way ANOVA was used to analyze data for morphological characteristics and circulating

APN data for adult, aged, and aged OVX animals. Protein levels for adult, aged, and aged OVX rats on chow or Lieber-DeCarli dietary intervention were assessed with a one-way ANOVA. A two-way ANOVA (group X drug) was used to analyze all functional data for adult, aged, and aged OVX animals with and without APN treatment. A three way ANOVA (group X drug X ischemia/reperfusion) was used to analyze protein levels for adult, aged, and aged OVX animals subject to control perfusion, or I/R with or without drug. The Tukey test was used for all post hoc analysis. An α-level of p < 0.05 was considered statistically significant.

Results

Baseline Morphological Characteristics

For the I/R study rats with pre-ischemic LVDP below 130 mmHg, unstable pre-ischemic

EDP (> 6 mmHg), or notable pathology/weight loss were excluded from analysis. Final data analysis was conducted on n=4 adult, n=5 aged, and n=3 aged OVX rats treated with vehicle and n=5 adult, n=6 aged, and n= 4 aged OVX treated with APN.

Baseline characteristics did not differ between APN and vehicle treated rats and data were pooled. Body, LV, and gonadal adipose depot weights were significantly greater in aged and aged OVX rats vs adult control rats (Table 6-1). There was no difference in body, LV, or gonadal adipose weights between aged and aged OVX rats. Uterine weight decreased significantly with

OVX which suggests relative E2-deficiency in aged OVX rats. Pre-ischemic LVDP, but not ± dP/dt, was significantly reduced in aged and aged OVX vs adult.

109

Table 6-1: Baseline morphological and functional characteristics. OVX, ovariectomized; LV left ventricle; EDP end diastolic pressure; LVDP left ventricular developed pressure; dP/dt first derivative of LVDP. *denotes different from adult; † denotes different from aged; p<0.05. Characteristic Adult; n=11 Aged; n=9 Aged OVX; n=7 Body Weight, g 208 ± 1 296 ± 2 * 299 ± 3* LV weight, mg 581.6 ± 5.8 779.6 ± 6.1 * 761.0 ± 8.7* LV/body weight, mg/g 2.8 ± 0 2.6 ± 0 2.5 ± 0 Uterine Weight, g 0.67 ± 0.02 0.67 ± 0.01 0.34 ± 0.01 † Gonadal Adipose Weight, g 3.41 ± 0.16 7.30 ± 0.27 * 7.17 ± 0.11* EDP, mmHg 5.5 ± 0.1 5.8 ± 0.1 5.9 ± 0.1 LVDP, mmHg 145.7 ± 1.3 134.9 ± 0.5 * 139.1 ± 1.4* +dP/dt, mmHg/sec 3907 ± 66 3865 ± 33 3757 ± 47 -dP/dt, mmHg/sec 2541 ± 40 2328 ± 21 2543 ± 37

Circulating Adiponectin

Circulating APN was significantly reduced in aged, but not aged OVX groups relative to adult intact rats (Figure 6-2). These findings recapitulate previously published data represented in

Figure 4-4 (409).

110

20

15 *

10 (ug/mL)

5 Circulating Adiponectin

0 Adult Aged Aged OVX

Figure 6-2: Circulating adiponectin in adult aged and aged OVX female rats, * denotes different from adult; p < 0.05; n=7-11/group.

Adiponectin Infusion and Left Ventricular Function

Aged and aged OVX rats demonstrated reduced functional recovery following I/R vs adult

controls. However, APN infusion was successful in improving functional recovery following I/R

injury in all groups. Specifically, LVDP was improved in all groups with APN infusion by 10-

20% (Figure 6-3). Post-ischemia, EDP was significantly increased by 100 fold but the rise in EDP

was significantly attenuated by 15-35 mmHg in all APN- treated groups (Figure 6-4). Similar to

LVDP, ± dP/dtmax, was attenuated following I/R injury in all groups, but decrements in function were significantly attenuated with APN treatment (Figure 6-5).

111

A. Adult B. Aged C. Aged OVX

100 Ctrl (vehicle) 100 100 Drug (adiopnectin 9ug)

80 80 80 ‡ 60 60 60 ‡ ‡ 40 40 * 40 *

20 20 20 Percent LVDP Recovery LVDP Percent Percent LVDP Recovery LVDP Percent Percent LVDP Recovery LVDP Percent

0 0 0 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min) Figure 6-3: Adiponectin (APN) delivery improves functional recovery in the female rat heart. Recovery of left ventricular developed pressure (LVDP), expressed as percent of pre-ischemic LVDP. Krebs-Henseleit buffer (vehicle) or 9μg of APN was infused during the first minute of a 47 min ischemia period at a flow rate of 2mL/min in adult (Panel A), aged (Panel B), aged OVX (Panel C) female rats. * denotes different from adult; ‡ denotes main effect of drug; p<0.05; n=3-6/group.

A. Adult B. Aged C. Aged OVX

70 Ctrl (vehicle) 70 70 Drug (adiponectin 9ug) ‡ ‡ ‡ ‡ ‡ 60 ‡ ‡ ‡ ‡ ‡ 60 60 ‡ ‡ ‡ ‡ ‡ 50 50 50

40 40 40

30 30 30 (mmHg) (mmHg) (mmHg)

20 20 20 End Diastolic Pressure End Diastolic End Diastolic Pressure End Diastolic End Diastolic Pressure End Diastolic 10 10 10

0 0 0 pre 5 10 15 30 60 pre 5 10 15 30 60 pre 5 10 15 30 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min) Figure 6-4: Adiponectin delivery improves post-ischemic end diastolic pressure (EDP) in female rat heart. Recovery of EDP following a 47 min ischemia in adult (Panel A), aged (Panel B), aged OVX (Panel C) female rats. ‡ denotes main effect of drug; p < 0.05; n=3-6/group.

112

A. Adult B. Aged C. Aged OVX 5000 Ctrl (vehicle) 5000 5000 Drug (adiponectin 9ug)

4000 4000 4000

3000 3000 3000 ‡ 2000 2000 ‡ 2000 ‡ +dP/dt (mmHg/s) +dP/dt +dP/dt (mmHg/s) +dP/dt (mmHg/s) * 1000 1000 * 1000

0 0 0 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min)

D. Adult E. Aged F. Aged OVX

3000 Ctrl (vehicle) 3000 3000 Drug (adiponectin 9ug)

2500 2500 2500

2000 2000 2000 1500 ‡ 1500 1500 ‡ 1000 1000 ‡ 1000 -dP/dt (mmHg/s) -dP/dt (mmHg/s) -dP/dt (mmHg/s) * 500 500 * 500

0 0 0 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 pre 1 2 3 4 5 6 7 8 9 1015 20 25 30 35 40 45 50 55 60 Reperfusion Time (min) Reperfusion Time (min) Reperfusion Time (min) Figure 6-5: Adiponectin delivery improves post-ischemic change in pressure with respect to time (+/-dP/dt max) in female rat heart. Recovery of dP/dtmax following a 47 min ischemia in adult (Panel A and D), aged (Panel B and E), aged OVX (Panel C and F) female rats. * denotes different from adult; ‡ denotes main effect of drug; p<0.5; n=3-6/group.

Adiponectin Receptors and AMPK in Perfused Hearts

Although there was no significant change in AdipoR1 protein abundance, AdipoR2 levels decreased in both aged and aged OVX groups compared to adult intact rats (Figure 6-6). Due to variability in AdipoR1 data, samples were assessed three times with western blotting and representative images are shown in Figure 6-6. AMPK phosphorylation increased in response I/R injury in adult and aged female rats (Figure 6-7). No additional increased in AMPK phosphorylation was observed with APN infusion in any group. In fact, APN treatment resulted in a decrease in pAMPK in adult rats. There was no significant difference in total AMPK protein levels among groups.

113

A. B.

AdipoR1 AdipoR2 Sypro Sypro Adult Aged Aged Adult Aged Aged OVX OVX

AdipoR1 AdipoR2 Sypro Sypro Adult Adult Adult Adult Adult Adult Perfused I/R I/R Perfused I/R I/R Control APN Control APN

AdipoR1 AdipoR2 Sypro Sypro Adult Aged Aged Adult Aged Aged Perfused I/R I/R Perfused I/R I/R Control APN Control APN

AdipoR1 AdipoR2 Sypro Sypro Adult Aged OVX Aged OVX Adult Aged OVX Aged OVX Perfused I/R I/R Perfused I/R I/R Control APN Control APN

Perfused Control Ischemia Reperfusion Ischemia Reperfusion APN

1.5 1.5 § § 1.0 1.0

Total AdipoR2 AdipoR2 Total 0.5

Total AdipoR1 AdipoR1 Total 0.5 (Relative to Adult Ctrl) to Adult (Relative (Relative to Adult Ctrl) to Adult (Relative

0.0 0.0 Adult Aged Aged OVX Adult Aged Aged OVX

Figure 6-6: Adiponectin Receptor 1 (AdipoR) 1and AdipoR2 in isolated hearts perfused for 30 min (Perfused Control), or subjected to ischemia/reperfusion (I/R; 47/60 min) with vehicle, or adiponectin (APN) infusion (9μg) delivery upon ischemia. Representative blots and protein levels for AdipoR1 (Panel A), and AdipoR2 (Panel B), § denotes different from adult groups; p < 0.05; n=4-5/group). Values are means ± SEM; data is presented relative to adult perfused control and corrected with Sypro Ruby Blot Stain.

114

Perfused Control A. B. Ischemia Reperfusion Ischemia Rerperfusion with APN 8 pAMPK AMPK † † sypro 6 * * *

Adult Aged Aged

OVX (Thr-172) 4 #

pAMPK 2 (Relative toCtrl) Adult (Relative

pAMPK 0 Adult Aged Aged OVX AMPK C. sypro 2.0

Adult Adult Adult Perfused I/R I/R Control APN 1.5

1.0 Total AMPK AMPK Total pAMPK 0.5 (Relative to Adult Ctrl) to Adult (Relative AMPK sypro 0.0 Adult Aged Aged Adult Aged Aged OVX Perfused I/R I/R D. Control APN 8 † *

6 *

pAMPK AMPK /Total AMPK 4 # * sypro (Thr-172) Adult Aged Aged 2 (Relative to Adult Ctrl) to Adult (Relative Perfused OVX I/R OVX I/R

Control APN pAMPK

0 Adult Aged Aged OVX

115

Figure 6-7: Adenosine monophosphate-dependent protein kinase (AMPK), activated AMPK (pAMPK), and the pAMPK/AMPK ratio in isolated hearts perfused for 30 min (Perfused Control), or subjected to ischemia/reperfusion (I/R; 47/60 min) with vehicle, or adiponectin (APN) infusion (9μg) delivery upon ischemia. Representative blots for pAMPK and AMPK (Panel A), protein levels for pAMPK (Panel B), protein levels for AMPK (Panel C) and the ratio of pAMPK/AMPK (Panel D). * denotes different from adult perfused control, † denotes different from aged perfused control; # denotes different from adult I/R; p < 0.05; n=4-5/group). Values are means ± SEM; data is presented relative to adult perfused control and corrected with Sypro Ruby Blot Stain.

116 Effect of High Fat Diet on Body Weight and Caloric Consumption

Randomly divided F344 rats assigned to consume standard chow (13% calories from fat) or the Lieber-DeCarli diet (35% calories from fat) showed no difference in initial body weight among groups. Aged and aged OVX female rats had significantly greater body weight relative to adult control rats (p<0.05). In aged (n=4) and aged OVX (n=2) Lieber-DeCarli diet consuming groups six rats died during the dietary intervention due to age-associated complications. All rats consuming the Lieber-DeCarli diet that survived the 20 week intervention had significantly greater final body weight vs chow consuming rats (Table 6-2; p<0.05). Greater body weight in

Lieber-DeCarli fed rats is attributable to increased total calorie consumption and fat consumption relative to chow fed rats (p<0.05).

Table 6-2: Body weight and food consumption in chow and Lieber-DeCarli fed rats. OVX, ovariectomized; *denotes different from adult chow; † denotes different from adult Lieber- DeCarli; p<0.05. Aged OVX Aged OVX Adult Lieber- Aged Lieber- Characteristic Adult Chow Aged Chow Lieber- Chow DeCarli DeCarli DeCarli N 4 5 4 5 3 2 Initial Body Weight, g 180 ± 5 280 ± 1* 260 ± 1* 200 ± 2 295 ± 3*† 264 ± 5*† Final Body Weight, g 218 ± 7 303 ± 4* 304 ± 7* 262 ± 2* 410 ± 3*† 397 ± 6*† Δ Body Weight, g 38 ± 7 25 ± 7* 44 ± 3* 62 ± 6* 115 ± 3*† 133 ± 5*† Total Kcal consumed 9 ± 0 7 ± 0* 7 ± 1* 17± 0* 14 ± 0*† 14 ± 1*† /100 g body weight /day Total fat consumed /100 2 ± 1 1 ± 0* 1 ± 0* 6 ± 0* 5 ± 0*† 5 ± 0*† g body weight / day

117 Effect of High Fat Diet on Adiponectin Receptors and AMPK

AdipoR1 was significantly increased in aged and aged OVX female vs adult rats

consuming the Lieber-DeCarli diet for 20 weeks (Figure 6-8). AdipoR2 did not differ among

groups.

A. B.

AdipoR1 AdipoR2 sypro sypro

Adult Aged Aged Adult Aged Aged OVX OVX * 2.5 2.5

2.0 * 2.0

1.5 1.5

1.0 1.0 Total AdipoR2 AdipoR2 Total Total AdipoR1 AdipoR1 Total (Relative to Adult Ctrl) to Adult (Relative (Relative to Adult Ctrl) to Adult (Relative 0.5 0.5

0.0 0.0 Adult Aged Aged OVX Adult Aged Aged OVX

Figure 6-8: Adiponectin Receptor (AdipoR) 1 and AdipoR2 in isolated perfused control hearts of rats consuming the Lieber-DeCarli diet. Representative blots and protein levels for AdipoR1 (Panel A), and AdipoR2 (Panel B), *denotes different from adult; p<0.05 ; n=3-5/group). Values are means ± SEM; data is presented relative to adult intact and corrected with Sypro Ruby Blot Stain.

Basal AMPK phosphorylation was unchanged with age in Lieber-DeCarli consuming female rats. Total AMPK abundance was significantly reduced in aged and aged OVX groups vs

adult and the pAMPK/total AMPK ratio was increased in aged rats only (Figure 6-9).

118

A. pAMPK AMPK Sypro B. Adult Aged Aged OVX Perfused Perfused Perfused Control Control Control 1.5

1.0 (Thr-172)

0.5 pAMPK (Relative to Adult Ctrl) to Adult (Relative

0.0 C. Adult Diet Aged Diet Aged OVX Diet 1.5

1.0 * *

Total AMPK AMPK Total 0.5 (Relative to Adult Ctrl) to Adult (Relative

0.0 D. Adult Diet Aged Diet Aged OVX Diet

2.5

2.0 *

1.5 /Total AMPK /Total

1.0 (Thr-172)

(Relative to Adult Ctrl) to Adult (Relative 0.5 pAMPK

0.0 Adult Diet Aged Diet Aged OVX Diet

119

Figure 6-9: Adenosine monophosphate-dependent protein kinase (AMPK) and activated AMPK (pAMPK) protein levels in isolated perfused control hearts of rats consuming the Lieber-DeCarli diet. Representative blots for pAMPK and AMPK (Panel A), protein levels for pAMPK (Panel B), protein levels for AMPK (Panel C) and the ratio of pAMPK/AMPK (Panel D) * denotes different from adult control; p < 0.05; n=3-5/group. Values are means ± SEM; data is presented relative to adult intact, and corrected with Sypro Ruby Blot Stain.

120 Discussion

APN has direct cardioprotective effects in response to I/R injury in adult male mice, rats,

and pigs (354-356, 443, 482). However, no previous studies have addressed APN-mediated

cardioprotection in the aged E2-deficient female heart. The aged female myocardium is refractory to many cardioprotective interventions proven efficacious in adult animals (315-317, 319, 321) and therapies are needed to treat aged post-menopausal women. The current study demonstrates

APN is effective in improving LV functional recovery in isolated hearts from adult, aged, and

aged OVX female rats. Moreover, we determined that AdipoR1 abundance is unchanged with

aging alone, but increased with aging in conjunction with a high fat diet. Finally, we

characterized the phosphorylation status of the APN target AMPK, and demonstrated pAMPK is

reduced with APN treatment in adult, but sustained in aged hearts following I/R injury.

Body and gonadal adipose depot weights increased significantly in aged and aged OVX

groups vs adult intact controls, but there was no significant weight gain in aged vs aged OVX

female rats. The lack of OVX-induced weight and adipose mass gain was surprising given that we

and others have previously documented contrary findings (24, 299). Although animals with

obvious pathology, neoplastic tumor growth, and associated weight loss ( > 10 g/week) were

excluded (7 aged, and 6 aged OVX rats) it is possible OVX-induced weight gain was masked by

confounding asymptomatic diseases in the cohort of F344 rats studied. Rats studied in the

investigation described in Chapter 3 also did not demonstrate significant OVX-induced weight gain. Gonadal adipose mass did not differ between aged and aged OVX rats which may be a function of similar total body weight in both groups or due to dissection errors in adipose collection. In aged rats adiposity also increases in the retroperitoneal, mesenteric, and omental depots. These depots can obscure the gonadal fat pad making it more challenging to dissect.

121

Similar to findings in adult male Sprague-Dawley rats (482), LVDP and ± dP/dtmax, were

significantly improved with a single 9 µg dose of APN delivered upon ischemia in adult, aged,

and aged OVX female rat hearts subjected to I/R injury (Figures 6-3 and 6-5). APN also

attenuated the post-ischemic rise in EDP in all groups (Figure 6-4). Thus, our findings extend

previous knowledge demonstrating APN-mediated cardioprotection in adult males to the adult, aged, and aged OVX female heart. These data also support the assertion that APN may be a relevant therapy for CHD in aged postmenopausal women.

Previously, we have shown circulating APN is reduced with age, but increased with OVX

(409). The interaction of age and OVX results in unchanged circulating APN concentrations in aged OVX rats vs adult controls and was observed previously and confirmed in the current study

(Figure 6-2 and 4-4) (409). That APN levels are reduced in aged female rats suggests they, like obese and diabetic animals, may require greater doses of APN to confer protection vs adult or aged OVX animals (93). That we saw protection in all groups suggests adult animals (which have the highest endogenous APN concentrations) may be protected with lower doses of APN during

I/R injury. Further studies are needed to determine the threshold dose for APN efficacy in females and aging models.

We characterized AdipoR1 and AdipoR2 receptor abundance in our model to better understand the mechanism(s) of APN action in a setting of aging and E2-deficiency. As expected we observed no significant effect of I/R injury on AdipoR1 or AdipoR2 abundance. Noteworthy, the AdipoR1 data exhibited variability which may be attributed to the timing of sample collection. Insulin reciprocally regulates AdipoR levels and significant changes in receptor abundance have been observed during fasted and fed states in mice (83). Although we limited

data collection time to the hours between 9:00am and 2:00pm daytime fasting may explain the

variability observed.

122 Interestingly, aging and high fat diet differentially regulated AdipoR1 and AdipoR2

abundance. Specifically, AdipoR1 was significantly increased in the myocardium of aged and

aged OVX female rats consuming the Lieber-DeCarli diet, but not in age-matched chow fed rats.

The Lieber-DeCarli diet contains 35% of calories derived from fat and rats had significant weight gain vs chow fed animals consuming an 13% fat diet. Since both total calorie consumption as well as calories derived from fat increased in Lieber-DeCarli fed rats it is impossible to determine if the change in AdipoR protein levels is attributable to increased total food intake or high fat diet alone. Increased AdipoR1 mRNA and protein abundance in liver, skeletal, and cardiac muscle is commonly observed in animal models of obesity and diabetes (83, 94, 425, 489, 491, 492).

Fluctuations in AdipoR1 mRNA and protein levels have been reported during early stages of metabolic disease progression and decreased AdipoR1 has been reported during short (10 week) high fat dietary interventions (94, 489). The increase in AdipoR1 after 20 weeks of high fat feeding observed in the present study is in line with findings of similar durations or more extreme

(42% fat content) dietary interventions (94, 489, 491). Both aged and diabetic rats are models predisposed to reductions in IT and upregulation of AdipoR1 under metabolic stress may be a compensatory mechanism to preserve APN signaling.

A role for AdipoR2 in the heart has yet to be discovered (433) and previous findings indicate AdipoR2 does not change in cardiac or skeletal muscle with metabolic disease (426,

491). We observed a significant age-related decrease with age in AdipoR2 in chow fed rats, but no change in Lieber-DeCarli fed rats. Previously, we have shown depressed AdipoR2 protein levels in adipose tissue with aging (409). Decreased AdipoR2 abundance may be a unique phenomenon associated with aging in F344 female rats or may be linked to altered metabolism associated with aging.

