DOCSLIB.ORG

Gene Expression Profiling in Human

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Expression Profiling in Human Endocrine-Related Cancer (2004) 11 295–303 Gene expression profiling in human insulinoma tissue: genes involved in the insulin secretion pathway and cloning of novel full-length cDNAs X-C Wang, S-Y Xu1, X-Y Wu 2, H-D Song1, Y-F Mao1, H-Y Fan 2,FYu1, B Mou1, Y-Y Gu1, L-Q Xu1, X-O Zhou1, Z Chen 2, J-L Chen1 and R-M Hu State Key Laboratory of Genetics Engineering, Institute of Endocrinology and Diabetology, Department of Endocrinology, Huashan Hospital, Fu Dan University, 12 Middle Urumqi Road, Shanghai 200040, People’s Republic of China Shanghai Institute of 1Endocrinology and 2Hematology, Ruijin Hospital, Shanghai Second Medical University, 197 Ruijin Er Road, Shanghai 200025, People’s Republic of China (Requests for offprints should be addressed to R-M Hu; Email: [email protected]) Abstract Insulinoma is a clinically common cause of organic hypoglycemia. The prominent characteristic of insulinoma is endogenous hyperinsulinism. Until now, the molecular biology of human insulinoma has been little understood. In this study, gene expression profiling of human insulinoma was established by expressed sequence tag (EST) sequencing and cDNA array. A total of 2063 clones were obtained, of these, 1589 clones were derived from EST sequencing, 975 clones were derived from cDNA array and 501 clones were shared by the two methods. G protein a-stimulating activity polypeptide (Gsa) and carboxypeptidase E (CPE) were the most highly expressed genes in human insulinoma, as derived by EST sequencing and cDNA array respectively. The genes involved in the protein/insulin secretion pathway were strongly expressed in human insulinoma tissue. Meanwhile, eight full-length cDNAs of novel genes were cloned and sequenced. The results demonstrated the molecular biology of human insulinoma tissue at the level of transcript abundance and validated the efficacy of EST sequencing combined with cDNA array in the construction of gene expression profiling. In conclusion, the predominance of the genes participating in the secretory pathway suggested that regulation of secretion might be a major mechanism by which insulin release is abnormally increased in patients with insulinomas. It was also concluded that overexpression of the Gsa gene played an important role in the pathogenesis of insulinoma. Endocrine-Related Cancer (2004) 11 295–303 Introduction Diabetes is characterized by hyperglycemia resulting from dysfunction of b-cells, and/or insensitivity to insulin, of The maintenance of plasma glucose concentration is peripheral tissues. Hypoglycemia can be the result of critical to the survival of most organisms; this is due to drugs, critical illness including hepatic or renal failure, plasma glucose being the predominant fuel utilized by hormonal deficiencies, endogenous hyperinsulinism (insu- organic cells under most conditions, especially cells of the linoma), etc. (Larsen et al. 2002). nervous system. The b-cells of the pancreatic islets of An insulinoma is the most common cause of Langerhans play a central role in glucose homeostasis by hypoglycemia resulting from endogenous hyperinsulin- secreting the polypeptide hormone insulin. Under phy- ism. The most consistent insulin secretory abnormalities siological conditions, b-cells sense plasma glucose con- associated with insulinoma are oversecretion of insulin centration and maintain tight control over insulin and failure of the normal decrease in insulin secretion biosynthesis and secretion. Functional disorders of which occurs as plasma glucose levels decline in the b-cells could result in hyperglycemia or hypoglycemia. postabsorptive state. Insulinomas are rare, the estimated Endocrine-Related Cancer (2004) 11 295–303 Online version via http://www.endocrinology.org 1351-0088/04/011–295 # 2004 Society for Endocrinology Printed in Great Britain Downloaded from Bioscientifica.com at 09/27/2021 07:35:41PM via free access Wang et al.: Gene expression profiling in insulinoma tissue incidence being one case per 250 000 patient-years in the package (Genetic Computer Version 9.0). The good- United States, but it is a curable cause of potentially lethal quality sequences were referred to those longer than hypoglycemia. Insulinomas almost always come to 100 bp and containing less than 3% ambiguous bases. clinical attention because of hypoglycemia (Larsen et al. After being compared with public databases such as 2002). Most insulinomas are derived from monoclonal GenBank, dbEST and Unigene by using Blast and Fasta proliferation of the b-cells of the pancreatic islets, which software, analyzable sequences were categorized into: means insulinomas are an optimal model for studying known genes that shared at least 95% homology with b-cell biology. Insulinoma cells offer several advantages certain genes over at least 100 bp of DNA sequences; over cultured b-cell lines and isolated islet material: (1) known ESTs that couldn’t meet the criteria of known studies of b-cell lines are conducted in