Molecular Systematics and Biogeography of Antillean Thrashers, Tremblers, and Mockingbirds (Aves: Mimidae)

Home , Black catbird, Brown trembler, Gray catbird, Mimid, Mimus, Mockingbird

The Auk 118(1):35-55, 2001

MOLECULAR SYSTEMATICS AND BIOGEOGRAPHY OF ANTILLEAN THRASHERS, TREMBLERS, AND MOCKINGBIRDS (AVES: MIMIDAE)

JEFFREYS. HUNT, 1,3ELDREDGE BERMINGHAM, TM AND ROBERTE. RICKLEFS2 •SrnithsonianTropical Research Institute, Apartado 2072, Balboa,Republic of Panamd;and 2Departmentof Biology,University of Missouri-St.Louis, 8001 NaturalBridge Road, St. Louis, Missouri 63121-4499, USA

ABSTRACT.--Weconstructed phylogenetic hypotheses for Greater and LesserAntillean Mimidae, including five endemicspecies of tremblersand thrashersthat representthe best plausibleexample of an avian radiation within the LesserAntilles. Phylogeneticrelation- shipswere inferred from analysisof 3,491base pairs (bp) of mitochondrialDNA (mtDNA) and roughly 780 bp of the nuclear-encodedmyoglobin gene. We used a subsetof mtDNA genesequences and pcrRFLPanalysis to evaluatethe phylogeographicrelationships among individualsrepresenting island populations of the Brown and Gray tremblers(Cinclocerthia ruficaudaand C. gutturalis), Pearly-eyedThrasher (Margaropsfuscatus), Scaly-breasted Thrasher(Margarops fuscus), and Antillean and continentalpopulations of the Tropical (Mi- musgilvus) and Northernmockingbirds (Mimus polyglottos). Phylogeographic analysis dis- tinguishedthree stronglydifferentiated mtDNA cladesamong tremblers, as well asdistinct southern(St. Lucia and Martinique)and northern(Dominica to Montserrat)mtDNA lineages of the Scaly-breastedThrasher. Minor geographicsubdivision was alsoobserved between continentaland Antillean populationsof the TropicalMockingbird. Phylogenetic analyses of species-levelMimidae relationshipsthat arebased on mtDNA and nuclearsequences provide strongsupport for the monophylyand Antillean origin of a cladethat consistsof the tremblers,Pearly-eyed Thrasher, and Scaly-breastedThrasher, but rejectthe monophylyof the genusMargarops. Phylogenetic analysis cannot confirm the monophylyof all endemic Antillean mimids becauseof the apparentlycontemporaneous diversification of the Antil- lean White-breastedThrasher (Ramphocinclus brachyurus) with the continentalGray Catbird (Dumetellacarolinensis) and Black Catbird (Melanoptilaglabrirostris). However, an insertion and a deletionin the myoglobinintron 2 sequencesupport grouping the WestIndian thrashers and tremblers, from which we infer that the endemic Lesser Antillean mimids are an indigenousradiation. Assuming a constantmtDNA clockfor the Mimidae,the splittingof the Northernand Tropicalmockingbird lineages is roughlycontemporaneous with the separationof the three tremblerclades, as well as the two Scaly-breastedThrasher clades. Ap- plicationof a mitochondrialDNA clockticking at 2% sequencedivergence per million years (Ma), suggeststhat the history of the endemicthrasher and tremblerlineage in the West Indies extendsback about 4 Ma, and the three distinct cladesof tremblerssplit about 2 Ma ago.Received 12 August1999, accepted 8 August2000.

AMONG BIRDSof the West Indies, few endem- in thosegenera have partially overlappingdis- ic radiationshave resulted in sympatricdaugh- tributions in the Lesser Antilles, and four are ter species,and certainly none are comparable sympatricon the islandsof St. Lucia and Mar- to the radiations of Hawaiian honeycreepers tinique (Fig. 1). In the absenceof a mimid phy- (Drepanidinae)and Galapagosfin&es (Geos- logeny,however, it is not possibleto determine pizinae). In the LesserAntillean avifauna,the whether the Lesser Antillean mimid endemics three endemic Mimidae genera Margarops, are monophyleticand thus representan indig- Ramphocinclus,and Cinclocerthiaconstitute the enousradiation within that islandarchipelago. bestplausible example of an autochthonousra- The principal objectiveof this study was to diation. The five currentlyrecognized species providea phylogenetichypothesis for the genera of mimids found within the Caribbean Ba- sin and assess whether the endemic Lesser An- 3 Present address: Bird Division, Field Museum of Natural History,Roosevelt Road at LakeShore Drive, tillean taxa were producedwithin the islands Chicago,Illinois 60605,USA or representmultiple colonizationsfrom the 4 E-mail: [email protected] American continents. In addition to the endem-

35 36 HUNT,BERMINGHAM, AND RICKLEFS [Auk,Vol. 118

Finally,our analysesprovide a molecular-sys- tematicperspective on the taxonomicstatus of Cinclocerthiaand Margaropsand on the evolutionary status of subspeciesin both these genera. We sequencedthe full mitochondrialATP synthase6 and 8 genesfor two or more indi- Lesser Antilles viduals representingall speciesand multiple geographicpopulations of Lesser Antillean mimids. Phylogeneticanalysis of the ATPase ß - C/nclocerthlaspecies SLI• ßß00 sequencesformed the basis of our biogeo- ß - Margarops(Allen/a) fuscus • - Margaropsfuscatus sv 4 graphicappraisal of the two Margaro?sspecies, ß - Ramphocinc/usbrachyurus Cinclocerthia,and the two widespreadMirnus # species.Mitochondrial genotypes were also determined for additional Margaro?sfuscus and M. fuscatusindividuals using RFLP analysisof PCR-amplifiedATPase fragments. Following our initial phylogeneticanalyses of Caribbean mimids, we selected11 species (including outgroups) and a secondgenetically differentiated FIG. 1. The geographicdistribution of the four population of C. ruficaudafor a more detailed speciesof thrashersand tremblers(Mimidae) found in the LesserAntilles. Specimensincluded in this molecular-systematicanalysis. Our phyloge- study were collectedfrom islandsrepresented by the netichypothesis for Caribbeanmimid relation- filled symbols.Geographic abbreviations are as fol- shipsis basedon direct sequenceanalysis of lows: Puerto Rico (PR), Barbuda(BU), Antigua (AN), 3,491 base pairs (bp) of mitochondrialDNA Montserrat(MO), Guadeloupe(GU), Dominica(DO), (mtDNA) and approximately780 bp that rep- Martinique (MA), St. Lucia (SL), and St. Vincent resentthe nuclear-encodedmyoglobin intron 2 (SV). and shortregions of flankingexons 2 and 3.

STUDY AREA AND TAXA ic thrashersand tremblers,our phylogenetic analysisincludes the migratory Gray Catbird The LesserAntilles (Fig. 1) comprisea corechain (Dumetellacarolinensis) of North America, the of six medium-sized, volcanic, oceanic islands with Black Catbird (Melano?tila glabrirostris)of high elevationand considerableenvironmental het- northernCentral America,the Blue Mocking- erogeneity (Grenada, St. Vincent, St. Lucia, Marti- bird (Melanotis caerulescens)of Mexico, and nique, Dominica, and Guadeloupe).Several smaller three Caribbean-basinspecies of mockingbird islandsare distributedamong the corechain includ- (Mimus;Fig. 2). Our taxonomicsampling of the ing a group of smaller, more northerly volcanicis- landsthat havehigh elevations(Montserrat through Mimidae includedToxostorna (T. rufurnand T. ci- Saba),and an outer chainof low-lying,dry islands, nereurn)and Oreosco?tesrnontanus, but our ini- that consistof uplifted marine sediments,also to the tial molecular-systematicresults indicated that north (the easternhalf of Guadeloupethrough An- Dumetellaand Melano?tilaare closerrelatives of guilla). The Lesser Antilles, excluding Barbados, the Antillean-endemic thrashers and tremblers. achievedtheir presentgeographic configuration by Accordingly, we deleted Toxostomaand Oreos- the middle of the Miocene,at least15 Ma ago (Don- coptesfrom the presentanalysis. nelly 1985, 1989, Iturralde-Vinent and MacPhee The secondobjective of this study was to 1999). providea phylogeographicdescription of each Weconsider the LesserAntillean archipelago to be WestIndian mimid speciesfor which we have considerablyolder than its contemporaryavifauna (Ricklefsand Bermingham1999). Nonetheless,the moderatesamples and broad geographicrep- West Indian thrashers and tremblers are so distinc- resentation.These species are the Scaly-breast- tive that early workersgrouped them variously with ed Thrasher (Margaropsfuscus), Pearly-eyed the ant thrushes, ovenbirds, wrens, and thrushes Thrasher(M. fuscatus),Brown Trembler(Cin- (seeGulledge 1975). By the beginningof the twen- clocerthiaruficauda), Gray Trembler (C. guttur- tieth century, ornithologistshad reachedgeneral alis),and Tropical and Northern mockingbirds. agreementon groupingthe Antilleanforms together January2001] CaribbeanMimidae Systematics 37

us • BH West Indies

M. polyglottos

I I

M. gundlachii DO• MA• SL--t M. gilvus sv•

VE TR

Flo. 2. The geographicdistribution of the threespecies of mockingbirds(Mimus) found in theWest Indies. Linesindicate the southernextent of Mimuspolyglottos and the northernextent of M. gilvusin the Antilles. Mimusgundlachii is foundon the BahamaIslands and keysoff the northerncoast of Cubain additionto the Jamaicandistribution pictured. Geographic abbreviations are asfollows: United States (US), Bahamas (BH), Jamaica(JA) Dominican Republic (RD), Puerto Rico (PR), Dominica (DO), Martinique (MA), St. Lucia (SL), St. Vincent (SV), Grenada (GR), Trinidad (TR), and Venezuela (VE).

