Knock-In Mice Limits Responses to Muramyl Dipeptide in Alters

Blau Syndrome−Associated Nod2 Mutation Alters Expression of Full-Length NOD2 and Limits Responses to Muramyl Dipeptide in Knock-in Mice This information is current as of October 1, 2021. Jae Dugan, Eric Griffiths, Paige Snow, Holly Rosenzweig, Ellen Lee, Brieanna Brown, Daniel W. Carr, Carlos Rose, James Rosenbaum and Michael P. Davey J Immunol 2015; 194:349-357; Prepublished online 26

November 2014; Downloaded from doi: 10.4049/jimmunol.1402330 http://www.jimmunol.org/content/194/1/349

Supplementary http://www.jimmunol.org/content/suppl/2014/11/26/jimmunol.140233 http://www.jimmunol.org/ Material 0.DCSupplemental References This article cites 50 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/194/1/349.full#ref-list-1

Why The JI? Submit online.

by guest on October 1, 2021 • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Blau Syndrome–Associated Nod2 Mutation Alters Expression of Full-Length NOD2 and Limits Responses to Muramyl Dipeptide in Knock-in Mice

Jae Dugan,*,† Eric Grifﬁths,* Paige Snow,* Holly Rosenzweig,*,‡,x Ellen Lee,‡ Brieanna Brown,‡ Daniel W. Carr,*,† Carlos Rose,{ James Rosenbaum,†,‡,‖ and Michael P. Davey*,†,x

The biochemical mechanism by which mutations in nucleotide-binding oligomerization domain containing 2 (NOD2) cause Blau syndrome is unknown. Several studies have examined the effect of mutations associated with Blau syndrome in vitro, but none has looked at the implication of the mutations in vivo. To test the hypothesis that mutated NOD2 causes alterations in signaling pathways downstream of NOD2, we created a Nod2 knock-in mouse carrying the most common mutation seen in Blau syndrome, Downloaded from R314Q (corresponding to R334Q in humans). The endogenous regulatory elements of mouse Nod2 were unaltered. R314Q mice showed reduced cytokine production in response to i.p. and intravitreal muramyl dipeptide (MDP). Macrophages from R314Q mice showed reduced NF-kB and IL-6 responses, blunted phosphorylation of MAPKs, and deﬁcient ubiquitination of receptor- interacting protein 2 in response to MDP. R314Q mice expressed a truncated 80-kDa form of NOD2 that was most likely generated by a posttranslational event because there was no evidence for a stop codon or alternative splicing event. Human macrophages from two patients with Blau syndrome also showed a reduction of both cytokine production and phosphorylation of p38 in http://www.jimmunol.org/ response to MDP, indicating that both R314Q mice and cells from patients with Blau syndrome show reduced responses to MDP. These data indicate that the R314Q mutation when studied with the Nod2 endogenous regulatory elements left intact is associated with marked structural and biochemical changes that are signiﬁcantly different from those observed from studies of the mutation using overexpression, transient transfection systems. The Journal of Immunology, 2015, 194: 349–357.

he innate immune system consists of several families containing muramyl dipeptide (MDP) (1, 2). Nod2 is composed of of pattern-recognition receptors capable of recognizing three domains: a C-terminal LRR domain, which is essential for conserved constituents of microbial pathogens and trig- its MDP-sensing ability; a central nucleotide binding and oligo- T by guest on October 1, 2021 gering inflammatory responses. Nucleotide-binding oligomeri- merization domain (NOD), which is important for ATP-dependent zation domain containing 2 (Nod2) is a nucleotide-binding and self-oligomerization; and two N-terminal caspase recruitment leucine-rich repeat (LRR)–containing (NLR) family member that domains that participate in protein–protein interactions and in- recognizes peptidoglycan fragments from bacterial cell walls duction of subsequent intracellular signaling responses (3). After recognition of MDP, Nod2 activates the transcription factors NF- kB and MAPKs via well-characterized pathways leading to in- *Portland Veterans Affairs Medical Center, Portland, OR 97239; †Department of Medicine, Oregon Health and Sciences University, Portland, OR 97239; flammatory responses and release of antimicrobial molecules ‡Department of Ophthalmology, Oregon Health and Sciences University, Portland, (reviewed in Ref. 4). Nod2 plays a pivotal role in host defense in OR 97239; xDepartment of Molecular Microbiology and Immunology, Oregon { the recognition of bacterial pathogens and ssRNA viruses, in- Health and Sciences University, Portland, OR 97239; Division of Rheumatology, DuPont Hospital for Children, Wilmington, DE 19803; and ‖Legacy Devers Eye duction of autophagy, and maintaining homeostasis with com- Institute, Portland, OR 97210 mensal bacteria (reviewed in Ref. 5). Received for publication September 11, 2014. Accepted for publication October 27, The importance of Nod2 in human health is further underscored 2014. by the fact that mutations in NOD2 are associated with the chronic This work was supported by Career Development (5 IK2 BX001295) and Merit inflammatory disorders Crohn’s disease and Blau syndrome (6–8). Review (5 I01 BX000229) Awards from the Department of Veterans Affairs Biomed- ical Laboratory Research and Development Service as well as National Institutes of Given the prevalence of Crohn’s disease and the availability of Health Training Grant 5-T32-AI07472. clinical material for analysis, the role of Nod2 in this disorder has Address correspondence and reprint requests to Dr. Michael P. Davey, Portland been extensively studied. NOD2 mutations linked to Crohn’s dis- Veterans Affairs Medical Center, 3710 SW U.S. Veterans Hospital Road, Mailstop: ease are clustered in the LRR region of the protein, and several Research and Development, Portland, OR 97239-2964. E-mail address: michael. [email protected] hypotheses regarding the mechanism of disease have been exam- The online version of this article contains supplemental material. ined (reviewed in Ref. 9). A current paradigm proposes that loss of Nod2 function, either in controlling the gut microbiome or regu- Abbreviations used in this article: BMDM, bone marrow–derived macrophage; CAPS, cryopyrin-associated periodic syndrome; FRT, FLIPPASE recognition target; KI, knock- lating TLR responses, is the underlying cause of Crohn’s disease. in; KO, knockout; LRR, leucine-rich repeat; MDP, muramyl dipeptide; MS2, tandem The inability of MDP to activate forms of Nod2 carrying Crohn’s mass spectrometry; NLR, nucleotide-binding and leucine-rich repeat–containing; NOD, nucleotide binding and oligomerization domain; NOD2, nucleotide-binding oligomeri- disease–associated mutations has been observed both in vitro using zation domain containing 2; PBDM, peripheral blood–derived macrophage; poly(I:C), cells transiently transfected with mutant forms of Nod2 and in polyinosinic-polycytidylic acid; siRNA, short interfering RNA; TUBE, tandem ubiquitin– macrophages prepared from patients with the disease (2, 10, 11). binding entities; WT, wild-type. In contrast, much less is understood about the mechanism by Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 which mutations in NOD2 cause Blau syndrome, a rare autosomal www.jimmunol.org/cgi/doi/10.4049/jimmunol.1402330 350 BLAU SYNDROME–ASSOCIATED MUTATION AND LOSS OF NOD2 FUNCTION dominant disorder characterized by granulomatous inflammatory every third generation by Southern blot analysis of genomic DNA digested arthritis, dermatitis, and uveitis (12). Mutations associated with with BglII, electrophoresed in 1% agarose, transferred to a nylon membrane Blau syndrome are located in the NOD domain of NOD2, and at (Roche), cross-linked, and then hybridized with a digoxigenin-labeled probe and developed as per the protocol recommended by the manufac- least 17 different mutations have been identified (12, 13). Tran- turer (Roche). The digoxigenin-labeled probe corresponds to a region of sient transfection assays performed in vitro using plasmids with exon 4 in Nod2 (Fig. 1A, top) and was generated by PCR (primer sequence powerful promoters that overexpress NOD2 have found that available upon request). The R314Q locus yields a 3.1-kb restriction frag- mutations associated with Blau syndrome cause excessive NF-kB ment, whereas the WT locus produces a 3.8-kb restriction fragment (Fig. 1B). NOD2-deficient mice (2/2) were purchased from Jackson and MAPK activation compared with the wild-type (WT) form of Laboratory. Mice were maintained under specific pathogen-free conditions NOD2, and this has led to the hypothesis that Blau syndrome is the at the Portland VA Medical Center. All animal studies were performed result of a gain of function of Nod2 (14). However, this gain-of- under protocols approved by the Institutional Animal Care and Use Com- function hypothesis has not been supported when clinical speci- mittee of the Portland VA Medical Center. mens from patients with Blau syndrome were analyzed (12, 15–17). Real-time and RT-PCR PBMCs were not found to have spontaneous release of cytokines, nor were inflammatory responses observed when PBMCs were stimu- RNA was isolated (RNeasy; Qiagen, Valencia, CA) from bone marrow– derived macrophages (BMDMs) and cDNA was synthesized (Superscript lated with MDP. Moreover, the degree of enhanced Nod2 function VILO; Invitrogen, Grand Island, NY). Real-time PCR for Nod2 and b-actin seen in vitro does not correlate with the severity of the disease in (Actb) mRNA levels were then performed with iQ Sybr-Green Supermix patients (16). To clarify the mechanism by which Blau syndrome– (BioRad, Hercules, CA) and analyzed according to comparative cycle associated mutations alter the function of Nod2, we sought to de- threshold method using Actb as the endogenous control plus comparing the range of expression to untreated cells from WT mice. RT-PCR to screen for velop a model not based on overexpression of the gene in vitro.