vitro; (2) isolated genes but shared at least 95% homology over at least islet material is a complex tissue composed of varied cell 100 bp of ESTs in dbEST; novel ESTs that shared no types. Insulinoma cells offer not only a pure b-cell homology or little homology with known genes and population but also a study in vivo. known ESTs. ESTs corresponding to known genes were To illuminate the molecular biology of insulinoma/ divided into several categories according to the Gene b-cells, gene expression profiling of human insulinoma Ontology Consortium functions (Ashburner et al. 2000) tissue has been established using expressed sequence tag (http://www.geneontology.org). Clustering of the ESTs (EST) sequencing and cDNA array. As a result, the genes generated in the work was performed using CAT 3.2 from involved in the secretory pathway of protein/insulin are Pangea (Oakland, CA, USA) with default parameters. strongly expressed in insulinoma tissue and several new full-length cDNAs have been cloned. cDNA microarray A total of 14 000 clones were spotted onto nylon Materials and methods membrane-based cDNA arrays by using Spotter (Bio- RNA extraction Robotics, Cambridge, UK); these clones were derived from human liver and hemopoietic stem cells and Insulinoma and normal pancreatic tissues were obtained hypothalamus–pituitary–adrenal (HPA) libraries or pur- from patients with insulinomas and adult males who had chased from Research Genetics (Huntsville, AL, USA). died of accidents respectively. Total RNA was extracted Approximately 1–2 mg mRNA of human insulinoma from frozen tissues using TRIzol reagent (Invitrogen). tissue were labeled in a reverse transcription (RT) in the mRNA was separated and purified using oligo(dT) presence of 200 mCi [a-33P]deoxyadenosine 50-tripho- (Qiagen). sphate (DuPont NEN, Boston, MA, USA) using Moloney murine leukemia virus reverse transcriptase according to cDNA library construction the manufacturer’s instructions (Promega). Prehybridiza- tion was carried out in 20 ml prehybridization solution cDNA synthesis was performed with a CapFinder PCR (6ÂSSC, 0.5% SDS, 5ÂDenhardt’s solution, 100 mg/ml cDNA library construction kit (Clontech). denatured salmon sperm DNA) at 688C for 4 h. Overnight hybridization with the 33P-labeled cDNA in 10 ml cDNA sequencing hybridization solution (6ÂSSC, 0.5% SDS, 100 mg/ml salmon sperm DNA) was followed by stringent washing Bacteria growth and plasmid extraction were performed (0.1ÂSSC, 0.5% SDS, at 658C for 1 h). Membranes were in a 96-well format (Qiagen). Sequencing reactions were exposed to a phosphor screen overnight and scanned performed on a 9600 thermal reactor (Perkin-Elmer, using a FLA-3000A plate/fluorescent image analyzer (Fuji Shelton, CT, USA) using a dye primer cycle sequencing Photo Film, Tokyo, Japan). The data analyses of kit (Perkin-Elmer), and partial cDNA sequencing of each hybridized membranes were performed using Array clone was taken from the 50 end. The reaction products Gauge software (Fuji Photo Film). were analyzed using an ABI 3700 DNA sequencer (Perkin-Elmer). Semi-quantitative RT-PCR Total RNA (1 mg) was incubated with DNase I and Bioinformatics analysis and data management reverse-transcribed with oligo(dT) using the superscript II Sequencing data were transmitted to a Sun station (Sun RT-PCR system (Life Technologies). RT product (1 ml) Microsystems, Santa Clara, CA, USA). Analysis of was amplified with primer pairs specific for the genes to be sequences, including quality assessment and quality base studied. Semi-quantitative multiplex PCR assays were trimming of ESTs, was performed with a GCG software designed to compare the RT-PCR products of the genes 296 www.endocrinology.org Downloaded from Bioscientifica.com at 09/27/2021 07:35:41PM via free access Endocrine-Related Cancer (2004) 11 295–303 under study with b-actin transcript. Conditions and significance > 99.9%. As a result, a total of 975 clones primer sequences are available on request. Each RT- were found expressed in human insulinoma tissue: 616 PCR product was loaded on 1.5% agarose gel containing known genes accounted for 63.2%, 275 known ESTs 0.5 mg/ml ethidium bromide. Gel images were made and accounted for 29.2% and 74 novel ESTs for 7.6%. To saved using the Gel Documentation System (UVP, confirm the accuracy and validity of the results of cDNA Upland, CA, USA). array, several expressed clones, including the highest and lowest expressed, were selected for RT-PCRs. The outcomes of RT-PCRs proved the cDNA array to be Cloning of full-length cDNAs accurate and valid. ESTs from dbEST and other databases were selected out; The highly expressed genes in human insulinoma are these ESTs were highly homologous with known ESTs listed in Tables 1 and 2 and some of these genes were from our cDNA library. Assemblies were carried out chosen to undergo semi-quantitative RT-PCR, as shown among known ESTs and selected ESTs using Autoassem- in Fig. 1. Using ESTs sequencing, G protein a-stimulating bler software (PE Applied Biosystems, Foster City, CA, activity polypeptide Gsa (14 copies) and insulin (13 USA).
