DOCSLIB.ORG

Prototheca Zopfii Genotype II Induces Mitochondrial Apoptosis in Models

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prototheca Zopfii Genotype II Induces Mitochondrial Apoptosis in Models www.nature.com/scientificreports OPEN Prototheca zopfi genotype II induces mitochondrial apoptosis in models of bovine mastitis Muhammad Shahid1, Eduardo R. Cobo2, Liben Chen3, Paloma A. Cavalcante2, Herman W. Barkema 2, Jian Gao1, Siyu Xu1, Yang Liu1, Cameron G. Knight4, John P. Kastelic2 & Bo Han 1* Prototheca zopfi is an alga increasingly isolated from bovine mastitis. Of the two genotypes of P. zopfi (genotype I and II (GT-I and -II)), P. zopfi GT-II is the genotype associated with acute mastitis and decreased milk production, although its pathogenesis is not well known. The objective was to determine infammatory and apoptotic roles of P. zopfi GT-II in cultured mammary epithelial cells (from cattle and mice) and murine macrophages and using a murine model of mastitis. Prototheca zopfi GT-II (but not GT-I) invaded bovine and murine mammary epithelial cells (MECs) and induced apoptosis, as determined by the terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick end labeling assay. This P. zopfi GT-II driven apoptosis corresponded to mitochondrial pathways; mitochondrial transmembrane resistance (ΔΨm) was altered and modulation of mitochondrion- mediated apoptosis regulating genes changed (increased transcriptional Bax, cytochrome-c and Apaf-1 and downregulated Bcl-2), whereas caspase-9 and -3 expression increased. Apoptotic efects by P. zopfi GT-II were more pronounced in macrophages compared to MECs. In a murine mammary infection model, P. zopfi GT-II replicated in the mammary gland and caused severe infammation with infltration of macrophages and neutrophils and upregulation of pro-infammatory genes (TNF-α, IL-1β and Cxcl-1) and also apoptosis of epithelial cells. Thus, we concluded P. zopfi GT-II is a mastitis-causing pathogen that triggers severe infammation and also mitochondrial apoptosis. Bovine mastitis (infammation of the udder), caused by infection with pathogenic microorganisms and destruc- tion of milk-synthesizing tissues1, reduces milk production and quality and is an important fnancial threat to the dairy industry2. Prototheca zopfi, a chlorophyllous alga (family Chlorellaceae) unable to synthesize chlorophyll and with heterotrophic modes of nutrition3,4, is a major cause of mastitis in dairy cows5,6. Bovine protothecal mastitis can be clinical or subclinical. In clinical cases, symptoms include fever (up to 40 °C), pain, mammary edema, anorexia and reluctance to move7. Subclinical protothecal mastitis is associated with increased number of leukocytes in the udder and milk and can be manifested by slight pain along with loss of appetite7. Bovine proto- thecal mastitis decreases milk production and elevates somatic cell count in milk, especially macrophages, ofen resulting in culling7. Reported bovine Prototheca zopfi mastitis occurrence ranges from 7.5 to 16.3%8,9; however, these reports are predominantly from outbreaks. Although a large proportion (up to 81%) of dairy herds are infected, this pathogen afects a limited proportion of cows (<10%)10,11. Cows are ofen infected intramammarily with P. z opfi following teat trauma during mechanical milking12 and contamination of the teat orifce with damp organic material7,13. Single Prototheca zopfi endospores or sporangiospores contact mammary gland epithelial cells, which are frst responders, sensing their presence and initiating an infammatory immune response. Afer breaching epithelial defenses, Prototheca zopfi may also invade macrophages of the mammary gland alveolar lumen and interstitium14, making Prototheca zopfi less accessible to antibiotics and diagnostic methods15. Two genotypes of Prototheca zopfi, genotype I (GT-I) and genotype II (GT-II) have been isolated from bovine milk and identifed16. Genotype I is predominantly isolated from environmental samples, whereas GT-II is isolated from 1Department of Clinical Veterinary Medicine, College of Veterinary Medicine, China Agricultural University, Beijing, 100193, P.R. China. 