We also assessed the phosphorylation status of the downstream target AMPK in chow and Lieber-DeCarli fed female rats. Basal AMPK phosphorylation was unchanged in aged female

123 rats consuming chow (Figure 6-7). However, total AMPK and the pAMPK/AMPK ratio in aged

rats on the Lieber-DeCarli diet were decreased and increased, respectively (findings for aged

OVX rats failed to reach significance; Figure 6-9). Similar findings were observed in aged male

F344 and high fat diet consuming mice in conjunction with reduced IT (93, 94, 352). Increased

pAMPK levels in Lieber-DeCarli fed rats may be consequent of increased myocardial fatty acid utilization. This phenomenon represents an adaptation to reduce the risk of lipotoxicity associated with increased circulating free fatty acids (466). We did not assess I/R injury in aged female rats on a high fat diet. However, a similar phenotype observed between our model and others on a high fat diet suggests APN-resistance and a predisposition for reduced IT.

All APN-treated rats subjected to I/R injury were protected from decrements in functional recovery vs control hearts. In accordance with previous reports pAMPK increased in response to

I/R injury in adult and aged rats (93, 94, 354, 482). In aged OVX rats the post-ischemic increase in pAMPK failed to reach significance. This may suggest the interaction of aging and E2-

deficiency is associated with a diminished capacity for AMPK activation.

Interestingly, with APN infusion, there was no additional increase in pAMPK after 60

min of reperfusion. Moreover, pAMPK was surprisingly downregulated after 60 min of

reperfusion in adult, but not aged animals. The response in female adults is curious given that in

vivo coronary artery ligation studies report sustained pAMPK levels even after 24 and 48 h of

reperfusion following APN treatment (93, 354, 482, 540). The divergent results observed in the

current study vs in vivo models may be consequent of the absence of fatty acids in the perfusion

buffer as well as timing of sample collection. However, in isolated Sprague-Dawley male rat

hearts perfused in a similar Langendorff preparation, pAMPK is increased by 60% with APN

treatment relative to vehicle treated hearts after 60 min of reperfusion (482). Sex or strain

differences may account for divergent AMPK responses associated with APN treatment. Further

studies will be needed to address this question. Regardless of the cause of divergent results, the

124 data suggest that AMPK activation may not be a critical mediator of APN-mediated

cardioprotection in the female rat heart.

That functional recovery is still improved in APN-treated aged OVX females suggests an

AMPK-independent cardioprotective mechanism may be operational. COX2-mediated suppression of inflammation or attenuation of cytotoxic nitrate production may be more relevant mechanisms of APN action in the ischemic aged OVX female rat heart. We attempted to assess

TNFα accumulation in hearts following I/R injury to determine the impact APN treatment has on the COX2-TNFα inflammatory pathway in aged hearts. However, cardiac-specific TNFα was below detection limits and could not be assessed.

In conclusion, we have demonstrated that the aged female rat heart is responsive to APN treatment. This suggests APN treatment may be a relevant therapy for aged post-menopausal women. A limitation of the study is that we only assessed one dose of APN. Animal models of obesity and diabetes demonstrate resistance to APN treatment (94, 460, 489). Type II diabetic mice require triple the dose needed for cardioprotection in adult controls. This suggests a threshold for APN-mediated cardioprotection exists and endogenous APN concentrations may dictate the supplemental quantity needed to protect the myocardium during I/R injury.

Additionally, we observed divergent changes in pAMPK activation in response to I/R and

APN treatment in adult, aged and aged OVX female rats. This discordance suggests alternative mechanisms of APN action involving suppression of inflammation or nitrate production may be differentially important in E2-replete and deficient animals. We also extended findings that a moderate high fat diet can evoke derangements in AdipoR1 and pAMPK levels at baseline in female rats indicative of APN-resistance.

125

CHAPTER 7

SUMMARY AND CONCLUSIONS

The aim of the four studies contained herein was to investigate ER-signaling disruptions in metabolic and cardiac tissues as well as characterize attenuations in APN signaling capacity in female aged and OVX F344 rats. The collective purpose of the work was to elucidate relevant targets for therapeutic intervention in a setting of aging and E2-deficiency with the ultimate goal of reducing CHD morbidity and mortality in aged women.

The aim of the first study (Chapter 3) was to determine the effects of acute ERβ activation on I/R injury in adult, aged, and aged OVX female rats. It was found that:

1. Acute ERβ activation does not affect cardiac functional recovery following I/R injury in adult, aged, and aged OVX female F344 rats.

2. ERβ is not detectable in the adult and aged female F344 rat myocardium.

Thus ERβ is not likely a relevant target for influencing direct cardioprotection in the

F344 female rat heart. Any influence of ERβ on the rat myocardium is likely via indirect genomic, or ligand-independent mechanisms in non-cardiac tissues. This work provides additional evidence refuting the controversial existence of ERβ in the myocardium.

The aim of the second study (Chapter4) was to determine the singular and combined effects of aging and E2-deficiency on ER isoform distribution in visceral adipose tissue and

skeletal muscle in F344 female rats. An additional aim was to also characterize alterations in

126 APN and its receptors and downstream targets PPARα and AMPK in adipose tissue. It was found

that:

1. ERα protein abundance is increased in gastrocnemius of aged OVX F344 female rats relative to adult ovary-intact controls. ERα protein abundance is unchanged in soleus of F344 female rats.

2. ERα protein abundance is decreased in the adipose tissue of adult OVX relative to

aged OVX female F344 rats.

3. ERβ protein abundance is increased in the adipose tissue of aged and aged OVX

female F344 rats relative to adult OVX and adult ovary-intact controls.

4. APN is increased in adipose-tissue in conjunction with reduced PPARγ protein levels,

yet circulating APN is increased with OVX, and decreased with age such that concentrations are

reduced in aged OVX vs adult OVX and aged vs adult F344 female rats.

5. AdipoR2, but not AdipoR1 is reduced with aging in adipose tissue such that aged and

aged OVX female rats demonstrate reduced levels vs adult intact rats. PPARα levels are

unchanged. The pAMPK/AMPK ratio is reduced in the adipose tissue of aged and aged OVX rats

relative to adult ovary-intact thus providing a mechanism for metabolic derangement.

Thus the unique state of aging plus E2-deficiency is associated with an altered ERα/β

ratio in favor of ERβ in adipose tissue. Compromised APN processing and/or secretion to the circulation is linked to enhanced ERβ presence in adipose tissue. Unfortunately, cell culture studies (Chapter 5) failed to reveal conclusive evidence regarding ERβ and APN intracellular actions. The increase in ERα in gastrocnemius, but not soleus muscle suggests there is differential regulation of ERα in glycolytic vs oxidative muscle fibers associated with aging.

In Chapter 4 we additionally conclude the aged-associated reductions in AdipoR2 and the pAMPK/AMPK ratio may translate to decreased autocrine signaling in adipose tissue. This

127 phenomenon may contribute to a reduced capability to metabolize lipids in adipose and may, in

part, explain increased weight gain in aged animals.

The aim of the study described in Chapter 6 was to determine if aging and OVX is associated

with APN resistance in the female rat myocardium. It was found that:

1. APN treatment improves functional recovery following I/R injury in adult, aged, and

aged OVX femaleF344 rats.

2. I/R injury increased pAMPK levels in adult and aged female rats, but APN treatment did not result in a further increase in pAMPK levels indicating APN-mediated cardioprotection is likely via an AMPK-independent mechanism.

3. Aging and OVX alone did not affect basal cardiac AdipoR1, AdipoR2, or AMPK

protein levels. However, in conjunction with high fat diet AdipoR1 and AMPK protein levels are

increased in the myocardium of aged and aged OVX female rats indicating an APN-resistant

phenotype.

Increased adiposity and reduced circulating APN in aged female rats suggests

progression toward a metabolic phenotype which may lead to APN-resistance. Fortunately, adult, aged and aged OVX female rats respond to APN treatment with improved post-ischemic function following I/R injury. However, consumption of a high fat diet in conjunction with aging produces changes in AdipoR1protein abundance and basal AMPK phosphorylation that resemble an APN- resistant phenotype. In conclusion, APN or downstream APN signaling targets may be a relevant therapy for combating CHD risk and mortality in aged women.

A summary of all key findings is presented in Figure 7-1.

128

Acute ERβ activation Adiponectin Treatment

Adiponectin Resistance

Ischemic Tolerance AdipoR1

Cardiovascular Age-associated E2 AMPK/AMPK Disease Risk P deficiency ratio

ERβ Metabolic Disease Risk High Fat Diet PPARγ Obesity

Adiponectin Circulating Retention Adiponectin

Figure 7-1: Summary of Key Findings from Chapters 3, 4, 5, and 6.

Strengths and Limitations

Aged OVX Female Rat Model

Use of age-appropriate rats in conjunction with OVX represents an overlooked but critical design consideration of rodent studies to recapitulate post-menopausal E2-deficiency in women (541). The adult OVX rat was erroneously relied upon as a model for post-menopausal

E2-deficiency in past studies by others (23, 300, 301, 303, 542). We have previously shown divergent responses to I/R injury and cardiac signaling proteins in adult OVX and aged OVX female rats (24, 299, 543). Aged rats were utilized in studies presented herein to appropriately mimic the point at which cardiovascular morbidity and mortality is likely to become manifest in

129

aged women (7). Also important, aged female rats have variable E2 concentrations due to

unpredictable estrous cycling that occurs with aging and therefore rats must be OVX to ensure

consistent E2-deficiency. In Chapter 4 adult intact, adult OVX, aged intact, and aged OVX rats were utilized to emphasize the independent and combined effects of aging and E2-deficiency.

Now that clear differences have been established between the four groups, only the clinically

relevant aged OVX, and adult ovary intact control need be studied in the future.

Langendorff Isolated Heart Model

The Langendorff isolated heart preparation is a reliable model which has been

successfully utilized and cited in the literature for over one hundred years. The isolated heart

preparation enables the assessment of the ventricular function in the absence of confounding

neural and hormonal influences. Examining the heart in isolation provides the advantage of

allowing for a tightly controlled setting for directly comparing LV function. Global cardiac

ischemia is extreme and less representative of an acute myocardial infarction in vivo; however it is required as a caveat for ensuring sufficient ischemic damage in this preparation. A clear disadvantage of studying the heart in isolation is the loss of circulating factors that may differentially modulate the response to I/R injury. An in vivo coronary artery ligation approach may be relevant for future studies focusing on titration of an appropriate APN dose for

cardioprotection based on relative endogenous circulating APN. However, use of the Langendorff

is preferred at this time given the cost prohibitive nature of APN and the increased dosage

required for whole animal vs isolated heart studies.

130 Future Directions

A suitable ERβ model of overexpression is necessary to extend the primarily descriptive findings demonstrating derangements in ERβ and other adipose proteins associated with

metabolic disease in Chapter 4. We attempted to produce such a model in Chapter 5, however,

were unsuccessful. Future efforts should include adenoviral transfection of a functional ERβ plasmid in an APN expressing cell line. A more physiologically relevant approach, albeit more

challenging, would employ use of adipocyte explants in primary culture for the study of ERβ interactions, in vitro.

To extend the findings in Chapter 6 regarding age and diet-induced APN-resistance,

functional recovery following I/R injury of aged female rats on a high fat diet must be completed.

We demonstrated that aged OVX female rats on a high fat diet exhibit changes in AdipoR1 and

AMPK protein levels indicative of APN-resistance. At this time these findings are descriptive and

IT must be assessed. Additionally, at least three pathways of APN-mediated cardioprotection have been described. To gain a better understanding of which APN signaling pathway(s) is relevant in the female rat heart markers of apoptotic (caspase 3), inflammatory (TNFα) and nitrative (superoxide; peroxynitrite) stress should be assessed. The candidate downstream targets of APN thought to mediate these processes in the myocardium currently include AMPK, COX2, and gp91phox, respectively. Pretreatment with activators, inhibitors, and dominant negative forms of AMPK, COX2 and gp91phox in conjunction of APN delivery in aged female rats will help elucidate which pathways are relevant in conferring cardioprotection. Both Langendorff and in vivo coronary artery ligation approaches may be needed to determine the respective relevance of each signaling pathway as well as a threshold dose of APN for adult and aged OVX female rats in the presence and absence of endogenous circulating APN.

131 APPENDIX

Preliminary ACC data in the female rat myocardium is presented herein. Samples were prepared as described in Chapter 6 methods. Briefly, hearts were subjected to I/R injury and treated with adiponectin or vehicle infusion upon ischemia. Perfused control hearts (no ischemia or adiponectin treatment) of chow or Lieber-DeCarli fed rats were also assessed. Samples were assessed once with western blotting, but transfer efficiency controls and loading controls have yet to be completed.

132

Figure A-1: Acetyl CoA carboxylase (ACC), phosphorylated ACC (pACC), and the pACC/ACC ratio in isolated hearts perfused for 30 min (Perfused Control), subjected to 47 min of ischemia and 60 min reperfusion (I/R; 47/60) with control Krebs-Henseleit infusion, or subjected to I/R with adiponectin (APN) infusion (9ug/mL). Protein levels for pACC (Panel A), protein levels for pACC (Panel B), and the ratio of pACC/ACC (Panel C). * denotes different from adult perfused control, † denotes different from aged perfused control; $ denotes different from aged OVX perfused control; p < 0.05; n=4-5/group and values are means ± SEM.

133

Figure A-2: Acetyl CoA carboxylase (ACC), phosphorylated ACC (pACC), and the pACC/ACC ratio in isolated hearts perfused for 30 min (Perfused Control) from rats consuming Lieber- DeCarli diet. Protein levels for pACC (Panel A), protein levels for pACC (Panel B), and the ratio of pACC/ACC (Panel C). Values are means ± SEM.

134

References

1. Lloyd-Jones D, Adams R, Carnethon M, De Simone G, Ferguson TB, Flegal K, et al. Heart disease and stroke statistics--2009 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Circulation2009 Jan 27;119(3):e21- 181. 2. Lakatta EG, Levy D. Arterial and cardiac aging: major shareholders in cardiovascular disease enterprises: Part II: the aging heart in health: links to heart disease. Circulation2003 Jan 21;107(2):346-54. 3. Boersma E, Pieper KS, Steyerberg EW, Wilcox RG, Chang WC, Lee KL, et al. Predictors of outcome in patients with acute coronary syndromes without persistent ST-segment elevation. Results from an international trial of 9461 patients. The PURSUIT Investigators. Circulation2000 Jun 6;101(22):2557-67. 4. Latting CA, Silverman ME. Acute myocardial infarction in hospitalized patients over age 70. Am Heart J1980 Sep;100(3):311-8. 5. Maggioni AP, Maseri A, Fresco C, Franzosi MG, Mauri F, Santoro E, et al. Age-related increase in mortality among patients with first myocardial infarctions treated with thrombolysis. The Investigators of the Gruppo Italiano per lo Studio della Sopravvivenza nell'Infarto Miocardico (GISSI-2). N Engl J Med1993 Nov 11;329(20):1442-8. 6. Tofler GH, Muller JE, Stone PH, Willich SN, Davis VG, Poole WK, et al. Factors leading to shorter survival after acute myocardial infarction in patients ages 65 to 75 years compared with younger patients. Am J Cardiol1988 Nov 1;62(13):860-7. 7. AHA. Heart Disease and Stroke Statistics: 2008 Update. 2008. 8. Galvan RE, Basurto L, Saucedo R, Campos S, Hernandez M, Zarate A. [Adiponectin concentrations during menstrual cycle]. Ginecol Obstet Mex2007 Aug;75(8):435-8. 9. Larsson B, Bengtsson C, Bjorntorp P, Lapidus L, Sjostrom L, Svardsudd K, et al. Is abdominal body fat distribution a major explanation for the sex difference in the incidence of myocardial infarction? The study of men born in 1913 and the study of women, Goteborg, Sweden. Am J Epidemiol1992 Feb 1;135(3):266-73. 10. Gambacciani M, Ciaponi M, Cappagli B, Piaggesi L, De Simone L, Orlandi R, et al. Body weight, body fat distribution, and hormonal replacement therapy in early postmenopausal women. J Clin Endocrinol Metab1997 Feb;82(2):414-7. 11. Chu MC, Cosper P, Orio F, Carmina E, Lobo RA. Insulin resistance in postmenopausal women with metabolic syndrome and the measurements of adiponectin, leptin, resistin, and ghrelin. Am J Obstet Gynecol2006 Jan;194(1):100-4. 12. Ford ES. Prevalence of the metabolic syndrome defined by the International Diabetes Federation among adults in the U.S. Diabetes Care2005 Nov;28(11):2745-9. 13. Flegal KM, Carroll MD, Ogden CL, Johnson CL. Prevalence and trends in obesity among US adults, 1999-2000. JAMA2002 Oct 9;288(14):1723-7. 14. van Seumeren I. Weight gain and hormone replacement therapy: are women's fears justified? Maturitas2000 Jan;34 Suppl 1:S3-8. 15. Beckett T, Tchernof A, Toth MJ. Effect of ovariectomy and estradiol replacement on skeletal muscle enzyme activity in female rats. Metabolism2002 Nov;51(11):1397-401.

135 16. Kamei Y, Suzuki M, Miyazaki H, Tsuboyama-Kasaoka N, Wu J, Ishimi Y, et al. Ovariectomy in mice decreases lipid metabolism-related gene expression in adipose tissue and skeletal muscle with increased body fat. J Nutr Sci Vitaminol (Tokyo)2005 Apr;51(2):110-7. 17. Liu ML, Xu X, Rang WQ, Li YJ, Song HP. Influence of ovariectomy and 17beta- estradiol treatment on insulin sensitivity, lipid metabolism and post-ischemic cardiac function. Int J Cardiol2004 Dec;97(3):485-93. 18. Wegorzewska IN, Walters K, Weiser MJ, Cruthirds DF, Ewell E, Larco DO, et al. Postovariectomy weight gain in female rats is reversed by estrogen receptor alpha agonist, propylpyrazoletriol. Am J Obstet Gynecol2008 Jul;199(1):67 e1-5. 19. Steingrimsdottir L, Brasel J, Greenwood MR. Hormonal modulation of adipose tissue lipoprotein lipase may alter food intake in rats. Am J Physiol1980 Aug;239(2):E162-7. 20. Rebuffe-Scrive M. Sex steroid hormones and adipose tissue metabolism in ovariectomized and adrenalectomized rats. Acta Physiol Scand1987 Apr;129(4):471-7. 21. Harris HA, Katzenellenbogen JA, Katzenellenbogen BS. Characterization of the Biological Roles of the Estrogen Receptors, ERα and ERβ, in Estrogen Target Tissues in Vivo through the Use of an ERα-Selective Ligand. Endocrinology2002 November 1, 2002;143(11):4172-7. 22. Xu Y, Armstrong SJ, Arenas IA, Pehowich DJ, Davidge ST. Cardioprotection by chronic estrogen or superoxide dismutase mimetic treatment in the aged female rat. Am J Physiol Heart Circ Physiol2004 Jul;287(1):H165-71. 23. Song X, Li G, Vaage J, Valen G. Effects of sex, gonadectomy, and oestrogen substitution on ischaemic preconditioning and ischaemia-reperfusion injury in mice. Acta Physiol Scand2003 Apr;177(4):459-66. 24. Novotny JL, Simpson AM, Tomicek NJ, Lancaster TS, Korzick DH. Rapid estrogen receptor-alpha activation improves ischemic tolerance in aged female rats through a novel protein kinase C epsilon-dependent mechanism. Endocrinology2009 Feb;150(2):889-96. 25. Jeanes HL, Tabor C, Black D, Ederveen A, Gray GA. Oestrogen-mediated cardioprotection following ischaemia and reperfusion is mimicked by an oestrogen receptor (ER)alpha agonist and unaffected by an ER beta antagonist. J Endocrinol2008 Jun;197(3):493- 501. 26. Hertrampf T, Seibel J, Laudenbach U, Fritzemeier KH, Diel P. Analysis of the effects of oestrogen receptor alpha (ERalpha)- and ERbeta-selective ligands given in combination to ovariectomized rats. Br J Pharmacol2008 Apr;153(7):1432-7. 27. Ryan AS, Nicklas BJ, Berman DM. Hormone replacement therapy, insulin sensitivity, and abdominal obesity in postmenopausal women. Diabetes Care2002 Jan;25(1):127-33. 28. Samaras K, Hayward CS, Sullivan D, Kelly RP, Campbell LV. Effects of postmenopausal hormone replacement therapy on central abdominal fat, glycemic control, lipid metabolism, and vascular factors in type 2 diabetes: a prospective study. Diabetes Care1999 Sep;22(9):1401-7. 29. de Villiers TJ. Clinical issues regarding cardiovascular disease and selective estrogen receptor modulators in postmenopausal women. Climacteric2009;12 Suppl 1:108-11. 30. Grady D, Herrington D, Bittner V, Blumenthal R, Davidson M, Hlatky M, et al. Cardiovascular disease outcomes during 6.8 years of hormone therapy: Heart and Estrogen/progestin Replacement Study follow-up (HERS II). JAMA2002 Jul 3;288(1):49-57. 31. Miller VT, Byington RL, Espeland MA, Langer R, Marcus R, Shumaker S, et al. Baseline characteristics of the PEPI participants. Postmenopausal Estrogen/Progestin Interventions. Control Clin Trials1995 Aug;16(4 Suppl):54S-65S.