Load more

Recommended publications
  • Mea6 Controls VLDL Transport Through the Coordinated Regulation of COPII Assembly
    Cell Research (2016) 26:787-804. npg © 2016 IBCB, SIBS, CAS All rights reserved 1001-0602/16 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Mea6 controls VLDL transport through the coordinated regulation of COPII assembly Yaqing Wang1, *, Liang Liu1, 2, *, Hongsheng Zhang1, 2, Junwan Fan1, 2, Feng Zhang1, 2, Mei Yu3, Lei Shi1, Lin Yang1, Sin Man Lam1, Huimin Wang4, Xiaowei Chen4, Yingchun Wang1, Fei Gao5, Guanghou Shui1, Zhiheng Xu1, 6 1State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; 2University of Chinese Academy of Sciences, Beijing 100101, China; 3School of Life Science, Shandong University, Jinan 250100, China; 4Institute of Molecular Medicine, Peking University, Beijing 100871, China; 5State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China; 6Translation- al Medical Center for Stem Cell Therapy, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, China Lipid accumulation, which may be caused by the disturbance in very low density lipoprotein (VLDL) secretion in the liver, can lead to fatty liver disease. VLDL is synthesized in endoplasmic reticulum (ER) and transported to Golgi apparatus for secretion into plasma. However, the underlying molecular mechanism for VLDL transport is still poor- ly understood. Here we show that hepatocyte-specific deletion of meningioma-expressed antigen 6 (Mea6)/cutaneous T cell lymphoma-associated antigen 5C (cTAGE5C) leads to severe fatty liver and hypolipemia in mice. Quantitative lip- idomic and proteomic analyses indicate that Mea6/cTAGE5 deletion impairs the secretion of different types of lipids and proteins, including VLDL, from the liver.
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization
    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]
  • Murine SEC24D Can Substitute Functionally for SEC24C in Vivo
    bioRxiv preprint doi: https://doi.org/10.1101/284398; this version posted March 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Functional Overlap Between Mouse SEC24C and SEC24D Murine SEC24D Can Substitute Functionally for SEC24C in vivo Elizabeth J. Adams1,2, Rami Khoriaty2,3, Anna Kiseleva1, Audrey C. A. Cleuren1,7, Kärt Tomberg1,4, Martijn A. van der Ent3, Peter Gergics4, K. Sue O’Shea5, Thomas L. Saunders3, David Ginsburg1-4,6,7 1From the Life Sciences Institute, 2Program in Cellular and Molecular Biology, 3Department of Internal Medicine, 4Departement of Human Genetics, 5Department of Cell and Developmental Biology, 6Department of Pediatrics and the 7Howard Hughes Medical Institute, University of Michigan, Ann Arbor, MI 48109 ABSTRACT The COPII component SEC24 mediates the recruitment of transmembrane cargoes or cargo adaptors into newly forming COPII vesicles on the ER membrane. Mammalian genomes encode four Sec24 paralogs (Sec24a-d), with two subfamilies based on sequence homology (SEC24A/B and C/D), though little is known about their comparative functions and cargo-specificities. Complete deficiency for Sec24d results in very early embryonic lethality in mice (before the 8 cell stage), with later embryonic lethality (E 7.5) observed in Sec24c null mice. To test the potential overlap in function between SEC24C/D, we employed dual recombinase mediated cassette exchange to generate a Sec24cc-d allele, in which the C-terminal 90% of SEC24C has been replaced by SEC24D coding sequence. In contrast to the embryonic lethality at E7.5 of SEC24C-deficiency, Sec24cc-d/c-d pups survive to term, though dying shortly after birth.