with othermimids as a separatefamily, the Mimidae. of Bermuda and winters to the south in Central Nevertheless,the positionof the Antilleanthrashers America and the Greater Antilles (AOU 1983). The and tremblerswithin that family,their relationships Black Catbird has a Caribbean-slopedistribution to eachother, and diversificationof eachof the spe- from northern Honduras to Yucatan, Mexico (AOU ciesamong islands are still poorly understood. 1983). Our molecular-systematic analysis was Margaropsand Alleniahave always been grouped roundedout with the mockingbirdsof the genusMi- togetherand, indeed,are usuallytreated as conge- mus,which are not consideredclosely related to the neric (Bond 1950, 1963;AOU 1983). Similarly, Ram- Antillean trembler, thrashers, or the catbirds and phocinclusand Cinclocerthia are often grouped togeth- thus providedan unambiguousoutgroup for evalu- er. Both Bond (1963) and Zusi (1969) noted atingrelationships among those species. In addition, similaritiesbetween skulls and plumageof thosetwo inclusionof Antillean Mimus speciescompleted our speciesand those of the BlueMockingbird (Melanotis phylogeographicappraisal of geographicallywide- caerulescens),which promptedinclusion of Melanotis spread Antillean mimids. in our analysisof the monophylyof LesserAntillean tremblers and thrashers. The catbirds have been in- MATERIAL AND METHODS cludedin this studyas possible close relatives of the LesserAntillean mimids becauseof our preliminary Field methodsand tissuecollection.--Samples were phylogeneticanalyses and their CaribbeanBasin collectedby mist-nettingand imported under the distribution. The migratory Gray Catbird breeds appropriatepermits during field work on thefollow- throughoutmost of North Americaand on the island ing islands:Bahamas, 1993; Barbuda, 1993; Domin- 38 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118 ica, 1991;Grenada, 1992;Guadeloupe, 1993; Jamaica, bosomalRNA, 16Sar,and 16Sbr(Palumbi 1996). The 1995; Martinique, 1991; Montserrat, 1993; Puerto myoglobingene region was amplified under the Rico, 1993 and 1994;Republic of Dominica, 1994;St. same conditions as the mitochondrial reactions, ex- Lucia, 1991; St. Vincent, 1993; Trinidad and Chaca- ceptthat an annealingtemperature of 60øCwas used chacare, 1995; and Venezuela, 1992. We drew blood with the amplificationprimer pairs MYO2 and MYO3 and excisedtissue samplesnondestructively in ac- (Slade et al. 1993) and MYO2 and MYO4 cordancewith our collectingpermits following the (TCTGGAGAGACAGTGAGGTCTAG). proceduredescribed by Baker(1981), except that we Typically we observeda singleamplification prod- surgicallyremoved a thin, triangular piece of the uct, whichwas cut from the gel and extractedusing pectoral muscle.In the field, blood sampleswere the "Gene Clean II" kit (Bio 101, Inc., Vista, Califor- storedat ambienttemperature in Queen'slysis buffer nia) and resuspendedin 25 •L of ddH20 or the GE- and tissue sampleswere stored at ambient temper- Lase• AgaroseGel-Digesting Preparation and the ature in salt-dimethyl sulfoxide (DMSO) solution "Fast Protocol" method (Epicentre Technologies, (Seutinet al. 1991). Our analysesinclude eight ad- Madison, Wisconsin).Purified amplificationprod- ditional mimid samplesrepresenting other collec- uctswere cycle-sequencedusing the Taq-DyeDeoxy tions and four cataloguedspecimens (see Appendix). Terminator Cycle Sequencingkit (Applied Biosys- Initially, we sequencedthe mitochondrial ATP tems,Inc., ForestCity, California)and the following synthase6 (ATPase6, 684 bp) and 8 (ATPase8, 168 sequencingprimers: ATPase6,8, COIIGQL, A8PWL, bp) genesfor two individualsthat were randomly A6TPL (see acknowledgements), and COIIIHMH; chosenfrom eachspecies and eachlocation where COl, COla, and COIf (Palumbi et al. 1992); ND2, sampleswere available(Table 1). One representative METb, ND2SCL, ND2LSH, and TRPc (see acknowl- of each speciesand mtDNA clade was selectedfor edgements); 12s, 12SA, and 12SB (Palumbi 1996); further sequencingof the followingadditional genes 16s, 16Sar, and 16Sbr (Palumbi 1996); and myoglo- or gene regions:the completesequence for mito- bin, MYO2, MYO3 (Slade et al. 1993), and MYO4. Se- chondrialprotein-coding NADH dehydrogenase2 quencingconditions were 25 cyclesof 96øCfor 30 s, gene(ND2, 1041bp), partial sequencesfor the mi- 50øCfor 15 s and 60øCfor 4 min. The cyclesequenc- tochondrialprotein-coding cytochrome oxidase I ing product was purified over Centri-Sep columns gene (CO1, 627 bp), and ribosomal genes(12S, 399 (PrincetonSeparations, Inc., Adelphia,NJ) and pre- bp, and 16S,572 bp plus or minus insertionsand de- pared for analysisusing either an ABI 373A or 377 letions),and approximately780 bp representingthe automated DNA sequencer. nuclear-encodedmyoglobin gene. Following gel electrophoresis,chromatograms DNA extraction,amplification, and sequencing.--DNA were imported into SeqEd• (1.0.3s, Applied Bios- was extractedby digesting0.1 to 0.5 g of groundpec- ystems) and aligned by eye. Nucleotide sequences toral muscle or 20 to 40 •L of blood in 500 •L of 2x were checkedfor reading-frameerrors, termination CTAB buffer solutionand 10 •L of a 10 mg/mL Pro~ codons,and improbablereplacement substitutions. teinaseK solutionat 54øCfor 6 to 14 h (Murry and Protein-coding sequenceswere translated in Mac- Thompson1980). A typical DNA extractionyielded Clade (Version 3.07, Maddison and Maddison 1992) a volume of 400 •L, of which 1 •L was used to seed and comparedto the amino acid sequencefor ho- our PolymeraseChain Reaction (PCR) amplifi- mologousmitochondrial genes publishedfor the cations. chicken(Desjardins and Morais 1990).A Nexusfile Amplification of all mtDNA genes and gene re- was createdwith each gene or generegion estab- gionswas carried out in 50 •L reactionsunder the lished as a separatepartition. In the caseof the following conditions:1 •L DNA (about 15-20 ng); ATPase6 and 8 genes,which have a 10-bpoverlap, 1x PCR Buffer II (Perkin-Elmer); 2.0 mM MgC12,2 this strategyleads to a duplicationof sequence.Nu- •M eachof dATP,dCTP, dGTP, and dTTP; 2 pM of cleotideposition 9246 (relative to the chicken[Gallus eachprimer; and 0.25 •L of Amplitaq polymerase gallus])in the 10-bpoverlap was phylogenetically in- (Perkin-Elmer). Reactions were denatured for 3 min formativebut the duplicatedinformation has no sig- at 94øC,followed by 25 thermal cyclesof 94øCde- nificantinfluence on the ensuinganalyses. Site 9249 naturing for 45 s, 54øCannealing for 45 s, and 72øC in this regionwas alsopolymorphic but represented extension for 1 min, and terminated with a 5 min ex- an autapomorphicchange in M. gundlachii. tensionat 72øC.We usedthe followingprimer pairs We verifiedthe identity of myoglobinintron 2 by to amplifythe mtDNA geneor generegion specified: comparingthe flanking sequences(exon 2 and 3) to ATPase6,8 gene region, COIIGQL, and COIIIHMH theManorina melanocephala (Meliphagidae) exon 2 se- (see acknowledgements);cytochrome oxidase sub- quence reported by Heslewood et al. (1998) (Gen- unit I, COIa, and COIf (Palumbi 1996); NADH de- Bank accessionnumber: U40497) and Sericornismag- hydrogenasesubunit II, METb, and TRPc (see ac- nirostris(Acanthizidae) exon 3 reportedby Sladeet knowledgements);12S ribosomal RNA, 12SA, and al. (1993) (GenBank accessionnumber: L17493). 12SBoriginally described in Kocheret al. (1989)but RFLPanalysis.•wing to the relativelylarge num- modified as describedby Palumbi (1996);and 16Sri- ber of Margaropsindividuals collected,we deter- January2001] CaribbeanMimidae Systematics 39 40 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118 mined mtDNA genotypesof M. fuscatusand M. fus- tochondrialand nucleargene regions could be com- cus by analyzing endonucleaserestriction sites. binedfor phylogeneticanalysis. The likelihood-ratio MargaropsATPase 6,8 sequenceswere examinedfor test implementedin MODELTEST(Posada and Cran- endonucleaserestriction sites that distinguishedthe dall, 1998) was utilized to selectthe model of molec- mtDNA cladesidentified by phylogeneticanalysis of ular evolutionused for our ML analysesof the com- thesegenes (Bermingham et al. 1996,Lovette et al. bined data. PAUP* was used to produceMP, NJ, and 1999b).The ATPase 6,8 gene region was amplified for ML treesfor comparisonacross different analytical all Margaropsand 5 IxL of PCR productwas digested methodsand genecombinations. Our MP analyses with 5 units of enzymefor 4 h usingthe buffersand utilized the Golobofffit criterion with k = 2 (Golo- temperatures recommendedby New England Bio- boff 1993). Our NJ analyseswere based on genetic Labs.Digestion products were loadedonto a 2% aga- distancescalculated with the LogDet model (Steel rose gel run in 1x Tris-boratebuffer (pH 8.0) (Sam- 1994)as a contrastto the classof site-to-siterate var- brook et al. 1989) containingethidium bromide(1 iation models evaluated by MODELTEST. We used mg/mL). The gelswere photographed and fragment 1,000 bootstrapreplications to assessconfidence for sizeswere comparedto thoseanticipated by our se- all pictured phylogenetichypotheses. Maximum quenceanalysis. likelihoodand parametricbootstrapping (Huelsen- Molecular characterizationand analysis.--We used becket al. 1996)were utilized to testthe monophyly the filter option in MacClade(Version 3.07, Maddi- of the Antillean tremblers and thrashers and the son and Maddison 1992) to combine identical se- monophylyof thegenus Margarops on the basis of the quencesand thus reducethe time requiredfor nu- full 4,271 nucleotide data set. For each of the tests of merical analysis. Variable and phylogenetically monophyly,we usedthe program Seq-Gen (Rambaut informative sites were identified. All unique se- and Grassly1997) to generate100 simulateddata sets quenceswere importedinto SequencerVersion 4.0.8a from which we developedour null distributionof (B. Kessingpers. comm.) to determine base compo- log-likelihoodscores for treesconstrained by thehy- sitionand nucleotidebias with respectto codonpo- pothesisof monophyly. sition. Biasin nucleotideusage was calculatedusing Rateheterogeneity was testedusing PAUP* to de- the C index (Irwin et al. 1991).To quantifyinter-se- terminewhether the phylogeneticbranch lengths for quencevariation in nucleotideusage, we calculated Caribbean mimids were consistent with a molecular the coefficientof variation(CV) of the proportionof clock. Maximum likelihood scores, for trees with and eachbase in the differentsequences for eachof the without a molecular clock enforced, were statistical- three codonpositions. The CVs of the four nucleo- ly comparedusing the KH test (Kishinoand Hase- tidesat eachcodon position were then averagedto gawa, 1989).In turn, we used the two-clusterand quantify overall inter-sequencevariability by posi- branch-lengthtests of Takezakiet al. (1995)to fur- tion. PAUP*, version 4.0bl (Swofford 1998), and therexamine molecular rate constancy among Carib- PUZZLE 4.0 (Strimmer and von Haeseler 1996, 1997) bean mimid lineages. were usedto calculatethe Ts/Tv ratio and gamma distributionrate parameters(alpha) for eachof the different genes. RESULTS Phylogeographicanalysis.--Phylogeographic analysis of all ATPase6,8 sequencesfor each of the five Our molecular-systematicstudy of Antillean speciesrepresented by multiple Caribbeanpopula- mimidsutilized the 842-bpsequence of the mi- tionswas based on neighbor-joining(NJ) andmaxi- tochondrialATPase 6,8 genesfor the phylogeo- mum parsimony (MP) analysesusing PAUP*, ver- graphic analysisof the island and mainland sion4.0bl (Swofford1998), and maximum likelihood populationsof five widespreadAntillean mim- (ML) using PUZZLE. Genetic distanceswere based on the HKY85 model of nucleotidesubstitution (Has- id taxa (Fig.3). In the secondstage of our study, egawaet al. 1985). The averagedivergence within we increased our taxon and nucleotide sam- and betweenmtDNA cladesrepresenting each spe- pling to assessthe likelihoodthat LesserAn- cieswas determinedwith SequencerVersion 4.0.8a. tillean tremblersand thrashersrepresented a MtDNA clade designationswere based on the monophyleticlineage. To this end, we se- ATPasephylogenetic analysis and the cladeswere quenced3,491 nucleotides representing the sin- definedby reciprocalmonophyly, although we rec- gle mitochondriallocus and approximately780 ognizedthat additionalsampling might reveala dif- nucleotidesof the nuclear-encodedmyoglobin ferent pictureof the relationship. intron 2 for onerepresentative of eachof 12ter- Phylogeneticanalysis.--Our molecular-systematic analysisof Caribbeanmimids focusedon 12 taxa. We minal mtDNA cladesidentified in our prelim- used the partition homogeneitytest of Farriset al. inary phylogeneticanalyses. All DNA sequenc- (1995) implementedin PAUP*(version 4.0d63) with es utilized in this study canbe retrievedfrom 100replicates to determinewhether the differentmi- GenBankusing the followingaccession num- January2001] CaribbeanMimidae Systematics 41