136 32. Hulley S, Furberg C, Barrett-Connor E, Cauley J, Grady D, Haskell W, et al. Noncardiovascular disease outcomes during 6.8 years of hormone therapy: Heart and Estrogen/progestin Replacement Study follow-up (HERS II). JAMA2002 Jul 3;288(1):58-66. 33. Manson JE, Hsia J, Johnson KC, Rossouw JE, Assaf AR, Lasser NL, et al. Estrogen plus progestin and the risk of coronary heart disease. N Engl J Med2003 Aug 7;349(6):523-34. 34. Harman SM. Estrogen replacement in menopausal women: recent and current prospective studies, the WHI and the KEEPS. Gend Med2006 Dec;3(4):254-69. 35. Merchenthaler I, Lane MV, Numan S, Dellovade TL. Distribution of estrogen receptor alpha and beta in the mouse central nervous system: in vivo autoradiographic and immunocytochemical analyses. J Comp Neurol2004 May 24;473(2):270-91. 36. Grohe C, Kahlert S, Lobbert K, Stimpel M, Karas RH, Vetter H, et al. Cardiac myocytes and fibroblasts contain functional estrogen receptors. FEBS Lett1997 Oct 13;416(1):107-12. 37. Grohe C, Kahlert S, Lobbert K, Vetter H. Expression of oestrogen receptor alpha and beta in rat heart: role of local oestrogen synthesis. J Endocrinol1998 Feb;156(2):R1-7. 38. Saunders PT, Maguire SM, Gaughan J, Millar MR. Expression of oestrogen receptor beta (ER beta) in multiple rat tissues visualised by immunohistochemistry. J Endocrinol1997 Sep;154(3):R13-6. 39. Lee KH, Hess RA, Bahr JM, Lubahn DB, Taylor J, Bunick D. Estrogen receptor alpha has a functional role in the mouse rete testis and efferent ductules. Biol Reprod2000 Dec;63(6):1873-80. 40. Dieudonne M, Leneveu M, Giudicelli Y, Pecquery R. Evidence for functional estrogen receptors α and β in human adipose cells: regional specificities and regulation by estrogens. Am J Physiol Cell Physiol2004;286:C655-C61. 41. Barros R, Machando U, Warner M, Gustafsson J-A. Muscle GLUT4 regulation by estrogen receptors ERβ and ERα PNAS2006;103(5):1605-8. 42. Andersen O, Pedersen SB, Svenstrup B, Hansen BR, Paulsen SK, Rathje GS, et al. Circulating sex hormones and gene expression of subcutaneous adipose tissue oestrogen and alpha-adrenergic receptors in HIV-lipodystrophy: implications for fat distribution. Clin Endocrinol (Oxf)2007 Aug;67(2):250-8. 43. Anderson L, McTernan P, Barnett A, Kumar S. The effects of androgens and estrogens on preadipocyte proliferation in human adipose tissue: influence of gender and site. The Journal of Clinical Endocrinology & Metabolism2001;86(10):5054-1. 44. Anwar A, McTernan PG, Anderson LA, Askaa J, Moody CG, Barnett AH, et al. Site- specific regulation of oestrogen receptor-alpha and -beta by oestradiol in human adipose tissue. Diabetes Obes Metab2001 Oct;3(5):338-49. 45. Armellini F, Zamboni M, De Pergola G, Bissoli L, Turcato E, Giorgino R, et al. Resting energy expenditure, growth hormone indices, body composition and adipose tissue distribution in premenopausal women. J Intern Med2000 Jun;247(6):709-14. 46. Barros RP, Gabbi C, Morani A, Warner M, Gustafsson JA. Participation of ERalpha and ERbeta in glucose homeostasis in skeletal muscle and white adipose tissue. Am J Physiol Endocrinol Metab2009 Jul;297(1):E124-33. 47. Wake DJ, Strand M, Rask E, Westerbacka J, Livingstone DE, Soderberg S, et al. Intra- adipose sex steroid metabolism and body fat distribution in idiopathic human obesity. Clin Endocrinol (Oxf)2007 Mar;66(3):440-6. 48. Chen FP, Hsu T, Hu CH, Wang WD, Wang KC, Teng LF. Expression of estrogen receptors alpha and beta in human osteoblasts: identification of exon-2 deletion variant of estrogen receptor beta in postmenopausal women. Chang Gung Med J2004 Feb;27(2):107-15.

137 49. Pedersen SB, Hansen PS, Lund S, Andersen PH, Odgaard A, Richelsen B. Identification of oestrogen receptors and oestrogen receptor mRNA in human adipose tissue. Eur J Clin Invest1996 Apr;26(4):262-9. 50. Shearman AM, Cupples LA, Demissie S, Peter I, Schmid CH, Karas RH, et al. Association between estrogen receptor alpha gene variation and cardiovascular disease. JAMA2003 Nov 5;290(17):2263-70. 51. Rexrode KM, Ridker PM, Hegener HH, Buring JE, Manson JE, Zee RY. Polymorphisms and haplotypes of the estrogen receptor-beta gene (ESR2) and cardiovascular disease in men and women. Clin Chem2007 Oct;53(10):1749-56. 52. Gallagher CJ, Langefeld CD, Gordon CJ, Campbell JK, Mychaleckyj JC, Bryer-Ash M, et al. Association of the estrogen receptor-alpha gene with the metabolic syndrome and its component traits in African-American families: the Insulin Resistance Atherosclerosis Family Study. Diabetes2007 Aug;56(8):2135-41. 53. Lo JC, Zhao X, Scuteri A, Brockwell S, Sowers MR. The association of genetic polymorphisms in sex hormone biosynthesis and action with insulin sensitivity and diabetes mellitus in women at midlife. Am J Med2006 Sep;119(9 Suppl 1):S69-78. 54. Schuit SC, Oei HH, Witteman JC, Geurts van Kessel CH, van Meurs JB, Nijhuis RL, et al. Estrogen receptor alpha gene polymorphisms and risk of myocardial infarction. JAMA2004 Jun 23;291(24):2969-77. 55. Gabel SA, Walker VR, London RE, Steenbergen C, Korach KS, Murphy E. Estrogen receptor beta mediates gender differences in ischemia/reperfusion injury. J Mol Cell Cardiol2005 Feb;38(2):289-97. 56. Pelzer T, Loza PA, Hu K, Bayer B, Dienesch C, Calvillo L, et al. Increased mortality and aggravation of heart failure in estrogen receptor-beta knockout mice after myocardial infarction. Circulation2005 Mar 29;111(12):1492-8. 57. Wang M, Crisostomo PR, Markel T, Wang Y, Lillemoe KD, Meldrum DR. Estrogen receptor beta mediates acute myocardial protection following ischemia. Surgery2008 Aug;144(2):233-8. 58. Wang M, Wang Y, Weil B, Abarbanell A, Herrmann J, Tan J, et al. Estrogen receptor beta mediates increased activation of PI3K/Akt signaling and improved myocardial function in female hearts following acute ischemia. Am J Physiol Regul Integr Comp Physiol2009 Apr;296(4):R972-8. 59. Zhai P, Eurell TE, Cooke PS, Lubahn DB, Gross DR. Myocardial ischemia-reperfusion injury in estrogen receptor-alpha knockout and wild-type mice. Am J Physiol Heart Circ Physiol2000 May;278(5):H1640-7. 60. Foryst-Ludwig A, Clemenz M, Hohmann S, Hartge M, Sprang C, Frost N, et al. Metabolic actions of estrogen receptor beta (ERbeta) are mediated by a negative cross-talk with PPARgamma. PLoS Genet2008 Jun;4(6):e1000108. 61. Naaz A, Zakroczymski M, Heine P, Taylor J, Saunders P, Lubahn D, et al. Effect of ovariectomy on adipose tissue of mice in the absence of estrogen receptor alpha (ERalpha): a potential role for estrogen receptor beta (ERbeta). Horm Metab Res2002;34:758-63. 62. Nikolic I, Liu D, Bell JA, Collins J, Steenbergen C, Murphy E. Treatment with an estrogen receptor-beta-selective agonist is cardioprotective. J Mol Cell Cardiol2007 Apr;42(4):769-80. 63. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A Novel Serum Protein Similar to C1q, Produced Exclusively in Adipocytes. Journal of Biological Chemistry1995 November 10, 1995;270(45):26746-9. 64. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature1994;372(6505):425.

138 65. Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. J Clin Endocrinol Metab2004 Jun;89(6):2548-56. 66. Okamoto Y, Kihara S, Ouchi N, Nishida M, Arita Y, Kumada M, et al. Adiponectin reduces atherosclerosis in apolipoprotein E-deficient mice. Circulation2002 Nov 26;106(22):2767-70. 67. Goldstein BJ, Scalia R. Adipokines and vascular disease in diabetes. Curr Diab Rep2007 Feb;7(1):25-33. 68. Zhu W, Cheng KK, Vanhoutte PM, Lam KS, Xu A. Vascular effects of adiponectin: molecular mechanisms and potential therapeutic intervention. Clin Sci (Lond)2008 Mar;114(5):361-74. 69. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem1996 May 3;271(18):10697-703. 70. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, et al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun1999 Apr 2;257(1):79-83. 71. Hotta K, Funahashi T, Arita Y, Takahashi M, Matsuda M, Okamoto Y, et al. Plasma concentrations of a novel, adipose-specific protein, adiponectin, in type 2 diabetic patients. Arterioscler Thromb Vasc Biol2000 Jun;20(6):1595-9. 72. Weyer C, Funahashi T, Tanaka S, Hotta K, Matsuzawa Y, Pratley RE, et al. Hypoadiponectinemia in obesity and type 2 diabetes: close association with insulin resistance and hyperinsulinemia. J Clin Endocrinol Metab2001 May;86(5):1930-5. 73. Gavrila A, Chan JL, Yiannakouris N, Kontogianni M, Miller LC, Orlova C, et al. Serum adiponectin levels are inversely associated with overall and central fat distribution but are not directly regulated by acute fasting or leptin administration in humans: cross-sectional and interventional studies. J Clin Endocrinol Metab2003 Oct;88(10):4823-31. 74. Kumada M, Kihara S, Sumitsuji S, Kawamoto T, Matsumoto S, Ouchi N, et al. Association of hypoadiponectinemia with coronary artery disease in men. Arterioscler Thromb Vasc Biol2003 Jan 1;23(1):85-9. 75. Shimabukuro M, Higa N, Asahi T, Oshiro Y, Takasu N, Tagawa T, et al. Hypoadiponectinemia is closely linked to endothelial dysfunction in man. J Clin Endocrinol Metab2003 Jul;88(7):3236-40. 76. Pajvani UB, Hawkins M, Combs TP, Rajala MW, Doebber T, Berger JP, et al. Complex Distribution, Not Absolute Amount of Adiponectin, Correlates with Thiazolidinedione-mediated Improvement in Insulin Sensitivity. J Biol Chem2004 March 26, 2004;279(13):12152-62. 77. Gomez-Abellan P, Gomez-Santos C, Madrid JA, Milagro FI, Campion J, Martinez JA, et al. Circadian expression of adiponectin and its receptors in human adipose tissue. Endocrinology Jan;151(1):115-22. 78. Pischon T, Girman CJ, Hotamisligil GS, Rifai N, Hu FB, Rimm EB. Plasma adiponectin levels and risk of myocardial infarction in men. JAMA2004 Apr 14;291(14):1730-7. 79. Lara-Castro C, Luo N, Wallace P, Klein RL, Garvey WT. Adiponectin Multimeric Complexes and the Metabolic Syndrome Trait Cluster. Diabetes2006 January 1, 2006;55(1):249- 59. 80. Kojima S, Funahashi T, Otsuka F, Maruyoshi H, Yamashita T, Kajiwara I, et al. Future adverse cardiac events can be predicted by persistently low plasma adiponectin concentrations in men and marked reductions of adiponectin in women after acute myocardial infarction. Atherosclerosis2007 Sep;194(1):204-13. 81. Nannipieri M, Bonotti A, Anselmino M, Cecchetti F, Madec S, Mancini E, et al. Pattern of expression of adiponectin receptors in human adipose tissue depots and its relation to the metabolic state. Int J Obes (Lond)2007 Dec;31(12):1843-8.

139 82. Matsubara M, Maruoka S, Katayose S. Inverse relationship between plasma adiponectin and leptin concentrations in normal-weight and obese women. Eur J Endocrinol2002 Aug;147(2):173-80. 83. Tsuchida A, Yamauchi T, Ito Y, Hada Y, Maki T, Takekawa S, et al. Insulin/Foxo1 pathway regulates expression levels of adiponectin receptors and adiponectin sensitivity. J Biol Chem2004 Jul 16;279(29):30817-22. 84. Yamauchi T, Kadowaki T. Physiological and pathophysiological roles of adiponectin and adiponectin receptors in the integrated regulation of metabolic and cardiovascular diseases. Int J Obes (Lond)2008 Dec;32 Suppl 7:S13-8. 85. Rasmussen MS, Lihn AS, Pedersen SB, Bruun JM, Rasmussen M, Richelsen B. Adiponectin receptors in human adipose tissue: effects of obesity, weight loss, and fat depots. Obesity (Silver Spring)2006 Jan;14(1):28-35. 86. Ouchi N, Kihara S, Arita Y, Maeda K, Kuriyama H, Okamoto Y, et al. Novel modulator for endothelial adhesion molecules: adipocyte-derived plasma protein adiponectin. Circulation1999 Dec 21-28;100(25):2473-6. 87. Rodriguez VE, Costas P. Systemic lupus erythematosus presenting as acute iceric hepatitis: a case report. Bol Asoc Med P R2008 Jul-Sep;100(3):54-7. 88. Bruce CR, Mertz VA, Heigenhauser GJ, Dyck DJ. The stimulatory effect of globular adiponectin on insulin-stimulated glucose uptake and fatty acid oxidation is impaired in skeletal muscle from obese subjects. Diabetes2005 Nov;54(11):3154-60. 89. Chen MB, McAinch AJ, Macaulay SL, Castelli LA, O'Brien P E, Dixon JB, et al. Impaired activation of AMP-kinase and fatty acid oxidation by globular adiponectin in cultured human skeletal muscle of obese type 2 diabetics. J Clin Endocrinol Metab2005 Jun;90(6):3665- 72. 90. Lin HV, Kim JY, Pocai A, Rossetti L, Shapiro L, Scherer PE, et al. Adiponectin resistance exacerbates insulin resistance in insulin receptor transgenic/knockout mice. Diabetes2007 Aug;56(8):1969-76. 91. Mullen KL, Smith AC, Junkin KA, Dyck DJ. Globular adiponectin resistance develops independently of impaired insulin-stimulated glucose transport in soleus muscle from high-fat-fed rats. American Journal of Physiology - Endocrinology And Metabolism2007 July 1, 2007;293(1):E83-E90. 92. Mullen KL, Pritchard J, Ritchie I, Snook LA, Chabowski A, Bonen A, et al. Adiponectin resistance precedes the accumulation of skeletal muscle lipids and insulin resistance in high-fat- fed rats. Am J Physiol Regul Integr Comp Physiol2009 Feb;296(2):R243-51. 93. Yi W, Sun Y, Gao E, Wei X, Lau WB, Zheng Q, et al. Reduced Cardioprotective Action of Adiponectin in High-Fat Diet-Induced Type II Diabetic Mice and Its Underlying Mechanisms. Antioxid Redox Signal2011 Apr 11. 94. Ma Y, Liu Y, Liu S, Qu Y, Wang R, Xia C, et al. Dynamic Alteration of Adiponectin/Adiponectin Receptor Expression and Its Impact on Myocardial Ischemia/Reperfusion in Type 1 Diabetic Mice. Am J Physiol Endocrinol Metab2011 May 17. 95. Shinmura K, Tamaki K, Saito K, Nakano Y, Tobe T, Bolli R. Cardioprotective effects of short-term caloric restriction are mediated by adiponectin via activation of AMP-activated protein kinase. Circulation2007 Dec 11;116(24):2809-17. 96. Lonard DM, Lanz RB, O'Malley BW. Nuclear receptor coregulators and human disease. Endocr Rev2007 Aug;28(5):575-87. 97. Green S, Walter P, Greene G, Krust A, Goffin C, Jensen E, et al. Cloning of the human oestrogen receptor cDNA. J Steroid Biochem1986 Jan;24(1):77-83.

140 98. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology1997 Mar;138(3):863-70. 99. Hall JM, Couse JF, Korach KS. The multifaceted mechanisms of estradiol and estrogen receptor signaling. J Biol Chem2001 Oct 5;276(40):36869-72. 100. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, et al. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science1997 Sep 5;277(5331):1508-10. 101. Webb P, Nguyen P, Valentine C, Lopez GN, Kwok GR, McInerney E, et al. The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol Endocrinol1999 Oct;13(10):1672-85. 102. Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, et al. Estrogen receptor pathways to AP-1. J Steroid Biochem Mol Biol2000 Nov 30;74(5):311-7. 103. Safe S. Transcriptional activation of genes by 17 beta-estradiol through estrogen receptor-Sp1 interactions. Vitam Horm2001;62:231-52. 104. Zhao C, Dahlman-Wright K, Gustafsson JA. Estrogen receptor beta: an overview and update. Nucl Recept Signal2008;6:e003. 105. Leung YK, Mak P, Hassan S, Ho SM. Estrogen receptor (ER)-beta isoforms: a key to understanding ER-beta signaling. Proc Natl Acad Sci U S A2006 Aug 29;103(35):13162-7. 106. Delaunay F, Pettersson K, Tujague M, Gustafsson JA. Functional differences between the amino-terminal domains of estrogen receptors alpha and beta. Mol Pharmacol2000 Sep;58(3):584-90. 107. Barkhem T, Nilsson S, Gustafsson JA. Molecular mechanisms, physiological consequences and pharmacological implications of estrogen receptor action. Am J Pharmacogenomics2004;4(1):19-28. 108. Hall JM, McDonnell DP. The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology1999 Dec;140(12):5566-78. 109. Pike AC. Lessons learnt from structural studies of the oestrogen receptor. Best Pract Res Clin Endocrinol Metab2006 Mar;20(1):1-14. 110. Lewandowski S, Kalita K, Kaczmarek L. Estrogen receptor beta. Potential functional significance of a variety of mRNA isoforms. FEBS Lett2002 Jul 31;524(1-3):1-5. 111. Moore JT, McKee DD, Slentz-Kesler K, Moore LB, Jones SA, Horne EL, et al. Cloning and characterization of human estrogen receptor beta isoforms. Biochem Biophys Res Commun1998 Jun 9;247(1):75-8. 112. Ogawa S, Inoue S, Watanabe T, Orimo A, Hosoi T, Ouchi Y, et al. Molecular cloning and characterization of human estrogen receptor betacx: a potential inhibitor ofestrogen action in human. Nucleic Acids Res1998 Aug 1;26(15):3505-12. 113. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA. Identification of estrogen receptor beta2, a functional variant of estrogen receptor beta expressed in normal rat tissues. Endocrinology1998 Mar;139(3):1082-92. 114. Fleming FJ, Hill AD, McDermott EW, O'Higgins NJ, Young LS. Differential recruitment of coregulator proteins steroid receptor coactivator-1 and silencing mediator for retinoid and thyroid receptors to the estrogen receptor-estrogen response element by beta-estradiol and 4- hydroxytamoxifen in human breast cancer. J Clin Endocrinol Metab2004 Jan;89(1):375-83. 115. Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, et al. Estrogen Receptor Activation Function 1 Works by Binding p160 Coactivator Proteins. Molecular Endocrinology1998 October 1, 1998;12(10):1605-18.