splice variants was also performed by analyzing cDNA from +/+, +/m, and Downloaded from In this study, we created a Nod2 knock-in (KI) mouse by ho- m/m macrophages, and looking for changes in PCR size indicating a de- mologous recombination. The mice will be referred to as R314Q letion/truncation (sequence of all primers are available upon request). Nod2 mice because they carry one of the most common genetic variants cDNA prepared from macrophages of m/m mice was also fully sequenced (R314Q, the ortholog of R334Q in humans) associated with Blau and compared with WT Nod2 from C57BL/6 mice to assess for any changes other than the G-to-A change intentionally introduced. syndrome. The regulatory elements for Nod2 expression were not altered by this approach. In this article, we show that the R314Q Immunoblotting http://www.jimmunol.org/ mutation does not lead to a gain of function of NOD2. Rather, the Cell lysates were prepared in radio-immunoprecipitation assay lysis buffer mutation leads to a truncated form of NOD2 and altered cytokine and (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% SDS, 1% NP-40, 0.5% intracellular signaling responsestoMDPbothinvivoandinvitro. deoxycholate, 2 mM Na4P2O7, 5 mM NaF, 1 mM Na3VO4) plus proteinase Macrophages from patients with Blau syndrome also showed reduced inhibitor mixtures (Roche). SDS-PAGE and protein transfer to PVDF cytokine production and intracellular signaling in response to MDP. membrane was performed using the manufacturer’s recommended protocols (Invitrogen, Grand Island, NY). Immunoblotting was performed with Abs to mouse IkBa, p-ERK, p-JNK, mouse p38, mouse p-p38 (Cell Sig- Materials and Methods naling, Danvers, MA), mouse b-actin (Abcam, Cambridge, MA), ubiq- Construction of the R314Q-Nod2 KI mice uitin, RIP2 (Santa Cruz Biotechnology, Santa Cruz CA), and mouse NOD2 (clone 26mNOD2; eBioscience, San Diego, CA) in PBS plus 5% nonfat A bacterial artificial chromosome (Children’s Hospital Oakland Research milk. HRP-conjugated secondary Abs (Santa Cruz Biotechnology) were by guest on October 1, 2021 Institute, Oakland, CA) containing the murine Nod2 genomic locus was detected by ECL (Pierce, Rockford, IL). modified by recombineering to create the specific point mutation (G-to-A change) within codon 314 of Nod2 leading to an arginine (R)-to-glutamine Macrophage generation and stimulation (Q) amino acid change (codon number as per UniProtKB/Swiss-Prot: Murine macrophages were generated from bone marrow cells with 30% Q8K3Z0.1, the 1020-aa-long isoform of murine NOD2). A second round L929 conditioned media as previously described (18). After 7 d, BMDMs of recombineering was performed to insert a neomycin resistance gene were treated overnight with either 100 mg/ml polyinosinic-polycytidylic (Neo) flanked by FLIPPASE recognition target (FRT) sequences in a re- acid (poly(I:C); Invivogen, San Diego, CA), 10 mg/ml MDP (Bachem), or gion of intron 3 showing low homology across several species. A BglII for 6 h with 10 ng/ml IFN-g. Human macrophages were generated from restriction site was placed 59 to the first FRT site for use in screening. viably frozen PBMCs (obtained under a protocol approved by the Insti- Subcloning from the mutated BAC clone was performed in pBluescript to tutional Review Board of the DuPont Hospital for Children and viably create a construct with the point mutation, neomycin resistance, and frozen until use) from two patients with familial Blau syndrome (a mother “homology arms” 4 kB on either side of the mutation (Fig. 1A, targeting and son carrying an R334W mutation). The mother (Blau-1), age 42 y, and vector). Using the University of Michigan Transgenic Animal Model Core son (Blau-2), age 15 y, had onset of disease at ages 2 and 1 y, respectively. Facility, the construct was electroporated into embryonic stem cells and Blau-1 had been treated with infliximab in the past, and was taking cloned on soft agar containing the selection agent, G418. Successful ho- methotrexate and adalimumab to control eye disease and arthritis. Blau-2 mologous recombination creating an intermediate locus (5.1 kb) was dis- had been on anakinra in the past and was on daily methylprednisolone, tinguished from the WT locus (3.8 kb) by Southern blotting with BglII azathioprine, and cyclosporine to control active eye disease. His arthritis digestion and the indicated probe (Δ) (Fig. 1A). A clone containing the was not active. Control macrophages were from viably frozen PBMCs mutation was used for blastocyst injection and embryonic stem cell–mouse from healthy individuals. PBMCs were incubated in RPMI 1640 containing chimeras were produced. After additional breeding to ensure germline 20% type AB Normal Human Serum (Atlanta Biologicals, Flowery Branch, transmission, offspring were bred on an Flp recombinase strain to remove GA) and 100 ng/ml GM-CSF (R&D Systems) for 5 d. After 5 d, nonadherent the Neo gene detected by the presence of a 3.1-kb BglII fragment (Fig. 1A, cells were discarded and the attached cells were treated with poly(I:C) final locus), and then for 10 generations on C57BL/6j (Jackson Laboratory, (100 mg/ml), MDP (100 mg/ml), or LPS (100 ng/ml, Escherichia coli Bar Harbor, ME) to create R314Q heterozygous mice (+/m). WT (+/+) O55:B5 [Sigma-Aldrich]) for cytokine studies or MDP alone (100 mg/ml) litter mates were used as controls for all studies. Brother-sister mating was for MAPK activation as described in Fig. 5. used to create homozygous R314Q mice (m/m). The genotypes of the final lines were confirmed by Southern blot analysis (Fig. 1B) and sequence Short interfering RNA analysis of genomic DNA (Fig. 1C). Genotyping of +/+, +/m, and m/m lines was routinely performed by PCR screening of genomic DNA am- Approximately 4 3 106 BMDMs from +/+, +/m, m/m, and 2/2 mice were plified by PCR (Taq DNA Polymerase with Thermopol Buffer; New resuspended in 100 ml sterile OptiMem (Invitrogen) plus 200 pmol England BioLabs) using primer: CATCAGAAATTGGCAGTGGA and ON-TARGETplus Mouse NOD2 SiRNA (257632; Thermo Scientific) or primer: GCAGGAATATAGCCGGGAAC. The primers span intron 3, giv- SiGenome Non-Targeting SiRNA Pool 1 (Thermo Scientific). After gently ing a WT amplicon that results in a 221-bp fragment and a mutant amplicon mixing, the cells were pulsed in a Gene Pulser II electroporation apparatus that results in a 254-bp fragment because of the presence of the FRT se- (400 V and 150 mF resistance; BioRad) and cultured for 2 d. BMDMs were quence remaining after FLP-FRT recombination. Amplicons were analyzed then treated with poly(I:C) for 24 h, lysed, and then analyzed by Western by electrophoresis in a 3% agarose gel. Genotypes were also confirmed blot for levels of NOD2 and b-actin protein. The Journal of Immunology 351

