DOCSLIB.ORG

Erbin and Erbb2 Play Roles in the Sexual Differentiation of the Song System Nucleus HVC in Bengalese Finches (Lonchura Striata Var

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Erbin and Erbb2 Play Roles in the Sexual Differentiation of the Song System Nucleus HVC in Bengalese Finches (Lonchura Striata Var Erbin and ErbB2 Play Roles in the Sexual Differentiation of the Song System Nucleus HVC in Bengalese Finches (Lonchura Striata Var. domestica) Yueliu Zhao,1† Xuebo Zhang,1,2† Rui Wang,1† Jie Bing,1 Fan Wu,1 Yitong Zhang,2 Jincao Xu,3 Zhongming Han,3 Xinwen Zhang,2* Shaoju Zeng 1* 1 Beijing Key Laboratory of Gene Resource and Molecular Development, Beijing Normal University, Beijing, 100875, China 2 College of Life Sciences, Hainan Normal University, Haikou, 571158, China 3 Department of Otorhinolaryngolgoy, The General Hospital of the PLA Rocket Force, Beijing, 100088, China Received 11 April 2017; revised 20 September 2017; accepted 25 October 2017 ABSTRACT: Song control nuclei have distinct sex- injection of erbin-orerbb2-interfering lentiviruses into ual differences in songbirds. However, the mechanism the HVC and its overlying VZ at PHD 15, the cell prolif- that underlies the sexual differentiation of song nuclei is eration in the VZ at PHD 24, the number of the differen- still not well understood. Using a combination of anatom- tiated neurons (Hu1/BrdU1 or NeuN1/BrdU1)inthe ical, pharmacological, genetic, and behavioral HVC at PHD 31 or PHD 130, and the number of RA- approaches, the present study investigated the role of projecting cells at PHD 130 all decreased significantly. erbb2 (a homolog of the avian erythroblastic leukemia Additionally, the adult songs displayed serious abnormal- viral oncogene homolog 2) and the erbb2-interacting ities. Finally, 173 male-biased genes were expressed in gene, erbin, in the sexual differentiation of the song the developing HVC at PHD 15 using cDNA microarrays, nucleus HVC in the Bengalese finch. We first found that of which 27.2% were Z-linked genes and approximately both erbin and erbb2 were expressed in the developing 20 genes were involved in the Erbin- or ErbB2-related HVC at posthatch day (PHD) 15 in a male-biased fashion signaling pathways. Our results provide some specific using qRT-PCR and in situ hybridization. Following the genetic factors that contribute to neurogenesis and sex addition of a pharmaceutical inhibitor of the ErbB2 sig- differentiation in a song nucleus of songbirds. VC 2017 naling pathway to the culture medium, cell proliferation Wiley Periodicals, Inc. Develop Neurobiol 78: 15–38, 2018 in the cultured ventricle zone (VZ) that overlies the Keywords: Songbirds; cell proliferation; cell differentia- developing HVC decreased significantly. After the tion; sexual difference; Z-linked genes Abbreviations: FC, fold changes; PHD, post-hatch day; RA, robust nucleus of the arcopallium; VZ, ventricle zone INTRODUCTION *Correspondence to: S.J. Zeng ([email protected]) and X.W. Zhang ([email protected]). †These authors contributed equally. In many oscine species, only male birds sing highly Contract grant sponsor: National Natural Science Foundation stereotyped songs. Accordingly, male birds possess of China to SJ Zeng; contract grant numbers: (No: 31372200, 31672283), XW Zhang (No: 31560275 and 31360517), ZM Han dimorphic and highly interconnected song control (No: 81371352) and XB Zhang (No: 31360243). nuclei (Nottebohm and Arnold, 1976; Tobari et al., Ó 2017 Wiley Periodicals, Inc. 2005). Therefore, songbirds provide a model to study Published online 30 October 2017 in Wiley Online Library (wileyonlinelibrary.com). the neural mechanism that underlies the sexual DOI 10.1002/dneu.22551 dimorphism of brain areas. 