2Department of Production Animal Health, Faculty of Veterinary Medicine, University of Calgary, Calgary, AB, T2N 4N1, Canada. 3Whiting School of Engineering, Johns Hopkins University, Baltimore, MD, 21218, USA. 4Department of Veterinary Clinical and Diagnositic Sciences, Faculty of Veterinary Medicine, University of Calgary, Calgary, AB, T2N 4N1, Canada. *email: [email protected] SCIENTIFIC REPORTS | (2020) 10:698 | https://doi.org/10.1038/s41598-020-57645-z 1 www.nature.com/scientificreports/ www.nature.com/scientificreports milk samples and has been reported as the causative pathogen of bovine mastitis17–19. In the latest study, the two types were named P. ciferri and P. b ov i s , separately20. Prototheca zopfi GT-II induced oxidative stress and apoptotic death in cultured bovine mammary epithelial cells (bMECs), Prototheca zopfi GT-II is more pathogenic than P. z opfi GT-I, commonly isolated as an enviromental apathogenic microbe21,22. Moreover, another study reported that mammary gland infected with P. z opfi GT-I had no clinical signs14, but pathogenesis of protothecal mastitis due to P. z opfi GT-II remains elusive. Tus, we aim to determine infammatory and apoptotic roles of Prototheca zopfi GT-II in cultured mammary epithelial cells (from cattle and mice) and murine macrophages and using a murine model of mastitis. Materials and Methods Statement of ethics. Te current study was conducted in accordance with ethical guidelines and regula- tions regarding laboratory animal care and use, as described in the “Guide to the Care and Use of Experimental Animals” from the Canadian Council on Animal Care (https://www.ccac.ca/Documents/Standards/Guidelines/ Experimental_Animals_Vol1.pdf). Animal use was reviewed and approved by the Animal Care Committee of the University of Calgary, Calgary, AB, Canada (protocol number AC16–0061). Prototheca zopfi culture. Prototheca zopfi GT-II isolates were collected from milk samples of dairy cows with clinical mastitis, whereas P. z opfi GT-I isolates were predominantly cultured from environmental samples in China, and cultured and stored at College of Veterinary Medicine, China Agricultural University, Beijing, China23. P. z opfi GT-I and II were isolated from a total of 163 P. z opfi isolates collected from mastitic milk and environ- mental samples18. In this study, P. z opfi GT-II was only isolated from mastitic milk, whereas GT-I was recovered from environmental samples (feed, feces, water and teat cups). Both genotypes were characterized by their cellular fatty acid pattern and 18 S rDNA sequences. P. z opfi GT-II had increased amounts of eicosadienoic acid (C20: 2) compared to GT-I. Whereas both P. z opfi GT-I and II had high sequence similarity (99.4%), GT-II (AY940456) dif- fered in some nucleotides from GT-I (AY973040)16. All bovine mastitis milk P. z opfi strains were further identifed by genotype-specifc PCR and restriction fragment length polymorphism analysis16,24. In our previous study, the 450 bp fragment internal amplifcation control was detected using Proto18–4f (GACATGGCGAGGATTGACAGA) and Proto18–4r (AGCACACCCAATCGGTAGGA) sequences. The GT-I strain was identified by Proto18–4f (GACATGGCGAGGATTGACAGA) and PZGT-1/r (GCCAAGGCCCCCCGAAG) primers. GT-II specific amplicon (165 bp) was detected with primers Proto18–4f (GACATGGCGAGGATTGACAGA) and PZGT-II/r (GTCGGCGGGGCAAAAGC)18. Te P. z opfi genotype was further confrmed by restriction fragment length pol- ymorphism (RFLP) analysis targeting the cytb gene fragment (599–668 bp)5. For this, a PCR mix (25 µL) contain- ing cytb-F1 (5′ GyGTwGAACAyATTATGAGAG-3′) and cytb-R2 (5′-wACCCATAArAArTACCATTCwGG-3′) primers (10 μM each primer), DNA template (1 µL), and 2x EasyTaq PCR supermix (TransGen Biotech, AS111–11; 12.5 µL) was amplifed