TABLE2. Molecularcharacterization of the mitochondrialgenes and myoglobinintron 2 used in the mo- lecularsystematic analysis of Caribbeanmimids. Values are percentagesexcept for the Ts/Tv ratio and alpha values;numbers in parenthesesrepresent the absolutenumber of sites.The twelveindividuals se- quencedfor all generegions were included in this analysis.

A8 A6 COI ND2 Ribosomal Myoglobin Nucleotide Composition G 8.1 12.2 17.3 12.7 23.0 22.9 A 30.2 29.4 28.6 30.3 29.3 29.0 T 22.5 22.6 24.2 21.1 20.8 26.5 C 35.9 35.8 29.9 35.8 26.9 21.6 Nucleotide Bias 1st Position 24.9 24.0 6.9 18.5 2nd Position 32.4 33.9 21.5 30.8 3rd Position 44.2 46.0 50.2 43.7 4-fold sites 44.1 45.0 52.3 42.7 Total 21.5 20.3 11.3 21.6 8.3 7.3 Percent Variable Sites 1st Position 10.7 (18) 6.0 (41) 0.8 (5) 7.9 (82) 2nd Position 3.0 (5) 1.3 (9) 0.0 (0) 2.7 (28) 3rd Position 20.2 (34) 23.4 (160) 19.8 (124) 22.2 (231) 4-fold sites 8.9 (15) 13.9 (95) 12.1 (76) 11.4 (119) Total 33.9 (57) 30.7 (210) 20.6 (129) 32.8 (341) 7.7 (75)a 4.7 (33)• Percent Informative Sites 1st Position 7.7 (13) 3.4 (23) 0.3 (2) 4.9 (51) 2nd Position 1.2 (2) 0.6 (4) 0.0 (0) 1.6 (17) 3rd Position 10.7 (18) 16.7 (114) 10.5 (66) 15.1 (157) 4-fold sites 5.4 (9) 10.5 (72) 5.9 (37) 7.7 (80) Total 19.6 (33) 20.6 (141) 10.8 (68) 21.6 (225) 4.1 (40) • 3.0 (21) a Ts/Tv Ratio 4.92 + 1.29 10.96 + 1.2 6.46 + 0.94 12.21 + O.63 3.45 + 0.15 4.29 + 0.23 Alpha Value 0.27 0.13 0.10 0.16 0.02 0.02

• lndels not included

bers for the mitochondrialgenes: AF140899- Table 2 presentsnucleotide frequencies, nu- AF140986 (ATPase 6,8); AF140999-AF141010 cleotide bias, percentagevariability, percent- (COI); AF140887-AF140898 (ND2); AF140987- ageinformative nucleotide positions, Ts / Tv ra- AF140998 (12S); AF140863-AF140874 (16S). tios, and the gamma-distributionparameters The myoglobin accessionnumbers are: for the different genesand generegions em- AF140875-AF140886. ployedin this study. The ATPase(31.3% vari- Molecularcharacterization and phylogeneticin- able) and ND2 (32.8%variable) regions appear formationcontent of themtDNA andnuclear genes to be evolvingat a similarrate to one another, usedto analyzeCaribbean mimid relationships.- and morerapidly than eitherCOI (20.6%vari- Comparedto the homologousamino acid se- able)or the ribosomalregions (7.7% variable). quencesfor the chicken,mimids exhibit a single The majority of the variablesites within the amino acid codon insertion in the ATPase 8 se- codingregions are at third positionswith the quence between positions 44 and 45, but highestpercentage in COI at 96.1%. ATPase 6, COI, and ND2 have neither inser- The mimid myoglobinintron 2, lying be- tionsnor deletions.Among the 12 mimidsan- tween myoglobin exons 2 and 3, ranges in alyzedextensively in thisstudy, those in thege- length from 679 bp to 699 bp (average= 690) nus Mimus exhibited two phylogenetically owingto indelvariation. The myoglobinintron informative insertions within the 12S ribosom- 2 washighly conservedand the majorityof in- al DNA sequence.One insertion was also formativesites distinguished Mimus from the sharedby Melanotiscaerulescens. The 16Sribo- remainingmimid genera.Intron 2 was flanked somalsequence exhibited only a singleinser- by 16 basepairs of exon2, and was identicalto tion, an autapomorphyin M. caerulescens. the publishedMeliphagidae sequence (Hesle- 42 HUNT, BERMINGHAM,AND RICKLEFS [Auk, Vol. 118

us1 0.012 BH1 A BH2 Mimus 0.006WJA2 B polyglottos lED1 [RD2 -PR2

I"d- VE1VE2 C

o.o12I o.oTTc TR22 • -- CC1 0.004 ] i SVl Mimus '-J.GR2 [[ GEl gilvus I I MA2 L{SL2 A IDOl I MA1 I sv2 ' SL1 0.010 i'• MA1 B 0.038 ' SL1 I DO2 Margarops 1•6u•El- SL2 (Allenia) I IF MO2 A fuseus I• MO3 -- DO1 D•02 o.oob%,c 0.083 I I I MO2 I I I I I IFPR10 B 0.034 In nr•4• PR7 I PR9' PR5 Margarops L PR1 fuscatus 0.003 PR3 MO3 0.020 BU2 MO4 BU1 PR6 PR2 MO5 0.015 LSL2 SL1 0.017 O.Ol6 • DO6 --SV1J'DO1 •DO3 IDO5 I DO4 I I 0.005 r-DO7 1% ' DO2 Cinclocerthia 0.021 Luø9 species

FIG.3. The phylogeographicstructure of mitochondrialATPase 6,8 lineagesfor five speciesor species groups(Cinclocerthia) of Caribbean Mimidae. The neighbor-joining tree is basedon HKY85genetic distances andpermits a visualcomparison of thepatterns of conspecificmtDNA lineage relationships among species or speciesgroups. The figure is notpresented as a hypothesisfor thephylogenetic relationships among Ca- ribbeanmimid species(see Figs. 4-6). The lettersA, B, and C indicategenetically distinct mtDNA clades January2001] CaribbeanMimidae Systematics 43

TABLE3. HKY85 geneticdistances, standard errors, and ranges(given in parentheses)among conspecific mtDNA cladesfor the five CaribbeanMimidae speciesanalyzed for phylogeographicstructure (see Fig. 3). The lettersA, B, and C identifygenetically distinct mtDNA cladeswithin eachspecies or speciesgroup (Cinclocerthia)pictured in Figure3 and carry no meaningbetween species.

desig-Clade Cladedesignations nations A B C

Cinclocerthia species A 0.12 •- 0.0 (0.12-0.12) B 4.0 _+0.08 (3.92-4.17) 0.07 •- 0.10 (0.0-0.35) C 4.28 _+0.16 (4.04-4.68) 4.01 _+0.16 (3.79-4.56) 0.30 _+0.32 (0.0-0.95) Margarops fuscatus A 0.06 _+0.07 (0.0-0.24) B 1.16 _+0.10 (0.95-1.43) 0.10 _+0.08 (0.0-0.24) C 0.96 _+0.15 (0.71-1.31) 0.72 + 0.16 (0.47-1.07) 0.29 ñ 0.16 (0.12-0.47) Margarops (Allenia) fuscus A 0.22 •- 0.10 (0.0-0.35) B 2.14 •- 0.11 (1.92-2.29) 0.55 _ 0.38 (0.12-0.83) Mimus gilvus A 0.06 _+0.06 (0.0-.12) B 0.91 •- 0.06 (0.83-0.95) 0.20 ___0.10 (0.0-0.24) C 0.73 _+0.08 (0.59-0.83) 1.13 _ 0.14 (0.95-1.31) 0.12 _+0.0 (0.12-0.12) Mimus polyglottos A 0.0 + 0.0 (0.0-0.0) B 0.63 _+0.09 (0.59-0.83) 0.08 ñ 0.11 (0.0-0.24) wood et al. 1998) exceptfor a singleC-T tran- mtDNA phylogeographyof Antillean Mimidae.-- sition in Melanotis caerulescens. On the other MitochondrialATPase 6,8 sequencedata were flank, we sequencedbetween 39 and 77 bp (av. utilized to analyze79 individualsrepresenting = 72) of exon3 of which six sites(8% of the re- 3 mimid generaand 6 species(Table 1): Cinclo- gion) in the Mimidae differed from the Acan- certhiaruficauda, C. gutturalis,Margarops fusca- thizidaeexon 3 sequencepublished by Sladeet tus,M. fuscus,Mimus gilvus, and M. polyglottos. al. (1993).In total we analyzedan averageof We observed40 distincthaplotypes distributed 778 bp of myoglobinsequence per individual. acrossspecies as follows: Cinclocerthia ruficauda, Among the 12 mimid taxa includedin this 9; C. gutturalis,2; Margaropsfuscatus, 10; M. fus- analysis,and consideringthe genusMimus as cus,9; Mimusgilvus, 7; and M. polyglottos,3. Of "ancestral,"the myoglobinintron 2 regionre- thosetaxa, Cinclocerthia spp. exhibited the larg- vealed seven indel events, five of which were est number of informative sites with 49, fol- phylogeneticallyinformative (Figs. 4, 5, and 6). lowedby Margaropsfuscus with 18, M. fuscatus Three of the phylogeneticallyinformative in- with 12, Mimusgilvus with 11, and M. polyglot- dels were confined to Mimus and consisted of tos with 5. three, 4-bp deletions.The other two informa- We observed a one-to-one correspondence tive indels were observedonly in Cinclocerthia, betweennamed species and mtDNA haplotype Margarops,and Ramphocinclusand consistedof clades;in all cases,mtDNA synapomorphies an insertionof 1 bp and a deletionof 7 bp. The and reciprocalmonophyly supported recog- autapomorphicindels were a 2-bp insertionin nized species.Additional phylogeneticallyin- Melanotiscaerulescens and a 4-bp deletionin Mi- formative variation was observed within Cin- musgundlachii. clocerthiaand Margaropsfuscus. The ATPase-

within eachspecies or speciesgroup (Cinclocerthia) referenced in Table3 andhave no meaningbetween species.Taxon labels reference the geographicsource of the mtDNA lineagesas follows:United States(US), Bahamas(BH), Jamaica (JA) Dominican Republic (RD), Puerto Rico (PR), Barbuda (BU), Antigua (AN), Mont- serrat (MO), Guadeloupe(GU), Dominica (DO), Martinique (MA), St. Lucia (SL), St. Vincent (SV), Grenada (GR), Chacachacare(CC), Trinidad (TR), and Venezuela(VE). 44 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118

