Erbin and ErbB2 Play Roles in the Sexual Differentiation of the Song System Nucleus HVC in Bengalese Finches (Lonchura Striata Var. domestica) Yueliu Zhao,1† Xuebo Zhang,1,2† Rui Wang,1† Jie Bing,1 Fan Wu,1 Yitong Zhang,2 Jincao Xu,3 Zhongming Han,3 Xinwen Zhang,2* Shaoju Zeng 1* 1 Beijing Key Laboratory of Gene Resource and Molecular Development, Beijing Normal University, Beijing, 100875, China 2 College of Life Sciences, Hainan Normal University, Haikou, 571158, China 3 Department of Otorhinolaryngolgoy, The General Hospital of the PLA Rocket Force, Beijing, 100088, China Received 11 April 2017; revised 20 September 2017; accepted 25 October 2017 ABSTRACT: Song control nuclei have distinct sex- injection of erbin-orerbb2-interfering lentiviruses into ual differences in songbirds. However, the mechanism the HVC and its overlying VZ at PHD 15, the cell prolif- that underlies the sexual differentiation of song nuclei is eration in the VZ at PHD 24, the number of the differen- still not well understood. Using a combination of anatom- tiated neurons (Hu1/BrdU1 or NeuN1/BrdU1)inthe ical, pharmacological, genetic, and behavioral HVC at PHD 31 or PHD 130, and the number of RA- approaches, the present study investigated the role of projecting cells at PHD 130 all decreased significantly. erbb2 (a homolog of the avian erythroblastic leukemia Additionally, the adult songs displayed serious abnormal- viral oncogene homolog 2) and the erbb2-interacting ities. Finally, 173 male-biased genes were expressed in gene, erbin, in the sexual differentiation of the song the developing HVC at PHD 15 using cDNA microarrays, nucleus HVC in the Bengalese finch. We first found that of which 27.2% were Z-linked genes and approximately both erbin and erbb2 were expressed in the developing 20 genes were involved in the Erbin- or ErbB2-related HVC at posthatch day (PHD) 15 in a male-biased fashion signaling pathways. Our results provide some specific using qRT-PCR and in situ hybridization. Following the genetic factors that contribute to neurogenesis and sex addition of a pharmaceutical inhibitor of the ErbB2 sig- differentiation in a song nucleus of songbirds. VC 2017 naling pathway to the culture medium, cell proliferation Wiley Periodicals, Inc. Develop Neurobiol 78: 15–38, 2018 in the cultured ventricle zone (VZ) that overlies the Keywords: Songbirds; cell proliferation; cell differentia- developing HVC decreased significantly. After the tion; sexual difference; Z-linked genes Abbreviations: FC, fold changes; PHD, post-hatch day; RA, robust nucleus of the arcopallium; VZ, ventricle zone INTRODUCTION *Correspondence to: S.J. Zeng ([email protected]) and X.W. Zhang ([email protected]). †These authors contributed equally. In many oscine species, only male birds sing highly Contract grant sponsor: National Natural Science Foundation stereotyped songs. Accordingly, male birds possess of China to SJ Zeng; contract grant numbers: (No: 31372200, 31672283), XW Zhang (No: 31560275 and 31360517), ZM Han dimorphic and highly interconnected song control (No: 81371352) and XB Zhang (No: 31360243). nuclei (Nottebohm and Arnold, 1976; Tobari et al., Ó 2017 Wiley Periodicals, Inc. 2005). Therefore, songbirds provide a model to study Published online 30 October 2017 in Wiley Online Library (wileyonlinelibrary.com). the neural mechanism that underlies the sexual DOI 10.1002/dneu.22551 dimorphism of brain areas. 15 16 Zhao et al. During mammalian embryonic development, the investigations, we wanted to know whether the two undifferentiated gonad develops into a testis rather genes are involved in the sexual differentiation of than an ovary under the action of the testis- HVC. determining gene, the sex-determining region of the To address the issue, we first investigated the sex- Y-chromosome (Sry) (Sinclair et al., 1990; Kashi- ual dimorphism in the expression of erbin and erbb2 mada and Koopman, 2010). The testes secrete steroid in the developing HVC of the Bengalese finch. We hormones, directing somatic cells to differentiate in a then examined whether erbin and erbb2 affect cell male fashion (McCarthy, 2009). However, this mode proliferation in the ventricular zone overlying the of sexual differentiation does not extend to all verte- developing HVC at PHD 15 using a pharmaceutical brates, including avian species with homogametic inhibitor for the ErbB family. Next, we injected males (ZZ) and heterogametic females (ZW). First, erbin- or erbb2-interfering lentiviruses into the devel- unlike in mammals, there is an incomplete sex- oping HVC and its overlying VZ and further investi- reverse of masculinization in female birds following gated how cell proliferation, neuronal differentiation estradiol treatment and an unsuccessful prevention of and adult song organization are affected. Finally, masculine development in male birds after blocking using cDNA microarrays, we examined sex-biased testicular hormones (Wade and Arnold, 1996). Sec- genes in the developing HVC, specifically those in ond, beyond the lack of a gene that