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name signal sequence receptor, beta (translocon-associated protein beta) Gene Symbol SSR2 Organism Human Gene Summary The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits a 34-kD glycoprotein (alpha-SSR or SSR1) and a 22-kD glycoprotein (beta-SSR or SSR2). The human beta-signal sequence receptor gene (SSR2) maps to chromosome bands 1q21-q23. Gene Aliases DKFZp686F19123, TLAP, TRAP-BETA, TRAPB RefSeq Accession No. NC_000001.10, NT_004487.19 UniGene ID Hs.74564 Ensembl Gene ID ENSG00000163479 Entrez Gene ID 6746 Assay Information Unique Assay ID qHsaCID0014663 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000295702, ENST00000529008, ENST00000480567, ENST00000531917, ENST00000526212 Amplicon Context Sequence GGGGCAATCCGGTCCCATTTGACATTGAGCATTCCAGACACAATGCCAAAGTCT TCTGGAGGGAAGGAATCATCAGATAGTTCCACGTCTAATGCAGCACTTGAGCCA ACATTGTAGATGTTGTACTGCAAGGTCAGGTCTCGTCCC Amplicon Length (bp) 117 Chromosome Location 1:155988061-155989851 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9998 cDNA Cq 17.45 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SSR2, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Consequences of Mutations in the Genes of the ER Export Machinery COPII in Vertebrates
    Biomedical Sciences Publications Biomedical Sciences 1-22-2020 Consequences of mutations in the genes of the ER export machinery COPII in vertebrates Chung-Ling Lu Iowa State University, [email protected] Jinoh Kim Iowa State University, [email protected] Follow this and additional works at: https://lib.dr.iastate.edu/bms_pubs Part of the Cellular and Molecular Physiology Commons, Molecular Biology Commons, and the Molecular Genetics Commons The complete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ bms_pubs/81. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Biomedical Sciences at Iowa State University Digital Repository. It has been accepted for inclusion in Biomedical Sciences Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Consequences of mutations in the genes of the ER export machinery COPII in vertebrates Abstract Coat protein complex II (COPII) plays an essential role in the export of cargo molecules such as secretory proteins, membrane proteins, and lipids from the endoplasmic reticulum (ER). In yeast, the COPII machinery is critical for cell viability as most COPII knockout mutants fail to survive. In mice and fish, homozygous knockout mutants of most COPII genes are embryonic lethal, reflecting the essentiality of the COPII machinery in the early stages of vertebrate development. In humans, COPII mutations, which are often hypomorphic, cause diseases having distinct clinical features. This is interesting as the fundamental cellular defect of these diseases, that is, failure of ER export, is similar.
    [Show full text]
  • Stx5-Mediated ER-Golgi Transport in Mammals and Yeast
    cells Review Stx5-Mediated ER-Golgi Transport in Mammals and Yeast Peter TA Linders 1 , Chiel van der Horst 1, Martin ter Beest 1 and Geert van den Bogaart 1,2,* 1 Tumor Immunology Lab, Radboud University Medical Center, Radboud Institute for Molecular Life Sciences, Geert Grooteplein 28, 6525 GA Nijmegen, The Netherlands 2 Department of Molecular Immunology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Nijenborgh 7, 9747 AG Groningen, The Netherlands * Correspondence: [email protected]; Tel.: +31-50-36-35230 Received: 8 July 2019; Accepted: 25 July 2019; Published: 26 July 2019 Abstract: The soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) syntaxin 5 (Stx5) in mammals and its ortholog Sed5p in Saccharomyces cerevisiae mediate anterograde and retrograde endoplasmic reticulum (ER)-Golgi trafficking. Stx5 and Sed5p are structurally highly conserved and are both regulated by interactions with other ER-Golgi SNARE proteins, the Sec1/Munc18-like protein Scfd1/Sly1p and the membrane tethering complexes COG, p115, and GM130. Despite these similarities, yeast Sed5p and mammalian Stx5 are differently recruited to COPII-coated vesicles, and Stx5 interacts with the microtubular cytoskeleton, whereas Sed5p does not. In this review, we argue that these different Stx5 interactions contribute to structural differences in ER-Golgi transport between mammalian and yeast cells. Insight into the function of Stx5 is important given its essential role in the secretory pathway of eukaryotic cells and its involvement in infections and neurodegenerative diseases. Keywords: syntaxin 5; Golgi apparatus; endoplasmic reticulum; membrane trafficking; secretory pathway 1. Introduction The secretory pathway is essential for secretion of cytokines, hormones, growth factors, and extracellular matrix proteins, as well as for the delivery of receptors and transporters to the cell membrane and lytic proteins to endo-lysosomal compartments.