15 16 Zhao et al. During mammalian embryonic development, the investigations, we wanted to know whether the two undifferentiated gonad develops into a testis rather genes are involved in the sexual differentiation of than an ovary under the action of the testis- HVC. determining gene, the sex-determining region of the To address the issue, we first investigated the sex- Y-chromosome (Sry) (Sinclair et al., 1990; Kashi- ual dimorphism in the expression of erbin and erbb2 mada and Koopman, 2010). The testes secrete steroid in the developing HVC of the Bengalese finch. We hormones, directing somatic cells to differentiate in a then examined whether erbin and erbb2 affect cell male fashion (McCarthy, 2009). However, this mode proliferation in the ventricular zone overlying the of sexual differentiation does not extend to all verte- developing HVC at PHD 15 using a pharmaceutical brates, including avian species with homogametic inhibitor for the ErbB family. Next, we injected males (ZZ) and heterogametic females (ZW). First, erbin- or erbb2-interfering lentiviruses into the devel- unlike in mammals, there is an incomplete sex- oping HVC and its overlying VZ and further investi- reverse of masculinization in female birds following gated how cell proliferation, neuronal differentiation estradiol treatment and an unsuccessful prevention of and adult song organization are affected. Finally, masculine development in male birds after blocking using cDNA microarrays, we examined sex-biased testicular hormones (Wade and Arnold, 1996). Sec- genes in the developing HVC, specifically those in ond, beyond the lack of a gene that is homologous to the Erbin- or ErbB2-involved signaling pathways. the mammalian Sry, chromosome-wide dosage com- pensation akin to mammalian X-inactivation is largely lacking in birds (Ellegren et al., 2007; Itoh METHODS et al., 2007; Naurin et al., 2011). Studies of gynan- dromorphic zebra finches and chickens reveal that Animals sexual differentiation of somatic cells (including cells in the song control nuclei) is the result of hormonal The Bengalese finches (Lonchura striata var. domestica) and genetic factors (Agate et al., 2003; Zhao et al., used in this study were originally purchased from a local 2010). Thus, the sexual differentiation of the song supplier (Beijing Guanyuan Flowers and Birds Market, Bei- jing Haidian District, Beijing, China) and then raised in the control nuclei seems to depend both on sex steroids breeding colony at Beijing Normal University. Nestling and on the steroid-independent differential expres- (PHD 15), young (PHD 45) and adult birds (PHD > 120) sion of genes. To our knowledge, the possible mecha- were used in this study. The birds were maintained in cages nisms that underlie the sexual differentiation of song (50 cm 3 62 cm 3 38 cm) equipped with perching sites control nuclei are still not clear. and nest boxes in a room under a 14/10 h light/dark cycle at We recently identified male-biased genes in the 20–308C. Seeds and fresh water were provided at all times, telencephalon of the Bengalese finch, including a Z while green vegetable supplements were provided occa- chromosome gene erbin (ErbB2 interacting