Mass spectrometry Results HEK293 monolayers were transfected with pcDNA3 plasmid (Invitrogen) R314Q-KI mice are refractive to MDP challenge in vivo containing mouse Nod2 cDNA, cultured for 24 h, lysed, and electro- To better understand the mechanism by which mutations of NOD2 phoresed in a 4–12% gradient polyacrylamide gel. A slice of the gel corresponding to the 116-kDa region was excised and analyzed further by the cause alterations in NOD2-signaling pathways, we constructed Proteomics Shared Resource at Oregon Health & Science University. Gel a KI mouse wherein the most frequent mutation observed in Blau slices were reduced with DTT, alkylated with iodoacetamide and digested syndrome (R334Q) was inserted into the Nod2 locus of C57BL/6J overnight with trypsin (19). Samples were then dried, dissolved in 5% mice at the orthologous location (R314Q) in exon 4. An important formic acid, and analyzed by liquid chromatography–tandem mass spec- aspect of the homologous recombination approach taken in this trometry (MS2) using an Orbitrap Fusion mass spectrometer (Thermo Scientific) to collect MS2 spectra in data-dependent mode, 75 mm 3 50 cm study was that this allowed the endogenous regulatory elements of Easy Spray C18 column, 2–30% acetonitrile gradient over 100 min in the mouse Nod2 gene to remain intact and unaltered (Fig. 1A). a mobile phase containing 0.1% formic acid, and 0.3 ml/min flow rate. Southern blot analysis of genomic DNA confirmed the successful Twenty-two unique peptides belonging to NOD2 were identified by the recombination of the WT allele (“+”) and mutated (“m”) allele as program Sequest using a database of mouse protein sequences downloaded from the Swiss-Prot database, and a list of 70 corresponding mass-to-charge detected by the 3.8- and 3.1-kb fragments, respectively (Fig. 1B). values for these peptides was created. This served as the reference library As shown in Fig. 1C, genomic sequencing further identified the for further analysis of NOD2 expressed in BMDMs from +/+ and m/m introduction of the point mutation (G to A) within codon 314 of mice. BMDMs from mice of each genotype were lysed, electrophoresed, the Nod2 gene, which led to an arginine (R)-to-glutamine (Q) and gel slices from the 116 (for +/+) and 80 kDa (for m/m) were excised. amino acid substitution. The KI mice were backcrossed 10 gen- Tryptic digests from these slices were then screened for the presence of the 22 observed NOD2 peptides using the Orbitrap Fusion under identical erations onto C57BL/6J background and survived normally and chromatography conditions, but in targeted MS2 mode to increase sensi- showed the expected Mendelian inheritance pattern for the mu- Downloaded from tivity for NOD2 peptide detection. Data analysis was performed using the tation. We did not observe any gross abnormalities of the skin, reference library containing the 70 MS2 data assigned to a digest of NOD2 inflammatory changes in the eyes, or cathepsin activation indic- standard and Skyline software (http://proteome.gs.washington.edu/software/ skyline). The fragment ions and retention times for each peptide in the ref- ative of arthritis in mice that were housed in specific pathogen-free erence library were then compared with the MS2 spectra generated by the conditions and examined up to 36 wk of age (Supplemental Fig. 1). targeted MS2 analysis of digest from BMDMs from +/+ and m/m mice. The cellularity of peripheral blood (WBCs, lymphocytes, mononu-

clear cells, granulocytes), as well as albumin, alkaline phosphatase, http://www.jimmunol.org/ Tandem ubiquitin binding entities assay alanine aminotransferase, amylase, blood urea nitrogen, calcium, Evaluation of ubiquitinated proteins was performed using tandem ubiq- creatinine, globulin, glucose, potassium, sodium, phosphorus, total uitin–binding entities (TUBE) containing GST tags as per the manu- bilirubin, and total protein were comparable in +/+, +/m, and m/m facturer’s instructions (Life Sensor, Malvern, PA). Protein lysate from MDP-treated (0–120 min) BMDMs isolated from +/+, +/m, and m/m mice (data not shown). mice were used as starting material and were further precipitated with To study the effect of the R314Q mutation on systemic responses, glutathione Sepharose (Sigma-Aldrich, St. Louis, MO) to isolate poly- we tested the in vivo inﬂammatory response of KI mice to an MDP ubiquitinated proteins, electrophoresed for analysis by immunoblotting challenge. Compared with WT mice that responded to MDP with with anti-ubiquitin and anti-RIP2 Abs. a 3-fold increase in IL-6, the addition of MDP to KI mice did not

Transient transfection of HEK293T cells alter basal IL-6 levels (Fig. 2A). NOD2 knockout (KO) mice also by guest on October 1, 2021 did not respond to MDP. A similar pattern was observed for KC HEK293T cells (CRL-11268; American Type Culture Collection, Man- assas, VA) were transiently transfected with empty pcDNA3.1(+) or (murine IL-8 homolog) and MIP2a, other commonly measured pcDNA3.1(+) containing the mouse Nod2 cDNA using the TransIT-293 indicators of MDP-induced NOD2 activation (27, 28). We did not transfection reagent according to manufacturer’s instructions (Mirus Bio, observe any basal changes in the levels of IL-6, MIP2a, and KC Madison, WI). After transfection, HEK cells were incubated at 37˚C for among the three genotypes, which argues against a gain of func- 24 h, lysed, and analyzed by immunoblotting. tion induced by R314Q as measured by a systemic response Histological evaluation and fundus examinations in vivo. These results indicate that the R314Q-NOD2 mutation results in a loss of function of NOD2 to respond to MDP in vivo. Eye and joint tissues were harvested at the indicated times and prepared for sectioning and staining with H&E as previously reported (20, 21). Ocular To further examine the consequences of the R314Q mutation on fundus examinations were performed under inhalation of isoflurane anesthesia inflammatory responses in vivo, we administered mice an intraoc- using topical endoscopic fundus imaging as previously described (22–24). ular injection of MDP (Fig. 2B), which we had previously shown elicits an acute ocular inflammation and measurable cytokine re- Near-infrared fluorescence imaging sponse (26). In WT (+/+) mice, MDP injection results in a signifi- The cathepsin activity within joints was monitored by near-infrared fluo- cant increase in KC production compared with control, saline- rescence imaging as previously described (25). Mice were injected with injected eyes (Fig. 2B). In contrast with the WT mice, +/m and m/m 2 nmol/150 ml vol ProSense (ViseEN Medical, Woburn, MA). Imaging was performed with the Li-Cor Biosciences Pearl Imager imaging system mice failed to respond to MDP through production of KC (or IL-6, with a mousePod attachment. Images were analyzed with LiCor software. data not shown), thereby indicating an inability to respond to MDP. MDP injection in vivo R314Q-NOD2 mutation results in loss of macrophage Adult mice (8–12 wk old) were administered an i.p. injection of 300 mg/ responsiveness to MDP challenge mouse MDP (Bachem) and serum IL-6, MIP2a, and KC levels were measured 3 h after injection by ELISA (R&D Systems, Minneapolis, MN). We further sought to investigate whether the loss of MDP respon- For uveitis experiments, each eye was intravitreally administered either siveness at the systemic level coincides with functional changes at MDP 100 mg/eye (2 ml) or saline (2 ml) according to previously estab- the cellular level. Poly(I:C) primed BMDMs were stimulated with lished protocols (26). KC cytokine levels in the ocular fluid were measured MDP, and the production of IL-6 was measured among the three 5 h after MDP administration. genotypes and KO mice (Fig. 3A). Because the level of NOD2 Statistical analysis expression is relatively low in BMDM, poly(I:C) treatment was Data are represented as mean 6 SD. Statistically significant differences used in these and subsequent studies to enhance NOD2 and RIP2 were determined by a two-tailed Student t test and p values , 0.05 were expression, and augment NOD2 signaling (29). In response to considered significant. MDP, a significant increase in IL-6 production was observed in 352 BLAU SYNDROME–ASSOCIATED MUTATION AND LOSS OF NOD2 FUNCTION Downloaded from http://www.jimmunol.org/