TABLE4. RFLP genotypesobserved for the two Margaropsspecies across the Antillean islandsof Puerto Rico (PR), Barbuda(BU), Montserrat(MO), Guadeloupe(GU), Dominica (DO), Martinique (MA), and St. Lucia(SL). Numbers include genotypes determined by RFLP,sequence assays, or both.

basedSequence- clade Geographiclocation namea Genotype PR BU MO GU DO MA SL Total Margarops fuscatus Clade A AAA 10 2 3 I 16 Clade A CAA 6 6 Clade B BBA 4 22 26 Clade C ABB 6 8 Clade C CBB 1 1 Total 57 Margarops (Allenia) fuscus Clade A DD 15 5 24 Clade A DE 1 1 Clade B EE 7 Total 32

• Cladenames are basedon the groupsidentified on the ATPasetree presentedin Figure3. basedtree depictedin Figure 3 is basedon a NJ LesserAntillean populationsbeing distinctive analysis of HKY85 genetic distancesand is from thosein Trinidad and, especially,in Ven- usedsimply to providea visual comparisonof ezuela.The divergenceamong mtDNA clades patterns of conspecificmtDNA lineage rela- of Mimus giIvuswas less than that between tionships among speciesor speciesgroups cladesof M. fuscus,ranging from 0.7 to 1.1%. (Cinclocerthia).Although principal featuresof Margaropsfuscatus displayed a moderatelevel the NJ tree picturedin Figure 3 were alsopre- of haplotypevariation that lackedany apparent sentin the ML and MP trees,we deferpresen- geographicpattern. Divergencebetween the tation of more detailedphylogenetic results to three, lettered mtDNA haplotype Margarops the next sectionwhere we provide the phylo- fuscatusclades ranged from 0.5 to 1.4% (Table genetichypotheses for Caribbeanmimids and 3). ExcludingBarbuda, from which two indi- outgroups. vidualsof Margaropsfuscatushad identicalhap- The moststriking phylogeographic result is lotypes, intra-island haplotype divergences the genetic divergence among Cinclocerthiaranged between0.5 and 0.7%. Within popula- populationsand species.Island populationson tionsof the otherfour species, the combined av- Guadeloupe and Montserrat form a mtDNA eragehaplotype divergence was 0.10%with a cladethat is sisterto a claderepresenting the range of 0.0 to 0.35%.In general,genetic vari- disjunctCinclocerthia populations of St. Vincent ability within mtDNA cladeswas low (Table3). and Dominica.The averagedistance between Subsequently,we used RFLP analysisto de- membersof the Guadeloupe/Montserratand terminethe genotypesof 57 additionalindivid- Dominica/St. Vincentclades is 4.0%. The geo- uals representingthe two Margaropsspecies, graphicallyintermediate CincIocerthia popula- bringing the total number of Margaropssam- tion from St. Lucia represents a distinct pled to 89. DdeI, HhaI, and Hinfi endonucleases mtDNA clade, with averagedistances to the were diagnosticfor M. fuscatusmtDNA clades othertwo cladesof 4.0 and 4.3% respectively. A, B, and C (Fig. 3), and identifiedthe follow- Margaropsfuscus populations were grouped ing RFLP genotypes(fragment sizeswere de- in two clades,one (clade A) representingthe ducedfrom the ATPasesequence data and are more northern Lesser Antillean islands of given in parentheses):DdeI-A (455, 319, 193, Montserrat, Guadeloupe, and Dominica, and 54), DdeI-B (648, 319, 54), DdeI-C (774, 193, 54), the other (clade B), representingthe more HhaI-A (780, 241), HhaI-B (1021), Hinfi-A (991, southern Lesser Antillean islands of Marti- 30), and Hinfi-B (596, 395, 30). Msp! and Taq! nique and St. Lucia. An averagedistance of werediagnostic for the two M. fuscusclades (A 2.1% separatedhaplotypes in the two clades. and B, Fig. 3) and identifiedthe followingge- Mimus gilvusalso exhibited phylogeographic notypes: MspI-D (590, 431), MspI-E (1021), structure in the eastern Caribbean, with the TaqI-D (718, 275, 28), and TaqI-E(718, 159, 116, January2001] CaribbeanMimidae Systematics 45

0.097 Melanotis caerulescens 189 Melanotls caerulescens

• 0.072 100148 47 M•muspolyglottos I 37 100 {•0.027 Mimusgundlachii 0200.015 Mimuspolyglottos i100 75 Mimusgundlachd '96O.OL08 Mimusgilvus Mimusgilvus Dumetella carolinens•s 0.058 Dumetellacarolinensis

95 86 Melanoptilaglabnrostris 1CO

56 117 0.037 Margarops(Allenia) fuscus 49 26 1O0 0.044 Melanoptilaglabfirostns 0'-•10t _•,r]0.040 Ramphocinclus brachyurus 120 Ramphocinclusbrachyurus 48 0.005• 0.045 Margarops(Allema) fuscus59 5 6 70 Margaropsfuscatus 19 0.006U 0.022 Margaropsfuscatus 91 27 Cinclocerth/agutturalis

4 100 27 C•nclocerfhia ruficauda Dom•nica 56 0.800061 0.00.•9Cinclocerthia gutturalis --50 changes 100 C/nclocerthiaruficauda 38 Cinclocerfhia ruf•cauda •2½0• St.LuciaMontserrat 0.007 Dominica 98 0.020•10.011 CinclocerthiaSt.Luc•a ruficauda --0.01 substitutions/site Montserrat FIG.5. Maximum-parsimony-basedphylogenetic hypothesisfor the Antillean tremblers, thrashers, F•G.4. Maximum-likelihood-basedphylogenetic and outgroups(Mimidae). The parsimony analysis hypothesisfor the Antillean tremblers, thrashers, was a branch-and-boundanalysis of the combined and outgroups(Mimidae). The tree is basedon anal- mitochondrialand myoglobinsequence data using a ysis of approximately 4,270 bp of combined mito- Golobofffit of k = 2. The resultingconsistency index chondrialand nuclear-encodedmyoglobin DNA se- was 0.67. The numberof nucleotidechanges along a quence. Genetic distances are shown above the branchare shownabove the branch. Bootstrap values branchesand were calculatedusing a generaltime- based on 1,000 replicatesare presentedbeneath the reversiblenucleotide substitutionmodel (seetext for branches.Myoglobin intron 2 insertions(dark rect- details).Confidence in the branchingorder was as- angles)and deletions(open rectangles) are mapped sessedwith 1,000bootstrap estimates with the pro- in the single most parsimoniousreconstruction of portion of times that a clade was supportedshown their evolution.The treewas rooted using Mimus and beneaththe branchleading to the clade.Myoglobin Melanotisas outgroups. intron 2 insertions(filled rectangles)and deletions (open rectangles) are presented in one of several minimum mutation step pathways. The tree was flectingdifferent colonization and demograph- rooted using Mimus and Melanotisas outgroups. ic historiesof the islandpopulations (Table 4). Molecularsystematics of CaribbeanMimidae.-- 28). Table 4 lists clade designationsand asso- For further appraisalof the phylogeneticrela- ciatedgenotype patterns produced by the re- tionshipsof the Caribbeanmimids, we selected striction enzymes. Only a single individual one representativeof eachMaragarops species from the M. fuscuspopulation on Montserrat and the threedistinct mtDNA cladesof the ge- displayeda novelRFLP genotype(DE) not ob- nus Cinclocerthia.We includeda representative servedin the initial sequence-basedanalyses. from eachof the two Antilleanendemic species SubsequentATPase sequencing and phyloge- (Ramphocinclusbrachyurus and Mimus gundla- neticanalysis of thatindividual placed it with- chii) for which we had samplesfrom only a in cladeA. The RFLPdata provided additional single population. Dumetellacarolinensis and supportfor the phylogeographicseparation of Melanotiscaerulescens represented putative out- thetwo M. fuscusclades documented by our se- groups,whereas Melanoptila glabrirostris and quence-basedanalysis of smaller numbers of the Mimusspecies served as certain outgroups individuals.Increasing the samplesize of M. for the Antillean endemic thrashers and trem- fuscatusindicated that mtDNA clades,while co- blers.Phylogenetic analysis was basedon the occurringon three of five islands,present an roughly 4,270 nucleotidesof combineddata, uneven geographicdistribution perhaps re- giventhat a partitionhomogeneity test (Farris 46 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118

0.046 Melanotis caerulescens LogDet (-In L: 13139.53)analyses (Figs. 5 and 6, respectively).

4 All analysesidentified three deeplyjoined • 0,030 mimid lineages(Figs. 4, 5, and 6). Oneof these I 37 100 •04.00,022 Mimus gundlachii lineagesincludes the three species of Mimus, 10012I 0.0080.012 MimusMirnus gilvuspolyglottos the second is formed by Melanotiscaerulescens, and the third comprisesthe catbirdsand An- 0.033 Dumetella carolinensis tillean thrashers and tremblers. All trees also group the three CinclocerthiamtDNA lineages 0.011I 0.028Melanoptila glabrirostris with Margaropsfuscatus.That result was strong-

O,OO3[•l O.O29 ly supportedin the MP (91%bootstrap) and NJ Ramphocinclusbrachyurus (98%bootstrap) analyses, but lessso in the ML