protein) sionally. Each cage contained 4–7 adult birds or 3–4 nes- and ErbB2 (a homolog of the avian erythroblastic tling birds that lived with foster parents. All experiments leukemia viral oncogene homolog 2) (Sun et al., that were performed in this study were conducted in accor- 2010). Both Erbin and ErbB2 have been reported to dance with the Beijing Laboratory Animal Welfare & be involved in cell proliferation, survival, and differ- Ethics Review guidelines. Furthermore, all of the protocols entiation through signaling pathways mediated by were reviewed and approved by the Animal Management Erbin (mitogen-activated protein kinases, MAPK; Committee of the College of Life Sciences of Beijing Nor- transforming growth factor b, TGF-b; nuclear factor- mal University. jB, NF-jB) or by Erbb2 (extracellular regulated pro- tein kinases, ERK or Ras-Raf-Mek-Erk; protein Sex Genotyping, RNA Extraction, in Situ kinase C, PKC) (Borg et al., 2000; Rangwala et al., Hybridization and Quantitative Real-Time 2005; Citri and Yarden, 2006; Zhou et al., 2012; Ros- PCR (qRT-PCR) koski, 2014; Tao et al., 2014). Given the reported To identify the sex of nestling finches (PHD 15), genomic roles of erbin and erbb2, we further wanted to know: DNA was extracted from axillary venous blood using a (1) whether erbin and erbb2 expressions have sexual TIANamp Genomic DNA Kit (TIANGEN Biotech, Bei- differences in the developing HVC, a song control jing). The PCR primers used in sex determination were pre- nucleus in the Bengalese finch; (2) whether cell pro- viously described in detail (Wang and Zhang, 2009; Wang liferation, and neuronal differentiation are affected et al., 2010), and listed in Table 1. PCR products were elec- after injections of erbin- or erbb2-interfering lentivi- trophoresed in a 1.5% agarose gel. There was a 0.18-kb Z- ruses into the developing HVC and its overlying VZ linked fragment in both sexes and a 0.22-kb W-linked frag- (after erbin- or erbb2 knock-down). Based on these ment in the female. Developmental Neurobiology Erbin and ErbB2 in the Sexual Differentiation of HVC 17 Table 1 Primers for PCR or qRT-PCR Use Gene name Primers (50! 30) For sex determination SS: CTCCCAAGGATGAGAAACTGTGCAAAACAG AS: CTTCACTTCCATTAAAGCTGATCTGGAATTTC For RNA probe synthesis erbin SS: CAAAGTCAGTCCAAGATC AS: GACAGGCTTCAGTGTTTA erbb2 SS: AAGATCTTTGGGAGCCTGGC AS: CGGGCCCCCAGCAGTGCC For qRT-PCR erbin SS: CAGTAAAGAATCAGTTCTGC AS: ATGTTCACATCACATGTTCAT erbb2 SS: ATCAAGTGGATGGCGCTGGA AS: TCGCCTTTCTCCAGCAGGT b-actin SS: TTGGCAATGAGAGGTTCAGGT AS: TACGGATGTCCACATCACACT SS: Sense sequence; AS: antisense sequence. The Bengalese finches were anesthetized via intramuscu- manufacturer’s instructions. The qualified RNA was used lar injection of pentobarbital (Sigma, 0.2 g of pentobarbital in qRT-PCR or cDNA microarray analysis. in 20 ml saline). With reference to previous reports (Cardin The primers for the RNA probes used in the in situ and Schmidt, 2004; Schumacher et al., 2011; Pawlisch and hybridization protocol were designed with the Primer3 out- Remage-Healey, 2015), the following doses were used in put program and shown in Table 1. The Erbin probe length the present study: overdose (0.065 ml/each bird) for the was 234 bp, ranging from chromosome location 6300 to birds that were sacrificed immediately, and 0.03–0.05 ml/ 6533, with an 18-bp sense and anti-sense primer at the two each bird for surgical anesthesia (0.03 ml for PHD 15 and ends of zebra finch XM_004177159.1 (Chr.