under specifc conditions (2 min at 95 °C, followed by 35 cycles of 30 sec at 95 °C, 30 sec at 50 °C, and 30 sec at 72 °C, with fnal extension of 5 min at 72 °C). Te PCR products depicted a 644 base pair (bp) product compatible with P. z opfi as visualized by agarose gel electrophoresis (1%, wt/vol) and stained with ethidium bromide. Te amplifed cytb gene products (644-bp) were digested by RsaI and TaiI digesting enzymes (FastDigest Enzymes, Termo Fisher Scientifc). Te total mixture (30 µL) containing 10x restriction enzyme bufer (3 µL), PCR product (10 µL), enzymes (1.5 µL each) and PCR water (16.5 µL) was digested by RsaI (5 min at 37 °C) followed by TaiI (5 min at 65 °C). Te restriction products visualized on 4% agarose gels, stained with ethidium bromide, and exposed to UV light showed DNA fragments of 200 and 450 bp afer RSaI/TaiI digestion, compatible with P. z opfi GT -II (Supplementary Fig. 1). Taken together, we confrmed a P. z opfi II genotype in the isolate clinically recovered from a case of mastitis in cows. Prior to each experiment, fresh P. z opfi GT-I and -II were cultured on Sabouraud dextrose agar (SDA; Sigma, Shanghai, China) for up to 48 h at 37 °C and single colonies incubated in Sabouraud dextrose broth (SDB; Sigma) at same conditions for up to 72 h23. Mouse protothecal mastitis model. C57BL/6 lactating female mice (6–8 wk old; 10–14 d afer parturition) were housed in specifc pathogen-free facilities at the University of Calgary with ad libitum access to food and water. Mice were inoculated intramammarily with either P. z opfi GT-II (50 µL containing 1 × 105 CFU/mL) or an equal volume of phosphate bufered saline (PBS) (control) in the lef fourth and right fourth (L4 and R4) mam- mary glands. Mice were euthanized 4 d post inoculation (dpi) to collect mammary tissue samples.
Load more

Recommended publications
  • The Non-Photosynthetic Algae Helicosporidium Spp.: Emergence of a Novel Group of Insect Pathogens
    Insects 2013, 4, 375-391; doi:10.3390/insects4030375 OPEN ACCESS insects ISSN 2075-4450 www.mdpi.com/journal/insects/ Review The Non-Photosynthetic Algae Helicosporidium spp.: Emergence of a Novel Group of Insect Pathogens Aurélien Tartar Division of Math, Science, and Technology, Nova Southeastern University, 3301 College Avenue, Fort Lauderdale, FL 33314, USA; E-Mail: [email protected]; Tel.: +1-954-262-8148; Fax: +1-954-262-3931 Received: 30 May 2013; in revised form: 4 July 2013 / Accepted: 8 July 2013 / Published: 17 July 2013 Abstract: Since the original description of Helicosporidium parasiticum in 1921, members of the genus Helicosporidium have been reported to infect a wide variety of invertebrates, but their characterization has remained dependent on occasional reports of infection. Recently, several new Helicosporidium isolates have been successfully maintained in axenic cultures. The ability to produce large quantity of biological material has led to very significant advances in the understanding of Helicosporidium biology and its interactions with insect hosts. In particular, the unique infectious process has been well documented; the highly characteristic cyst and its included filamentous cell have been shown to play a central role during host infection and have been the focus of detailed morphological and developmental studies. In addition, phylogenetic analyses inferred from a multitude of molecular sequences have demonstrated that Helicosporidium are highly specialized non-photosynthetic algae (Chlorophyta: Trebouxiophyceae), and represent the first described entomopathogenic algae. This review provides an overview of (i) the morphology of Helicosporidium cell types, (ii) the Helicosporidium life cycle, including the entire infectious sequence and its impact on insect hosts, (iii) the phylogenetic analyses that have prompted the taxonomic classification of Helicosporidium as green algae, and (iv) the documented host range for this novel group of entomopathogens.