0, 0.029 Margarops(Allenia) fuscus analysis(80% bootstrap).There was alsocon- cordanceacross all analysesregarding the re- Margaropsfuscatus lationshipsamong the three Mimus species with M. polyglottosand M. gilvussharing more recentancestry with eachother than with M. gundlachii. 5•6•7•9080•L • lO00,019 0.010o.009Cinclocerthia Cinclocerthiagutturalisruficauda 0.012l St, Lucia Differences in thethree trees lie in thehighly --0,01 changes0.00399 __•0.OLO Cinc/ocerthia Dominicaruficauda unstable position of Ramphocinclusbrachyurus. Montserrat In the ML tree (Fig. 4), Ramphocinclusgrouped FIG. 6. Neighborjoining-based phylogenetic hy- with Dumetellaoutside Melanoptila and the Cin- pothesisfor the Antillean tremblers,thrashers, and clocerthia/Margaropsclade, whereas in the MP outgroups(Mimidae). Genetic distances are shown (Fig. 5) and NJ (Fig. 6) treesRamphocinclus joins above the branchesand were calculated using a the other Antillean thrashers and tremblers as LogDet-paralinear nucleotide substitution model the sistergroup to Melanoptila.Although both and the combined mitochondrialand myoglobin the MP and NJ analysessupport the monophy- data. Bootstrapvalues based on 1000 replicatesare ly of the Antilleanthrashers and tremblers,the presentedbeneath the branches.Myoglobin intron 2 bootstrap-basedconfidence of monophylyis insertions(dark rectangles)and deletions(open rectangles)are mappedin the singlemost parsimonious not strong.Furthermore, the positionof Ram- reconstruction of their evolution. The tree was rooted phocincluschanges between the MP tree,where using Mimus and Melanotisas outgroups. it is the sisterof Margaropsfuscus, and the NJ tree,where it is the sistertaxa of the remaining Antillean endemic tremblers and thrashers. et al. 1995) on the combineddata set for all the The monophylyof the Antillean thrashersand mtDNA regions(6 partitions;3,491 bp) and the tremblersis further supportedby the myoglo- nuclear region (1 partition, 699 bp) indicated bin indeldata (Figs. 4, 5, and6), althoughthose that the generegions did not differ significant- data do not resolvethe positionof Ramphocin- ly, whether tested as 7 gene partitions (P = clus within the Antillean clade. 0.88) or two partitions (mtDNA and myoglo- The phylogeneticresolution afforded by bin; P = 0.98). mtDNA, whetherprotein coding or ribosomal MODELTEST (Posadaand Crandall 1998) in- sequences,was clearlygreater than that of the dicatedthat a generaltime-reversible (GTR) "6 nuclear myoglobinintron. However,LogDet ST" substitutionmodel (Rodriguez et al. 1990) distancesconnecting sister taxa or a terminal incorporatingan estimated proportion of 0.44 taxon and the basalnode of its sisterclade (n = invariable sites and a gamma distribution 11) were not stronglycorrelated for protein- shapeparameter of 0.28 best fit the combined coding and ribosomalmtDNA sequences(r = data. The mimid tree based on this model is 0.41, P = 0.21). Distances calculatedfor the presentedin Figure4. However,the log-likeli- myoglobinintron 2 were0 for 5 of thebranches, hood estimated for ML tree (-In L: 13132.27) corresponding to mtDNA protein distances wasnot significantlybetter than the log-likeli- less than 6-9% and ribosomal distances less hoodscalculated for two alternativetopologies than 1.45%.Myoglobin distances (including ze- identified by MP (-In L: 13149.08) and NJ ros) were positivelycorrelated with ribosomal January2001] CaribbeanMimidae Systematics 47