Load more

Recommended publications
  • Isoforms, Structures, and Functions of Versatile Spectraplakin MACF1
    BMB Rep. 2016; 49(1): 37-44 BMB www.bmbreports.org Reports Contiributed Mini Review Isoforms, structures, and functions of versatile spectraplakin MACF1 Lifang Hu1, Peihong Su1, Runzhi Li1, Chong Yin1, Yan Zhang1, Peng Shang1, Tuanmin Yang2 & Airong Qian1,* 1Key Laboratory for Space Bioscience and Biotechnology, Institute of Special Environmental Biophysics, School of Life Sciences, Northwestern Polytechnical University, Xi’an, Shaanxi 710072, 2Honghui Hospital, Xi’an Jiaotong University College of Medicine, Xi’an, Shaanxi 710054, P. R. China Spectraplakins are crucially important communicators, linking ability of interacting with all three types of cytoskeletal fila- cytoskeletal components to each other and cellular junctions. ments, i.e., F-actin, MTs, and IFs (1). Microtubule actin crosslinking factor 1 (MACF1), also known Spectraplakins are exceptionally long and gigantic with mo- as actin crosslinking family 7 (ACF7), is a member of the spec- lecular weight of ＞500 kD. They are multi-domain cytoskele- traplakin family. It is expressed in numerous tissues and cells tal proteins and master orchestrators for coordinating cytoske- as one extensively studied spectraplakin. MACF1 has several letal elements by binding to F-actin, MTs, and IFs (1, 2). isoforms with unique structures and well-known function to be Spectraplakins are evolutionarily conserved. They belong to able to crosslink F-actin and microtubules. MACF1 is one ver- both spectrin and plakin superfamilies (3). “Spectraplakins” are satile spectraplakin with various functions in cell processes, named as combinations of “spectrin” and “plakin” because embryo development, tissue-specific functions, and human they share features of both spectrins and plakins (3, 4). So far, diseases. The importance of MACF1 has become more appa- mammalian spectraplakins have two members: microtubule rent in recent years.
    [Show full text]
  • Biocreative 2012 Proceedings
    Proceedings of 2012 BioCreative Workshop April 4 -5, 2012 Washington, DC USA Editors: Cecilia Arighi Kevin Cohen Lynette Hirschman Martin Krallinger Zhiyong Lu Carolyn Mattingly Alfonso Valencia Thomas Wiegers John Wilbur Cathy Wu 2012 BioCreative Workshop Proceedings Table of Contents Preface…………………………………………………………………………………….......... iv Committees……………………………………………………………………………………... v Workshop Agenda…………………………………………………………………………….. vi Track 1 Collaborative Biocuration-Text Mining Development Task for Document Prioritization for Curation……………………………………..……………………………………………….. 2 T Wiegers, AP Davis, and CJ Mattingly System Description for the BioCreative 2012 Triage Task ………………………………... 20 S Kim, W Kim, CH Wei, Z Lu and WJ Wilbur Ranking of CTD articles and interactions using the OntoGene pipeline ……………..….. 25 F Rinaldi, S Clematide and S Hafner Selection of relevant articles for curation for the Comparative Toxicogenomic Database…………………………………………………………………………………………. 31 D Vishnyakova, E Pasche and P Ruch CoIN: a network exploration for document triage………………………………................... 39 YY Hsu and HY Kao DrTW: A Biomedical Term Weighting Method for Document Recommendation ………... 45 JH Ju, YD Chen and JH Chiang C2HI: a Complete CHemical Information decision system……………………………..….. 52 CH Ke, TLM Lee and JH Chiang Track 2 Overview of BioCreative Curation Workshop Track II: Curation Workflows….…………... 59 Z Lu and L Hirschman WormBase Literature Curation Workflow ……………………………………………………. 66 KV Auken, T Bieri, A Cabunoc, J Chan, Wj Chen, P Davis, A Duong, R Fang, C Grove, Tw Harris, K Howe, R Kishore, R Lee, Y Li, Hm Muller, C Nakamura, B Nash, P Ozersky, M Paulini, D Raciti, A Rangarajan, G Schindelman, Ma Tuli, D Wang, X Wang, G Williams, K Yook, J Hodgkin, M Berriman, R Durbin, P Kersey, J Spieth, L Stein and Pw Sternberg Literature curation workflow at The Arabidopsis Information Resource (TAIR)…..……… 72 D Li, R Muller, TZ Berardini and E Huala Summary of Curation Process for one component of the Mouse Genome Informatics Database Resource …………………………………………………………………………....