    [Show full text]
  • A First Insight Into the Genome of Prototheca Wickerhamii, a Major
    Bakuła et al. BMC Genomics (2021) 22:168 https://doi.org/10.1186/s12864-021-07491-8 RESEARCH ARTICLE Open Access A first insight into the genome of Prototheca wickerhamii, a major causative agent of human protothecosis Zofia Bakuła1, Paweł Siedlecki2,3, Robert Gromadka4, Jan Gawor4, Agnieszka Gromadka3, Jan J. Pomorski5, Hanna Panagiotopoulou5 and Tomasz Jagielski1* Abstract Background: Colourless microalgae of the Prototheca genus are the only known plants that have consistently been implicated in a range of clinically relevant opportunistic infections in both animals and humans. The Prototheca algae are emerging pathogens, whose incidence has increased importantly over the past two decades. Prototheca wickerhamii is a major human pathogen, responsible for at least 115 cases worldwide. Although the algae are receiving more attention nowadays, there is still a substantial knowledge gap regarding their biology, and pathogenicity in particular. Here we report, for the first time, the complete nuclear genome, organelle genomes, and transcriptome of the P. wickerhamii type strain ATCC 16529. Results: The assembled genome size was of 16.7 Mbp, making it the smallest and most compact genome sequenced so far among the protothecans. Key features of the genome included a high overall GC content (64.5%), a high number (6081) and proportion (45.9%) of protein-coding genes, and a low repetitive sequence content (2.2%). The vast majority (90.6%) of the predicted genes were confirmed with the corresponding transcripts upon RNA-sequencing analysis. Most (93.2%) of the genes had their putative function assigned when searched against the InterProScan database. A fourth (23.3%) of the genes were annotated with an enzymatic activity possibly associated with the adaptation to the human host environment.
    [Show full text]
  • Protothecosis and Chlorellosis in Sheep and Goats: a Review
    VDIXXX10.1177/1040638720978781Protothecosis and chlorellosis in sheep and goatsRiet-Correa et al. 978781review-article2020 Review Journal of Veterinary Diagnostic Investigation 1 –5 Protothecosis and chlorellosis in sheep © 2020 The Author(s) Article reuse guidelines: sagepub.com/journals-permissions and goats: a review DOI:https://doi.org/10.1177/1040638720978781 10.1177/1040638720978781 jvdi.sagepub.com Franklin Riet-Correa,1 Priscila Maria Silva do Carmo, Francisco A. Uzal Abstract. Protothecosis and chlorellosis are sporadic algal diseases that can affect small ruminants. In goats, protothecosis is primarily associated with lesions in the nose and should be included in the differential diagnosis of causes of rhinitis. In sheep, chlorellosis causes typical green granulomatous lesions in various organs. Outbreaks of chlorellosis have been reported in sheep consuming stagnant water, grass from sewage-contaminated areas, and pastures watered by irrigation canals or by effluents from poultry-processing plants. Prototheca and Chlorella are widespread in the environment, and environmental and climatic changes promoted by anthropogenic activities may have increased the frequency of diseases produced by them. The diagnosis of these diseases must be based on gross, microscopic, and ultrastructural lesions, coupled with detection of the agent by immunohistochemical-, molecular-, and/or culture-based methods. Key words: chlorellosis; goats; protothecosis; sheep. Introduction pathogenic for animals and humans.1,2,12,26 Genotype 2 is involved more frequently than genotype 1 in protothecosis of Prototheca spp. (achlorophyllous algae) and Chlorella spp. animals and human.1,2,12,16,26 Since 2008, 2 more species have (chlorophyll-containing algae) are ubiquitous algae that been recognized as pathogens: P. blaschkeae was isolated reproduce asexually by internal septation (endosporulation) from the mammary gland of cows with mastitis,16 and P.