(r = 0.80, P = 0.003, n = 11) but not signifi- DISCUSSION cantlywith mtDNA protein(r = 0.39,P = 0.24, n = 11) distances.When regressionswere We touchupon four issuesin this discussion: forcedthrough the origin,percentage of nucle- (1) the relativephylogenetic information con- otide substitution was observed to increase tent of the gene regions sequencedin this 0.19 (+__0.03)times as rapidly in rDNA sequenc- study; (2) the phylogeographyof severalspe- cies of West Indian mimids for which we have esand 0.11(+0.03) timesas rapidly in themyo- globin intron 2 as in protein-coding mtDNA sampled multiple island populations;(3) the molecularphylogenetics of WestIndian mimid sequences. The robust grouping of Cinclocerthiawith species;and (4) the taxonomicimplications of our molecularphylogenetic analysis. The West Margaropsfuscatus prompted us to test the Indian mimids are particularly interestingbe- monophylyof the genusMargarops. The null causeof their high level of endemism(three or hypothesisof Margaropsmonophyly was re- four endemicgenera) and the possiblemono- jected with 95% confidencebased on a maxi- phyly of someor all of the WestIndian endemic mum-likelihoodratio testand parametric boot- genera.In so far as thosegenera do constitute strapping(Huelsenbeck et al. 1996).The same a single clade,they would representthe only analyticalapproach failed to rejectthe null hy- radiation of birds within the West Indies that pothesisof monophylyfor the entire groupof has led to substantialsympatry on individual Antillean thrashers and tremblers, but the test islands(four taxa on St. Lucia and Martinique alsofailed to rejectthe alternatehypotheses in in the LesserAntilles). In addition,although which either Melanoptilaor Dumetellawere two of the endemictaxa (Margaropsfuscus and placedinside Ramphocinclus. M. fuscatus)are widely distributedthroughout The Kishino-Hasegawa(1989) test demon- the Lesser Antilles, Cinclocerthiahas fewer, strated a significantlog-likelihood difference morehighly differentiatedisland populations, between the best tree and one for which nucle- and Ramphocinclusis restrictedto two islands. otide substitutions were assumed to be clock- Thus, it would be instructive to determine like. The non-clock-like molecular evolution of whether distribution and taxonomic differen- the mimidswas explored in greaterdetail with tiationare relatedto phylogenetichistory. the Takezaki et al. (1995) two-cluster and Phylogeneticinformation content.--Nucleotide branch-lengthtests. The two-clustertest did bias, transition / transversion bias, and hetero- not uncoversignificant rate variation between geneity among sites in the rate of nucleotide a cluster composedof catbirds and Antillean substitution are important considerationsin thrashers and tremblers, and a second cluster makinginferences about phylogenetic trees (Li includingMelanotis and Mimusspecies. We next 1997).Among the gene regionssequenced in centered our focus on catbirds and Antillean this analysis,the 12S and 16S ribosomalre- endemic thrashers and tremblers and used MO- gionsand the myoglobinintron 2 showedthe least nucleotide bias and the most uniform nu- DELTEST (Posada and Crandall 1998) to find cleotidecomposition overall. The mtDNA ND2 the bestmodel and parametersfor that group and ATPase6 and 8 regionsshowed the great- alone.Although the analyticaloutcome was the est nucleotidebias, with a deficiencyof G and sameas previouslydescribed for the full taxo- excess of C and, to a lesser extent, A. Nucleo- nomic sampleof 12 mimid taxa (a GTR model tide biaswas greatest at the third position.Mir- of evolution and a tree with the same internal roring differencesin nucleotidebias, the ND2 topologyfor the groupas presentedin Fig. 4), and ATPase6 and 8 regionsexhibited the high- the parameters,particularly gamma (13.00), est percentagesof variable sites (33 and 31%), differed considerably.We used that tree to and ribosomalregions (7.7%) and myoglobin comparethe root-to-tipbranch length of each intron 2 (9.4%) exhibitedthe lowestpercent- taxon with the averageroot-to-tip distance ages.The COI regionwas intermediatein var- (branch-lengthtest), and determinedthat Du- iability, primarily becauseof extreme conser- metella,and the two Margaropsspecies had sig- vatismin the first and secondpositions relative nificantly different branch lengths than the to thosein ND2 and ATPase6 and 8. The pro- average. portion of phylogeneticallyinformative sites 48 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118 and the transition/transversionratio paral- Montserrat (Hellmayr 1934) and Guadeloupe leled the percentageof variablesites (Table 2). (Storer1989). In the absenceof samplesfor ge- Althoughthe myoglobin intron 2 wasrelatively neticanalysis from the morenorthern islands, invariant, even the absenceof divergencein the simplestexplanation for thatpattern of uni- thatsequence is informative.In thisstudy, com- formity is that C. ruficaudahas recentlycolo- parisonsbetween taxa with 0.0% divergence nized thoseislands from Guadeloupe. were associatedwith mtDNA sequencedis- The disjunctionbetween the closelyrelated tancesof 2.8-8.8%,whereas comparisons with members of clade C on Dominica and St. Vin- myoglobin intron 2 divergencesexceeding centis moreproblematic because it requiresei- 0.0% were associated with mtDNA distances of ther long-distancecolonization from one of 6.2-14.7%. thoseislands to the other,or stepping-stone Phylogeography.--Allendemic West Indian colonization between the two islands with the mimid speciesare characterized by moderately subsequentdisappearance of C. ruficaudage- longbasal branches and variousdepths of ter- notypes from the intervening C. gutturalis minal diversificationas measuredby mtDNA (cladeA) islandpopulations. The nuclear myo- divergence(Fig. 3). The relativelylong basal globin intron 2 exhibitedno differentiation branchescompared to shortgenetic distances among clades of tremblersand thus cannot within taxa suggesta fairly high turnoverof helpto resolvethat problem. Supposing that C. lineagesand relativelyshort coalescence time ruficaudacoexisted recently with C. gutturalis within the WestIndies, a findingthat applies on Martinique and St. Lucia, it is surprising generallyto the LesserAntillean taxa that we that the latter two populationshave retained have studied (Seutin et al. 1993, 1994; Ber- theirdistinctive appearance and especially that minghamet al. 1996,Lovette et al. 1998,1999a). St. Vincent birds do not resemble St. Lucia The deepersplitting of lineagesin Margarops birdsmore closely than theyresemble Domin- fuscusand Cinclocerthiais generallycongruent ica birds. with geographicaldistribution. The two clades Numbers of individuals sampledfrom Dom- of M. fuscuscorrespond to populationson the inica (7), St. Lucia (2), and St. Vincent (1) were northern Lesser Antillean islands from Mont- smallenough that the observeddistribution of serrat through Dominica (clade A) and the lineagesmight have resulted from nonrandom southernislands of Martinique and St. Lucia samplingfrom a homogeneousdistribution of (cladeB). AlthoughDominica and Martinique haplotypesoccurring from Dominicasouth to are separatedby only 33.8 km, we found a dis- at least St. Vincent. However, a uniform distri- tinct genetic break between M. fuscus from bution of genotypesover the islandsbetween thoseislands. M. fuscusis thoughtto be extinct St. Vincentand Dominicais highlyunlikely. If on Barbuda and Grenada at the northern and haplotypeswere present in proportionsof 50% southern extremes of the distribution, and we A and 50% C, the probabilityof drawingthe did not samplethe specieson St. Vincent. observed distribution would be only 0.5•ø = Thephylogeography of theCinclocerthia pop- 0.001,and the probabilityof any disjunctpat- ulationsindicates a dynamichistory within the tern would be only 0.002. Even if proportions LesserAntilles (Figs.1 and 3). On onehand, were 80% A and 20% C, the probabilityof deepsplits between some islands suggest long drawing the observeddistribution would be evolutionaryindependence and lack of migra- 0.8s x 0.22,or only 0.0067.The probabilityof tion amongislands. On the other hand, the that result is maximizedwhen the proportion presenceof closelyrelated genotypes on other of theSt. Vincent genotype is 1/ 8, in whichcase islandssuggests continued inter-island move- the probabilityis 0.049. ment or recent colonization. It is remarkable It is alsohighly unlikely for two reasonsthat that movementmight have occurredbetween birds from Dominicawere introducedrecently the Guadeloupeand MontserratC. ruficauda to St. Vincent. First, nucleotidedivergence in populationsto the northas evidencedby their the ATPase6,8 regionbetween the C groupof membershipin cladeB, but not betweenGua- mtDNA haplotypeson St. Vincentand Dom- deloupeand Dominicatrembler populations to inicaaverages 0.83%, which exceeds the range the south.Cinclocerthia ruficauda from Nevis to of divergencefound within mostisland popu- Sabaare indistinguishable from individuals on lationsof LesserAntillean birds (e.g.Seutin et January2001] CaribbeanMimidae Systematics 49 al. 1993,1994; Lovette et al. 1998).The highest 0.71-0.95%.The lack of differentiationamong within-islanddivergence observed among Cin- populationsof M. gilvusin the LesserAnt, illes clocerthiahaplotypes was 0.35%. Second,the (inter-island distances 0.00-0.12%) suggests chanceof drawing one genotypefrom a popu- that geneflow connectsthe islandpopulations. lation(the St. Vincentsample) for whichseven Alternatively,tropical mockingbirds may have independentdraws (the Dominica sample) recentlyspread throughout the islandsfrom a cameup with alternative(albeit closely related) centerwithin the LesserAntilles, having orig- genotypesis slim. inally colonizedthe islandsfrom the mainland Thus,the parsimoniousalternative to a sam- sometimein the past. pling explanationfor the observeddisjunction Assumingclock-like behavior of nucleotide is fairly recentlong-distance colonization of St. substitutionin the mtDNA ATPase6,8 genere- Vincent from Dominica. Because the St. Vincent gion, and a rate of divergenceof 0.02 per mil- haplotype is considerablymore distant from lion years (Fleischeret al. 1998),it is possibleto the Dominicanhaplotypes (0.71-0.95%) than assignapproximate relative ages to the diver- anyof the Dominicanhaplotypes are from each sificationof conte_mporaryclades. These esti- other (0.00-0.35%), sufficientdivergence ap- matesvary from 2.0-2.1 Ma for Cinclocerthia,to pearsto have occurredbetween the islandsto 1.1 Ma for M. fuscus,0.5-0.6 My for M. fuscatus, rule out the possibilityof pre-Columbianhu- and perhaps0.4-0.6 Ma for M. gilvus,and 0.3 man transport.In our analysesof othertaxa in Ma for M. polyglottos,although the mimid phy- the LesserAntilles, long-distancecolonization logenetictree exhibitssignificant rate hetero- eventsappear to be uncommon.Further reso- geneity.Thus, diversificationof contemporary lution of the Dominica-St.-Vincentdisjunction lineagesshows no particulartemporal congru- in Cinclocerthiawill require additional sam- ence,which might have occurredif diversifi- pling from theseislands plus from St. Lucia cationhad respondedto a singlestrong exter- and Martinique, as well as alternative genetic nal signal in the environment (Pregill and assays. Olson 1981). In addition, diversification of in- Margaropsfuscatus exhibits considerable ge- dividual island populationsdates from as long netic diversity within the LesserAntilles and agoas 2.1 Ma, wellbefore the onset of thePleis- Puerto Rico (Fig. 3), and intrapopulation dis- toceneglacial cycles. However, the phylogeog- tanceson the well-sampledislands of Puerto raphy of Caribbeanmimids and the lack of Rico, Montserrat, and Guadeloupe averaged sequencedivergence among many island pop- 0.63, 0.64, and 0.68%; however, the species ulations,also provides a record of geneflow or showsrelatively less geographical structuring colonizationevents among islandsthat have thanM. fuscusor Cinclocerthia.Clade A is found continuedto the presentin somecases. throughoutmost of the speciesdistribution When we considerall mimid taxa, it is ap- (Fig. 1); it is most commonon Puerto Rico and parentthat geneticbreaks within speciesin the appearsto be absentfrom Dominicain the Lesser Antilles appear at different places: south. Clade B predominateson Montserrat, South-America-Grenada(Mimus gilvus), St.- where 22 out of 26 individualshad that hap- Vincent-St.-Lucia (Cinclocerthia), St. Lucia/ lotype,but this cladewas also found on Puerto Martinique-Dominica (Cinclocerthia),Martin- Rico. Clade C is restricted in our sample to ique-Dominica (Margaropsfuscus), Dominica- Guadeloupe and Dominica. Guadeloupe (Cinclocerthia),and Guadeloupe- The two widespreadspecies of Mimusshow Montserrat(Margarops fuscatus). That lack of little differentiation within the West Indies geographiccongruence and the differentrela- (Figs.2 and 3). However,populations of M. po- tive agesof the geneticbreaks suggest that the lyglottosin the GreaterAntilles (clade B: Jamai- phylogeographyof eachof the mimid species ca, Puerto Rico, and the Dominican Republic) hasdeveloped independently within theLesser are distinguishablefrom thosein the Bahamas Antilles. and alsofrom our singleNorth Americanspec- Geneticand taxonomic differentiation.--The in- imen (cladeA) by averagegenetic distances of traspecificdiversification of island populations 0.6-0.7%. Lesser Antillean M. gilvus (clade A) of WestIndian mimids has long been acknowl- are distinguishablefrom birdsin Trinidadand edgedby the manysubspecific names assigned Venezuela (clades B and C) by distances of to thosetaxa. In severalcases, our samplingof 50 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118 multiple island taxa permits us to commenton pared to mtDNA divergence,and they do not how well subspecificdesignations match mo- identify monophyleticgroupings of popula- lecularphylogeographic results. tionsin this species. The trembler Cinclocerthia has been subdivid- Within the area consideredin this study, ed into as many as six named units (Davis and Bond (1950) recognizedtwo subspeciesof Mar- Miller 1960). The absenceof mtDNA differen- garopsfuscatus, namely M. f. fuscatus,occurring tiation amongthe northernislands occupied by from the GreaterAntilles to Antigua and Bar- this taxonsuggests that the separationof C. r. buda in the northernLesser Antilles, and M. f. pavida(Montserrat) and C. r. trernula(Guade- densirostris,occurring from Montserrat and loupe) is not warranted, a conclusionalso Guadeloupesouth. For the most part, M. fus- reachedusing morphometric criteria by Storer catusshows no consistentgeographical pattern (1989),who groupedthose island populations in geneticvariation. However, the relativenum- togetherin C. r. trernula.Similarly, C. r. ruficauda bers of individuals from Montserrat, Guade- of Dominica and C. r. tenebrosa of St. Vincent are loupe,and Dominicathat are assignedto clades sistertaxa, althoughthey exhibitmoderate ge- B and C, in comparisonto clade A M. fuscatus netic differentiation (d = 0.83%). Storer (1989) that predominateon islandsto the north, sug- recognizedthe similarity between those two gestthat the differencesnoted by Bondmay in- forms,as opposed to differencesbetween other dicate a period of separationbetween M. fus- island populations.He also emphasizedthe catuspopulations in the southernand northern distinctivenessof C. r. gutturalisof Martinique parts of its range. and C. r. rnacrorhynchaof St. Lucia by elevating Ramphocincluspopulations on St. Lucia and those two island populationsto specificrank, Martinique have been variouslydistinguished C. gutturalis.Unfortunately, we did not sample as separate species(Ridgway 1907) or well- Cinclocerthiaon Martinique and so we cannot marked subspecies(Hellmayr 1934, and more commenton the geneticsimilarity of the Mar- recent treatments).We did not samplethe en- tinique and St. Lucia populations.Storer's care- dangered Ramphocincluspopulation on Marti- ful study of morphologicalcharacters of Cin- niqueand thereforecannot comment on the ge- clocerthia generally parallels the genetic neticdivergence among those populations. The distinctionsobtained in this study,although he absenceof subspeciesdistinctions in West In- recognizedonly two principal Cinclocerthialin- dian populationsof Mimus gilvusand M. poly- eages, whereas the molecular data identify glottosis consistentwith the absenceof signif- three distinctlineages. icant mtDNA genetic differentiationbetween AlthoughBond (1950) recognized no subspe- island populations.The Antillean populations cific differentiationin Margaropsfuscus, Buden of M. gilvusare recognizedas a distinctsub- (1993) grouped populationsfrom Guadeloupe species(M. g. antillarum,Bond 1950),which is and islandsto the north (M. f. hypenernus),as consistentwith theirmoderate genetic distance distinct from populationson Dominica, Mar- from populationsin Trinidad and Venezuela. tinique, and St. Vincent (M.f. fuscus),and on St. Molecularsystematics.-•Dur extended analy- Lucia (M. f. schwartzi).Our molecular data are sis of DNA sequencesfor each cladeof Antil- incongruentwith that arrangementbecause lean endemicsand other speciesof Caribbean- they place birds from Dominica with those basin mimids allows us to address three issues from Guadeloupe and Montserrat, and birds concerningrelationships among West Indian from Martinique with thosefrom St. Lucia.We endemic mimids: (1) the species-leveldiffer- did not samplebirds from St. Vincent and so entiationof the tremblers(Cinclocerthia), (2) the we cannotcomment on the supposeddisjunc- relationshipsamong Margarops and Cinclocer- tion in M. f. fuscus.However, Kratter and Gar- thia,and (3) the monophylyof the Antilleanen- rido (1996)later separatedSt. Vincentbirds (M. demic thrashers. f. vincenti)on the basisof the extentof the white Storer (1989) placed the tremblersof Marti- tips on the outer tail feathers.Buden's subspe- nique and St. Lucia in a separatespecies (C. cific distinctions are based on measurements, gutturalis,the Gray Trembler)on the basisof which permittedthe quantitativeclustering of differencesin plumagecoloration and reduced some populations.However, morphological sexualdimorphism in culmenlength in the St. charactersappear evolutionarilylabile com- Lucia population.That resulted in the Brown January2001] CaribbeanMimidae Systematics 51