141 116. Kim MY, Woo EM, Chong YT, Homenko DR, Kraus WL. Acetylation of estrogen receptor alpha by p300 at lysines 266 and 268 enhances the deoxyribonucleic acid binding and transactivation activities of the receptor. Mol Endocrinol2006 Jul;20(7):1479-93. 117. O'Lone R, Knorr K, Jaffe IZ, Schaffer ME, Martini PG, Karas RH, et al. Estrogen receptors alpha and beta mediate distinct pathways of vascular gene expression, including genes involved in mitochondrial electron transport and generation of reactive oxygen species. Mol Endocrinol2007 Jun;21(6):1281-96. 118. Uht RM, Anderson CM, Webb P, Kushner PJ. Transcriptional activities of estrogen and glucocorticoid receptors are functionally integrated at the AP-1 response element. Endocrinology1997 Jul;138(7):2900-8. 119. Porter W, Saville B, Hoivik D, Safe S. Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol Endocrinol1997 Oct;11(11):1569-80. 120. Grohe C, Kahlert S, Löbbert K, Meyer R, Linz KW, Karas RH, et al. Modulation of hypertensive heart disease by estrogen. Steroids. [doi: 10.1016/0039-128X(96)00014-1]. 1996;61(4):201-4. 121. Homma H, Kurachi H, Nishio Y, Takeda T, Yamamoto T, Adachi K, et al. Estrogen suppresses transcription of lipoprotein lipase gene. Existence of a unique estrogen response element on the lipoprotein lipase promoter. J Biol Chem2000 Apr 14;275(15):11404-11. 122. Pinzone JJ, Stevenson H, Strobl JS, Berg PE. Molecular and cellular determinants of estrogen receptor alpha expression. Mol Cell Biol2004 Jun;24(11):4605-12. 123. Kaneko KJ, Furlow JD, Gorski J. Involvement of the coding sequence for the estrogen receptor gene in autologous ligand-dependent down-regulation. Mol Endocrinol1993 Jul;7(7):879-88. 124. Mohamed MK, Abdel-Rahman AA. Effect of long-term ovariectomy and estrogen replacement on the expression of estrogen receptor gene in female rats. Eur J Endocrinol2000 Mar;142(3):307-14. 125. Ropero AB, Eghbali M, Minosyan TY, Tang G, Toro L, Stefani E. Heart estrogen receptor alpha: distinct membrane and nuclear distribution patterns and regulation by estrogen. J Mol Cell Cardiol2006 Sep;41(3):496-510. 126. Jazbutyte V, Hu K, Kruchten P, Bey E, Maier SK, Fritzemeier KH, et al. Aging reduces the efficacy of estrogen substitution to attenuate cardiac hypertrophy in female spontaneously hypertensive rats. Hypertension2006 Oct;48(4):579-86. 127. Joel PB, Traish AM, Lannigan DA. Estradiol-induced phosphorylation of serine 118 in the estrogen receptor is independent of p42/p44 mitogen-activated protein kinase. J Biol Chem1998 May 22;273(21):13317-23. 128. Medunjanin S, Hermani A, De Servi B, Grisouard J, Rincke G, Mayer D. Glycogen synthase kinase-3 interacts with and phosphorylates estrogen receptor alpha and is involved in the regulation of receptor activity. J Biol Chem2005 Sep 23;280(38):33006-14. 129. Ali S, Metzger D, Bornert JM, Chambon P. Modulation of transcriptional activation by ligand-dependent phosphorylation of the human oestrogen receptor A/B region. EMBO J1993 Mar;12(3):1153-60. 130. Aronica SM, Katzenellenbogen BS. Stimulation of estrogen receptor-mediated transcription and alteration in the phosphorylation state of the rat uterine estrogen receptor by estrogen, cyclic adenosine monophosphate, and insulin-like growth factor-I. Mol Endocrinol1993 Jun;7(6):743-52. 131. Denton RR, Koszewski NJ, Notides AC. Estrogen receptor phosphorylation. Hormonal dependence and consequence on specific DNA binding. J Biol Chem1992 Apr 15;267(11):7263- 8.

142 132. Joel PB, Smith J, Sturgill TW, Fisher TL, Blenis J, Lannigan DA. pp90rsk1 regulates estrogen receptor-mediated transcription through phosphorylation of Ser-167. Mol Cell Biol1998 Apr;18(4):1978-84. 133. Joel PB, Traish AM, Lannigan DA. Estradiol and phorbol ester cause phosphorylation of serine 118 in the human estrogen receptor. Mol Endocrinol1995 Aug;9(8):1041-52. 134. Le Goff P, Montano MM, Schodin DJ, Katzenellenbogen BS. Phosphorylation of the human estrogen receptor. Identification of hormone-regulated sites and examination of their influence on transcriptional activity. J Biol Chem1994 Feb 11;269(6):4458-66. 135. Dos Santos EG, Dieudonne MN, Pecquery R, Le Moal V, Giudicelli Y, Lacasa D. Rapid nongenomic E2 effects on p42/p44 MAPK, activator protein-1, and cAMP response element binding protein in rat white adipocytes. Endocrinology2002 Mar;143(3):930-40. 136. Levin ER. Integration of the extranuclear and nuclear actions of estrogen. Mol Endocrinol2005 Aug;19(8):1951-9. 137. Razandi M, Pedram A, Park ST, Levin ER. Proximal events in signaling by plasma membrane estrogen receptors. J Biol Chem2003 Jan 24;278(4):2701-12. 138. Pappas TC, Gametchu B, Watson CS. Membrane estrogen receptors identified by multiple antibody labeling and impeded-ligand binding. Faseb J1995 Mar;9(5):404-10. 139. Chambliss KL, Shaul PW. Rapid activation of endothelial NO synthase by estrogen: evidence for a steroid receptor fast-action complex (SRFC) in caveolae. Steroids2002 May;67(6):413-9. 140. Razandi M, Alton G, Pedram A, Ghonshani S, Webb P, Levin ER. Identification of a structural determinant necessary for the localization and function of estrogen receptor alpha at the plasma membrane. Mol Cell Biol2003 Mar;23(5):1633-46. 141. Razandi M, Pedram A, Greene GL, Levin ER. Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells. Mol Endocrinol1999 Feb;13(2):307-19. 142. Evinger AJ, 3rd, Levin ER. Requirements for estrogen receptor alpha membrane localization and function. Steroids2005 May-Jun;70(5-7):361-3. 143. Marino M, Ascenzi P, Acconcia F. S-palmitoylation modulates estrogen receptor alpha localization and functions. Steroids2006 Apr;71(4):298-303. 144. Song RX, Barnes CJ, Zhang Z, Bao Y, Kumar R, Santen RJ. The role of Shc and insulin- like growth factor 1 receptor in mediating the translocation of estrogen receptor alpha to the plasma membrane. Proc Natl Acad Sci U S A2004 Feb 17;101(7):2076-81. 145. Pedram A, Razandi M, Levin ER. Nature of functional estrogen receptors at the plasma membrane. Mol Endocrinol2006 Sep;20(9):1996-2009. 146. Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M, et al. PI3-kinase in concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7 cells. EMBO J2001 Nov 1;20(21):6050-9. 147. Kousteni S, Bellido T, Plotkin LI, O'Brien CA, Bodenner DL, Han L, et al. Nongenotropic, sex-nonspecific signaling through the estrogen or androgen receptors: dissociation from transcriptional activity. Cell2001 Mar 9;104(5):719-30. 148. Geraldes P, Sirois MG, Tanguay JF. Specific contribution of estrogen receptors on mitogen-activated protein kinase pathways and vascular cell activation. Circ Res2003 Sep 5;93(5):399-405. 149. Mori-Abe A, Tsutsumi S, Takahashi K, Toya M, Yoshida M, Du B, et al. Estrogen and raloxifene induce apoptosis by activating p38 mitogen-activated protein kinase cascade in synthetic vascular smooth muscle cells. J Endocrinol2003 Sep;178(3):417-26. 150. Galluzzo P, Caiazza F, Moreno S, Marino M. Role of ERbeta palmitoylation in the inhibition of human colon cancer cell proliferation. Endocr Relat Cancer2007 Mar;14(1):153-67.

143 151. Levin ER. Membrane oestrogen receptor alpha signalling to cell functions. J Physiol2009 Nov 1;587(Pt 21):5019-23. 152. Deroo BJ, Korach KS. Estrogen receptors and human disease. J Clin Invest2006 Mar;116(3):561-70. 153. Simoncini T, Hafezi-Moghadam A, Brazil DP, Ley K, Chin WW, Liao JK. Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature2000 Sep 28;407(6803):538-41. 154. de Jager T, Pelzer T, Muller-Botz S, Imam A, Muck J, Neyses L. Mechanisms of estrogen receptor action in the myocardium. Rapid gene activation via the ERK1/2 pathway and serum response elements. J Biol Chem2001 Jul 27;276(30):27873-80. 155. Booth EA, Obeid NR, Lucchesi BR. Activation of estrogen receptor-alpha protects the in vivo rabbit heart from ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol2005 Nov;289(5):H2039-47. 156. Thomas P, Pang Y, Filardo EJ, Dong J. Identity of an estrogen membrane receptor coupled to a G protein in human breast cancer cells. Endocrinology2005 Feb;146(2):624-32. 157. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER. A transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science2005 Mar 11;307(5715):1625-30. 158. Owman C, Blay P, Nilsson C, Lolait SJ. Cloning of Human cDNA Encoding a Novel Heptahelix Receptor Expressed in Burkitt's Lymphoma and Widely Distributed in Brain and Peripheral Tissues. Biochemical and Biophysical Research Communications. [doi: 10.1006/bbrc.1996.1654]. 1996;228(2):285-92. 159. Deschamps AM, Murphy E. Activation of a novel estrogen receptor, GPER, is cardioprotective in male and female rats. American Journal of Physiology - Heart and Circulatory Physiology2009 November 1, 2009;297(5):H1806-H13. 160. Chang EC, Frasor J, Komm B, Katzenellenbogen BS. Impact of estrogen receptor beta on gene networks regulated by estrogen receptor alpha in breast cancer cells. Endocrinology2006 Oct;147(10):4831-42. 161. Thomas RS, Sarwar N, Phoenix F, Coombes RC, Ali S. Phosphorylation at serines 104 and 106 by Erk1/2 MAPK is important for estrogen receptor-alpha activity. J Mol Endocrinol2008 Apr;40(4):173-84. 162. Kato S, Endoh H, Masuhiro Y, Kitamoto T, Uchiyama S, Sasaki H, et al. Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science1995 Dec 1;270(5241):1491-4. 163. Rogatsky I, Trowbridge JM, Garabedian MJ. Potentiation of human estrogen receptor alpha transcriptional activation through phosphorylation of serines 104 and 106 by the cyclin A- CDK2 complex. J Biol Chem1999 Aug 6;274(32):22296-302. 164. Chen D, Riedl T, Washbrook E, Pace PE, Coombes RC, Egly JM, et al. Activation of estrogen receptor alpha by S118 phosphorylation involves a ligand-dependent interaction with TFIIH and participation of CDK7. Mol Cell2000 Jul;6(1):127-37. 165. Endoh H, Maruyama K, Masuhiro Y, Kobayashi Y, Goto M, Tai H, et al. Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol Cell Biol1999 Aug;19(8):5363-72. 166. Sheeler CQ, Singleton DW, Khan SA. Mutation of serines 104, 106, and 118 inhibits dimerization of the human estrogen receptor in yeast. Endocr Res2003 May;29(2):237-55. 167. Masuhiro Y, Mezaki Y, Sakari M, Takeyama K, Yoshida T, Inoue K, et al. Splicing potentiation by growth factor signals via estrogen receptor phosphorylation. Proc Natl Acad Sci U S A2005 Jun 7;102(23):8126-31.

144 168. Dutertre M, Smith CL. Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol Endocrinol2003 Jul;17(7):1296-314. 169. Arnold SF, Obourn JD, Jaffe H, Notides AC. Phosphorylation of the human estrogen receptor by mitogen-activated protein kinase and casein kinase II: consequence on DNA binding. J Steroid Biochem Mol Biol1995 Nov;55(2):163-72. 170. Clark DE, Poteet-Smith CE, Smith JA, Lannigan DA. Rsk2 allosterically activates estrogen receptor alpha by docking to the hormone-binding domain. EMBO J2001 Jul 2;20(13):3484-94. 171. Sun M, Paciga JE, Feldman RI, Yuan Z, Coppola D, Lu YY, et al. Phosphatidylinositol- 3-OH Kinase (PI3K)/AKT2, activated in breast cancer, regulates and is induced by estrogen receptor alpha (ERalpha) via interaction between ERalpha and PI3K. Cancer Res2001 Aug 15;61(16):5985-91. 172. Chen D, Pace PE, Coombes RC, Ali S. Phosphorylation of human estrogen receptor alpha by protein kinase A regulates dimerization. Mol Cell Biol1999 Feb;19(2):1002-15. 173. Tsai HW, Katzenellenbogen JA, Katzenellenbogen BS, Shupnik MA. Protein kinase A activation of estrogen receptor alpha transcription does not require proteasome activity and protects the receptor from ligand-mediated degradation. Endocrinology2004 Jun;145(6):2730-8. 174. Wang RA, Mazumdar A, Vadlamudi RK, Kumar R. P21-activated kinase-1 phosphorylates and transactivates estrogen receptor-alpha and promotes hyperplasia in mammary epithelium. EMBO J2002 Oct 15;21(20):5437-47. 175. Williams CC, Basu A, El-Gharbawy A, Carrier LM, Smith CL, Rowan BG. Identification of four novel phosphorylation sites in estrogen receptor alpha: impact on receptor-dependent gene expression and phosphorylation by protein kinase CK2. BMC Biochem2009;10:36. 176. Lee H, Bai W. Regulation of estrogen receptor nuclear export by ligand-induced and p38- mediated receptor phosphorylation. Mol Cell Biol2002 Aug;22(16):5835-45. 177. He X, Zheng Z, Song T, Wei C, Ma H, Ma Q, et al. c-Abl regulates estrogen receptor alpha transcription activity through its stabilization by phosphorylation. Oncogene2010 Apr 15;29(15):2238-51. 178. Migliaccio A, Castoria G, Di Domenico M, de Falco A, Bilancio A, Lombardi M, et al. Steroid-induced androgen receptor-oestradiol receptor beta-Src complex triggers prostate cancer cell proliferation. EMBO J2000 Oct 16;19(20):5406-17. 179. Varricchio L, Migliaccio A, Castoria G, Yamaguchi H, de Falco A, Di Domenico M, et al. Inhibition of estradiol receptor/Src association and cell growth by an estradiol receptor alpha tyrosine-phosphorylated peptide. Mol Cancer Res2007 Nov;5(11):1213-21. 180. Patrone C, Gianazza E, Santagati S, Agrati P, Maggi A. Divergent pathways regulate ligand-independent activation of ER alpha in SK-N-BE neuroblastoma and COS-1 renal carcinoma cells. Mol Endocrinol1998 Jun;12(6):835-41. 181. Tremblay A, Tremblay GB, Labrie F, Giguere V. Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1. Mol Cell1999 Apr;3(4):513-9. 182. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, et al. Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci U S A1998 Mar 17;95(6):2920-5. 183. Weis KE, Ekena K, Thomas JA, Lazennec G, Katzenellenbogen BS. Constitutively active human estrogen receptors containing amino acid substitutions for tyrosine 537 in the receptor protein. Mol Endocrinol1996 Nov;10(11):1388-98.

145 184. White R, Sjoberg M, Kalkhoven E, Parker MG. Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine. EMBO J1997 Mar 17;16(6):1427-35. 185. Picard N, Charbonneau C, Sanchez M, Licznar A, Busson M, Lazennec G, et al. Phosphorylation of activation function-1 regulates proteasome-dependent nuclear mobility and E6-associated protein ubiquitin ligase recruitment to the estrogen receptor beta. Mol Endocrinol2008 Feb;22(2):317-30. 186. Coleman KM, Dutertre M, El-Gharbawy A, Rowan BG, Weigel NL, Smith CL. Mechanistic differences in the activation of estrogen receptor-alpha (ER alpha)- and ER beta- dependent gene expression by cAMP signaling pathway(s). J Biol Chem2003 Apr 11;278(15):12834-45. 187. Post WS, Goldschmidt-Clermont PJ, Wilhide CC, Heldman AW, Sussman MS, Ouyang P, et al. Methylation of the estrogen receptor gene is associated with aging and atherosclerosis in the cardiovascular system. Cardiovasc Res1999 Sep;43(4):985-91. 188. Wang X, Kilgore MW. Signal cross-talk between estrogen receptor alpha and beta and the peroxisome proliferator-activated receptor gamma1 in MDA-MB-231 and MCF-7 breast cancer cells. Mol Cell Endocrinol2002 Aug 30;194(1-2):123-33. 189. Keller H, Givel F, Perroud M, Wahli W. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements. Mol Endocrinol1995 Jul;9(7):794-804. 190. Stauffer SR, Coletta CJ, Tedesco R, Nishiguchi G, Carlson K, Sun J, et al. Pyrazole Ligands: S tructure−Affinity/Activity Relationships and Estrogen Receptor -α-Selective Agonists. Journal of Medicinal Chemistry. [doi: 10.1021/jm000170m]. 2000;43(26):4934-47. 191. Hillisch A, Peters O, Kosemund D, Müller G, Walter A, Schneider B, et al. Dissecting Physiological Roles of Estrogen Receptor α and β with Potent Selective Ligands from Structure- Based Design. Molecular Endocrinology2004 July 1, 2004;18(7):1599-609. 192. Meyers MJ, Sun J, Carlson KE, Marriner GA, Katzenellenbogen BS, Katzenellenbogen JA. Estrogen Receptor-β Potency-Selective Ligands: Structure −Activity Relationship Studies of Diarylpropionitriles and Their Acetylene and Polar Analogues. Journal of Medicinal Chemistry. [doi: 10.1021/jm010254a]. 2001;44(24):4230-51. 193. Malamas MS, Manas ES, McDevitt RE, Gunawan I, Xu ZB, Collini MD, et al. Design and Synthesis of Aryl Diphenolic Azoles as Potent and Selective Estrogen Receptor-β Ligands. Journal of Medicinal Chemistry. [doi: 10.1021/jm049719y]. 2004;47(21):5021-40. 194. Mewshaw RE, Edsall RJ, Yang C, Manas ES, Xu ZB, Henderson RA, et al. ERβ Ligands. 3. Exploiting Two Binding Orientations of the 2-Phenylnaphthalene Scaffold To Achieve ERβ Selectivity. Journal of Medicinal Chemistry. [doi: 10.1021/jm058173s]. 2005;48(12):3953-79. 195. Mak P, Leung YK, Tang WY, Harwood C, Ho SM. Apigenin suppresses cancer cell growth through ERbeta. Neoplasia2006 Nov;8(11):896-904. 196. Hugo ER, Brandebourg TD, Woo JG, Loftus J, Alexander JW, Ben-Jonathan N. Bisphenol A at environmentally relevant doses inhibits adiponectin release from human adipose tissue explants and adipocytes. Environ Health Perspect2008 Dec;116(12):1642-7. 197. Yan S, Chen Y, Dong M, Song W, Belcher SM, Wang HS. Bisphenol A and 17beta- estradiol promote arrhythmia in the female heart via alteration of calcium handling. PLoS One2011;6(9):e25455. 198. Gao H, Bryzgalova G, Hedman E, Khan A, Efendic S, Gustafsson JA, et al. Long-term administration of estradiol decreases expression of hepatic lipogenic genes and improves insulin sensitivity in ob/ob mice: a possible mechanism is through direct regulation of signal transducer and activator of transcription 3. Mol Endocrinol2006 Jun;20(6):1287-99.