FIGURE 2. In vivo responses to MDP. (A) Serum IL-6, MIP2a, and KC levels 3 h after i.p. administration of 300 mg MDP in +/+, +/m, m/m, and 2/2 mice (three mice each genotype, repeated three times with comparable result). (B) KC cytokine levels in the eye of +/+, +/m, and m/m mice 5 h after intravitreal injection of MDP or saline (ﬁve mice each genotype and treatment). Results are given as means 6 SD. *p , 0.05, **p , 0.01,

***p , 0.001. +/m, heterozygous mutant; m/m, homozygous mutant; +/+, by guest on October 1, 2021 WT.

A FIGURE 1. Generation of R314Q Nod2 KI mice. ( ) Schematic of ge- further observed for MDP induction of the MAPK pathway. MDP Materials and nomic, targeting, intermediate, and final loci described in stimulation resulted in increased expression level of the active, Methods. Asterisks (*) denote point mutation. Δ, probe for Southern blotting; B, BglII site; F, FRT; Neo, neomycin resistance gene. (B) Southern blot phosphorylated forms of the signaling mediators ERK, JNK, and analysis of genomic DNA digested with BglII and hybridized with the probe p38, which occurred within 30 min in WT cells. This response was (Δ) shown in (A). +/m, heterozygous mutant; m/m, homozygous mutant; +/+, impaired and absent in m/+ and m/m cells, respectively. WT. (C) Chromatograms from sequence analysis of exon 4 from genomic One of the most immediate and measurable intracellular DNA from +/+, +/m, and m/m mice confirming the G-to-A base change (see responses of MDP-induced NOD2 activity is the ubiquitination of squares in each panel) leading to a codon change from R to Q. the kinase RIP2, which is necessary for downstream signal transduction events in the NF-kB and MAPK pathways (30). Using TUBEs, which are protein complexes that bind cellular poly- WT cells, and this was absent in negative control NOD2 KO cells, ubiquitinated proteins and protect them from deubiquitination or thereby indicating the NOD2 specificity for the MDP-induced IL-6 proteasomal degradation (31), we evaluated whether the R314Q response. Interestingly, MDP-triggered IL-6 production was sig- mutation altered MDP-induced RIP2 ubiquitination. As shown in nificantly reduced in a gene dosage-dependent effect. Indeed, the Fig. 3C, antiubiquitin immunoblotting showed the abundance of MDP-induced IL-6 production in m/m cells was completely ab- ubiquitinated proteins in all three genotypes, indicating that the rogated and was indistinguishable from the cellular response of TUBE protein complexes were successful in isolating poly- NOD2 KO cells. ubiquitinated proteins from the BMDMs (Fig. 3C, top). However, To assess whether the decrease in cytokine production in KI cells immunodetection specifically for the ubiquitinated form of RIP2 was due to impaired intracellular signaling responses, we examined showed different amounts of polyubiquitination among the three MDP induction of the NF-kB and MAPK pathways in BMDMs different genotypes (Fig 3C, middle). RIP2 is detected over a (Fig. 3B). Western blot analysis detected diminished expression of broad m.w. range because the diverse array of ubiquitin linkages IkBa in the WT cells within 30 min, which ultimately recovered that can occur creates a modified population of RIP2 protein 120 min later. Consistent with the heterogenous expression of of varying sizes (32). The amount of RIP2 in the lysates of Nod2, a disappearance of IkBa was observed in +/2 cells, albeit it all genotypes before pull down with TUBEs was comparable was slightly delayed (i.e., it took 45 min). BMDMs of m/m mice (Fig. 3C, bottom). The level of polyubiquitinated RIP2 was the did not respond to MDP as indicated by the unaltered expression highest in BMDMs from +/+ mice, reduced in lysates prepared of IkBa. The lack of responsiveness to MDP in m/m cells was from +/m mice, and not observed in lysates from m/m, even at the The Journal of Immunology 353

quantitative real-time PCR. As shown in Fig. 4A, the expression levels of Nod2 in the baseline state were comparable among all three genotypes. Stimulation with poly(I:C) elicited a robust induction of Nod2 mRNA expression, and this gene induction was not signifi- cantly altered by the point mutation. As expected, the mRNA expression of Nod2 was nondetectable in BMDMs prepared from NOD2 KO mice. These data indicate that the introduction of the R314Q mutation does not impair the transcriptional control of Nod2. To investigate whether a change in protein expression occurs as a consequence of the R314Q mutation, we measured NOD2 protein levels in BMDMs in the resting state or upon induction with poly(I:C). Immunoblotting revealed the expected full-length 116- kDa form of NOD2 in cells from WT cells (+/+; Fig. 4B), which was further increased upon stimulation with poly(I:C). NOD2 expression was appropriately absent in cells prepared from control NOD2 KO mice (2/2), indicating the Ab specificity of this assay. In contrast, BMDMs from KI mice (+/m or m/m) did not show constitutive NOD2 expression in the naive state. Indeed, the m/m cells lacked the full-length NOD2 and instead showed the appearance of a smaller, 80-kDa protein that reacted with the anti- Downloaded from NOD2 Ab. The smaller 80-kDa band was further increased by stimulation with poly(I:C). Consistent with their heterozygous genotype, the BMDMs from +/m mice showed expression of both the 116- and 80-kDa forms of putative NOD2 upon induction with poly(I:C). In line with prior reports that NOD2 is upregulated by IFN-g (33), we found increased expression of a 116-kDa http://www.jimmunol.org/ form of NOD2 in +/+ BMDMs when stimulated with IFN-g (Supplemental Fig. 2A). Again, the full-length form of NOD2 was absent from both m/m cells and NOD2 KO cells, and instead generation of the 80-kDa band in m/m or m/+ cells was confirmed. Of note, a longer exposure of the blot revealed a faint 80-kDa form of FIGURE 3. BMDMs from R314Q-Nod2 mice have reduced responses to NOD2 in WT cells. This raises the possibility that the 80-kDa form MDP. (A) BMDMs from +/+, +/m, m/m, and2/2 mice were treated with may be generated normally when NOD2 is upregulated, and that the poly(I:C) alone or poly(I:C) and MDP for 24 h, and IL-6 was measured in R314Q mutation promotes the conversion to the 80-kDa form of by guest on October 1, 2021 supernatants (three mice each genotype). Error bars represent SD. Results NOD2. We have further confirmed the specificity of the anti-NOD2 , B are representative of three separate experiments. *p 0.05. ( ) BMDMs Ab used in these studies using HEK293 cells transiently transfected from +/+, +/m, and m/m were treated with MDP from 0–120 min (indi- with a plasmid carrying mouse Nod2 cDNA (Supplemental Fig. cated at the top of each lane), and lysates were analyzed by immunoblot with Abs to monitor the amount of IkBa and the degree of phosphorylation (p) 2B). These data indicate that despite normal transcription, the point of ERK, JNK, and p38. Abs to p38 were used as a control for the amount mutation results in loss of full-length NOD2 protein. of protein loaded. (C) BMDMs from +/+, +/m, and m/m were treated with To further investigate generation of the putative 80-kDa form of MDP from 0–120 min (indicated at the top of each lane). TUBE-GST NOD2 that occurs in KI mice, we performed knockdown experi- protein complexes were used to precipitate all polyubiquitinated proteins ments in BMDMs prepared from WT (+/+) versus mutant mice from lysates of BMDMs, and subsequent immunoblotting was performed (m/m) using short interfering RNA (siRNA). Compared with the using anti-ubiquitin (top) or anti-RIPs (middle). Bottom blot is an immu- scrambled, control siRNA, the specific siRNA treatment resulted in noblot with anti-RIP2 Abs on lysates before treatment with TUBEs. IB, significant reduction in full-length WT-NOD2 (Fig. 4C, left) and immunoblot; IP, immunoprecipitation; +/m, heterozygous mutant; m/m, also the 80-kDa form in the mutant BMDCs (Fig 4C, right). These homozygous mutant; +/+, WT. data demonstrate that posttranscriptional gene silencing by siRNA effectively knocked down both forms of NOD2, thereby indicating later time points. These results show that NOD2 in BMDMs prepared that introduction of R314Q mutation results in a unique and from +/m and m/m mice have an impaired ability to activate RIP2 in smaller form of the NOD2 protein. response to MDP and the degree of impairment is a function of the The identity of the mutant 80-kDa form of NOD2 was further copy number of the mutation. Collectively, these data indicate that evaluated by mass spectrometry (Fig. 4D). Analysis of tryptic digests introduction of the Blau-point mutation results in impaired cellular from gel slices cut from the 116-kDa region of lysates from responses to MDP involving RIP2-initiated signal transduction BMDMs of +/+ mice identified two peptides, GFSEEGIQLYLRK of NF-kB and MAPK pathways and diminished IL-6 production. (aa 426–438) and SLYEMQEEQLAQEAVR (aa 724–739), of NOD2 defined by mass-to-charge ratios and fragment ions created from the R314Q mutation results in the conversion of NOD2 from reference library of overexpressed NOD2. The peptide SLYEM- full-length protein to a smaller form QEEQLAQEAVR was also identified in gel slices from the 80-kDa To assess whether the abnormal response to MDP observed both region of lysates of BMDMs isolated from m/m mice, thereby in vivo and in vitro for R314Q mice was the result of alterations in identifying NOD2 in the 80-kDa region. Other spectra matched too transcriptional and/or translational control of Nod2 at the cellular few ions to be able to identify their source. Although the mass level, we performed studies on BMDMs prepared from WT and spectrometry results indicate that the 80-kDa region contained a KI mice. To determine whether the point mutation alters Nod2 modified form of the full-length 116-kDa NOD2 protein, the yield transcription, we analyzed the levels of mRNA expression by of tryptic fragments was insufficient to generate spectra throughout 354 BLAU SYNDROME–ASSOCIATED MUTATION AND LOSS OF NOD2 FUNCTION