Trembler (C. ruficauda)having a geographic are reasonablyconfident of the monophylyof disjunctionbetween populationson Dominica Margaropsand Cinclocerthia.Considering the and St. Vincent. The moleculardata support presentLesser Antillean distributions of those the species-leveldistinctiveness of C. gutturalis, generaand the fact that the PuertoRican pop- but are also evidencefor a split almostas deep ulationof Margaropsfuscatus shares genotypes betweenC. ruficaudapopulations on Dominica with birds on Montserrat, Barbuda, and Gua- and St. Vincent,on onehand, and Guadeloupe deloupe,it is plausiblethat that claderadiated and Montserrat,on the other (Figs.3-6). Cin- within the Lesser Antilles. Less certain, how- clocerthiagutturalis appears to be the basal ever,are the phylogenetic positions of theLess- memberof the group,and bootstrapsupport er Antillean White-breastedThrasher Rampho- for the sisterstatus of the two C. ruficaudalin- cinclus and the continental Dumetella and eageswas high in all analyses(Figs. 4-6). Ap- Melanoptila. plicationof a molecularclock suggested that Bond (1963) regarded Cinclocerthiaand Ram- differentiation of the three Cinclocerthia line- phocinclusas a group related to Melanotis;Mar- agesprobably occurred in the late Pliocene. garopsrepresented a secondgroup not closely The secondsystematic issue addressedby relatedto any mainlandgenus. Clearly that in- our analysisinvolves the monophylyof the ge- terpretationis incorrecton the basis of our nusMargarops and its relationshipto Cinclocer- data. Melanotis is basal within the mimids, and thia. Margaropsfuscus, the Scaly-breastedMelanoptila groups more closelywith the An- Thrasher,was originallyallied with the Forest tillean forms as well as with Dumetella. Bond Thrush (Cichlherminialherminieri: Turdidae) further noted that all the Antillean thrasher (Sclater1871). However, Cory (1891)placed the and tremblerspecies have immaculate,green- Scaly-breastedThrasher in the genusAllenia in ish blueeggs, like thoseof Melanotis,Melanop- the Mimidae followingarguments for the re- tila, and Dumetella,but unlikethose of anyspe- moval of this thrasherfrom the Turdidae (Ste- ciesof Mimus.Depending on the phylogenetic jneger 1883). Following Bond (1956), Alleniais positionof Melanotis,that charactereither links usuallymerged with the Pearly-eyedThrasher Melanotis to the West Indian thrashers, albeit in the genusMargarops. Zusi's (1969)compari- deeplywithin the mimid phylogeny,or it rep- son of skeletonsrepresenting all 13 generaof resentsthe primitive egg colorationof the Mimidaesuggested that Cinclocerthiais closest to Margarops.However, analyses based on skull Mimidae(shared by somemembers of the sis- anatomyled Zusi to suggestthat bothMargar- ter taxonSturnidae), which was subsequently opsspecies share a morerecent common ances- lost in the genusMimus. tor than either shares with Cinclocerthia. The Melanoptila,Dumetella, and Ramphocinclus,to- mtDNA results support Zusi's conclusionre- getherwith the Margarops-Cinclocerthiaclade, garding the generallyclose relationship be- clearlyconstitute a monophyleticgroup, with tweenCinclocerthia and Margarops, but theskull Melanotisand Mimus as outgroups.If Rampho- charactersthat set Cinclocerthiaapart from the cinclus were basal within the Antillean endem- othertwo speciesare not paralleledby the pat- ics,then onecould plausibly postulate a Lesser tern of moleculardifferentiation. Forcing the Antillean radiation for all the endemic taxa pairingof theMargarops species with Cinclocer- from a single Antillean ancestor.However, if thiaas their sister taxon in anyof the treespre- Ramphocinclusgrouped with eitherDumetella or sentedin Figure 4 significantlyreduced the Melanoptila,or formeda polytomywith bothof likelihoodof the trees.Forcing the pairing of them,then one could postulate that Ramphocin- M. fuscuswith Cinclocerthiaalso produced an clusand the Margarops-Cinclocerthia clade were unlikely arrangement.As it standsat present, independentlyderived from an ancestorwith a the genusMargarops is probablyparaphyletic broad former distribution that included conti- with M. fuscus(Allenia) basal to M. fuscatusand nental Central and North America. In the un- Cinclocerthia. likely circumstancethat Ramphocinclusis basal Our third issueconcerns the monophylyof to the entireclade, including Dumetella and Me- the endemicAntillean thrashersand the pos- lanoptila,then either the cladehad an Antillean sibleadaptive radiation of thegroup within the origin and later colonizedthe continentor WestIndies, most likely theLesser Antilles. We Ramphocinclusis an island relic of an extinct 52 HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118 lineage with a broad, continent-baseddis- cleotidedivergence of between9 and 11%,the tribution. ancestor(s)of the clade were distributed on Phylogeneticanalyses based on sequencedi- both the continent and within the West Indies. vergenceare ambivalentabout the placement of Ramphocinclusand the Margarops-Cinclocerthia Ramphocinclus,Dumetella, and Melanoptila.The cladelikely are independentrelics of thosean- neighbor-joiningtree places the continental cestraltaxa and possiblyare derivedfrom the speciesas basal to the Antillean endemics,al- same colonizationof the West Indies by a con- thoughbootstrap support for this arrangement tinental mimid. If the observedunique indels is not strong,and forcingMelanoptila interior to held those generatogether, then they could Ramphocinclusdoes not lengthenthe tree sig- represent a radiation derived from a unique nificantly. The maximum parsimonytree also Antillean ancestor,comparable to the radia- supportsthe monophylyof the Antillean en- tions of Darwin's finches and Hawaiian hon- demics,but links M. fuscusand Ramphocincluseycreepers. (Fig. 5). The maximum-likelihoodtree places The phylogeographyof extantmimids sug- Dumetellaand Ramphocinclus together and plac- geststhat colonization of the LesserAntilles by es Melanoptilawith the otherAntillean endem- the ancestor(s)of the endemic genera must ics, but the basal internode branches are short have occurredby way of the GreaterAntilles, and poorly supported(Fig. 4). Thus, our se- but at presentthere is no extantendemic trem- quence-basedanalysis does not resolvethe rel- bler or thrasher in the Greater Antilles. Mar- ative positions of the basal taxa in the clade garopsfuscatuson PuertoRico is clearlyderived containing the endemic Antillean mimids. from the Lesser Antilles. Thus, the West Indian However, additional support for uniting the mimids apparentlypersisted on severalislands Antillean endemicgenera comes from two in- in the LesserAntilles, occasionally undergoing dels in the myoglobin intron 2, which are periodsof spreadwithin the islands,followed sharedby Ramphocinclus,Margarops, and Cin- by speciesformation and extinctionof island clocerthia.Because the likelihood of obtaining populations.If we assumedthat speciationre- thosesame indels independently is small,those quires allopatric separationof gene pools on charactersappear to providegood synapomor- differentislands, then we would haveto pos- phiesfor the Antilleanendemics. tulatethat the generationof theMargarops-Cin- Whether the polytomy of Melanoptila,Du- clocerthia clade within the Lesser Antilles in- metella,and the Antillean thrashers is hard or volved as many as 16 phases of island soft would be difficult to determine without colonization.That figure representsone colo- additional sequencingof nucleargenes. The nization phase at each node in the clade,in- basalnode of this cladein theneighbor-joining cluding the contemporarydistributions of un- tree subtendsa genetic distance of 10.7% for differentiatedpopulations on more than one protein-coding mtDNA sequences.Consider- island. Frequent extinctionsof island popula- ing the nucleotidesubstitution bias in those tionsare alsoimplied by the absenceof highly regions,the saturationlevel for nucleotidesub- divergenthaplotypes of the samespecies on a stitutions is probably close to 15% for transi- single island. Overall, the picture painted by tions in third-position sites (Seutin and Ber- phylogeographicand molecular systematic mingham unpubl. data), and so additional analysisof Antillean mimids is one of a high sequencingof the mitochondrialgenome might level of evolutionarydynamism when viewed increaseresolution somewhat. Slower-evolving on the scaleof a few million years. nuclearprotein coding regions might showless homoplasy,but long nucleotide sequences ACKNOWLEDGMENTS would be needed to provide sufficient infor- mativecharacters. Noncoding regions hold out Our laboratory work was supported by grants froin the Smithsonian Institution and National Sci- the possibilitiesof phylogeneticallyinforma- enceFoundation (DEB-9419645). Fieldwork was sup- tive indels, such as those observedin the mimid ported by grants from the National GeographicSo- myoglobinintron 2. ciety and the SmithsonianInstitution. We thank Regardlessof whetherthe apparentpolyto- GillesSeutin, Parks Canada, who organizedand di- my at the base of the catbird-thrasherclade is rected our field expeditionsand initiated our molec- hard or soft, it is clear that at an ATPase 6,8 nu- ular studies of Caribbean birds; and Irby Lovette, January2001] CaribbeanMimidae Systematics 53