    [Show full text]
  • Promoting Drosophila Research Through Multiple Audience
    bioRxiv preprint doi: https://doi.org/10.1101/122010; this version posted March 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Voelzmann et al. - Drosophila spectraplakins 1 1 Drosophila Short stop as a paradigm for the role and regulation of spectraplakins 2 3 4 Andre Voelzmann1, Yu-Ting Liew1, Yue Qu1, Ines Hahn1, Cristina Melero1, Natalia Sánchez- 5 Soriano2, Andreas Prokop1,* 6 7 8 1) The University of Manchester, Manchester Academic Health Science Centre, Faculty of Biology, 9 Medicine and Health, School of Biology, Michael Smith Building, Oxford Road, Manchester M13 10 9PT UK 11 2) University of Liverpool, Institute of Translational Medicine, Department of Cellular and Molecular 12 Physiology, Crown Street, Liverpool, L69 3BX, UK 13 14 15 16 * author for correspondence: 17 The University of Manchester 18 Faculty of Biology, Medicine and Health 19 Oxford Road 20 Manchester M13 9PT 21 Tel: +44-(0)161-27-51556 22 Fax: +44-(0)161-27-51505 23 [email protected] 24 25 26 Abstract 27 28 Spectraplakins are evolutionarily well conserved cytoskeletal linker molecules that are true 29 members of three protein families: plakins, spectrins and Gas2-like proteins. Spectraplakin genes 30 encode at least 7 characteristic functional domains which are combined in a modular fashion into 31 multiple isoforms, and which are responsible for an enormous breadth of cellular functions. These 32 functions are related to the regulation of actin, microtubules, intermediate filaments, intracellular 33 organelles, cell adhesions and signalling processes during the development and maintenance of a 34 wide variety of tissues.
    [Show full text]
  • The Oncogene HER2: Its Signaling and Transforming Functions and Its Role in Human Cancer Pathogenesis
    Oncogene (2007) 26, 6469–6487 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW The oncogene HER2: its signaling and transforming functions and its role in human cancer pathogenesis MM Moasser Department of Medicine and Comprehensive Cancer Center, University of California, San Francisco, CA, USA The year 2007 marks exactly two decades since Human homologous to the v-erbB (avian erythroblastosis virus) Epidermal Growth Factor Receptor-2 (HER2) was viral oncogene and the cellular epidermal growth factor functionally implicated in the pathogenesis of human receptor (EGFR) gene (Schechter et al., 1984; Schechter breast cancer. This finding established the HER2 et al., 1985). In independent studies, an EGFR-related oncogene hypothesis for the development of some human gene was found to be amplified in a human breast cancer cancers. The subsequent two decades have brought about cell line and named HER2 (King et al., 1985). The an explosion of information about the biology of HER2 HER2 protein product was related to and had tyrosine and the HER family. An abundance of experimental kinase activity similar to EGFR (Akiyama et al., 1986). evidence nowsolidly supports the HER2 oncogene Subsequent cloning of two other related human genes hypothesis and etiologically links amplification of the and the post-genome characterization of the human HER2 gene locus with human cancer pathogenesis. The kinome completed the description of this family of molecular mechanisms underlying HER2 tumorigenesis four members (Kraus et al., 1989; Plowman et al., appear to be complex and a unified mechanistic model of 1993; Manning et al., 2002).