the entire length of the protein to provide information on the exact residues that were missing from the 80-kDa form. Because Nod2 splice variants have been described that lead to truncated forms of NOD2 protein (34), mRNA from BMDMs of +/+, +/m, and m/m mice were analyzed for evidence of splice variants by PCR. DNA fragments of the predicted size were obtained that were comparable in all genotypes, and smaller-sized fragments, which would have been indicative of altered exon splicing, were not observed (Supplemental Fig. 2C). Nod2 mRNA from BMDMs of m/m mice was reverse transcribed and sequenced to rule out the possibility of introduction of a premature stop codon. The resulting sequence was exactly as predicted (data not shown), with the only difference from WT being the G-to-A change that we intentionally introduced to create the R314Q mutation. Collectively, these data indicate that the R314Q mutation results in a posttranslational modiﬁcation of NOD2, wherein the full-length protein is converted to a smaller form of NOD2. Macrophages from patients with Blau syndrome demonstrate

loss of responsiveness to MDP Downloaded from To compare the observations obtained in mutant KI mice with clinical disease, we sought to examine the cellular response of patients with Blau syndrome. PBMCs obtained from two different patients with Blau syndrome (with mutations at orthologous location 334) were used to generate peripheral blood–derived macrophages

(PBDMs). Comparable numbers of PBDMs were generated from http://www.jimmunol.org/ both patients, as well as healthy control subjects. Experiments were carried out as described earlier, wherein macrophages primed with poly(I:C) were challenged with MDP, and IL-6 and IL-8 production were measured (Fig. 5A, 5B). In contrast with PBDMs from healthy control subjects, which produced both IL-6 and IL-8 in response to MDP stimulation, PBDMs from both of the patients with Blau syndrome demonstrated a complete loss of IL-6 and IL-8 production (Blau-1, Fig. 5A; Blau-2, Fig. 5B). Differences in spontaneous release of IL-6 or IL-8 (i.e., media control) were not observed, by guest on October 1, 2021 which is contrary to the gain-of-function model theorized for Blau syndrome. Consistent with prior reports using PBMCs of Blau syndrome patients (15, 17), we confirmed that the PBDMs used in this study were capable of responding to LPS as measured by production of IL-6 (Fig. 5B), indicating that the NOD2 mutation does not impair cellular capacity to respond to other pattern- recognition receptor ligands and rules out indirect effects of im- munosuppressive therapy. Investigation of the MDP-triggered FIGURE 4. R314Q mutation results in the conversion of NOD2 from full- MAPK pathway activation in PBDMs of Blau syndrome patients length protein to a smaller form. (A) Nod2 mRNA levels present in BMDMs showed that the phosphorylation of p38, quantitated by densi- from +/+, +/m, m/m, and 2/2 mice cultured in media alone (no treatment) or tometry, was absent or severely blunted in both patients (Fig. 5C). media supplemented with poly(I:C) for 24 h. Transcript levels were determined Studies of NF-kB activation, measured by disappearance of IkBa, in cDNA by quantitative RT-PCR and expressed as fold induction compared using PBDM from Blau-1 showed no evidence of NF-kB activa- with b-actin for each condition. Error bars represent SD. Results are repre- tion (data not shown), further indicating impaired intracellular sentative of three separate experiments. (B) Western blot analysis with anti- signaling. NOD2 Ab on lysates from BMDMs of +/+, +/m, m/m, and 2/2 mice cultured in media alone (2) or media supplemented (+) with poly(I:C) for 24 h. Two examples (different BMDM preparations) are shown for m/m mice. Results are Discussion representative of three separate experiments. (C) siRNA knockdown of NOD2. We created the R314Q KI mouse with the goal of studying the Immunoblot of lysates from poly(I:C)-primed BMDMs of +/+ or m/m mice, function of a variant of Nod2 carrying the most common Blau which were electroporated with either nonspecific scrambled control siRNA syndrome–associated mutation. The data in this article demon- (Scram) or NOD2-specific siRNA. Blots were developed with anti-NOD2 strate that R314Q KI mice, wherein Nod2 was endogenously D antisera or anti–b-actin as a loading control. ( ) Mass spectrometry analysis of expressed under the control of its normal regulatory elements, proteins eluted from gel slices from the 80-kDa region after electrophoresis of exhibited impaired NOD2 activation to MDP. The macrophage lysates from BMDMs of m/m mice. Tryptic digests were analyzed by targeted LC-MS2 for the presence of NOD2 peptides. A peptide corresponding to response to MDP was impaired in that RIP2 activation was re- residues 724–739 of mouse NOD2 in the 80-kDa band is shown. Each line on duced, which resulted in mitigated responses within the MAPK the chromatogram represents the intensity of one of the fragment ions also and NF-kB pathways and diminished cytokine production. Such observed when a digest of NOD2 standard was analyzed. +/m, heterozygous abated cellular inflammatory responses were paralleled in vivo in mutant; m/m, homozygous mutant; +/+, WT. that KI mice were refractory to MDP challenge. MDP-induced The Journal of Immunology 355

and no spontaneous disease is in contrast with well-understood gain-of-function genetic disorder involving NLRP3. Mutations in NLRP3 cause cryopyrin-associated periodic syndrome (CAPS), a gain-of-function autosomal dominant disorder associated with spontaneous activation of the NLRP3 inflammasome, excessive IL-1b release, and a uniform response in patients to IL-1b inhibitors (37).This phenotype has readily been reproduced in KI mouse models where autoactivation of the inflammasome was demonstrated (38, 39). Because mutations in Blau syndrome and CAPS are found at analogous positions in their respective NLR family member genes, it has been inferred that they would have a comparable mechanism of action (40, 41). However, in contrast with patients with CAPS, patients with Blau syndrome do not spontaneously release cytokines from PBMCs. Our R314Q model, in contrast with NLRP3 KI models, also does not show spontaneous activation of cytokines triggered by the NOD2 pathway. We have expressed WT and murine R314Q mutated NOD2 in HEK cells using expression vectors and in murine J774 macrophages using retroviral vectors to produce stable transformants (data not shown). Western blot analysis of lysates from these cells Downloaded from does not show the 80-kDa truncated form of NOD2. It is possible in artificial overexpression systems that the cellular processes responsible for the 80-kDa form of NOD2 are not functional or are only expressed in cell types different from these cell lines used FIGURE 5. Monocyte-derived macrophages (MDMs) from patients because of their ease of in vitro culture and manipulation. The lack