    [Show full text]
  • Disseminated Prototheca Wickerhamii Infection with Arthritis and Tenosynovitis JOAN S
    Case Report Disseminated Prototheca wickerhamii Infection with Arthritis and Tenosynovitis JOAN S. PASCUAL, LUCIA L. BALOS, and ALAN N. BAER ABSTRACT. Achloric algae of the Prototheca species are a rare cause of infection in humans. These infections are usually localized to the skin, olecranon bursae, and tendon sheaths of the hands and wrists. Our patient with acquired immunodeficiency syndrome and a chronic Prototheca wickerhamii skin infec- tion of the hand developed tenosynovitis and arthritis of his ankle in the setting of a documented algemia. This is the first reported case of protothecal arthritis and tenosynovitis resulting from hematogenous dissemination. The reported musculoskeletal manifestations of protothecal infections are reviewed. (J Rheumatol 2004;31:1861–5) Key Indexing Terms: PROTOTHECA ALGAE TENOSYNOVITIS INFECTIOUS ARTHRITIS ACQUIRED IMMUNODEFICIENCY SYNDROME Prototheca are achloric algae that can be a rare cause of tous inflammation with ovoid basophilic bodies both in and around histio- infection in humans. Infections are generally localized to cytes (Figure 1). A culture grew P. wickerhamii. Oral itraconazole was resumed. Within 3 weeks of this biopsy, the patient inadvertently stepped exposed skin of the face and distal extremities, olecranon in a hole and forcibly dorsiflexed his left ankle; swelling of the ankle bursae, and tendon sheaths of the hands and wrists. They persisted for over 2 months, prompting an intraarticular injection of dexam- occur in both immunocompetent and immunocompromised ethasone. Five months prior to hospitalization, the patient developed hosts. Systemic protothecosis with visceral and meningeal several subcutaneous nodules in his left lower extremity, despite ongoing involvement occurs rarely in immunocompromised individ- itraconazole therapy.
    [Show full text]
  • Protothecosis: Agent Characterization and Pathogenesis
    PROTOTHECOSIS: AGENT CHARACTERIZATION AND PATHOGENESIS SARA ANDREIA DE BARROS COSTA MARQUES Tese de doutoramento em Ciências Veterinárias 2010 SARA ANDREIA DE BARROS COSTA MARQUES PROTOTHECOSIS: AGENT CHARACTERIZATION AND PATHOGENESIS Tese de Candidatura ao grau de Doutor em Ciências Veterinárias submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto. Orientador – Doutora Gertrude Averil Baker Thompson Categoria – Professor Associado Afiliação – Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto. Co-orientador – Doutor Arnaldo António de Moura Silvestre Videira Categoria – Professor Catedrático Afiliação – Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto. Co-orientador – Doutor Volker A. R. Huss Categoria – Professor Associado Afiliação – Molekulare Pflanzenphysiologie, Friedrich-Alexander – Universität Erlangen – Nürnberg, Germany. Os resultados dos trabalhos experimentais incluídos na presente dissertação fazem parte dos seguintes artigos científicos: The results obtained from the experimental work included in this thesis became from several research articles published: Marques S., Silva E., Kraft C., Carvalheira J., Videira A., Huss V., Thompson G. 2008. Bovine mastitis associated with Prototheca blaschkeae. Journal of Clinical Microbiology. 46(6):1941-1945. Thompson, G., E. Silva, S. Marques, A. Müller and J. Carvalheira. 2008. Algaemia in a dairy cow by Prototheca blaschkeae. Medical Mycology. 47(5): 527-531. Marques S., Silva E., Carvalheira J., Thompson G. 2010. Phenotypic characterization of mastitic Prototheca spp. isolates. Research in Veterinary Science. 89(1): 5-9. Marques S., Silva E., Carvalheira J., Thompson G. 2010. In vitro susceptibility of Prototheca to pH and salt concentration. Mycopathologia. 169(4): 297-302. Marques S., Silva E., Carvalheira J., Thompson G. 2010. Short communication: Temperature sensibility of Prototheca blaschkeae strains isolated from bovine mastitic milk.