146 199. Lundholm L, Bryzgalova G, Gao H, Portwood N, Fält S, Berndt KD, et al. The estrogen receptor α-selective agonist propyl pyrazole triol improves glucose tolerance in ob/ob mice; potential molecular mechanisms. Journal of Endocrinology2008 November 1, 2008;199(2):275- 86. 200. Cederroth CR, Vinciguerra M, Kuhne F, Madani R, Doerge DR, Visser TJ, et al. A phytoestrogen-rich diet increases energy expenditure and decreases adiposity in mice. Environ Health Perspect2007 Oct;115(10):1467-73. 201. Naaz A, Yellayi S, Zakroczymski MA, Bunick D, Doerge DR, Lubahn DB, et al. The soy isoflavone genistein decreases adipose deposition in mice. Endocrinology2003 Aug;144(8):3315- 20. 202. Cederroth CR, Vinciguerra M, Gjinovci A, Kühne F, Klein M, Cederroth M, et al. Dietary Phytoestrogens Activate AMP-Activated Protein Kinase With Improvement in Lipid and Glucose Metabolism. Diabetes2008 May 2008;57(5):1176-85. 203. Santollo J, Wiley MD, Eckel LA. Acute activation of ER alpha decreases food intake, meal size, and body weight in ovariectomized rats. Am J Physiol Regul Integr Comp Physiol2007 Dec;293(6):R2194-201. 204. Sun J, Ma X, Chen YX, Rayner K, Hibbert B, McNulty M, et al. Attenuation of Atherogenesis via the Anti-Inflammatory Effects of the Selective Estrogen Receptor Beta Modulator 8beta-VE2. J Cardiovasc Pharmacol Jun 18. 205. Hsieh YC, Choudhry MA, Yu HP, Shimizu T, Yang S, Suzuki T, et al. Inhibition of cardiac PGC-1alpha expression abolishes ERbeta agonist-mediated cardioprotection following trauma-hemorrhage. Faseb J2006 Jun;20(8):1109-17. 206. Yu HP, Shimizu T, Choudhry MA, Hsieh YC, Suzuki T, Bland KI, et al. Mechanism of cardioprotection following trauma-hemorrhagic shock by a selective estrogen receptor-beta agonist: up-regulation of cardiac heat shock factor-1 and heat shock proteins. J Mol Cell Cardiol2006 Jan;40(1):185-94. 207. Novensà L, Novella S, Medina P, Segarra G, Castillo N, Heras M, et al. Aging Negatively Affects Estrogens-Mediated Effects on Nitric Oxide Bioavailability by Shifting ERα/ERβ Balance in Female Mice. PLoS One;6(9):e25335. 208. Matthews J, Gustafsson JA. Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol Interv2003 Aug;3(5):281-92. 209. Koehler KF, Helguero LA, Haldosen LA, Warner M, Gustafsson JA. Reflections on the discovery and significance of estrogen receptor beta. Endocr Rev2005 May;26(3):465-78. 210. Sakaguchi H, Fujimoto J, Aoki I, Tamaya T. Expression of estrogen receptor alpha and beta in myometrium of premenopausal and postmenopausal women. Steroids2003 Jan;68(1):11-9. 211. Bonomo SM, Rigamonti AE, Giunta M, Galimberti D, Guaita A, Gagliano MG, et al. Menopausal transition: a possible risk factor for brain pathologic events. Neurobiol Aging2009 Jan;30(1):71-80. 212. Batra GS, Hainey L, Freemont AJ, Andrew G, Saunders PT, Hoyland JA, et al. Evidence for cell-specific changes with age in expression of oestrogen receptor (ER) alpha and beta in bone fractures from men and women. J Pathol2003 May;200(1):65-73. 213. Sharma PK, Thakur MK. Expression of estrogen receptor (ER) alpha and beta in mouse cerebral cortex: effect of age, sex and gonadal steroids. Neurobiol Aging2006 Jun;27(6):880-7. 214. Thakur MK, Sharma PK. Transcription of estrogen receptor alpha and beta in mouse cerebral cortex: effect of age, sex, 17beta-estradiol and testosterone. Neurochem Int2007 Jan;50(2):314-21. 215. Gorres BK, Bomhoff GL, Gupte AA, Geiger PC. Altered estrogen receptor expression in skeletal muscle and adipose tissue of female rats fed a high-fat diet. J Appl Physiol2011 Apr;110(4):1046-53.

147 216. Nilsson M, Dahlman I, Ryden M, Nordstrom E, Gustafsson J-A, Arner P, et al. Oestrogen receptor α gene expression levels are reduced in obese compared to normal weight females. International Journal of Obesity2007;31:900-7. 217. Dieudonne MN, Leneveu MC, Giudicelli Y, Pecquery R. Evidence for functional estrogen receptors alpha and beta in human adipose cells: regional specificities and regulation by estrogens. Am J Physiol Cell Physiol2004 Mar;286(3):C655-61. 218. Dieudonne MN, Pecquery R, Leneveu MC, Giudicelli Y. Opposite effects of androgens and estrogens on adipogenesis in rat preadipocytes: evidence for sex and site-related specificities and possible involvement of insulin-like growth factor 1 receptor and peroxisome proliferator- activated receptor gamma2. Endocrinology2000 Feb;141(2):649-56. 219. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, et al. Generation and reproductive phenotypes of mice lacking estrogen receptor β. Proceedings of the National Academy of Sciences1998 December 22, 1998;95(26):15677-82. 220. Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M. Effect of single and compound knockouts of estrogen receptors alpha (ERalpha) and beta (ERbeta) on mouse reproductive phenotypes. Development2000 October 1, 2000;127(19):4277-91. 221. Shughrue PJ, Askew GR, Dellovade TL, Merchenthaler I. Estrogen-Binding Sites and Their Functional Capacity in Estrogen Receptor Double Knockout Mouse Brain. Endocrinology2002 May 1, 2002;143(5):1643-50. 222. Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, et al. Postnatal sex reversal of the ovaries in mice lacking estrogen receptors alpha and beta. Science1999 Dec 17;286(5448):2328-31. 223. Bryzgalova G, Gao H, Ahren B, Zierath JR, Galuska D, Steiler TL, et al. Evidence that oestrogen receptor-alpha plays an important role in the regulation of glucose homeostasis in mice: insulin sensitivity in the liver. Diabetologia2006 Mar;49(3):588-97. 224. Heine P, Taylor J, Iwamoto G, Lubahn D, Cooke P. Increased adipose tissue in male and female estrogen receptor-a knockout mice. PNAS2000;97(23):12729-34. 225. Ohlsson C, Hellberg N, Parini P, Vidal O, Bohlooly M, Rudling M, et al. Obesity and Disturbed Lipoprotein Profile in Estrogen Receptor-[alpha]-Deficient Male Mice. Biochemical and Biophysical Research Communications. [doi: 10.1006/bbrc.2000.3827]. 2000;278(3):640-5. 226. Wang M, Crisostomo P, Wairiuko GM, Meldrum DR. Estrogen receptor-alpha mediates acute myocardial protection in females. Am J Physiol Heart Circ Physiol2006 Jun;290(6):H2204- 9. 227. Forster C, Kietz S, Hultenby K, Warner M, Gustafsson JA. Characterization of the ERbeta-/-mouse heart. Proc Natl Acad Sci U S A2004 Sep 28;101(39):14234-9. 228. Dubuc PU. Effects of estrogen on food intake, body weight, and temperature of male and female obese mice. Proc Soc Exp Biol Med1985 Dec;180(3):468-73. 229. Fisher C, Graves K, Parlow A, Simpson E. Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of the cyp19 gene. Medical Sciences1998;95:6965-70. 230. Jones ME, Thorburn AW, Britt KL, Hewitt KN, Wreford NG, Proietto J, et al. Aromatase-deficient (ArKO) mice have a phenotype of increased adiposity. Proc Natl Acad Sci U S A2000 Nov 7;97(23):12735-40. 231. Simpson E. Role of aromatase in sex steroid action. Journal of Molecular Endocrinology2000;25:149-56. 232. Carr M. The emergence of the metabolic syndrome with menopause. J Clin Endocrinol Metab2003;86(6):2404-11. 233. Flegal KM, Carroll MD, Kit BK, Ogden CL. Prevalence of Obesity and Trends in the Distribution of Body Mass Index Among US Adults, 1999-2010. JAMA2012 Jan 17.

148 234. Simpson E, Mahendroo M, Means G, Kilgore M, Hinshelwood M, Graham-Lorence S, et al. Aromatase cytochorme P450, the enzyme responsible for estrogen biosynthesis. Endocrine Review1994;15(3):342-55. 235. Simpson E. Sources of estrogen and thier importance. Journal of Steroid Biochemistry & Molecular Biology 2003;86:225-30. 236. Britt KL, Kerr J, O'Donnell L, Jones ME, Drummond AE, Davis SR, et al. Estrogen regulates development of the somatic cell phenotype in the eutherian ovary. Faseb J2002 Sep;16(11):1389-97. 237. Ropero AB, Alonso-Magdalena P, Quesada I, Nadal A. The role of estrogen receptors in the control of energy and glucose homeostasis. Steroids2008 Oct;73(9-10):874-9. 238. Laudenslager ML, Wilkinson CW, Carlisle HJ, Hammel HT. Energy balance in ovariectomized rats with and without estrogen replacement. Am J Physiol1980 May;238(5):R400-5. 239. Saengsirisuwan V, Pongseeda S, Prasannarong M, Vichaiwong K, Toskulkao C. Modulation of insulin resistance in ovariectomized rats by endurance exercise training and estrogen replacement. Metabolism. [doi: 10.1016/j.metabol.2008.08.004]. 2009;58(1):38-47. 240. Riant E, Waget A, Cogo H, Arnal JF, Burcelin R, Gourdy P. Estrogens protect against high-fat diet-induced insulin resistance and glucose intolerance in mice. Endocrinology2009 May;150(5):2109-17. 241. Mueller K, Hsiao S. Estrus- and ovariectomy-induced body weight changes: evidence for two estrogenic mechanisms. J Comp Physiol Psychol1980 Dec;94(6):1126-34. 242. Pedersen SB, Bruun JM, Kristensen K, Richelsen B. Regulation of UCP1, UCP2, and UCP3 mRNA expression in brown adipose tissue, white adipose tissue, and skeletal muscle in rats by estrogen. Biochem Biophys Res Commun2001 Oct 19;288(1):191-7. 243. Smith EP, Boyd J, Frank GR, Takahashi H, Cohen RM, Specker B, et al. Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. N Engl J Med1994 Oct 20;331(16):1056-61. 244. Morishima A, Grumbach MM, Simpson ER, Fisher C, Qin K. Aromatase deficiency in male and female siblings caused by a novel mutation and the physiological role of estrogens. J Clin Endocrinol Metab1995 Dec;80(12):3689-98. 245. Heine PA, Taylor JA, Iwamoto GA, Lubahn DB, Cooke PS. Increased adipose tissue in male and female estrogen receptor-alpha knockout mice. Proc Natl Acad Sci U S A2000 Nov 7;97(23):12729-34. 246. Ribas V, Nguyen MT, Henstridge DC, Nguyen AK, Beaven SW, Watt MJ, et al. Impaired Oxidative Metabolism and Inflammation are Associated with Insulin Resistance in ER{alpha} Deficient Mice. Am J Physiol Endocrinol Metab2009 Nov 17. 247. Bryzgalova G, Lundholm L, Portwood N, Gustafsson JA, Khan A, Efendic S, et al. Mechanisms of antidiabetogenic and body weight-lowering effects of estrogen in high-fat diet-fed mice. Am J Physiol Endocrinol Metab2008 Oct;295(4):E904-12. 248. Bonds D, Lasser N, Qi L, Brzyski R, Caan B, Heiss G, et al. The effect of conjugated equine oestrogen on diabetes incidence: the Women’s Health Initiative randomised trial. Diabetologia2006;49(3):459-68. 249. Regitz-Zagrosek V, Lehmkuhl E, Weickert MO. Gender differences in the metabolic syndrome and their role for cardiovascular disease. Clin Res Cardiol2006 Mar;95(3):136-47. 250. Frias JP, Macaraeg GB, Ofrecio J, Yu JG, Olefsky JM, Kruszynska YT. Decreased Susceptibility to Fatty Acid–Induced Peripheral Tissue Insulin Resistance in Women. Diabetes2001 June 1, 2001;50(6):1344-50.

149 251. Kuhl J, Hilding A, Östenson C, Grill V, Efendic S, Båvenholm P. Characterisation of subjects with early abnormalities of glucose tolerance in the Stockholm Diabetes Prevention Programme: the impact of sex and type 2 diabetes heredity. Diabetologia2005;48(1):35-40. 252. Kalyani RR, Franco M, Dobs AS, Ouyang P, Vaidya D, Bertoni A, et al. The association of endogenous sex hormones, adiposity, and insulin resistance with incident diabetes in postmenopausal women. J Clin Endocrinol Metab2009 Nov;94(11):4127-35. 253. Ding EL, Song Y, Manson JE, Rifai N, Buring JE, Liu S. Plasma sex steroid hormones and risk of developing type 2 diabetes in women: a prospective study. Diabetologia2007 Oct;50(10):2076-84. 254. Livingstone C, Collison M. Sex steroids and insulin resistance. Clin Sci (Lond)2002 Feb;102(2):151-66. 255. Fink RI, Huecksteadt T, Karaoghlanian Z. The effects of aging on glucose metabolism in adipocytes from Fischer rats. Endocrinology1986 Mar;118(3):1139-47. 256. Levy JR, Davenport B, Clore JN, Stevens W. Lipid metabolism and resistin gene expression in insulin-resistant Fischer 344 rats. Am J Physiol Endocrinol Metab2002 Mar;282(3):E626-33. 257. Levy JR, Lesko J, Krieg RJ, Jr., Adler RA, Stevens W. Leptin responses to glucose infusions in obesity-prone rats. Am J Physiol Endocrinol Metab2000 Nov;279(5):E1088-96. 258. Ruhe RC, Curry DL, Herrmann S, McDonald RB. Age and gender effects on insulin secretion and glucose sensitivity of the endocrine pancreas. Am J Physiol1992 Apr;262(4 Pt 2):R671-6. 259. Delp MD, Evans MV, Duan C. Effects of aging on cardiac output, regional blood flow, and body composition in Fischer-344 rats. J Appl Physiol1998 Nov;85(5):1813-22. 260. Docherty JR. Cardiovascular responses in ageing: a review. Pharmacol Rev1990 Jun;42(2):103-25. 261. Coleman GL, Barthold W, Osbaldiston GW, Foster SJ, Jonas AM. Pathological changes during aging in barrier-reared Fischer 344 male rats. J Gerontol1977 May;32(3):258-78. 262. Greising SM, Baltgalvis KA, Lowe DA, Warren GL. Hormone therapy and skeletal muscle strength: a meta-analysis. J Gerontol A Biol Sci Med Sci2009 Oct;64(10):1071-81. 263. Phillips SK, Rook KM, Siddle NC, Bruce SA, Woledge RC. Muscle weakness in women occurs at an earlier age than in men, but strength is preserved by hormone replacement therapy. Clin Sci (Lond)1993 Jan;84(1):95-8. 264. Vandervoort AA. Aging of the human neuromuscular system. Muscle Nerve2002 Jan;25(1):17-25. 265. Aagaard P, Magnusson PS, Larsson B, Kjaer M, Krustrup P. Mechanical muscle function, morphology, and fiber type in lifelong trained elderly. Med Sci Sports Exerc2007 Nov;39(11):1989-96. 266. Mercuro G, Saiu F, Deidda M, Mercuro S, Vitale C, Rosano GM. Impairment of physical exercise capacity in healthy postmenopausal women. Am Heart J2006 Apr;151(4):923-7. 267. Moreno M, Ordonez P, Alonso A, Diaz F, Tolivia J, Gonzalez C. Chronic 17beta- estradiol treatment improves skeletal muscle insulin signaling pathway components in insulin resistance associated with aging. Age (Dordr)2010 Mar;32(1):1-13. 268. Gould GW, Holman GD. The glucose transporter family: structure, function and tissue- specific expression. Biochem J1993 Oct 15;295 ( Pt 2):329-41. 269. Long SD, Pekala PH. Lipid mediators of insulin resistance: ceramide signalling down- regulates GLUT4 gene transcription in 3T3-L1 adipocytes. Biochem J1996 Oct 1;319 ( Pt 1):179- 84.

150 270. Kaestner KH, Christy RJ, Lane MD. Mouse insulin-responsive glucose transporter gene: characterization of the gene and trans-activation by the CCAAT/enhancer binding protein. Proceedings of the National Academy of Sciences1990 January 1, 1990;87(1):251-5. 271. Ruan H, Hacohen N, Golub TR, Van Parijs L, Lodish HF. Tumor necrosis factor-alpha suppresses adipocyte-specific genes and activates expression of preadipocyte genes in 3T3-L1 adipocytes: nuclear factor-kappaB activation by TNF-alpha is obligatory. Diabetes2002 May;51(5):1319-36. 272. Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, et al. Mechanisms of estrogen action. Physiol Rev2001 Oct;81(4):1535-65. 273. Baltgalvis KA, Greising SM, Warren GL, Lowe DA. Estrogen regulates estrogen receptors and antioxidant gene expression in mouse skeletal muscle. PLoS One2010;5(4):e10164. 274. Crespo CJ, Smit E, Snelling A, Sempos CT, Andersen RE. Hormone Replacement Therapy and Its Relationship to Lipid and Glucose Metabolism in Diabetic and Nondiabetic Postmenopausal Women. Diabetes Care2002 October 1, 2002;25(10):1675-80. 275. Nuutila P, Knuuti MJ, Maki M, Laine H, Ruotsalainen U, Teras M, et al. Gender and insulin sensitivity in the heart and in skeletal muscles. Studies using positron emission tomography. Diabetes1995 Jan;44(1):31-6. 276. Wade GN, Gray JM. Cytoplasmic 17 beta-[3H]estradiol binding in rat adipose tissues. Endocrinology1978 Nov;103(5):1695-701. 277. Gray JM, Dudley SD, Wade GN. In vivo cell nuclear binding of 17 beta-[3H]estradiol in rat adipose tissues. Am J Physiol1981 Jan;240(1):E43-6. 278. Pedersen SB, Borglum JD, Eriksen EF, Richelsen B. Nuclear estradiol binding in rat adipocytes. Regional variations and regulatory influences of hormones. Biochim Biophys Acta1991 Jun 7;1093(1):80-6. 279. Pedersen S, Bruun J, Hube F, Kristensen K, Hauner H, Richelsen B. Demonstration of estrogen receptor subtypes α and β in human adipose tissue: influences of adipose cell differentiation and fat depot localization. Molecular and Cellular Endocrinology2001;182:27-37. 280. Price T, O'Brien S. Determination of estrogen receptor messenger ribonucleic acid (mRNA) and cytochrome P450 aromatase mRNA levels in adipocytes and adipose stromal cells by competitive polymerase chain reaction amplification. J Clin Endocrinol Metab1993;77:1041- 5. 281. Mizutani T, Nishikawa Y, Adachi H, Enomoto T, Ikegami H, Kurachi H, et al. Identification of estrogen receptor in human adipose tissue and adipocytes. J Clin Endocrinol Metab1994 Apr;78(4):950-4. 282. Hamosh M, Hamosh P. The effect of estrogen on the lipoprotein lipase activity of rat adipose tissue. The Journal of Clinical Investigation1975;55(5):1132-5. 283. Poehlman ET, Toth MJ, Gardner AW. Changes in energy balance and body composition at menopause: a controlled longitudinal study. Ann Intern Med1995 Nov 1;123(9):673-5. 284. Barros RP, Machado UF, Gustafsson JA. Estrogen receptors: new players in diabetes mellitus. Trends Mol Med2006 Sep;12(9):425-31. 285. Regitz-Zagrosek V, Lehmkuhl E, Weickert M. Gender differences in the metabolic syndrome and their role for cardiovascular disease. Clinical Research in Cardiology2006;95(3):136-47. 286. Steinbaum SR. The metabolic syndrome: an emerging health epidemic in women. Prog Cardiovasc Dis2004 Jan-Feb;46(4):321-36. 287. Berthoud HR, Morrison C. The brain, appetite, and obesity. Annu Rev Psychol2008;59:55-92.

151 288. Wang Y, Beydoun MA, Liang L, Caballero B, Kumanyika SK. Will all Americans become overweight or obese? estimating the progression and cost of the US obesity epidemic. Obesity (Silver Spring)2008 Oct;16(10):2323-30. 289. Price TM, O'Brien SN, Welter BH, George R, Anandjiwala J, Kilgore M. Estrogen regulation of adipose tissue lipoprotein lipase--Possible mechanism of body fat distribution. American Journal of Obstetrics and Gynecology1998;178(1, Part 1):101-7. 290. Iverius PH, Brunzell JD. Relationship between lipoprotein lipase activity and plasma sex steroid level in obese women. J Clin Invest1988 Sep;82(3):1106-12. 291. Barrett-Connor E, Bush TL. Estrogen and coronary heart disease in women. JAMA1991 Apr 10;265(14):1861-7. 292. Lagranha CJ, Deschamps A, Aponte A, Steenbergen C, Murphy E. Sex differences in the phosphorylation of mitochondrial proteins result in reduced production of reactive oxygen species and cardioprotection in females. Circ Res2010 Jun 11;106(11):1681-91. 293. Booth EA, Marchesi M, Kilbourne EJ, Lucchesi BR. 17Beta-estradiol as a receptor- mediated cardioprotective agent. J Pharmacol Exp Ther2003 Oct;307(1):395-401. 294. Hale SL, Birnbaum Y, Kloner RA. beta-Estradiol, but not alpha-estradiol, reduced myocardial necrosis in rabbits after ischemia and reperfusion. Am Heart J1996 Aug;132(2 Pt 1):258-62. 295. Hale SL, Birnbaum Y, Kloner RA. Estradiol, Administered Acutely, Protects Ischemic Myocardium in Both Female and Male Rabbits. J Cardiovasc Pharmacol Ther1997 Jan;2(1):47- 52. 296. Das B, Sarkar C. Similarities between ischemic preconditioning and 17beta-estradiol mediated cardiomyocyte KATP channel activation leading to cardioprotective and antiarrhythmic effects during ischemia/reperfusion in the intact rabbit heart. J Cardiovasc Pharmacol2006 Feb;47(2):277-86. 297. Sbarouni E, Iliodromitis EK, Bofilis E, Kyriakides ZS, Kremastinos DT. Estrogen alone or combined with medroxyprogesterone but not raloxifene reduce myocardial infarct size. Eur J Pharmacol2003 Apr 25;467(1-3):163-8. 298. Bae S, Zhang L. Gender differences in cardioprotection against ischemia/reperfusion injury in adult rat hearts: focus on Akt and protein kinase C signaling. J Pharmacol Exp Ther2005 Dec;315(3):1125-35. 299. Hunter JC, Kostyak JC, Novotny JL, Simpson AM, Korzick DH. Estrogen deficiency decreases ischemic tolerance in the aged rat heart: Roles of PKCdelta, PKCepsilon, Akt, and GSK3beta. Am J Physiol Regul Integr Comp Physiol2007 Feb;292(2):R800-9. 300. Xu Y, Arenas IA, Armstrong SJ, Davidge ST. Estrogen modulation of left ventricular remodeling in the aged heart. Cardiovasc Res2003 Feb;57(2):388-94. 301. Zhai P, Eurell TE, Cotthaus R, Jeffery EH, Bahr JM, Gross DR. Effect of estrogen on global myocardial ischemia-reperfusion injury in female rats. Am J Physiol Heart Circ Physiol2000 Dec;279(6):H2766-75. 302. Wang M, Tsai BM, Reiger KM, Brown JW, Meldrum DR. 17-beta-Estradiol decreases p38 MAPK-mediated myocardial inflammation and dysfunction following acute ischemia. J Mol Cell Cardiol2006 Feb;40(2):205-12. 303. Kolodgie FD, Farb A, Litovsky SH, Narula J, Jeffers LA, Lee SJ, et al. Myocardial protection of contractile function after global ischemia by physiologic estrogen replacement in the ovariectomized rat. J Mol Cell Cardiol1997 Sep;29(9):2403-14. 304. Falkeborn M, Persson I, Adami HO, Bergstrom R, Eaker E, Lithell H, et al. The risk of acute myocardial infarction after oestrogen and oestrogen-progestogen replacement. Br J Obstet Gynaecol1992 Oct;99(10):821-8.