A http://www.jimmunol.org/ with Blau syndrome have reduced responses to MDP. ( ) IL-6 and IL-8 of NOD2 processing when mutant NOD2 is overexpressed in HEK levels in supernatants of MDMs from a healthy control (NL) and Blau cells may also account for the discrepancy between the gain of patient 1 (Blau-1) pretreated overnight in poly(I:C) followed by treatment function attributed to mutant NOD2 in HEK cells and the lack of for an additional 24 h in media alone or media supplemented with MDP. (B) IL-6 and IL-8 levels in supernatants of MDMs from a different healthy response to MDP observed in patients with Blau syndrome. We control (NL) and Blau patient 2 (Blau-2) pretreated overnight in media have initiated studies of PBDMs to investigate whether the con- alone (for subsequent study with LPS) or media supplemented with poly(I:C) version process of full-length Nod2 to the 80-kDa form is observed followed by treatment for an additional 24 h in media alone, or media in patients with Blau syndrome. However, as previously described supplemented with LPS or MDP. (C) MDMs from a healthy control and by others (42), interpreting these studies is difficult because of the Blau patients 1 and 2 were treated with MDP from 0–60 min (indicated quality and specificity of antisera or Abs currently available. Us- by guest on October 1, 2021 at the top of each lane), and lysates were analyzed by immunoblot with ing a reagent from ProSci that had been used by others to detect Abs for the phosphorylated and nonphosphorylated forms of p38. Blau-1 human Nod2 (43), we identified multiple irresolvable bands in the and Blau-2 were analyzed in different experiments. Densitometry readings 80- to 120-kDa section of Western blots from PBDMs of healthy of p-p38 and p38 bands are indicated below each lane. control subjects, as well as patients Blau-1 and -2 (data not shown), such that a definitive conclusion about the disappearance of full- cytokine production systemically and locally within the eye was length Nod2 or appearance of an 80-kDa truncated form could not absent. In contrast with previous studies based on transient trans- be made and will require further study. The heterozygous nature of fection assays, we did not find any evidence for the spontaneous Blau syndrome creates a further challenge for experiments using activation of NF-kB or enhanced responses to MDP. PBDMs from Western blot analysis. Because patients express a normal 116-kDa two different patients with Blau syndrome exhibited the same form of Nod2, detecting the disappearance of full-length Nod2 on phenotype in that MDP-induced cytokine and intracellular signal- a Western blot would require interpreting relative intensities of ing responses involving MAPK and NF-kB were impaired. These bands compared with healthy individuals, unlike the homozygous data are all consistent with the possibility that Blau syndrome, like R314Q mutant mice created by breeding where the disappearance Crohn’s disease, is also a disease mediated by loss of function of of full-length NOD2 is readily appreciated. NOD2. Although Blau syndrome is not associated with gut in- One mechanism by which we believe that mutant NOD2 results flammation, arthritis and uveitis can occur in Crohn’s disease, and in loss of responsiveness to MDP is through the posttranslational both diseases are associated with granulomatous inflammation. modification and conversion of the full-length NOD2 to a smaller Even though macrophages from R314Q mouse showed a com- form of NOD2 that lacks the ability to sense MDP. The structure of parable biochemical response to challenge with MDP as did the 80-kDa form of NOD2 is under further study. The commercial macrophages from patients, the mice did not develop a spontaneous anti-mouse NOD2 mAb used in this study was created by im- clinical phenotype. This is comparable with other genetic manip- munizing rats with two separate large peptide fragments (NOD2 aa ulations of Nod2, including Nod2 KO mice (35) and mice engi- 150–450 and 481–750), but the exact epitope was not elucidated. neered to contain a mutation found in Crohn’s disease (28). It is Furthermore, this Ab did not work in our hands for immunopre- possible that the transcriptome response in humans that causes cipitation studies requiring us to analyze whole-cell lysates to Blau syndrome does not trigger the same orthologs in B6 mice, study the structure. Although our work with mass spectrometry did and the mice cannot respond to the NOD2 mutation in the same identify one peptide that allowed us to conclude that the 80-kDa way as a human carrying the mutation (36). Human diseases region of electrophoresis gels of lysates from BMDMs from m/m caused by loss-of-function mutations in NLR family members may did contain NOD2, the approach did not yield enough material to be be more difficult to model in mice than gain-of-function muta- quantitative and provide information of which residues or domain of tions. Our R314Q KI model showing a loss of function of NOD2 the NOD2 protein was altered. The structure of the 80-kDa mutant 356 BLAU SYNDROME–ASSOCIATED MUTATION AND LOSS OF NOD2 FUNCTION form of NOD2 is currently under further study. Nonetheless, it is Institute, Frederick, MD) for the gift of plasmids used in recombineering. interesting to consider whether the 80-kDa form has a yet-to-be- We thank Emily E. Vance for technical contributions. determined function. For example, if the 80-kDa form showed autoinhibitory capability for NOD2 oligomerization, like NOD2-S Disclosures (34), or antagonism for MDP-induced activation of NOD2, like The authors have no financial conflicts of interest. NOD2-C2 (42), this could explain the loss of response to systemic administration of MDP seen in R314Q +/m mice and the absent response to MDP seen in macrophages from Blau syndrome patients References who still carry a normal copy of NOD2. It has been shown that the 1. Girardin, S. E., I. G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas, D. J. Philpott, and P. J. Sansonetti. 2003. Nod2 is a general sensor of peptidoglycan truncated form of NOD2 caused by the 3020insC mutation found in through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278: 8869–8872. Crohn’s disease does result in a new function that may be patho- 2. Inohara, N., Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase, S. Inamura, S. Kusumoto, M. Hashimoto, et al. 2003. Host recognition of bac- genic: the inhibition of basal levels of IL-10 release by interfering terial muramyl dipeptide mediated through NOD2. Implications for Crohn’s with phosphorylation of hnRNP-A1 (44). Interestingly, this new disease. J. Biol. Chem. 278: 5509–5512. function was observed only in humans, not mice, indicating an 3. Ogura, Y., N. Inohara, A. Benito, F. F. Chen, S. Yamaoka, and G. Nunez. 2001. Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and acti- important difference between mouse and human orthologs of NOD2. vates NF-kappaB. J. Biol. Chem. 276: 4812–4818. Another topic of interest uncovered by our studies is the in- 4. Jun, J. C., F. Cominelli, and D. W. Abbott. 2013. RIP2 activity in inflammatory vestigation of the mechanism by which the full-length form of disease and implications for novel therapeutics. J. Leukoc. Biol. 94: 927–932. 5. Shaw, M. H., N. Kamada, N. Warner, Y. G. Kim, and G. Nun˜ez. 2011. The ever- NOD2 is converted to the mutant 80-kDa form. We have ruled out expanding function of NOD2: autophagy, viral recognition, and T cell activation. a premature stop codon in the mRNA and a splice variant. Several Trends Immunol. 32: 73–79. 6. Hugot, J. P., M. Chamaillard, H. Zouali, S. Lesage, J. P. Ce´zard, J. Belaiche, Downloaded from proteins have been shown to bind to Nod2 and negatively regulate S. Almer, C. Tysk, C. A. O’Morain, M. Gassull, et al. 2001. Association of downstream signaling events, including Erbin, CENTB1, AAMP, NOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature CAD, and JNKBP1 (45–50). These negative regulators are not 411: 599–603. 7. Ogura, Y., D. K. Bonen, N. Inohara, D. L. Nicolae, F. F. Chen, R. Ramos, thought to act by cleavage of Nod2. More recently, Nod2-binding H. Britton, T. Moran, R. Karaliuskas, R. H. Duerr, et al. 2001. A frameshift partners were identified that regulated Nod2 pathways by con- mutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 411: trolling proteasome-mediated turnover of Nod2, including Hsp90, 603–606.