    [Show full text]
  • Plmitrna, a Database on the Heterogeneous Genetic Origin of Mitochondrial Trna Genes and Trnas in Photosynthetic Eukaryotes
    436–438 Nucleic Acids Research, 2003, Vol. 31, No. 1 # 2003 Oxford University Press DOI: 10.1093/nar/gkg080 PLMItRNA, a database on the heterogeneous genetic origin of mitochondrial tRNA genes and tRNAs in photosynthetic eukaryotes Guglielmo Rainaldi, Mariateresa Volpicella, Flavio Licciulli1, Sabino Liuni1, Raffaele Gallerani and Luigi R. Ceci1,* Dipartimento di Biochimica e Biologia Molecolare, Universita` di Bari and 1Centro di Studio sui Mitocondri e Downloaded from https://academic.oup.com/nar/article/31/1/436/2401376 by guest on 30 September 2021 Metabolismo Energetico, CNR, Via Amendola 165/A, 70126 Bari Italy Received September 13, 2002; Accepted September 20, 2002 ABSTRACT classification in different classes as indicated in Table 1 for Viridiplantae and in a similar Table (see Table S3 in The updated version of PLMItRNA reports informa- Supplementary Material) for Cryptophyta, Rhodophyta and tion and multialignments on 609 genes and 34 tRNA Stramenopiles. These tables report a general view of all the molecules active in the mitochondria of Viridiplantae complete tRNA genes and molecules identified in the (27 Embryophyta and 10 Chlorophyta), and photo- mitochondrial genomes of photosynthetic eukaryotes. synthetic algae (one Cryptophyta, four Rhodophyta Coloured squares have hyper-textual link to single gene (or and two Stramenopiles). Colour-code based tables molecule) entry. Colour code refers to the different genetic reporting the different genetic origin of identified origin of tRNA genes or molecules (see Table 1). Genes or genes allow hyper-textual link to single entries. molecules with chloroplast or nuclear origins are aligned Promoter sequences identified for tRNA genes in separately. the mitochondrial genomes of Angiospermae are PLMItRNA updating was carried out essentially as already also reported.
    [Show full text]
  • Green Algae Secondary Article
    Green Algae Secondary article Mark A Buchheim, University of Tulsa, Tulsa, Oklahoma, USA Article Contents . Introduction The green algae comprise a large and diverse group of organisms that range from the . Major Groups microscopic to the macroscopic. Green algae are found in virtually all aquatic and some . Economic and Ecological Importance terrestrial habitats. Introduction generalization). The taxonomic and phylogenetic status of The green algae comprise a large and diverse group of the green plant group is supported by both molecular and organisms that range from the microscopic (e.g. Chlamy- nonmolecular evidence (Graham, 1993; Graham and domonas) to the macroscopic (e.g. Acetabularia). In Wilcox, 2000). This group of green organisms has been addition to exhibiting a considerable range of structural termed the Viridaeplantae or Chlorobionta. Neither the variability, green algae are characterized by extensive euglenoids nor the chlorarachniophytes, both of which ecological diversity. Green algae are found in virtually all have apparently acquired a green chloroplast by a aquatic (both freshwater and marine) and some terrestrial secondary endosymbiosis, are included in the green plant habitats. Although most are free-living, a number of green lineage (Graham and Wilcox, 2000). Furthermore, the algae are found in symbiotic associations with other Chloroxybacteria (e.g. Prochloron), which possess chlor- organisms (e.g. the lichen association between an alga ophyll a and b organized on thylakoids, are true and a fungus). Some green algae grow epiphytically (e.g. prokaryotes, and are not, therefore, included in the green Characiochloris, which grows on other filamentous algae plant lineage. The green algal division Chlorophyta forms or higher aquatic plants), epizoically (e.g.