152 305. Grodstein F, Manson JE, Colditz GA, Willett WC, Speizer FE, Stampfer MJ. A prospective, observational study of postmenopausal hormone therapy and primary prevention of cardiovascular disease. Ann Intern Med2000 Dec 19;133(12):933-41. 306. Stampfer MJ, Colditz GA, Willett WC, Manson JE, Rosner B, Speizer FE, et al. Postmenopausal estrogen therapy and cardiovascular disease. Ten-year follow-up from the nurses' health study. N Engl J Med1991 Sep 12;325(11):756-62. 307. Stampfer MJ, Colditz GA. Estrogen replacement therapy and coronary heart disease: a quantitative assessment of the epidemiologic evidence. Prev Med1991 Jan;20(1):47-63. 308. Trial TWGftP. Effects of estrogen or estrogen/progestin regimens on heart disease risk factors in postmenopausal women. JAMA1995;273(3):199-208. 309. Miller MM, Tousignant P, Yang U, Pedvis S, Billiar RB. Effects of age and long-term ovariectomy on the estrogen-receptor containing subpopulations of beta-endorphin- immunoreactive neurons in the arcuate nucleus of female C57BL/6J mice. Neuroendocrinology1995 May;61(5):542-51. 310. Heiss G, Wallace R, Anderson GL, Aragaki A, Beresford SA, Brzyski R, et al. Health risks and benefits 3 years after stopping randomized treatment with estrogen and progestin. JAMA2008 Mar 5;299(9):1036-45. 311. Miller VM, Black DM, Brinton EA, Budoff MJ, Cedars MI, Hodis HN, et al. Using basic science to design a clinical trial: baseline characteristics of women enrolled in the Kronos Early Estrogen Prevention Study (KEEPS). J Cardiovasc Transl Res2009 Sep;2(3):228-39. 312. Harman SM, Brinton EA, Cedars M, Lobo R, Manson JE, Merriam GR, et al. KEEPS: The Kronos Early Estrogen Prevention Study. Climacteric2005 Mar;8(1):3-12. 313. Kajstura J, Cheng W, Sarangarajan R, Li P, Li B, Nitahara JA, et al. Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am J Physiol1996 Sep;271(3 Pt 2):H1215-28. 314. Zhang Y, Chong E, Herman B. Age-associated increases in the activity of multiple caspases in Fisher 344 rat organs. Exp Gerontol2002 Jun;37(6):777-89. 315. Tani M, Honma Y, Hasegawa H, Tamaki K. Direct activation of mitochondrial K(ATP) channels mimics preconditioning but protein kinase C activation is less effective in middle-aged rat hearts. Cardiovasc Res2001 Jan;49(1):56-68. 316. Schulman D, Latchman DS, Yellon DM. Effect of aging on the ability of preconditioning to protect rat hearts from ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol2001 Oct;281(4):H1630-6. 317. Pepe S. Dysfunctional ischemic preconditioning mechanisms in aging. Cardiovasc Res2001 Jan;49(1):11-4. 318. Mariani J, Ou R, Bailey M, Rowland M, Nagley P, Rosenfeldt F, et al. Tolerance to ischemia and hypoxia is reduced in aged human myocardium. J Thorac Cardiovasc Surg2000 Oct;120(4):660-7. 319. Willems L, Zatta A, Holmgren K, Ashton KJ, Headrick JP. Age-related changes in ischemic tolerance in male and female mouse hearts. Journal of Molecular and Cellular Cardiology2005;38(2):245. 320. Liu P, Xu B, Cavalieri TA, Hock CE. Age-related difference in myocardial function and inflammation in a rat model of myocardial ischemia-reperfusion. Cardiovascular research2002;56(3):443. 321. Azhar G, Gao W, Liu L, Wei JY. Ischemia-reperfusion in the adult mouse heart influence of age. Exp Gerontol1999 Aug;34(5):699-714. 322. Wei YH. Mitochondrial DNA alterations as ageing-associated molecular events. Mutat Res1992 Sep;275(3-6):145-55.

153 323. Liu L, Azhar G, Gao W, Zhang X, Wei JY. Bcl-2 and Bax expression in adult rat hearts after coronary occlusion: age-associated differences. Am J Physiol1998 Jul;275(1 Pt 2):R315-22. 324. Juhaszova M, Rabuel C, Zorov DB, Lakatta EG, Sollott SJ. Protection in the aged heart: preventing the heart-break of old age? Cardiovasc Res2005 May 1;66(2):233-44. 325. Fenton RA, Dickson EW, Dobson JG, Jr. Inhibition of phosphatase activity enhances preconditioning and limits cell death in the ischemic/reperfused aged rat heart. Life Sci2005 Nov 12;77(26):3375-88. 326. Fenton RA, Dickson EW, Meyer TE, Dobson JG, Jr. Aging reduces the cardioprotective effect of ischemic preconditioning in the rat heart. J Mol Cell Cardiol2000 Jul;32(7):1371-5. 327. Nilsson S, Gustafsson JA. Estrogen receptors: therapies targeted to receptor subtypes. Clin Pharmacol Ther2011 Jan;89(1):44-55. 328. Peter I, Shearman AM, Vasan RS, Zucker DR, Schmid CH, Demissie S, et al. Association of estrogen receptor beta gene polymorphisms with left ventricular mass and wall thickness in women. Am J Hypertens2005 Nov;18(11):1388-95. 329. Pelzer T, Jazbutyte V, Hu K, Segerer S, Nahrendorf M, Nordbeck P, et al. The estrogen receptor-α agonist 16α-LE2 inhibits cardiac hypertrophy and improves hemodynamic function in estrogen-deficient spontaneously hypertensive rats. Cardiovascular Research2005 September 1, 2005;67(4):604-12. 330. Babiker FA, Lips D, Meyer R, Delvaux E, Zandberg P, Janssen B, et al. Estrogen receptor beta protects the murine heart against left ventricular hypertrophy. Arterioscler Thromb Vasc Biol2006 Jul;26(7):1524-30. 331. Jankowski M, Rachelska G, Donghao W, McCann SM, Gutkowska J. Estrogen receptors activate atrial natriuretic peptide in the rat heart. Proc Natl Acad Sci U S A2001 Sep 25;98(20):11765-70. 332. Yang SH, Liu R, Perez EJ, Wen Y, Stevens SM, Jr., Valencia T, et al. Mitochondrial localization of estrogen receptor beta. Proc Natl Acad Sci U S A2004 Mar 23;101(12):4130-5. 333. Schwend T, Gustafsson JA. False positives in MALDI-TOF detection of ERbeta in mitochondria. Biochem Biophys Res Commun2006 May 12;343(3):707-11. 334. Nilsson S, Koehler KF, Gustafsson JA. Development of subtype-selective oestrogen receptor-based therapeutics. Nat Rev Drug Discov2011 Oct;10(10):778-92. 335. Nuedling S, Karas RH, Mendelsohn ME, Katzenellenbogen JA, Katzenellenbogen BS, Meyer R, et al. Activation of estrogen receptor [beta] is a prerequisite for estrogen-dependent upregulation of nitric oxide synthases in neonatal rat cardiac myocytes. FEBS Letters2001;502(3):103-8. 336. Zhu Y, Bian Z, Lu P, Karas RH, Bao L, Cox D, et al. Abnormal vascular function and hypertension in mice deficient in estrogen receptor beta. Science2002 Jan 18;295(5554):505-8. 337. Skavdahl M, Steenbergen C, Clark J, Myers P, Demianenko T, Mao L, et al. Estrogen receptor-beta mediates male-female differences in the development of pressure overload hypertrophy. Am J Physiol Heart Circ Physiol2005 Feb;288(2):H469-76. 338. Fliegner D, Schubert C, Penkalla A, Witt H, Kararigas G, Dworatzek E, et al. Female sex and estrogen receptor-beta attenuate cardiac remodeling and apoptosis in pressure overload. Am J Physiol Regul Integr Comp Physiol2010 Jun;298(6):R1597-606. 339. Register TC, Adams MR. Coronary artery and cultured aortic smooth muscle cells express mRNA for both the classical estrogen receptor and the newly described estrogen receptor beta. J Steroid Biochem Mol Biol1998 Feb;64(3-4):187-91. 340. Tsutsumi S, Zhang X, Takata K, Takahashi K, Karas RH, Kurachi H, et al. Differential regulation of the inducible nitric oxide synthase gene by estrogen receptors 1 and 2. J Endocrinol2008 Nov;199(2):267-73.

154 341. Ihionkhan CE, Chambliss KL, Gibson LL, Hahner LD, Mendelsohn ME, Shaul PW. Estrogen causes dynamic alterations in endothelial estrogen receptor expression. Circ Res2002 Nov 1;91(9):814-20. 342. Brinckmann M, Kaschina E, Altarche-Xifro W, Curato C, Timm M, Grzesiak A, et al. Estrogen receptor alpha supports cardiomyocytes indirectly through post-infarct cardiac c-kit+ cells. J Mol Cell Cardiol2009 Jul;47(1):66-75. 343. Camper-Kirby D, Welch S, Walker A, Shiraishi I, Setchell KD, Schaefer E, et al. Myocardial Akt activation and gender: increased nuclear activity in females versus males. Circ Res2001 May 25;88(10):1020-7. 344. Arias-Loza PA, Hu K, Dienesch C, Mehlich AM, Konig S, Jazbutyte V, et al. Both estrogen receptor subtypes, alpha and beta, attenuate cardiovascular remodeling in aldosterone salt-treated rats. Hypertension2007 Aug;50(2):432-8. 345. Shih CD. Activation of estrogen receptor beta-dependent nitric oxide signaling mediates the hypotensive effects of estrogen in the rostral ventrolateral medulla of anesthetized rats. J Biomed Sci2009;16:60. 346. Friedman JM. A war on obesity, not the obese. Science2003 Feb 7;299(5608):856-8. 347. Reilly MP, Rader DJ. The metabolic syndrome: more than the sum of its parts? Circulation2003 Sep 30;108(13):1546-51. 348. Orlander PR, Goff DC, Morrissey M, Ramsey DJ, Wear ML, Labarthe DR, et al. The relation of diabetes to the severity of acute myocardial infarction and post-myocardial infarction survival in Mexican-Americans and non-Hispanic whites. The Corpus Christi Heart Project. Diabetes1994 Jul;43(7):897-902. 349. Wolk R, Berger P, Lennon RJ, Brilakis ES, Somers VK. Body mass index: a risk factor for unstable angina and myocardial infarction in patients with angiographically confirmed coronary artery disease. Circulation2003 Nov 4;108(18):2206-11. 350. von Eynatten M, Humpert PM, Bluemm A, Lepper PM, Hamann A, Allolio B, et al. High-molecular weight adiponectin is independently associated with the extent of coronary artery disease in men. Atherosclerosis2008 Jul;199(1):123-8. 351. Shinmura K, Tamaki K, Bolli R. Short-term caloric restriction improves ischemic tolerance independent of opening of ATP-sensitive K+ channels in both young and aged hearts. J Mol Cell Cardiol2005 Aug;39(2):285-96. 352. Gonzalez AA, Kumar R, Mulligan JD, Davis AJ, Saupe KW. Effects of aging on cardiac and skeletal muscle AMPK activity: basal activity, allosteric activation, and response to in vivo hypoxemia in mice. Am J Physiol Regul Integr Comp Physiol2004 November 1, 2004;287(5):R1270-5. 353. Li R, Xu M, Wang X, Wang Y, Lau WB, Yuan Y, et al. Reduced vascular responsiveness to adiponectin in hyperlipidemic rats--mechanisms and significance. J Mol Cell Cardiol2010 Sep;49(3):508-15. 354. Shibata R, Sato K, Pimentel DR, Takemura Y, Kihara S, Ohashi K, et al. Adiponectin protects against myocardial ischemia-reperfusion injury through AMPK- and COX-2-dependent mechanisms. Nat Med2005 Oct;11(10):1096-103. 355. Kondo K, Shibata R, Unno K, Shimano M, Ishii M, Kito T, et al. Impact of a single intracoronary administration of adiponectin on myocardial ischemia/reperfusion injury in a pig model. Circ Cardiovasc Interv2010 Apr;3(2):166-73. 356. Debinski M, Buszman PP, Milewski K, Wojakowski W, Jackiewicz W, Pajak J, et al. Intracoronary adiponectin at reperfusion reduces infarct size in a porcine myocardial infarction model. Int J Mol Med2011 Jun;27(6):775-81.

155 357. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun1996 Apr 16;221(2):286-9. 358. Nakano Y, Tobe T, Choi-Miura NH, Mazda T, Tomita M. Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J Biochem1996 Oct;120(4):803-12. 359. Suzuki S, Wilson-Kubalek EM, Wert D, Tsao TS, Lee DH. The oligomeric structure of high molecular weight adiponectin. FEBS Lett2007 Mar 6;581(5):809-14. 360. Kishore U, Gaboriaud C, Waters P, Shrive AK, Greenhough TJ, Reid KBM, et al. C1q and tumor necrosis factor superfamily: modularity and versatility. Trends in Immunology. [doi: 10.1016/j.it.2004.08.006]. 2004;25(10):551-61. 361. Shapiro L, Scherer PE. The crystal structure of a complement-1q family protein suggests an evolutionary link to tumor necrosis factor. Curr Biol1998 Mar 12;8(6):335-8. 362. Kishore U, Reid KB. C1q: structure, function, and receptors. Immunopharmacology2000 Aug;49(1-2):159-70. 363. Rouen PA, Lukacs JL, Reame NE. Adipokine concentrations in nonobese women: a study of reproductive aging, body mass index, and menstrual cycle effects. Biol Res Nurs2010 Jul;12(1):54-61. 364. Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J, et al. Adiponectin gene expression and secretion is inhibited by interleukin-6 in 3T3-L1 adipocytes. Biochem Biophys Res Commun2003 Feb 21;301(4):1045-50. 365. Ouchi N, Kihara S, Funahashi T, Matsuzawa Y, Walsh K. Obesity, adiponectin and vascular inflammatory disease. Curr Opin Lipidol2003 Dec;14(6):561-6. 366. Kwon K, Jung SH, Choi C, Park SH. Reciprocal association between visceral obesity and adiponectin: in healthy premenopausal women. Int J Cardiol2005 Jun 8;101(3):385-90. 367. Tsao TS, Tomas E, Murrey HE, Hug C, Lee DH, Ruderman NB, et al. Role of disulfide bonds in Acrp30/adiponectin structure and signaling specificity. Different oligomers activate different signal transduction pathways. J Biol Chem2003 Dec 12;278(50):50810-7. 368. Liu M, Zhou L, Xu A, Lam KS, Wetzel MD, Xiang R, et al. A disulfide-bond A oxidoreductase-like protein (DsbA-L) regulates adiponectin multimerization. Proc Natl Acad Sci U S A2008 Nov 25;105(47):18302-7. 369. Frizzell N, Rajesh M, Jepson MJ, Nagai R, Carson JA, Thorpe SR, et al. Succination of thiol groups in adipose tissue proteins in diabetes: succination inhibits polymerization and secretion of adiponectin. J Biol Chem2009 Sep 18;284(38):25772-81. 370. Wang ZV, Schraw TD, Kim JY, Khan T, Rajala MW, Follenzi A, et al. Secretion of the adipocyte-specific secretory protein adiponectin critically depends on thiol-mediated protein retention. Mol Cell Biol2007 May;27(10):3716-31. 371. Kishida K, Nagaretani H, Kondo H, Kobayashi H, Tanaka S, Maeda N, et al. Disturbed secretion of mutant adiponectin associated with the metabolic syndrome. Biochem Biophys Res Commun2003 Jun 20;306(1):286-92. 372. Wang Y, Lam KS, Yau MH, Xu A. Post-translational modifications of adiponectin: mechanisms and functional implications. Biochem J2008 Feb 1;409(3):623-33. 373. Qiang L, Wang H, Farmer SR. Adiponectin secretion is regulated by SIRT1 and the endoplasmic reticulum oxidoreductase Ero1-L alpha. Mol Cell Biol2007 Jul;27(13):4698-707. 374. Anelli T, Alessio M, Bachi A, Bergamelli L, Bertoli G, Camerini S, et al. Thiol-mediated protein retention in the endoplasmic reticulum: the role of ERp44. EMBO J2003 Oct 1;22(19):5015-22.