is homologous to the Erbin- or ErbB2-involved signaling pathways. the mammalian Sry, chromosome-wide dosage com- pensation akin to mammalian X-inactivation is largely lacking in birds (Ellegren et al., 2007; Itoh METHODS et al., 2007; Naurin et al., 2011). Studies of gynan- dromorphic zebra finches and chickens reveal that Animals sexual differentiation of somatic cells (including cells in the song control nuclei) is the result of hormonal The Bengalese finches (Lonchura striata var. domestica) and genetic factors (Agate et al., 2003; Zhao et al., used in this study were originally purchased from a local 2010). Thus, the sexual differentiation of the song supplier (Beijing Guanyuan Flowers and Birds Market, Bei- jing Haidian District, Beijing, China) and then raised in the control nuclei seems to depend both on sex steroids breeding colony at Beijing Normal University. Nestling and on the steroid-independent differential expres- (PHD 15), young (PHD 45) and adult birds (PHD > 120) sion of genes. To our knowledge, the possible mecha- were used in this study. The birds were maintained in cages nisms that underlie the sexual differentiation of song (50 cm 3 62 cm 3 38 cm) equipped with perching sites control nuclei are still not clear. and nest boxes in a room under a 14/10 h light/dark cycle at We recently identified male-biased genes in the 20–308C. Seeds and fresh water were provided at all times, telencephalon of the Bengalese finch, including a Z while green vegetable supplements were provided occa- chromosome gene erbin (ErbB2 interacting protein) sionally. Each cage contained 4–7 adult birds or 3–4 nes- and ErbB2 (a homolog of the avian erythroblastic tling birds that lived with foster parents. All experiments leukemia viral oncogene homolog 2) (Sun et al., that were performed in this study were conducted in accor- 2010). Both Erbin and ErbB2 have been reported to dance with the Beijing Laboratory Animal Welfare & be involved in cell proliferation, survival, and differ- Ethics Review guidelines. Furthermore, all of the protocols entiation through signaling pathways mediated by were reviewed and approved by the Animal Management Erbin (mitogen-activated protein kinases, MAPK; Committee of the College of Life Sciences of Beijing Nor- transforming growth factor b, TGF-b; nuclear factor- mal University. jB, NF-jB) or by Erbb2 (extracellular regulated pro- tein kinases, ERK or Ras-Raf-Mek-Erk; protein Sex Genotyping, RNA Extraction, in Situ kinase C, PKC) (Borg et al., 2000; Rangwala et al., Hybridization and Quantitative Real-Time 2005; Citri and Yarden, 2006; Zhou et al., 2012; Ros- PCR (qRT-PCR) koski, 2014; Tao et al., 2014). Given the reported To identify the sex of nestling finches (PHD 15), genomic roles of erbin and erbb2, we further wanted to know: DNA was extracted from axillary venous blood using a (1) whether erbin and erbb2 expressions have sexual TIANamp Genomic DNA Kit (TIANGEN Biotech, Bei- differences in the developing HVC, a song control jing). The PCR primers used in sex determination were pre- nucleus in the Bengalese finch; (2) whether cell pro- viously described in detail (Wang and Zhang, 2009; Wang liferation, and neuronal differentiation are affected et al., 2010), and listed in Table 1. PCR products were elec- after injections of erbin- or erbb2-interfering lentivi- trophoresed in a 1.5% agarose gel. There was a 0.18-kb Z- ruses into the developing HVC and its overlying VZ linked fragment in both sexes and a 0.22-kb W-linked frag- (after erbin- or erbb2 knock-down). Based on these ment in the female. Developmental Neurobiology Erbin and ErbB2 in the Sexual Differentiation of HVC 17 Table 1 Primers for PCR or qRT-PCR Use Gene name Primers (50! 30) For sex determination SS: CTCCCAAGGATGAGAAACTGTGCAAAACAG AS: CTTCACTTCCATTAAAGCTGATCTGGAATTTC For RNA probe synthesis erbin SS: CAAAGTCAGTCCAAGATC AS: GACAGGCTTCAGTGTTTA erbb2 SS: AAGATCTTTGGGAGCCTGGC AS: CGGGCCCCCAGCAGTGCC For qRT-PCR erbin SS: CAGTAAAGAATCAGTTCTGC AS: ATGTTCACATCACATGTTCAT erbb2 SS: ATCAAGTGGATGGCGCTGGA AS: TCGCCTTTCTCCAGCAGGT b-actin SS: TTGGCAATGAGAGGTTCAGGT AS: TACGGATGTCCACATCACACT SS: Sense sequence; AS: antisense sequence. The Bengalese finches were anesthetized via intramuscu- manufacturer’s instructions. The qualified RNA was used lar injection of pentobarbital (Sigma, 0.2 g of pentobarbital in qRT-PCR or cDNA microarray analysis. in 20 ml saline). With reference to previous reports (Cardin The primers for the RNA probes used in the in situ and Schmidt, 2004; Schumacher et al., 2011; Pawlisch and hybridization protocol were designed with the Primer3 out- Remage-Healey, 2015), the following doses were used in put program and shown in Table 1. The Erbin probe length the present study: overdose (0.065 ml/each bird) for the was 234 bp, ranging from chromosome location 6300 to birds that were sacrificed immediately, and 0.03–0.05 ml/ 6533, with an 18-bp sense and anti-sense primer at the two each bird for surgical anesthesia (0.03 ml for PHD 15 and ends of zebra finch XM_004177159.1 (Chr.