8. Miceli-Richard, C., S. Lesage, M. Rybojad, A. M. Prieur, S. Manouvrier-Hanu, http://www.jimmunol.org/ SOCS-3, and TRIM27 (33, 51). Nod2 degradation did not occur by R. Ha¨fner, M. Chamaillard, H. Zouali, G. Thomas, and J. P. Hugot. 2001. these pathways in the presence of proteasomal inhibitors. We have CARD15 mutations in Blau syndrome. Nat. Genet. 29: 19–20. 9. Strober, W., N. Asano, I. Fuss, A. Kitani, and T. Watanabe. 2014. Cellular and conducted studies to investigate whether full-length NOD2 could molecular mechanisms underlying NOD2 risk-associated polymorphisms in be recovered in BMDM from +/m and m/m mice by a variety of Crohn’s disease. Immunol. Rev. 260: 249–260. inhibitors, including the calpain inhibitors ALLN and calpastatin, 10. Li, J., T. Moran, E. Swanson, C. Julian, J. Harris, D. K. Bonen, M. Hedl, D. L. Nicolae, C. Abraham, and J. H. Cho. 2004. Regulation of IL-8 and IL- the proteasome inhibitors bortezomib and MG132, the pan caspase 1beta expression in Crohn’s disease associated NOD2/CARD15 mutations. Hum. inhibitor z-vad.fmk, the cathepsin inhibitors L-006235, chymostatin, Mol. Genet. 13: 1715–1725. and pepstatin A, and NH Cl as an inhibitor of phagosome-lysosomal 11. Netea, M. G., G. Ferwerda, D. J. de Jong, T. Jansen, L. Jacobs, M. Kramer, 4 T. H. Naber, J. P. Drenth, S. E. Girardin, B. J. Kullberg, et al. 2005. Nucleotide- fusion (data not shown). All of these treatments, including some in

binding oligomerization domain-2 modulates specific TLR pathways for the by guest on October 1, 2021 combination, failed to restore the 116-kDa form of NOD2. If induction of cytokine release. J. Immunol. 174: 6518–6523. 12. Rose, C. D., T. M. Martin, and C. H. Wouters. 2011. Blau syndrome revisited. a specific enzyme is responsible for generating the 80-kDa form in Curr. Opin. Rheumatol. 23: 411–418. the setting of the mutation, it remains to be identified. A recent 13. Punzi, L., A. Gava, P. Galozzi, and P. Sfriso. 2011. Miscellaneous non- study using a genome-wide siRNA screen for proteins regulating inflammatory musculoskeletal conditions. Blau syndrome. Best Pract. Res. Clin. Rheumatol. 25: 703–714. Nod2 and NF-kB signaling in HEK-293 cells found that although 14. Kanazawa, N., I. Okafuji, N. Kambe, R. Nishikomori, M. Nakata-Hizume, there were hundreds serving as general regulators of the NF-kB S. Nagai, A. Fuji, T. Yuasa, A. Manki, Y. Sakurai, et al. 2005. Early-onset sar- pathway, there were few that were negative regulators specific to coidosis and CARD15 mutations with constitutive nuclear factor-kappaB activation: common genetic etiology with Blau syndrome. Blood 105: 1195–1197. Nod2 (52). If the faint 80-kDa band found in macrophages from 15. Martin, T. M., Z. Zhang, P. Kurz, C. D. Rose´, H. Chen, H. Lu, S. R. Planck, WT mice represents a normally occurring cleavage of NOD2 that M. P. Davey, and J. T. Rosenbaum. 2009. The NOD2 defect in Blau syndrome does not result in excess interleukin-1 activity. Arthritis Rheum. 60: 611–618. is enhanced by the R314Q mutation, future studies to elucidate 16. Okafuji, I., R. Nishikomori, N. Kanazawa, N. Kambe, A. Fujisawa, S. Yamazaki, the mechanism would be an important advance in identifying M. Saito, T. Yoshioka, T. Kawai, H. Sakai, et al. 2009. Role of the NOD2 ge- additional negative regulators specific to NOD2. notype in the clinical phenotype of Blau syndrome and early-onset sarcoidosis. Arthritis Rheum. 60: 242–250. Through the R314Q mouse we have identified a structural 17. Son, S., J. Lee, C. W. Woo, I. Kim, Y. Kye, K. Lee, and J. Lee. 2010. Altered change in NOD2 when the ortholog of human NOD2 has been cytokine profiles of mononuclear cells after stimulation in a patient with Blau modified to carry one point mutation found in Blau syndrome. syndrome. Rheumatol. Int. 30: 1121–1124. 18. Lutz, M. B., N. Kukutsch, A. L. Ogilvie, S. Ro¨ssner, F. Koch, N. Romani, and R314Q mice showed reduced cytokine production in vivo in re- G. Schuler. 1999. An advanced culture method for generating large quantities of sponse to MDP. Macrophages from R314Q mice and from patients highly pure dendritic cells from mouse bone marrow. J. Immunol. Methods 223: 77–92. from Blau syndrome showed reduced cytokine production and 19. Shevchenko, A., H. Tomas, J. Havlis, J. V. Olsen, and M. Mann. 2006. In-gel intracellular signaling of pathways normally activated by MDP. In digestion for mass spectrometric characterization of proteins and proteomes. contrast with analyses of Blau mutations done in transient trans- Nat. Protoc. 1: 2856–2860. 20. Rosenzweig, H. L., J. S. Clowers, G. Nunez, J. T. Rosenbaum, and M. P. Davey. fection assays, spontaneous activation of the NF-kB pathway was 2011. Dectin-1 and NOD2 mediate cathepsin activation in zymosan-induced not observed. These data provide new insights into how muta- arthritis in mice. Inflamm. Res. 60: 705–714. tions associated with Blau syndrome could alter the function of 21. Kezic, J. M., M. P. Davey, T. T. Glant, J. T. Rosenbaum, and H. L. Rosenzweig. 2012. Interferon-g regulates discordant mechanisms of uveitis versus joint and NOD2. axial disease in a murine model resembling spondylarthritis. Arthritis Rheum. 64: 762–771. 22. Paques, M., J. L. Guyomard, M. Simonutti, M. J. Roux, S. Picaud, Acknowledgments J. F. Legargasson, and J. A. Sahel. 2007. Panretinal, high-resolution color pho- We thank Thom Saunders (University of Michigan Transgenic Animal tography of the mouse fundus. Invest. Ophthalmol. Vis. Sci. 48: 2769–2774. Model Core Facility, Ann Arbor, MI) and Larry David (Proteomics Shared 23. Xu, H., P. Koch, M. Chen, A. Lau, D. M. Reid, and J. V. Forrester. 2008. A clinical grading system for retinal inflammation in the chronic model of ex- Resource at Oregon Health and Science University) for performing mass perimental autoimmune uveoretinitis using digital fundus images. Exp. Eye Res. spectrometry and helpful discussions and Neal Copeland (National Cancer 87: 319–326. The Journal of Immunology 357