156 375. Wang Y, Xu A, Knight C, Xu LY, Cooper GJ. Hydroxylation and glycosylation of the four conserved lysine residues in the collagenous domain of adiponectin. Potential role in the modulation of its insulin-sensitizing activity. J Biol Chem2002 May 31;277(22):19521-9. 376. Richards AA, Stephens T, Charlton HK, Jones A, Macdonald GA, Prins JB, et al. Adiponectin multimerization is dependent on conserved lysines in the collagenous domain: evidence for regulation of multimerization by alterations in posttranslational modifications. Mol Endocrinol2006 Jul;20(7):1673-87. 377. Kobayashi H, Ouchi N, Kihara S, Walsh K, Kumada M, Abe Y, et al. Selective Suppression of Endothelial Cell Apoptosis by the High Molecular Weight Form of Adiponectin. Circ Res2004 March 5, 2004;94(4):e27-31. 378. Hug C, Wang J, Ahmad NS, Bogan JS, Tsao TS, Lodish HF. T-cadherin is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc Natl Acad Sci U S A2004 Jul 13;101(28):10308-13. 379. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, et al. Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci U S A2001 Feb 13;98(4):2005-10. 380. Fisher FFM, Trujillo ME, Hanif W, Barnett AH, McTernan PG, Scherer PE, et al. Serum high molecular weight complex of adiponectin correlates better with glucose tolerance than total serum adiponectin in Indo-Asian males. Diabetologia2005;48(6):1084. 381. Kaser S, Tatarczyk T, Stadlmayr A, Ciardi C, Ress C, Tschoner A, et al. Effect of obesity and insulin sensitivity on adiponectin isoform distribution. Eur J Clin Invest2008 Nov;38(11):827-34. 382. Hara K, Horikoshi M, Yamauchi T, Yago H, Miyazaki O, Ebinuma H, et al. Measurement of the high-molecular weight form of adiponectin in plasma is useful for the prediction of insulin resistance and metabolic syndrome. Diabetes Care2006 Jun;29(6):1357-62. 383. El-Menyar A, Rizk N, Al Nabti AD, Hassira SA, Singh R, Abdel Rahman MO, et al. Total and high molecular weight adiponectin in patients with coronary artery disease. J Cardiovasc Med (Hagerstown)2009 Apr;10(4):310-5. 384. Crandall DL, Busler DE, Novak TJ, Weber RV, Kral JG. Identification of estrogen receptor beta RNA in human breast and abdominal subcutaneous adipose tissue. Biochem Biophys Res Commun1998 Jul 30;248(3):523-6. 385. Okuno A, Tamemoto H, Tobe K, Ueki K, Mori Y, Iwamoto K, et al. Troglitazone increases the number of small adipocytes without the change of white adipose tissue mass in obese Zucker rats. J Clin Invest1998 Mar 15;101(6):1354-61. 386. Barroso I, Gurnell M, Crowley VE, Agostini M, Schwabe JW, Soos MA, et al. Dominant negative mutations in human PPARgamma associated with severe insulin resistance, diabetes mellitus and hypertension. Nature1999 Dec 23-30;402(6764):880-3. 387. Guerre-Millo M, Gervois P, Raspe E, Madsen L, Poulain P, Derudas B, et al. Peroxisome proliferator-activated receptor alpha activators improve insulin sensitivity and reduce adiposity. J Biol Chem2000 Jun 2;275(22):16638-42. 388. Combs TP, Wagner JA, Berger J, Doebber T, Wang W-J, Zhang BB, et al. Induction of Adipocyte Complement-Related Protein of 30 Kilodaltons by PPAR{gamma} Agonists: A Potential Mechanism of Insulin Sensitization. Endocrinology2002 March 1, 2002;143(3):998- 1007. 389. Long Q, Lei T, Feng B, Yin C, Jin D, Wu Y, et al. Peroxisome proliferator-activated receptor-gamma increases adiponectin secretion via transcriptional repression of endoplasmic reticulum chaperone protein ERp44. Endocrinology2010 Jul;151(7):3195-203. 390. Dieudonne M, Sammari A, Santos E, Leneveu M, Giudicelli Y, Pecquery R. Sex steroids and leptin regulate 11β-hydroxysteroid dehydrogenase I and P450 aromatase expressions in

157 human preadipocytes: sex specificities. Journal of Steroid Biochemistry & Molecular Biology2006;99:189-96. 391. Sieminska L, Wojciechowska C, Niedziolka D, Marek B, Kos-Kudla B, Kajdaniuk D, et al. Effect of postmenopause and hormone replacement therapy on serum adiponectin levels. Metabolism2005 Dec;54(12):1610-4. 392. Kleiblova P, Springer D, Haluzik M. The influence of hormonal changes during menstrual cycle on serum adiponectin concentrations in healthy women. Physiol Res2006;55(6):661-6. 393. Jurimae J, Jurimae T. Plasma adiponectin concentration in healthy pre- and postmenopausal women: relationship with body composition, bone mineral, and metabolic variables. Am J Physiol Endocrinol Metab2007 July 1, 2007;293(1):E42-7. 394. Mitsuhashi H, Yatsuya H, Tamakoshi K, Matsushita K, Otsuka R, Wada K, et al. Adiponectin level and left ventricular hypertrophy in Japanese men. Hypertension2007 Jun;49(6):1448-54. 395. Takefuji S, Yatsuya H, Tamakoshi K, Otsuka R, Wada K, Matsushita K, et al. Smoking status and adiponectin in healthy Japanese men and women. Prev Med2007 Dec;45(6):471-5. 396. Tamakoshi K, Yatsuya H, Wada K, Matsushita K, Otsuka R, Yang PO, et al. The transition to menopause reinforces adiponectin production and its contribution to improvement of insulin-resistant state. Clin Endocrinol (Oxf)2007 Jan;66(1):65-71. 397. Kunnari A, Santaniemi M, Jokela M, Karjalainen AH, Heikkinen J, Ukkola O, et al. Estrogen replacement therapy decreases plasma adiponectin but not resistin in postmenopausal women. Metabolism2008 Nov;57(11):1509-15. 398. Leung KC, Xu A, Craig ME, Martin A, Lam KS, O'Sullivan AJ. Adiponectin isoform distribution in women--relationship to female sex steroids and insulin sensitivity. Metabolism2009 Feb;58(2):239-45. 399. Laughlin GA, Barrett-Connor E, May S. Sex-specific determinants of serum adiponectin in older adults: the role of endogenous sex hormones. Int J Obes (Lond)2007 Mar;31(3):457-65. 400. Xu A, Chan KW, Hoo RL, Wang Y, Tan KC, Zhang J, et al. Testosterone selectively reduces the high molecular weight form of adiponectin by inhibiting its secretion from adipocytes. J Biol Chem2005 May 6;280(18):18073-80. 401. Peake PW, Kriketos AD, Campbell LV, Shen Y, Charlesworth JA. The metabolism of isoforms of human adiponectin: studies in human subjects and in experimental animals. Eur J Endocrinol2005 Sep;153(3):409-17. 402. Böttner A, Kratzsch J, Müller G, Kapellen TM, Blüher S, Keller E, et al. Gender Differences of Adiponectin Levels Develop during the Progression of Puberty and Are Related to Serum Androgen Levels. Journal of Clinical Endocrinology & Metabolism2004 August 1, 2004;89(8):4053-61. 403. Lee CG, Carr MC, Murdoch SJ, Mitchell E, Woods NF, Wener MH, et al. Adipokines, inflammation, and visceral adiposity across the menopausal transition: a prospective study. J Clin Endocrinol Metab2009 Apr;94(4):1104-10. 404. Henneman P, Janssens AC, Zillikens MC, Frolich M, Frants RR, Oostra BA, et al. Menopause impacts the relation of plasma adiponectin levels with the metabolic syndrome. J Intern Med2010 Apr;267(4):402-9. 405. Tabara Y, Osawa H, Kawamoto R, Tachibana-Iimori R, Yamamoto M, Nakura J, et al. Reduced high-molecular-weight adiponectin and elevated high-sensitivity C-reactive protein are synergistic risk factors for metabolic syndrome in a large-scale middle-aged to elderly population: the Shimanami Health Promoting Program Study. J Clin Endocrinol Metab2008 Mar;93(3):715- 22.

158 406. Miyatani Y, Yasui T, Uemura H, Yamada M, Matsuzaki T, Kuwahara A, et al. Associations of circulating adiponectin with estradiol and monocyte chemotactic protein-1 in postmenopausal women. Menopause2008 May-Jun;15(3):536-41. 407. Tworoger SS, Mantzoros C, Hankinson SE. Relationship of plasma adiponectin with sex hormone and insulin-like growth factor levels. Obesity (Silver Spring)2007 Sep;15(9):2217-24. 408. Combs TP, Berg AH, Rajala MW, Klebanov S, Iyengar P, Jimenez-Chillaron JC, et al. Sexual differentiation, pregnancy, calorie restriction, and aging affect the adipocyte-specific secretory protein adiponectin. Diabetes2003 Feb;52(2):268-76. 409. Tomicek NJ, Lancaster TS, Korzick DH. Increased Estrogen Receptor beta in Adipose Tissue Is Associated With Increased Intracellular and Reduced Circulating Adiponectin Protein Levels in Aged Female Rats. Gend Med2011 Jul 20. 410. Dafopoulos K, Sourlas D, Kallitsaris A, Pournaras S, Messinis IE. Blood ghrelin, resistin, and adiponectin concentrations during the normal menstrual cycle. Fertil Steril2009 Oct;92(4):1389-94. 411. Horenburg S, Fischer-Posovszky P, Debatin KM, Wabitsch M. Influence of sex hormones on adiponectin expression in human adipocytes. Horm Metab Res2008 Nov;40(11):779-86. 412. D'Eon TM, Souza SC, Aronovitz M, Obin MS, Fried SK, Greenberg AS. Estrogen regulation of adiposity and fuel partitioning. Evidence of genomic and non-genomic regulation of lipogenic and oxidative pathways. J Biol Chem2005 Oct 28;280(43):35983-91. 413. Kizer JR, Arnold AM, Strotmeyer ES, Ives DG, Cushman M, Ding J, et al. Change in circulating adiponectin in advanced old age: determinants and impact on physical function and mortality. The Cardiovascular Health Study All Stars Study. J Gerontol A Biol Sci Med Sci2010 Nov;65(11):1208-14. 414. Bik W, Baranowska-Bik A, Wolinska-Witort E, Martynska L, Chmielowska M, Szybinska A, et al. The relationship between adiponectin levels and metabolic status in centenarian, early elderly, young and obese women. Neuro Endocrinol Lett2006 Aug;27(4):493- 500. 415. Sattar N, Watt P, Cherry L, Ebrahim S, Davey Smith G, Lawlor DA. High molecular weight adiponectin is not associated with incident coronary heart disease in older women: a nested prospective case-control study. J Clin Endocrinol Metab2008 May;93(5):1846-9. 416. Pischon T, Hu FB, Girman CJ, Rifai N, Manson JE, Rexrode KM, et al. Plasma total and high molecular weight adiponectin levels and risk of coronary heart disease in women. Atherosclerosis2011 Nov;219(1):322-9. 417. Hong SC, Yoo SW, Cho GJ, Kim T, Hur JY, Park YK, et al. Correlation between estrogens and serum adipocytokines in premenopausal and postmenopausal women. Menopause2007 Sep-Oct;14(5):835-40. 418. Nishizawa H, Shimomura I, Kishida K, Maeda N, Kuriyama H, Nagaretani H, et al. Androgens decrease plasma adiponectin, an insulin-sensitizing adipocyte-derived protein. Diabetes2002 Sep;51(9):2734-41. 419. Denzel MS, Scimia MC, Zumstein PM, Walsh K, Ruiz-Lozano P, Ranscht B. T-cadherin is critical for adiponectin-mediated cardioprotection in mice. J Clin Invest2010 Dec 1;120(12):4342-52. 420. Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors. Endocr Rev2005 May;26(3):439-51. 421. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature. [Article]. 2003;423(6941):762.

159 422. Garitaonandia I, Smith JL, Kupchak BR, Lyons TJ. Adiponectin identified as an agonist for PAQR3/RKTG using a yeast-based assay system. J Recept Signal Transduct Res2009;29(1):67-73. 423. Tang YT, Hu T, Arterburn M, Boyle B, Bright JM, Emtage PC, et al. PAQR proteins: a novel membrane receptor family defined by an ancient 7-transmembrane pass motif. J Mol Evol2005 Sep;61(3):372-80. 424. Yamauchi T, Nio Y, Maki T, Kobayashi M, Takazawa T, Iwabu M, et al. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat Med2007 Mar;13(3):332-9. 425. Beylot M, Pinteur C, Peroni O. Expression of the adiponectin receptors AdipoR1 and AdipoR2 in lean rats and in obese Zucker rats. Metabolism2006 Mar;55(3):396-401. 426. Bauer S, Weigert J, Neumeier M, Wanninger J, Schaffler A, Luchner A, et al. Low- abundant adiponectin receptors in visceral adipose tissue of humans and rats are further reduced in diabetic animals. Arch Med Res2010 Feb;41(2):75-82. 427. Hopkins TA, Ouchi N, Shibata R, Walsh K. Adiponectin actions in the cardiovascular system. Cardiovasc Res2007 Apr 1;74(1):11-8. 428. Ding G, Qin Q, He N, Francis-David SC, Hou J, Liu J, et al. Adiponectin and its receptors are expressed in adult ventricular cardiomyocytes and upregulated by activation of peroxisome proliferator-activated receptor gamma. J Mol Cell Cardiol2007 Jul;43(1):73-84. 429. Sun X, Han R, Wang Z, Chen Y. Regulation of adiponectin receptors in hepatocytes by the peroxisome proliferator-activated receptor-gamma agonist rosiglitazone. Diabetologia2006 Jun;49(6):1303-10. 430. Zhou Y, Sun X, Jin L, Stringfield T, Lin L, Chen Y. Expression profiles of adiponectin receptors in mouse embryos. Gene Expr Patterns2005 Jun;5(5):711-5. 431. Lindsay RS, Funahashi T, Hanson RL, Matsuzawa Y, Tanaka S, Tataranni PA, et al. Adiponectin and development of type 2 diabetes in the Pima Indian population. Lancet2002 Jul 6;360(9326):57-8. 432. Spranger J, Kroke A, Mohlig M, Bergmann MM, Ristow M, Boeing H, et al. Adiponectin and protection against type 2 diabetes mellitus. Lancet2003 Jan 18;361(9353):226-8. 433. Fang X, Palanivel R, Cresser J, Schram K, Ganguly R, Thong FS, et al. An APPL1- AMPK signaling axis mediates beneficial metabolic effects of adiponectin in the heart. Am J Physiol Endocrinol Metab2010 Nov;299(5):E721-9. 434. Cheng KK, Lam KS, Wang Y, Huang Y, Carling D, Wu D, et al. Adiponectin-induced endothelial nitric oxide synthase activation and nitric oxide production are mediated by APPL1 in endothelial cells. Diabetes2007 May;56(5):1387-94. 435. Mao X, Kikani CK, Riojas RA, Langlais P, Wang L, Ramos FJ, et al. APPL1 binds to adiponectin receptors and mediates adiponectin signalling and function. Nat Cell Biol2006 May;8(5):516-23. 436. Wang Y, Tao L, Yuan Y, Lau WB, Li R, Lopez BL, et al. Cardioprotective effect of adiponectin is partially mediated by its AMPK-independent antinitrative action. Am J Physiol Endocrinol Metab2009 Aug;297(2):E384-91. 437. Ding Q, Wang Z, Chen Y. Endocytosis of adiponectin receptor 1 through a clathrin- and Rab5-dependent pathway. Cell Res2009 Mar;19(3):317-27. 438. Bucci C, Parton RG, Mather IH, Stunnenberg H, Simons K, Hoflack B, et al. The small GTPase rab5 functions as a regulatory factor in the early endocytic pathway. Cell1992 Sep 4;70(5):715-28. 439. Zerial M, McBride H. Rab proteins as membrane organizers. Nat Rev Mol Cell Biol2001 Feb;2(2):107-17.

160 440. Seachrist JL, Ferguson SS. Regulation of G protein-coupled receptor endocytosis and trafficking by Rab GTPases. Life Sci2003 Dec 5;74(2-3):225-35. 441. McCaffrey MW, Bielli A, Cantalupo G, Mora S, Roberti V, Santillo M, et al. Rab4 affects both recycling and degradative endosomal trafficking. FEBS Lett2001 Apr 20;495(1- 2):21-30. 442. Shibata R, Izumiya Y, Sato K, Papanicolaou K, Kihara S, Colucci WS, et al. Adiponectin protects against the development of systolic dysfunction following myocardial infarction. J Mol Cell Cardiol2007 Jun;42(6):1065-74. 443. Tao L, Gao E, Jiao X, Yuan Y, Li S, Christopher TA, et al. Adiponectin cardioprotection after myocardial ischemia/reperfusion involves the reduction of oxidative/nitrative stress. Circulation2007 Mar 20;115(11):1408-16. 444. Wang J, Shao ML, Cao H, Ke YS. [Protective effects of adiponectin on myocardial ischemia-reperfusion injury in rats]. Zhonghua Xin Xue Guan Bing Za Zhi2010 Mar;38(3):252-8. 445. Takahashi T, Saegusa S, Sumino H, Nakahashi T, Iwai K, Morimoto S, et al. Adiponectin, T-cadherin and tumour necrosis factor-alpha in damaged cardiomyocytes from autopsy specimens. J Int Med Res2005 Mar-Apr;33(2):236-44. 446. Ishikawa Y, Akasaka Y, Ishii T, Yoda-Murakami M, Choi-Miura NH, Tomita M, et al. Changes in the distribution pattern of gelatin-binding protein of 28 kDa (adiponectin) in myocardial remodelling after ischaemic injury. Histopathology2003 Jan;42(1):43-52. 447. Takahashi T, Saegusa S, Sumino H, Nakahashi T, Iwai K, Morimoto S, et al. Adiponectin replacement therapy attenuates myocardial damage in leptin-deficient mice with viral myocarditis. J Int Med Res2005 Mar-Apr;33(2):207-14. 448. Shibata R, Sato K, Kumada M, Izumiya Y, Sonoda M, Kihara S, et al. Adiponectin accumulates in myocardial tissue that has been damaged by ischemia-reperfusion injury via leakage from the vascular compartment. Cardiovasc Res2007 Jun 1;74(3):471-9. 449. Okamoto Y, Arita Y, Nishida M, Muraguchi M, Ouchi N, Takahashi M, et al. An adipocyte-derived plasma protein, adiponectin, adheres to injured vascular walls. Horm Metab Res2000 Feb;32(2):47-50. 450. Chen H, Montagnani M, Funahashi T, Shimomura I, Quon MJ. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem2003 Nov 7;278(45):45021-6. 451. Ouchi N, Shibata R, Walsh K. AMP-activated protein kinase signaling stimulates VEGF expression and angiogenesis in skeletal muscle. Circ Res2005 Apr 29;96(8):838-46. 452. Ohashi K, Kihara S, Ouchi N, Kumada M, Fujita K, Hiuge A, et al. Adiponectin replenishment ameliorates obesity-related hypertension. Hypertension2006 Jun;47(6):1108-16. 453. Shibata R, Ouchi N, Ito M, Kihara S, Shiojima I, Pimentel DR, et al. Adiponectin- mediated modulation of hypertrophic signals in the heart. Nat Med2004 Dec;10(12):1384-9. 454. Fujioka D, Kawabata K, Saito Y, Kobayashi T, Nakamura T, Kodama Y, et al. Role of adiponectin receptors in endothelin-induced cellular hypertrophy in cultured cardiomyocytes and their expression in infarcted heart. Am J Physiol Heart Circ Physiol2006 Jun;290(6):H2409-16. 455. Ohashi K, Ouchi N, Sato K, Higuchi A, Ishikawa TO, Herschman HR, et al. Adiponectin promotes revascularization of ischemic muscle through a cyclooxygenase 2-dependent mechanism. Mol Cell Biol2009 Jul;29(13):3487-99. 456. Ouchi N, Kobayashi H, Kihara S, Kumada M, Sato K, Inoue T, et al. Adiponectin stimulates angiogenesis by promoting cross-talk between AMP-activated protein kinase and Akt signaling in endothelial cells. J Biol Chem2004 Jan 9;279(2):1304-9. 457. Kondo M, Shibata R, Miura R, Shimano M, Kondo K, Li P, et al. Caloric restriction stimulates revascularization in response to ischemia via adiponectin-mediated activation of endothelial nitric-oxide synthase. J Biol Chem2009 Jan 16;284(3):1718-24.

161 458. Pineiro R, Iglesias MJ, Gallego R, Raghay K, Eiras S, Rubio J, et al. Adiponectin is synthesized and secreted by human and murine cardiomyocytes. FEBS Lett2005 Sep 26;579(23):5163-9. 459. Amin RH, Mathews ST, Alli A, Leff T. Endogenously produced adiponectin protects cardiomyocytes from hypertrophy by a PPARgamma-dependent autocrine mechanism. Am J Physiol Heart Circ Physiol2010 Sep;299(3):H690-8. 460. Bonnard C, Durand A, Vidal H, Rieusset J. Changes in adiponectin, its receptors and AMPK activity in tissues of diet-induced diabetic mice. Diabetes Metab2008 Feb;34(1):52-61. 461. Abete P, Cioppa A, Ferrara P, Caccese P, Ferrara N, Rengo F. Reduced aerobic metabolic efficiency in postischemic myocardium dysfunction in rats: role of aging. Gerontology1995;41(4):187-94. 462. Russell RR, 3rd, Li J, Coven DL, Pypaert M, Zechner C, Palmeri M, et al. AMP- activated protein kinase mediates ischemic glucose uptake and prevents postischemic cardiac dysfunction, apoptosis, and injury. J Clin Invest2004 Aug;114(4):495-503. 463. Hardie DG. AMP-activated protein kinase: the guardian of cardiac energy status. J Clin Invest2004 Aug;114(4):465-8. 464. Ruderman NB, Saha AK, Kraegen EW. Minireview: malonyl CoA, AMP-activated protein kinase, and adiposity. Endocrinology2003 Dec;144(12):5166-71. 465. Stanley WC, Recchia FA, Lopaschuk GD. Myocardial substrate metabolism in the normal and failing heart. Physiol Rev2005 Jul;85(3):1093-129. 466. Borradaile NM, Schaffer JE. Lipotoxicity in the heart. Curr Hypertens Rep2005 Dec;7(6):412-7. 467. Liao Y, Takashima S, Maeda N, Ouchi N, Komamura K, Shimomura I, et al. Exacerbation of heart failure in adiponectin-deficient mice due to impaired regulation of AMPK and glucose metabolism. Cardiovasc Res2005 Sep 1;67(4):705-13. 468. Palanivel R, Fang X, Park M, Eguchi M, Pallan S, De Girolamo S, et al. Globular and full-length forms of adiponectin mediate specific changes in glucose and fatty acid uptake and metabolism in cardiomyocytes. Cardiovasc Res2007 Jul 1;75(1):148-57. 469. Kusmic C, L'Abbate A, Sambuceti G, Drummond G, Barsanti C, Matteucci M, et al. Improved myocardial perfusion in chronic diabetic mice by the up-regulation of pLKB1 and AMPK signaling. J Cell Biochem2010 Apr 1;109(5):1033-44. 470. Shaw RJ, Kosmatka M, Bardeesy N, Hurley RL, Witters LA, DePinho RA, et al. The tumor suppressor LKB1 kinase directly activates AMP-activated kinase and regulates apoptosis in response to energy stress. Proceedings of the National Academy of Sciences of the United States of America2004 March 9, 2004;101(10):3329-35. 471. Zhou L, Deepa SS, Etzler JC, Ryu J, Mao X, Fang Q, et al. Adiponectin activates AMP- activated protein kinase in muscle cells via APPL1/LKB1-dependent and phospholipase C/Ca2+/Ca2+/calmodulin-dependent protein kinase kinase-dependent pathways. J Biol Chem2009 Aug 14;284(33):22426-35. 472. Shimano M, Ouchi N, Shibata R, Ohashi K, Pimentel DR, Murohara T, et al. Adiponectin deficiency exacerbates cardiac dysfunction following pressure overload through disruption of an AMPK-dependent angiogenic response. J Mol Cell Cardiol2010 Aug;49(2):210-20. 473. Marsin AS, Bertrand L, Rider MH, Deprez J, Beauloye C, Vincent MF, et al. Phosphorylation and activation of heart PFK-2 by AMPK has a role in the stimulation of glycolysis during ischaemia. Curr Biol2000 Oct 19;10(20):1247-55. 474. Russell RR, 3rd, Bergeron R, Shulman GI, Young LH. Translocation of myocardial GLUT-4 and increased glucose uptake through activation of AMPK by AICAR. Am J Physiol1999 Aug;277(2 Pt 2):H643-9.