Universityof Pennsylvania,another central member BOND, J. 1963. Derivation of the Antillean avifauna. of both our field and laboratory-basedstudies of Ca- Proceedingsof the Academyof Natural Sciences ribbean birds. Vijay Aswani is gratefully acknowl- of Philadelphia115:79-98. edgedfor assistingwith the dataanalysis. This study BUDEN,D. W. 1993. Geographicvariation in the would have been impossiblewithout the assistance Scaly-breastedThrasher Margarops fuscus with of national and local authorities of countries within descriptionsof threenew subspecies.Bulletin of the CaribbeanBasin. We are gratefulto the Agricul- the BritishOrnithologists' Club 113:75-84. ture, Forestry,and Environmentministries of the Ba- CORY, C. B. 1891. Notes on West Indian birds. Auk 8: hamas, Barbuda,Dominica, Grenada,Guadeloupe, 41-46. Jamaica, Martinique, Montserrat, Puerto Rico, Re- DAVIS,J., AND A. H. MILLER.1960. FanLily Mimidae. public of Dominica, St. Lucia, St. Vincent, Trinidad Pages440-458 in Check-listof Birdsof theWorld and Chacachacare,and Venezuelafor granting the (E. Mayr and J. Greenway, Eds.). Museum of research,collecting, and exportpermits that havefa- Comparative Zoology No. 9, Cambridge, cilitated our studies of Caribbean birds. We thank E Massachusetts. Sheldon and D. Dittmann of the Louisiana State Uni- DESJARDINS,P., AND R. MORALS.1990. Sequenceand versity Museum of Natural Scienceand Michael gene organizationof the chickenmitochondrial Braunand Gary Gravesof the Smithsonian(U.S. Na- genome--A novel order in higher vertebrates. tional Museumof Natural History) for the generous Journalof MolecularBiology 212:599-634. loan of tissue samples.We also thank S. Cardiff, F. DONNELLY,t. W. 1985. Mesozoic and Cenozoicplate Gill, P. Marra, J. V. Reinsen, T. J. Parsons, R. L. evolutionof the Caribbeanregion. Pages 89-121 McKernan, and K. Rosenbergfor collectingtissues in The Great American BioticInterchange (E G. and associatedvoucher specimens. More information Stehli and S. D. Webb,Eds.). Plenum Press,New concerningsome primers used in this study can be York. found at http://nmg.si.edu/bermlab.htm. D. Swof- DONNELLY,t. W. 1989.Geologic history of the Carib- ford kindly allowed us to use a prereleaseversion of bean and Central America.Pages 299-321 in The PAUP*.We thank V. Apanius,D. Wechsler,W. Shew, Geology of North America--An Overview vol. and P. Sievert for their assistancein the field, B. Kess- A (A. W. Bally and A. R. Palmer,Eds.). The Geo- ing for helpful suggestionson laboratorytechniques logical Societyof America, Boulder,Colorado. and data analysis, and S. Hackett and J. Bates for FARRIS, J. S., M. K•LLERSJO,A. G. KLUGE, AND C. their comments on an earlier version of this manu- BULT. 1995. Testing significanceof incongru- script.We are gratefulfor the constructivecriticism ence. Cladistics 10:315-319. provided by JoannaFreeland and two anonymous FLEISCHER, R. C., C. E. MCINTOSH, AND C. E. TARR. reviewers. 1998. Evolution on a volcanicconveyor belt: Us- ing phylogeographicreconstructions and K-Ar- LITERATURE CITED based agesof the Hawaiian Islands to estimate molecularevolutionary rates. Molecular Ecology AMERICAN ORNITHOLOGISTS' UNION. 1983. Check- 7:533-545. list of North American birds, 6th ed. American GOLOBOFF,P. A. 1993. Estimatingcharacter weights Ornithologists'Union, Washington,D.C. during tree search.Cladistics 9:83-91. BAKER,M. C. 1981. A musclebiopsy procedure for GULLEDGE,J. L. 1975.A study of pheneticand phy- use in electrophoreticstudies of birds. Auk 98: logenetic relationshipsamong the mocking- 392-393. birds, thrashers and their allies. Ph.D. Disserta- BERMINGHAM, E., G. SEUTIN, AND R. E. R1CKLEFS. tion, City University of New York, New York. 1996. Regional approachesto conservationbi- HASEGAWA,M., H. KISHINO, AND t. YANO. 1985. Dat- ology: RFLPs, DNA sequence,and Caribbean ing of the human-ape splitting by a molecular birds. Pages104-124 in Molecular Genetic Ap- clock of mitochondrial DNA. Journal of Molec- proachesin Conservation(T. B. Smith and R. K. ular Evolution 22:160-174. Wayne, Eds.). Oxford University Press, New HELLMAYR,C. E. 1934. Catalogue of birds of the York. Americas,part 7. Field Museum of Natural His- BOND,J. 1950. Check-list of Birds of the West Indies. tory ZoologicalSeries 13. Academyof Natural Sciencesof Philadelphia, HESLEWOOD, M. M., M. S. ELPH1NSTONE,S.C. TIDE- Philadelphia. MANN, AND P. R. BAVERSTOCK.1998. Myoglobin BOND,J. 1956. Check-list of Birds of the West Indies. intron variationin the GouldianFinch Erythrura Academyof Natural Sciencesof Philadelphia, gouldiaeassessed by temperature gradient gel Philadelphia. electrophoresis.Electrophoresis 19:142-151. BOND,J. 1959.Fourth supplement to the check-listof HUELSENBECK,J.P., D. M. HILLIS, AND R. NIELSEN. birds of the WestIndies (1956).Academy of Nat- 1996.A likelihood-ratiotest of monophyly.Sys- ural Sciencesof Philadelphia,Philadelphia. tematicBiology 45:546-558. 54, HUNT,BERMINGHAM, AND RICKLEFS [Auk, Vol. 118

IRWIN, D. M., T. D. KOCHER, AND A. C. WILSON. 1991. Pleistoceneclimatic cycles. Annual Review of Evolutionof the cytochromeb geneof mammals. Ecologyand Systematics12:75-98. Journal of Molecular Evolution 32:128-144. RAMBAUT,A., ANDN. C. GRASSLY.1997. Seq-Gen: An ITURRALDE-VINENT, M. A., AND R. D. E. MACPHEE. applicationfor the Monte Carlo simulationof 1999.Paleogeography of the Caribbeanregion: DNA sequenceevolution along phylogenetic Implicationsfor Cenozoicbiogeography. Bulle- trees.Computer Applications in the Biosciences tin of the AmericanMuseum of NaturalHistory 13:235-238. No. 238. RICKLEFS,R. E., ANDE. BERMINGHAM.1999. Taxon cy- KISHINO, H., AND M. HASEGAWA. 1989. Evaluation of cles in the Lesser Antillean avifauna. Ostrich 70: the maximum-likelihood estimate of the evolu- 49-59. tionary tree topologies from DNA sequence RIDGWAY, R. 1907. The birds of North and Middle data, and the branchingorder in Hominoidea. America, part 4. United StatesNational Museum Journal of Molecular Evolution 29:170-179. Bulletin 50. KOCHER, T. D., W. K. THOMAS, A. MEYER, S. V. ED- RODRIGUEZE, J. E OLIVER,A. MARIN, AND J. R. ME- WARDS, S. P;•XBO, E X. VILLABLANCA, AND A. C. DINA.1990. The generalstochastic model of nu- WILSON.1989. Dynamics of mitochondrialDNA cleotide substitutions.Journal of TheoreticalBi- evolution in animals: Amplification and se- ology 142:485-501. quencingwith conservedprimers. Proceedings SAMBROOK,J., E. E FRITSCH,AND T. MANIATIS. 1989. of the National Academyof SciencesUSA 86: Molecular Cloning: A LaboratoryManual. Cold 6196-6200. SpringHarbor LaboratoryPress, New York. KRATTER, A. W., AND O. GARRIDO. 1996. A new sub- SCLATER,P. k. 1871. On the birds of the island of St. species of Margaropsfuscus (Scaly-breasted Lucia,West Indies. Proceedings of the Zoologi- Thrasher) from St. Vincent, LesserAntilles. Bul- cal Societyof London41:263-272. letin of the BritishOrnithologists' Club 116:189- SEUTIN, G., J. BRAWN, R. E. RICKLEFS,AND E. BER- 193. MINGHAM.1993. Genetic divergence among pop- LI, W.-H. 1997. Molecular Evolution. Sinauer Asso- ulationsof a tropicalpasserine, the Streaked Sal- ciates, Sunderland, Massachusetts. tator (Saltatoralbicollis). Auk 110:117-126. LOVETTE,I. J., E. BERMINGHAM,AND R. E. RICKLEFS. SEUTIN, G., N. K. KLEIN, R. E. RICKLEFS,AND E. BER- 1999a.Mitochondrial DNA phylogeographyand MINGHAM.1994. Historical biogeography of the the conservationof endangeredLesser Antillean Bananaquit(Coerebafiaveola) in the Caribbeanre- Icterus orioles. ConservationBiology 13:1088- 1096. gion:A mitochondrialDNA assessment.Evolu- tion 48:1041-1061. LOVETTE,I. J., E. BERMINGHAM,S. ROHWER, AND C. SEUTIN, G., B. N. WHITE, AND P. t. BOAG. 1991. Pres- WOOD. 1999b. Mitochondrial RFLP and se- ervation of avian blood and tissue samplesfor quencevariation among closelyrelated avian DNA analyses.Canadian Journal of Zoology 69: speciesand the geneticcharacterization of hy- 82-90. brid Dendroicawarblers. Molecular Ecology 8: 1431-1441. SLADE, R. W., C. MORITZ, A. HEIDEMAN, AND P. T. LOVETTE,I. J., E. BERMINGHAM,G. SEUTIN,AND R. E. HALE. 1993. Rapid assessmentof single-copy RICKLEFS.1998. Evolutionary differentiationin nuclear DNA variation in diverse species.Mo- three endemic West Indian warblers. Auk 115: lecular Ecology2:329-373. 890-903. STEEL,M. A. 1994.Recovering a tree from the Mar- MADDISON, W. P., AND D. R. MADDISON. 1992. kov leaf colourationsit generatesunder a Mar- MacClade:Analysis of Phylogenyand Character kov model. Applied MathematicsLetters 7:19- Evolution. Sinauer Associates, Sunderland, 23. Massachusetts. STEJNEGER,L. 1883. Remarkson the systematicar- MURRY,M. G., ANDW. E THOMPSON.1980. Rapid iso- rangementof the American Turdidae. Proceed- lationof high molecularweight plant DNA. Nu- ings of the United StatesNational Museum82: cleic Acids Research 8:4321-4325. 449-489. PALUMBI,S. R. 1996.Nucleic acids II: Thepolymerase STORER,R. W. 1989.Geographic variation and sexual chain reaction. Pages 205-247 in Molecular dimorphismin the tremblers(Cinclocerthia) and Systematics(D. M. Hillis, C. Moritz and B. K. White-breastedThrasher (Rarnphocinclus). Auk Mable, Eds.). Sinauer Associates, Sunderland, 106:249-258. Massachusetts. STRIMMER,K., AND A. VON HAESELER.1996. Quartet POSADA, D., AND K. A. CRANDALL. 1998. Modeltest: puzzling:A quartetmaximum-likelihood meth- Testingthe model of DNA substitution.Bioin- od for reconstructingtree topologies.Molecular formatics 14:817-818. Biologyand Evolution13:964-969. PREGILL,G. K., AND S. L. OLSON.1981. Zoogeogra- STRIMMER,K., AND A. VON HAESELER.1997. PUZZLE phy of West Indian vertebratesin relation to 4.0: Maximum-LikelihoodAnalysis for Nucleo- January2001] CaribbeanMimidae Systematics 55

tide and Amino Acid Alignments. Universitiit ized trees. Molecular Biology and Evolution 12: Mtinchen,Munich, Germany. 823-833. SWOFFORD,D. L. 1998.PAUP*. Phylogenetic Analysis ZusI, R. L. 1969. Ecology and adaptationsof the UsingParsimony (*and other methods), Version 4. Trembleron the island of Dominica.Living Bird Sinauer Associates,Sunderland, Massachusetts. 8:137-164. TAKEZKI,N., A. RZHETSKY,AND M. NEI. 1995. Phy- logenetictest of the molecularclock and linear- Associate Editor: R. Zink

APPENDIX.Mimidae taxa includedin this studythat representother collections and museumcatalog specimens.

Voucher Catalog Tissue Tissue Species locationa number location• number Location Cinclocerthiaruficauda USNM 612562b USNMLMS B-2134 St. Vincent Margaropsfuscatus LSUMNS 150140 LSUMNS B-11316 Puerto Rico Margaropsfuscatus LSUMNS 112318 LSUMNS B-18097 Puerto Rico Melanoptilaglabrirostris No Voucher LSUMNS B-0081 Mexico Melanoptilaglabrirostris No Voucher LSUMNS B-0082 Mexico Melanotis caerulescens No Voucher LSUMNS B-0022 Mexico Melanotis caerulescens No Voucher LSUMNS B-0048 Mexico Mimus polyglottos SBCM 53786 LSUMNS B-21369 California, United States • Museumcodes: United StatesNational Museum of Natural History (USNM), United StatesNational Museum Laboratory of MolecularSys- tematics(USNMLMS), LouisianaState University Museum of Natural Science(LSUMNS), and San BernardinoCounty Museum (SBCM). b Specimenprepped as a skeleton.