    [Show full text]
  • Persistent Activation of Interlinked Type 2 Airway Epithelial Gene Networks
    www.nature.com/scientificreports OPEN Persistent activation of interlinked type 2 airway epithelial gene networks in sputum-derived cells Received: 27 June 2017 Accepted: 4 January 2018 from aeroallergen-sensitized Published: xx xx xxxx symptomatic asthmatics Anya C. Jones1,2, Niamh M. Troy1,2, Elisha White1, Elysia M. Hollams1, Alexander M. Gout1, Kak-Ming Ling1, Anthony Kicic 1,2,3,4, Stephen M. Stick1,2,3,4, Peter D. Sly 5, Patrick G. Holt1,5, Graham L. Hall1,6,7 & Anthony Bosco1 Atopic asthma is a persistent disease characterized by intermittent wheeze and progressive loss of lung function. The disease is thought to be driven primarily by chronic aeroallergen-induced type 2-associated infammation. However, the vast majority of atopics do not develop asthma despite ongoing aeroallergen exposure, suggesting additional mechanisms operate in conjunction with type 2 immunity to drive asthma pathogenesis. We employed RNA-Seq profling of sputum-derived cells to identify gene networks operative at baseline in house dust mite-sensitized (HDMS) subjects with/ without wheezing history that are characteristic of the ongoing asthmatic state. The expression of type 2 efectors (IL-5, IL-13) was equivalent in both cohorts of subjects. However, in HDMS-wheezers they were associated with upregulation of two coexpression modules comprising multiple type 2- and epithelial-associated genes. The frst module was interlinked by the hubs EGFR, ERBB2, CDH1 and IL-13. The second module was associated with CDHR3 and mucociliary clearance genes. Our fndings provide new insight into the molecular mechanisms operative at baseline in the airway mucosa in atopic asthmatics undergoing natural aeroallergen exposure, and suggest that susceptibility to asthma amongst these subjects involves complex interactions between type 2- and epithelial-associated gene networks, which are not operative in equivalently sensitized/exposed atopic non-asthmatics.
    [Show full text]
  • Drosophila Short Stop As a Paradigm for the Role and Regulation of Spectraplakins
    G Model YSCDB-2225; No. of Pages 18 ARTICLE IN PRESS Seminars in Cell & Developmental Biology xxx (2017) xxx–xxx Contents lists available at ScienceDirect Seminars in Cell & Developmental Biology journal homepage: www.elsevier.com/locate/semcdb Review Drosophila Short stop as a paradigm for the role and regulation of spectraplakins a a a a a André Voelzmann , Yu-Ting Liew , Yue Qu , Ines Hahn , Cristina Melero , b a,∗ Natalia Sánchez-Soriano , Andreas Prokop a The University of Manchester, Manchester Academic Health Science Centre, Faculty of Biology, Medicine and Health, School of Biology, Michael Smith Building, Oxford Road, Manchester M13 9PT, UK b University of Liverpool, Institute of Translational Medicine, Department of Cellular and Molecular Physiology, Crown Street, Liverpool, L69 3BX, UK a r t i c l e i n f o a b s t r a c t Article history: Spectraplakins are evolutionarily well conserved cytoskeletal linker molecules that are true members Received 24 April 2017 of three protein families: plakins, spectrins and Gas2-like proteins. Spectraplakin genes encode at least Received in revised form 22 May 2017 7 characteristic functional domains which are combined in a modular fashion into multiple isoforms, Accepted 29 May 2017 and which are responsible for an enormous breadth of cellular functions. These functions are related Available online xxx to the regulation of actin, microtubules, intermediate filaments, intracellular organelles, cell adhesions and signalling processes during the development and maintenance of a wide variety of tissues. To gain a Keywords: deeper understanding of this enormous functional diversity, invertebrate genetic model organisms, such Drosophila Spectraplakins as the fruit fly Drosophila, can be used to develop concepts and mechanistic paradigms that can inform the investigation in higher animals or humans.
    [Show full text]
  • ERBIN CRISPR/Cas9 KO Plasmid (H): Sc-402637
    SANTA CRUZ BIOTECHNOLOGY, INC. ERBIN CRISPR/Cas9 KO Plasmid (h): sc-402637 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and ERBIN CRISPR/Cas9 KO Plasmid (h) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in human cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives systems. Science 339: 819-823. 2A peptide: expression of Cas9 allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308.