162 475. Xing Y, Musi N, Fujii N, Zou L, Luptak I, Hirshman MF, et al. Glucose metabolism and energy homeostasis in mouse hearts overexpressing dominant negative alpha2 subunit of AMP- activated protein kinase. J Biol Chem2003 Aug 1;278(31):28372-7. 476. Folmes CDL, Wagg CS, Shen M, Clanachan AS, Tian R, Lopaschuk GD. Suppression of 5′-AMP-activated protein kinase activity does not impair recovery of contractile function during reperfusion of ischemic hearts. American Journal of Physiology - Heart and Circulatory Physiology2009 July 2009;297(1):H313-H21. 477. Dyck JR, Kudo N, Barr AJ, Davies SP, Hardie DG, Lopaschuk GD. Phosphorylation control of cardiac acetyl-CoA carboxylase by cAMP-dependent protein kinase and 5'-AMP activated protein kinase. Eur J Biochem1999 May;262(1):184-90. 478. Lopaschuk GD, Spafford MA. Energy substrate utilization by isolated working hearts from newborn rabbits. Am J Physiol1990 May;258(5 Pt 2):H1274-80. 479. Lopaschuk GD, Saddik M, Barr R, Huang L, Barker CC, Muzyka RA. Effects of high levels of fatty acids on functional recovery of ischemic hearts from diabetic rats. Am J Physiol1992 Dec;263(6 Pt 1):E1046-53. 480. Lopaschuk GD, Wall SR, Olley PM, Davies NJ. Etomoxir, a carnitine palmitoyltransferase I inhibitor, protects hearts from fatty acid-induced ischemic injury independent of changes in long chain acylcarnitine. Circ Res1988 Dec;63(6):1036-43. 481. Sambandam N, Lopaschuk GD, Brownsey RW, Allard MF. Energy metabolism in the hypertrophied heart. Heart Fail Rev2002 Apr;7(2):161-73. 482. Gonon AT, Widegren U, Bulhak A, Salehzadeh F, Persson J, Sjoquist PO, et al. Adiponectin protects against myocardial ischaemia-reperfusion injury via AMP-activated protein kinase, Akt, and nitric oxide. Cardiovasc Res2008 Apr 1;78(1):116-22. 483. Ikeda Y, Ohashi K, Shibata R, Pimentel DR, Kihara S, Ouchi N, et al. Cyclooxygenase-2 induction by adiponectin is regulated by a sphingosine kinase-1 dependent mechanism in cardiac myocytes. FEBS Lett2008 Apr 2;582(7):1147-50. 484. Zhang P, Wang Y, Fan Y, Tang Z, Wang N. Overexpression of adiponectin receptors potentiates the antiinflammatory action of subeffective dose of globular adiponectin in vascular endothelial cells. Arterioscler Thromb Vasc Biol2009 Jan;29(1):67-74. 485. Soccio T, Zhang YY, Bacci S, Mlynarski W, Placha G, Raggio G, et al. Common haplotypes at the adiponectin receptor 1 (ADIPOR1) locus are associated with increased risk of coronary artery disease in type 2 diabetes. Diabetes2006 Oct;55(10):2763-70. 486. Vaxillaire M, Dechaume A, Vasseur-Delannoy V, Lahmidi S, Vatin V, Leprêtre F, et al. Genetic Analysis of ADIPOR1 and ADIPOR2 Candidate Polymorphisms for Type 2 Diabetes in the Caucasian Population. Diabetes2006 March 2006;55(3):856-61. 487. Crimmins NA, Martin LJ. Polymorphisms in adiponectin receptor genes ADIPOR1 and ADIPOR2 and insulin resistance. Obesity Reviews2007;8(5):419-23. 488. Siitonen N, Pulkkinen L, Lindstrom J, Kolehmainen M, Schwab U, Eriksson J, et al. Association of ADIPOR2 gene variants with cardiovascular disease and type 2 diabetes risk in individuals with impaired glucose tolerance: the Finnish Diabetes Prevention Study. Cardiovascular Diabetology2011;10(1):83. 489. Bullen JW, Jr., Bluher S, Kelesidis T, Mantzoros CS. Regulation of adiponectin and its receptors in response to development of diet-induced obesity in mice. Am J Physiol Endocrinol Metab2007 Apr;292(4):E1079-86. 490. Oana F, Takeda H, Hayakawa K, Matsuzawa A, Akahane S, Isaji M, et al. Physiological difference between obese (fa/fa) Zucker rats and lean Zucker rats concerning adiponectin. Metabolism2005 Aug;54(8):995-1001.

163 491. Wang T, Qiao S, Lei S, Liu Y, Ng KF, Xu A, et al. N-acetylcysteine and allopurinol synergistically enhance cardiac adiponectin content and reduce myocardial reperfusion injury in diabetic rats. PLoS One2011;6(8):e23967. 492. Inukai K, Nakashima Y, Watanabe M, Takata N, Sawa T, Kurihara S, et al. Regulation of adiponectin receptor gene expression in diabetic mice. Am J Physiol Endocrinol Metab2005 May;288(5):E876-82. 493. Guo Z, Zheng C, Qin Z, Wei P. Effect of telmisartan on the expression of cardiac adiponectin and its receptor 1 in type 2 diabetic rats. J Pharm Pharmacol2011 Jan;63(1):87-94. 494. de Oliveira C, de Mattos A, Biz C, Oyama L, Ribeiro E, Oller do Nascimento C. High-fat diet and glucocorticoid treatment cause hyperglycemia associated with adiponectin receptor alterations. Lipids in Health and Disease2011;10(1):11. 495. Song T, Lv LY, Xu J, Tian ZY, Cui WY, Wang QS, et al. Diet-induced obesity suppresses sevoflurane preconditioning against myocardial ischemia-reperfusion injury: role of AMP-activated protein kinase pathway. Exp Biol Med (Maywood)2011 Dec 1;236(12):1427-36. 496. Rohrbach S, Aurich AC, Li L, Niemann B. Age-associated loss in adiponectin-activation by caloric restriction: lack of compensation by enhanced inducibility of adiponectin paralogs CTRP2 and CTRP7. Mol Cell Endocrinol2007 Oct 15;277(1-2):26-34. 497. Niemann B, Silber RE, Rohrbach S. Age-specific effects of short- and long-term caloric restriction on the expression of adiponectin and adiponectin receptors: influence of intensity of food restriction. Exp Gerontol2008 Jul;43(7):706-13. 498. Anderson GL, Limacher M, Assaf AR, Bassford T, Beresford SA, Black H, et al. Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial. JAMA2004 Apr 14;291(14):1701-12. 499. Hunter JC, Korzick DH. Age- and sex-dependent alterations in protein kinase C (PKC) and extracellular regulated kinase 1/2 (ERK1/2) in rat myocardium. Mech Ageing Dev2005 May;126(5):535-50. 500. Korzick DH, Kostyak JC, Hunter JC, Saupe KW. Local delivery of PKCepsilon- activating peptide mimics ischemic preconditioning in aged hearts through GSK-3beta but not F1-ATPase inactivation. Am J Physiol Heart Circ Physiol2007 Oct;293(4):H2056-63. 501. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem1987 Apr;162(1):156-9. 502. Mueller SO, Simon S, Chae K, Metzler M, Korach KS. Phytoestrogens and their human metabolites show distinct agonistic and antagonistic properties on estrogen receptor alpha (ERalpha) and ERbeta in human cells. Toxicol Sci2004 Jul;80(1):14-25. 503. Hunter JC, Korzick DH. Protein kinase C distribution and translocation in rat myocardium: Methodological considerations. J Pharmacol Toxicol Methods2005 Mar- Apr;51(2):129-38. 504. Lu B, Leygue E, Dotzlaw H, Murphy LJ, Murphy LC, Watson PH. Estrogen receptor- beta mRNA variants in human and murine tissues. Mol Cell Endocrinol1998 Mar 16;138(1- 2):199-203. 505. Poola I, Abraham J, Baldwin K. Identification of ten exon deleted ERbeta mRNAs in human ovary, breast, uterus and bone tissues: alternate splicing pattern of estrogen receptor beta mRNA is distinct from that of estrogen receptor alpha. FEBS Lett2002 Apr 10;516(1-3):133-8. 506. Fitzpatrick SL, Funkhouser JM, Sindoni DM, Stevis PE, Deecher DC, Bapat AR, et al. Expression of estrogen receptor-beta protein in rodent ovary. Endocrinology1999 Jun;140(6):2581-91. 507. Filice E, Recchia AG, Pellegrino D, Angelone T, Maggiolini M, Cerra MC. A new membrane G protein-coupled receptor (GPR30) is involved in the cardiac effects of 17beta- estradiol in the male rat. J Physiol Pharmacol2009 Dec;60(4):3-10.

164 508. Pournajafi-Nazarloo H, Perry A, Partoo L, Papademeteriou E, Azizi F, Carter CS, et al. Neonatal oxytocin treatment modulates oxytocin receptor, atrial natriuretic peptide, nitric oxide synthase and estrogen receptor mRNAs expression in rat heart. Peptides2007 Jun;28(6):1170-7. 509. Du XJ, Dart AM, Riemersma RA, Oliver MF. Sex difference in presynaptic adrenergic inhibition of norepinephrine release during normoxia and ischemia in the rat heart. Circ Res1991 Mar;68(3):827-35. 510. Du X-J, Riemersma RA, Dart AM. Cardiovascular protection by oestrogen is partly mediated through modulation of autonomic nervous function. Cardiovascular Research1995 August 1, 1995;30(2):161-5. 511. Ford ES, Giles WH, Dietz WH. Prevalence of the metabolic syndrome among US adults: findings from the third National Health and Nutrition Examination Survey. JAMA2002 Jan 16;287(3):356-9. 512. Shibata R, Numaguchi Y, Matsushita K, Sone T, Kubota R, Ohashi T, et al. Usefulness of adiponectin to predict myocardial salvage following successful reperfusion in patients with acute myocardial infarction. Am J Cardiol2008 Jun 15;101(12):1712-5. 513. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem1976 May 7;72:248-54. 514. Kostyak JC, Hunter JC, Korzick DH. Acute PKCdelta inhibition limits ischaemia- reperfusion injury in the aged rat heart: role of GSK-3beta. Cardiovasc Res2006 May 1;70(2):325-34. 515. Gorres BK, Bomhoff GL, Gupte AA, Geiger PC. Altered estrogen receptor expression in skeletal muscle and adipose tissue of female rats fed a high-fat diet. J Appl Physiol Jan 13. 516. Gustafson B, Jack MM, Cushman SW, Smith U. Adiponectin gene activation by thiazolidinediones requires PPAR[gamma]2, but not C/EBP[alpha]--evidence for differential regulation of the aP2 and adiponectin genes. Biochemical and Biophysical Research Communications2003;308(4):933. 517. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, et al. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med2002 Nov;8(11):1288-95. 518. Vidal-Puig A, Jimenez-Linan M, Lowell BB, Hamann A, Hu E, Spiegelman B, et al. Regulation of PPAR gamma gene expression by nutrition and obesity in rodents. J Clin Invest1996 Jun 1;97(11):2553-61. 519. Bauer S, Weigert J, Neumeier M, Wanninger J, Schaffler A, Luchner A, et al. Low- abundant adiponectin receptors in visceral adipose tissue of humans and rats are further reduced in diabetic animals. Arch Med Res Feb;41(2):75-82. 520. Wu X, Motoshima H, Mahadev K, Stalker TJ, Scalia R, Goldstein BJ. Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes. Diabetes2003 Jun;52(6):1355-63. 521. Wade GN, Gray JM, Bartness TJ. Gonadal influences on adiposity. Int J Obes1985;9 Suppl 1:83-92. 522. Yepuru M, Eswaraka J, Kearbey JD, Barrett CM, Raghow S, Veverka KA, et al. Estrogen receptor-{beta}-selective ligands alleviate high-fat diet- and ovariectomy-induced obesity in mice. J Biol Chem2010 Oct 8;285(41):31292-303. 523. Fu M, Sun T, Bookout AL, Downes M, Yu RT, Evans RM, et al. A Nuclear Receptor Atlas: 3T3-L1 Adipogenesis. Molecular Endocrinology2005 October 1, 2005;19(10):2437-50. 524. Schmitt K, Daubener W, Bitter-Suermann D, Hadding U. A safe and efficient method for elimination of cell culture mycoplasmas using ciprofloxacin. J Immunol Methods1988 Apr 22;109(1):17-25.

165 525. Gregoire FM, Smas CM, Sul HS. Understanding adipocyte differentiation. Physiol Rev1998 Jul;78(3):783-809. 526. Mueller SO, Hall JM, Swope DL, Pedersen LC, Korach KS. Molecular determinants of the stereoselectivity of agonist activity of estrogen receptors (ER) alpha and beta. J Biol Chem2003 Apr 4;278(14):12255-62. 527. Couse JF, Davis VL, Hanson RB, Jefferson WN, McLachlan JA, Bullock BC, et al. Accelerated onset of uterine tumors in transgenic mice with aberrant expression of the estrogen receptor after neonatal exposure to diethylstilbestrol. Mol Carcinog1997 Aug;19(4):236-42. 528. Chen YH, Lee MJ, Chang HH, Hung PF, Kao YH. 17 beta-estradiol stimulates resistin gene expression in 3T3-L1 adipocytes via the estrogen receptor, extracellularly regulated kinase, and CCAAT/enhancer binding protein-alpha pathways. Endocrinology2006 Sep;147(9):4496- 504. 529. Kidani T, Kamei S, Miyawaki J, Aizawa J, Sakayama K, Masuno H. Bisphenol A downregulates Akt signaling and inhibits adiponectin production and secretion in 3T3-L1 adipocytes. J Atheroscler Thromb2010 Aug 31;17(8):834-43. 530. Yi KW, Shin JH, Seo HS, Lee JK, Oh MJ, Kim T, et al. Role of estrogen receptor-alpha and -beta in regulating leptin expression in 3T3-L1 adipocytes. Obesity (Silver Spring)2008 Nov;16(11):2393-9. 531. Ogawa S, Inoue S, Watanabe T, Hiroi H, Orimo A, Hosoi T, et al. The complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitro. Biochem Biophys Res Commun1998 Feb 4;243(1):122-6. 532. Bhat RA, Harnish DC, Stevis PE, Lyttle CR, Komm BS. A novel human estrogen receptor beta: identification and functional analysis of additional N-terminal amino acids. J Steroid Biochem Mol Biol1998 Nov;67(3):233-40. 533. Muraki K, Okuya S, Tanizawa Y. Estrogen receptor α regulates insulin sensitivity through IRS-1 tyrosine phosphorylation in mature 3T3-L1 adipocytes. Endocrine Journal2006;53:841-51. 534. Hollingsworth DR. Alterations of maternal metabolism in normal and diabetic pregnancies: differences in insulin-dependent, non-insulin-dependent, and gestational diabetes. Am J Obstet Gynecol1983 Jun 15;146(4):417-29. 535. Tomazic M, Janez A, Sketelj A, Kocijancic A, Eckel J, Sharma PM. Comparison of alterations in insulin signalling pathway in adipocytes from Type II diabetic pregnant women and women with gestational diabetes mellitus. Diabetologia2002 Apr;45(4):502-8. 536. Polderman KH, Gooren LJ, Asscheman H, Bakker A, Heine RJ. Induction of insulin resistance by androgens and estrogens. J Clin Endocrinol Metab1994 Jul;79(1):265-71. 537. Diamond MP, Simonson DC, DeFronzo RA. Menstrual cyclicity has a profound effect on glucose homeostasis. Fertil Steril1989 Aug;52(2):204-8. 538. Fischer-Posovszky P, Newell FS, Wabitsch M, Tornqvist HE. Human SGBS Cells – a Unique Tool for Studies of Human Fat Cell Biology. Obesity Facts2008;1(4):184-9. 539. Larkin LM, Reynolds TH, Supiano MA, Kahn BB, Halter JB. Effect of Aging and Obesity on Insulin Responsiveness and Glut-4 Glucose Transporter Content in Skeletal Muscle of Fischer 344 x Brown Norway Rats. J Gerontol A Biol Sci Med Sci2001 November 1, 2001;56(11):B486-92. 540. Ma H, Xu L, Yuan J, Shao M, Hu Z, Wang F, et al. Tagging single nucleotide polymorphisms in excision repair cross-complementing group 1 (ERCC1) and risk of primary lung cancer in a Chinese population. Pharmacogenet Genomics2007 Jun;17(6):417-23. 541. Chakraborty TR, Gore AC. Aging-related changes in ovarian hormones, their receptors, and neuroendocrine function. Exp Biol Med (Maywood)2004 Nov;229(10):977-87.

166 542. Grist M, Wambolt RB, Bondy GP, English DR, Allard MF. Estrogen replacement stimulates fatty acid oxidation and impairs post-ischemic recovery of hearts from ovariectomized female rats. Can J Physiol Pharmacol2002 Oct;80(10):1001-7. 543. Lancaster TS, Jefferson SJ, Korzick DH. Local delivery of a PKCepsilon-activating peptide limits ischemia reperfusion injury in the aged female rat heart. Am J Physiol Regul Integr Comp Physiol2011 Nov;301(5):R1242-9.

CURRICULUM VITA

Nanette J. Tomicek

Education and Professional Experience

B.S. Biology: Westminster College, New Wilmington, PA, 2006

Teaching Assistant, Dept. Biology, Westminster College, New Wilmington, PA 2003-2006 Intern, Carnegie Science Center: Science on the Road Division, Pittsburgh, PA 2004 Research Intern, Dept. Pharmacology, University of Pittsburgh, Pittsburgh, PA 2005 Ph.D. Candidate, Intercollege Graduate Degree Program in Physiology, The Pennsylvania State University, University Park, PA 2006-present Teaching Assistant, Dept. Biology, The Pennsylvania State University, University Park, PA 2008-2011 Instructor, Dept. Biology, The Pennsylvania State University, University Park, PA 2011-present Laboratory Coordinator, Dept. Biology, The Pennsylvania State University, University, Park, PA 2012

Awards and Service

Completion of Westminster College Honors Program 2006 Graduation with Honors, Cum Laude, Westminster College 2006 Huck Institute Graduate Fellowship Award 2006 Completion of American Physiological Society’s: Professional Writing Skills Course 2009 Judge for Annual Pennsylvania Junior Academy of Science State Meeting, 2008-present Escort for American Physiological Society’s: Workshop for High School Life Science Teachers and Students 2011

Peer-reviewed Publications

1. Novotny JL, AM Simpson, NJ Tomicek, TS Lancaster, and DH Korzick, Rapid Estrogen Receptor-α Activation Improves Ischemic Tolerance in Aged Female Rats Through a Novel PKC -Dependent Mechanism. Endocrinology. 2009 Feb;150(2):889-96. (Epub 2008 Oct 16). 2. Tomicek NJ, JL Miller-Lee, JC Hunter, DH Korzick. Estrogen Receptor Beta Does Not Influence Ischemic Tolerance in the Aged Female Rat Heart, in press, Cardiovascular Therapeutics, May 2011. 3. Tomicek NJ, TS Lancaster, DH Korzick. Increased Estrogen Receptor β in Adipose Tissue Is Associated With Increased Intracellular and Reduced Circulating Adiponectin Protein Levels in Aged Female Rats, in press, Gender Med, July 2011.