    [Show full text]
  • ER-To-Golgi Trafficking and Its Implication in Neurological Diseases
    cells Review ER-to-Golgi Trafficking and Its Implication in Neurological Diseases 1,2, 1,2 1,2, Bo Wang y, Katherine R. Stanford and Mondira Kundu * 1 Department of Pathology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA; [email protected] (B.W.); [email protected] (K.R.S.) 2 Department of Cell and Molecular Biology, St. Jude Children’s Research Hospital, Memphis, TN 38105, USA * Correspondence: [email protected]; Tel.: +1-901-595-6048 Present address: School of Life Sciences, Xiamen University, Xiamen 361102, China. y Received: 21 November 2019; Accepted: 7 February 2020; Published: 11 February 2020 Abstract: Membrane and secretory proteins are essential for almost every aspect of cellular function. These proteins are incorporated into ER-derived carriers and transported to the Golgi before being sorted for delivery to their final destination. Although ER-to-Golgi trafficking is highly conserved among eukaryotes, several layers of complexity have been added to meet the increased demands of complex cell types in metazoans. The specialized morphology of neurons and the necessity for precise spatiotemporal control over membrane and secretory protein localization and function make them particularly vulnerable to defects in trafficking. This review summarizes the general mechanisms involved in ER-to-Golgi trafficking and highlights mutations in genes affecting this process, which are associated with neurological diseases in humans. Keywords: COPII trafficking; endoplasmic reticulum; Golgi apparatus; neurological disease 1. Overview Approximately one-third of all proteins encoded by the mammalian genome are exported from the endoplasmic reticulum (ER) and transported to the Golgi apparatus, where they are sorted for delivery to their final destination in membrane compartments or secretory vesicles [1].
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • Vesicular and Uncoated Rab1-Dependent Cargo Carriers Facilitate ER to Golgi Transport Laura M
    © 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs239814. doi:10.1242/jcs.239814 RESEARCH ARTICLE Vesicular and uncoated Rab1-dependent cargo carriers facilitate ER to Golgi transport Laura M. Westrate1,*, Melissa J. Hoyer2,3,*, Michael J. Nash2 and Gia K. Voeltz2,3,‡ ABSTRACT next recruits the heterodimer ‘inner coat’ complex Sec23/Sec24, Secretory cargo is recognized, concentrated and trafficked from which stabilizes membrane curvature and recruits cargo through the endoplasmic reticulum (ER) exit sites (ERES) to the Golgi. Cargo cargo binding sites on Sec24 (Bi et al., 2002; Kuehn et al., 1998; export from the ER begins when a series of highly conserved COPII Miller et al., 2002, 2003). The inner coat recruits the heterotetramer ‘ ’ coat proteins accumulate at the ER and regulate the formation of outer coat complex composed of Sec13/Sec31, resulting in the cargo-loaded COPII vesicles. In animal cells, capturing live de novo formation of a fully formed COPII-coated transport vesicle that cargo trafficking past this point is challenging; it has been difficult to delivers incorporated cargo to the Golgi complex via anterograde discriminate whether cargo is trafficked to the Golgi in a COPII-coated trafficking from the ER (Kirk and Ward, 2007; Lederkremer et al., vesicle. Here, we describe a recently developed live-cell cargo export 2001; Lee et al., 2004; Rossanese et al., 1999; Stagg et al., 2006). system that can be synchronously released from ERES to illustrate de Many of these studies have been performed in yeast cells because of novo trafficking in animal cells.
    [Show full text]