    [Show full text]
  • The Function of Erbin, a Scaffold Protein, As a Tumor Suppressor in Colon Cancer
    University of Kentucky UKnowledge Theses and Dissertations--Molecular and Cellular Biochemistry Molecular and Cellular Biochemistry 2018 THE FUNCTION OF ERBIN, A SCAFFOLD PROTEIN, AS A TUMOR SUPPRESSOR IN COLON CANCER Payton D. Stevens University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/ETD.2018.038 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Stevens, Payton D., "THE FUNCTION OF ERBIN, A SCAFFOLD PROTEIN, AS A TUMOR SUPPRESSOR IN COLON CANCER" (2018). Theses and Dissertations--Molecular and Cellular Biochemistry. 36. https://uknowledge.uky.edu/biochem_etds/36 This Doctoral Dissertation is brought to you for free and open access by the Molecular and Cellular Biochemistry at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Molecular and Cellular Biochemistry by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Large-Scale Interaction Profiling of PDZ Domains Through Proteomic Peptide-Phage Display Using Human and Viral Phage Peptidomes
    Large-scale interaction profiling of PDZ domains through proteomic peptide-phage display using human and viral phage peptidomes Ylva Ivarssona,1, Roland Arnolda, Megan McLaughlina,b, Satra Nima, Rakesh Joshic, Debashish Raya, Bernard Liud, Joan Teyraa, Tony Pawsond,2, Jason Moffata,b, Shawn Shun-Cheng Lic, Sachdev S. Sidhua,c,3, and Philip M. Kima,b,e,3 bDepartment of Molecular Genetics, eDepartment of Computer Science, aDonnelly Centre, University of Toronto, Toronto, ON, Canada M5S 3E1; cDepartment of Biochemistry, Western University, London, ON, Canada N6A 5C1; and dLunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, ON, Canada M5G 1X5 Edited* by William F. DeGrado, University of California at San Francisco School of Pharmacy, San Francisco, CA, and approved January 6, 2014 (receivedfor review July 2, 2013) The human proteome contains a plethora of short linear motifs advantage of microarray-based oligonucleotide synthesis to con- (SLiMs) that serve as binding interfaces for modular protein domains. struct custom-made peptide-phage libraries for screening peptide– Such interactions are crucial for signaling and other cellular processes, protein interactions, an approach we call proteomic peptide- but are difficult to detect because of their low to moderate phage display (ProP-PD) (Fig. 1). This process is similar in con- affinities. Here we developed a dedicated approach, proteomic cept to the method for autoantigen discovery recently proposed peptide-phage display (ProP-PD), to identify domain–SLiM interac- by Larman et al. (12). In this earlier work, a T7 phage display tions. Specifically, we generated phage libraries containing all hu- library comprising 36-residue overlapping peptides covering all man and viral C-terminal peptides using custom oligonucleotide ORFs in the human genome was used to develop a phage im- microarrays.
    [Show full text]
  • S41467-021-25474-X.Pdf
    ARTICLE https://doi.org/10.1038/s41467-021-25474-x OPEN Epigenetic inactivation of the autophagy–lysosomal system in appendix in Parkinson’s disease ✉ Juozas Gordevicius 1,2 , Peipei Li1, Lee L. Marshall1, Bryan A. Killinger1,3, Sean Lang 1, Elizabeth Ensink 1, Nathan C. Kuhn4, Wei Cui5, Nazia Maroof6, Roberta Lauria6, Christina Rueb6, Juliane Siebourg-Polster7, Pierre Maliver7, Jared Lamp4,8, Irving Vega4,8, Fredric P. Manfredsson 4,9, Markus Britschgi 6 & Viviane Labrie 1,10 1234567890():,; The gastrointestinal tract may be a site of origin for α-synuclein pathology in idiopathic Parkinson’s disease (PD). Disruption of the autophagy-lysosome pathway (ALP) may con- tribute to α-synuclein aggregation. Here we examined epigenetic alterations in the ALP in the appendix by deep sequencing DNA methylation at 521 ALP genes. We identified aberrant methylation at 928 cytosines affecting 326 ALP genes in the appendix of individuals with PD and widespread hypermethylation that is also seen in the brain of individuals with PD. In mice, we find that DNA methylation changes at ALP genes induced by chronic gut inflam- mation are greatly exacerbated by α-synuclein pathology. DNA methylation changes at ALP genes induced by synucleinopathy are associated with the ALP abnormalities observed in the appendix of individuals with PD specifically involving lysosomal genes. Our work identifies epigenetic dysregulation of the ALP which may suggest a potential mechanism for accu- mulation of α-synuclein pathology in idiopathic PD. 1 Center for Neurodegenerative Science, Van Andel Institute, Grand Rapids, MI, USA. 2 Institute of Biotechnology, Life Sciences Center, Vilnius University, Vilnius, Lithuania.