24. Furtado, J. M., M. H. Davies, D. Choi, A. K. Lauer, B. Appukuttan, S. T. Bailey, Inflammasome-mediated disease animal models reveal roles for innate but not H. T. Rahman, J. F. Payne, A. J. Stempel, K. Mohs, M. R. Powers, et al. 2012. adaptive immunity. Immunity 30: 875–887. Imaging retinal vascular changes in the mouse model of oxygen-induced reti- 39. Meng, G., F. Zhang, I. Fuss, A. Kitani, and W. Strober. 2009. A mutation in the nopathy. Transl. Vis. Sci. Technol.1:5. Nlrp3 gene causing inflammasome hyperactivation potentiates Th17 cell- 25. Rosenzweig, H. L., M. J. Jann, E. E. Vance, S. R. Planck, J. T. Rosenbaum, and dominant immune responses. Immunity 30: 860–874. M. P. Davey. 2010. Nucleotide-binding oligomerization domain 2 and Toll-like 40. Albrecht, M., T. Lengauer, and S. Schreiber. 2003. Disease-associated variants in receptor 2 function independently in a murine model of arthritis triggered by PYPAF1 and NOD2 result in similar alterations of conserved sequence. Bio- intraarticular peptidoglycan. Arthritis Rheum. 62: 1051–1059. informatics 19: 2171–2175. 26. Rosenzweig, H. L., T. M. Martin, M. M. Jann, S. R. Planck, M. P. Davey, 41. Philpott, D. J., M. T. Sorbara, S. J. Robertson, K. Croitoru, and S. E. Girardin. K. Kobayashi, R. A. Flavell, and J. T. Rosenbaum. 2008. NOD2, the gene re- 2014. NOD proteins: regulators of inflammation in health and disease. Nat. Rev. sponsible for familial granulomatous uveitis, in a mouse model of uveitis. Invest. Immunol. 14: 9–23. Ophthalmol. Vis. Sci. 49: 1518–1524. 42. Kramer, M., J. Boeck, D. Reichenbach, C. Kaether, S. Schreiber, M. Platzer, 27. Carneiro, L. A., J. G. Magalhaes, I. Tattoli, D. J. Philpott, and L. H. Travassos. P. Rosenstiel, and K. Huse. 2010. NOD2-C2 - a novel NOD2 isoform activating 2008. Nod-like proteins in inflammation and disease. J. Pathol. 214: 136–148. NF-kappaB in a muramyl dipeptide-independent manner. BMC Res. Notes 3: 28. Kim, Y. G., M. H. Shaw, N. Warner, J. H. Park, F. Chen, Y. Ogura, and G. Nuń˜ez. 224. 2011. Cutting edge: Crohn’s disease-associated Nod2 mutation limits production 43. Brooks, M. N., M. V. Rajaram, A. K. Azad, A. O. Amer, M. A. Valdivia-Arenas, of proinflammatory cytokines to protect the host from Enterococcus faecalis- J. H. Park, G. Nuń˜ez, and L. S. Schlesinger. 2011. NOD2 controls the nature of induced lethality. J. Immunol. 187: 2849–2852. the inflammatory response and subsequent fate of Mycobacterium tuberculosis 29. Kim, Y. G., J. H. Park, T. Reimer, D. P. Baker, T. Kawai, H. Kumar, S. Akira, and M. bovis BCG in human macrophages. Cell. Microbiol. 13: 402–418. C. Wobus, and G. Nuń˜ez. 2011. Viral infection augments Nod1/2 signaling to 44. Noguchi, E., Y. Homma, X. Kang, M. G. Netea, and X. Ma. 2009. A Crohn’s potentiate lethality associated with secondary bacterial infections. Cell Host disease-associated NOD2 mutation suppresses transcription of human IL10 by Microbe 9: 496–507. inhibiting activity of the nuclear ribonucleoprotein hnRNP-A1. Nat. Immunol. 30. Tao, M., P. C. Scacheri, J. M. Marinis, E. W. Harhaj, L. E. Matesic, and 10: 471–479. D. W. Abbott. 2009. ITCH K63-ubiquitinates the NOD2 binding protein, RIP2, 45. McDonald, C., F. F. Chen, V. Ollendorff, Y. Ogura, S. Marchetto, P. Lećine, to influence inflammatory signaling pathways. Curr. Biol. 19: 1255–1263. J. P. Borg, and G. Nun˜ez. 2005. A role for Erbin in the regulation of Nod2- 31. Marblestone, J. G., J. P. Larocque, M. R. Mattern, and C. A. Leach. 2012. dependent NF-kappaB signaling. J. Biol. Chem. 280: 40301–40309. Analysis of ubiquitin E3 ligase activity using selective polyubiquitin binding 46. Kufer, T. A., E. Kremmer, D. J. Banks, and D. J. Philpott. 2006. Role for erbin in Downloaded from proteins. Biochim. Biophys. Acta 1823: 2094–2097. bacterial activation of Nod2. Infect. Immun. 74: 3115–3124. 32. Malynn, B. A., and A. Ma. 2010. Ubiquitin makes its mark on immune regu- 47. Yamamoto-Furusho, J. K., N. Barnich, R. Xavier, T. Hisamatsu, and lation. Immunity 33: 843–852. D. K. Podolsky. 2006. Centaurin beta1 down-regulates nucleotide-binding 33. Lee, K. H., A. Biswas, Y. J. Liu, and K. S. Kobayashi. 2012. Proteasomal oligomerization domains 1- and 2-dependent NF-kappaB activation. J. Biol. degradation of Nod2 protein mediates tolerance to bacterial cell wall compo- Chem. 281: 36060–36070. nents. J. Biol. Chem. 287: 39800–39811. 48. Bielig, H., B. Zurek, A. Kutsch, M. Menning, D. J. Philpott, P. J. Sansonetti, and 34. Rosenstiel, P., K. Huse, A. Till, J. Hampe, S. Hellmig, C. Sina, S. Billmann, T. A. Kufer. 2009. A function for AAMP in Nod2-mediated NF-kappaB acti-

O. von Kampen, G. H. Waetzig, M. Platzer, et al. 2006. A short isoform of vation. Mol. Immunol. 46: 2647–2654. http://www.jimmunol.org/ NOD2/CARD15, NOD2-S, is an endogenous inhibitor of NOD2/receptor- 49. Richmond, A. L., A. Kabi, C. R. Homer, N. Marina-Garcıá, K. P. Nickerson, A. interacting protein kinase 2-induced signaling pathways. Proc. Natl. Acad. Sci. I. Nesvizhskii, A. Sreekumar, A. M. Chinnaiyan, G. Nun˜ez, and C. McDonald. USA 103: 3280–3285. 2012. The nucleotide synthesis enzyme CAD inhibits NOD2 antibacterial 35. Pauleau, A. L., and P. J. Murray. 2003. Role of nod2 in the response of mac- function in human intestinal epithelial cells. Gastroenterology 142: 1483–1492. rophages to toll-like receptor agonists. Mol. Cell. Biol. 23: 7531–7539. e6. 36. Seok, J., H. S. Warren, A. G. Cuenca, M. N. Mindrinos, H. V. Baker, W. Xu, 50. Lecat, A., E. Di Valentin, J. Somja, S. Jourdan, M. Fillet, T. A. Kufer, D. R. Richards, G. P. McDonald-Smith, H. Gao, L. Hennessy, et al.; Inflam- Y. Habraken, C. Sadzot, E. Louis, P. Delvenne, et al. 2012. The c-Jun N-terminal mation and Host Response to Injury, Large Scale Collaborative Research Pro- kinase (JNK)-binding protein (JNKBP1) acts as a negative regulator of NOD2 gram. 2013. Genomic responses in mouse models poorly mimic human protein signaling by inhibiting its oligomerization process. J. Biol. Chem. 287: inflammatory diseases. Proc. Natl. Acad. Sci. USA 110: 3507–3512. 29213–29226. 37. Hoffman, H. M., M. L. Throne, N. J. Amar, M. Sebai, A. J. Kivitz, 51. Zurek, B., I. Schoultz, A. Neerincx, L. M. Napolitano, K. Birkner, E. Bennek,

A. Kavanaugh, S. P. Weinstein, P. Belomestnov, G. D. Yancopoulos, N. Stahl, G. Sellge, M. Lerm, G. Meroni, J. D. So¨derholm, and T. A. Kufer. 2012. TRIM27 by guest on October 1, 2021 and S. J. Mellis. 2008. Efﬁcacy and safety of rilonacept (interleukin-1 Trap) in negatively regulates NOD2 by ubiquitination and proteasomal degradation. PLoS patients with cryopyrin-associated periodic syndromes: results from two se- ONE 7: e41255. quential placebo-controlled studies. Arthritis Rheum. 58: 2443–2452. 52. Warner, N., A. Burberry, L. Franchi, Y. G. Kim, C. McDonald, M. A. Sartor, and 38. Brydges, S. D., J. L. Mueller, M. D. McGeough, C. A. Pena, A. Misaghi, G. Nu´n˜ez. 2013. A genome-wide siRNA screen reveals positive and negative C. Gandhi, C. D. Putnam, D. L. Boyle, G. S. Firestein, A. A. Horner, et al. 2009. regulators of the NOD2 and NF-kB signaling pathways. Sci. Signal. 6: rs3.