    [Show full text]
  • Knock-In Mice Limits Responses to Muramyl Dipeptide in Alters
    Blau Syndrome−Associated Nod2 Mutation Alters Expression of Full-Length NOD2 and Limits Responses to Muramyl Dipeptide in Knock-in Mice This information is current as of October 1, 2021. Jae Dugan, Eric Griffiths, Paige Snow, Holly Rosenzweig, Ellen Lee, Brieanna Brown, Daniel W. Carr, Carlos Rose, James Rosenbaum and Michael P. Davey J Immunol 2015; 194:349-357; Prepublished online 26 November 2014; Downloaded from doi: 10.4049/jimmunol.1402330 http://www.jimmunol.org/content/194/1/349 Supplementary http://www.jimmunol.org/content/suppl/2014/11/26/jimmunol.140233 http://www.jimmunol.org/ Material 0.DCSupplemental References This article cites 50 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/194/1/349.full#ref-list-1 Why The JI? Submit online. by guest on October 1, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Blau Syndrome–Associated Nod2 Mutation Alters Expression of Full-Length NOD2 and Limits Responses to Muramyl Dipeptide in Knock-in Mice Jae Dugan,*,† Eric Griffiths,* Paige Snow,* Holly Rosenzweig,*,‡,x Ellen Lee,‡ Brieanna Brown,‡ Daniel W.
    [Show full text]
  • The LINC Complex Transmits Integrin- Dependent Tension to the Nuclear
    RESEARCH ARTICLE The LINC complex transmits integrin- dependent tension to the nuclear lamina and represses epidermal differentiation Emma Carley1†, Rachel M Stewart1†, Abigail Zieman2†, Iman Jalilian1, Diane E King3, Amanda Zubek4, Samantha Lin2, Valerie Horsley2,4*, Megan C King1,2* 1Department of Cell Biology, Yale School of Medicine, New Haven, United States; 2Department of Molecular, Cell and Developmental Biology, Yale University, New Haven, United States; 3Sunnycrest Bioinformatics, Flemington, United States; 4Department of Dermatology, Yale School of Medicine, New Haven, United States Abstract While the mechanisms by which chemical signals control cell fate have been well studied, the impact of mechanical inputs on cell fate decisions is not well understood. Here, using the well-defined system of keratinocyte differentiation in the skin, we examine whether and how direct force transmission to the nucleus regulates epidermal cell fate. Using a molecular biosensor, we find that tension on the nucleus through linker of nucleoskeleton and cytoskeleton (LINC) complexes requires integrin engagement in undifferentiated epidermal stem cells and is released during differentiation concomitant with decreased tension on A-type lamins. LINC complex ablation in mice reveals that LINC complexes are required to repress epidermal differentiation in vivo and in vitro and influence accessibility of epidermal differentiation genes, suggesting that force transduction from engaged integrins to the nucleus plays a role in maintaining keratinocyte *For correspondence: progenitors. This work reveals a direct mechanotransduction pathway capable of relaying adhesion- [email protected] (VH); specific signals to regulate cell fate. [email protected] (MCK) †These authors contributed equally to this work Competing interest: See Introduction page 22 Physical forces and the architecture of the extracellular environment are an emerging area of cell Funding: See page 22 fate regulation (Discher et al., 2009).
    [Show full text]