    [Show full text]
  • Mastitis Associated with Prototheca Zopfii - an Emerging Health and Economic Problem on Dairy Farms
    J Vet Res 60, 373-378, 2016 DE DE GRUYTER OPEN DOI: 10.1515/jvetres-2016-0054 G REVIEW ARTICLE Mastitis associated with Prototheca zopfii - an emerging health and economic problem on dairy farms Dubravka Milanov1, Tamaš Petrović1, Vladimir Polaček1, Ljiljana Suvajdžić2, Jovan Bojkovski3 1Scientific Veterinary Institute “Novi Sad”, 21000 Novi Sad, Republic of Serbia 2Department of Pharmacy, Faculty of Medicine, University of Novi Sad, 21000 Novi Sad, Republic of Serbia 3Faculty of Veterinary Medicine, University of Belgrade, 11000 Belgrade, Republic of Serbia [email protected] Received: May 19, 2016 Accepted: November 16, 2016 Abstract Increased incidence of protothecal mastitis has been recorded in several countries in the past ten years. The main goal of this article is to draw the attention of scientific and professional community to the emerging issue of mammary protothecosis. The article collates currently known facts about infection reservoirs, predisposing factors for the development of mastitis, clinical manifestations of the disease, and potential transmission routes within the herd as well as the measures for control and eradication. We would like to point out that identification of protothecal mastitis on a dairy farm is associated with a range of problems. Early detection of infected animals can be difficult because of predominantly subclinical course of early-stage infection, which easily spreads between cows via the milking system. Spontaneous recovery has not been recorded and infected cows typically develop chronic mastitis with granulomatous infiltration and progressive loss of functional parenchyma of the mammary gland. Substantial economic losses and health damages associated with mammary protothecosis strongly emphasise the need for developing effective prevention strategies aimed at control of the infection.
    [Show full text]
  • Characteristics and Importance of the Genus Prototheca in Human and Veterinary Medicine
    Zbornik Matice srpske za prirodne nauke / Proc. Nat. Sci, Matica Srpska Novi Sad, ¥ 110, 15—27, 2006 UDC 582.26/.27 Dubravka S. Milanov1 Ljiljana Ð. Suvajdÿiã2 1 Scientific Veterinary Institute “Novi Sad" Rumenaåki put 6, 21000 Novi Sad, Serbia 2 Faculty of Medicine, Department of Pharmacy Hajduk Veljkova 3, 21000 Novi Sad, Serbia CHARACTERISTICS AND IMPORTANCE OF THE GENUS PROTOTHECA IN HUMAN AND VETERINARY MEDICINE ABSTRACT: Prototheca spp. are strange algae, assigned to the genus Prototheca, family Chlorelaceae. They are ubiquitous in nature, living predominantly in aqueous locales containing decomposing plant material. Prototheca spp. were isolated from skin scarificates, sputum and feces of humans in absence of infection, as well as in a variety of domestic and some wild animals. Prototheca spp. are unicellular organisms, oval or spheric in shape. They differ from bacteria and fungi in size, shape and reproductive characteristics. Of the five known species of the genus, only P. wickerhamii and P. zopfii are considered pathoge- nic, and they are the only known plant causative agents of human and animal infections. Over the past 25 years medical references reported more than 100 cases of human protothe- coses, mostly induced by P. wickerhamii and rarely by P. zopfii. A half of the reports on human protothecoses relates to localized cutaneous infections and oleocranon bursitis. The rarest and most severe form of the infection is disseminated or systemic protothecosis, de- scribed in patients with durable course of primary disease or immune disfunction. In veterinary medicine, Prototheca zopfii and rarely also P. wickerhamii are reported as causa- tive agents of cutaneous protothecosis in dogs and cats, systemic protothecosis in dogs and mastitis in dairy cows.
    [Show full text]
  • In Vivo and in Vitro Development of the Protist Helicosporidium Sp
    J. Eukaryot. Microbiol., 48(4), 2001 pp. 460±470 q 2001 by the Society of Protozoologists In Vivo and In Vitro Development of the Protist Helicosporidium sp. DRION G. BOUCIAS,a JAMES J. BECNEL,b SUSAN E. WHITEb and MICHEAL BOTT aDepartment of Entomology and Nematology, University of Florida, Gainesville, Florida, 32611 USA, and bCenter for Medical, Agricultural and Veterinary Entomology, USDA, ARS, Gainesville, Florida 32604, USA ABSTRACT. We describe the discovery and developmental features of a Helicosporidium sp. isolated from the black ¯y Simulium jonesi. Morphologically, the helicosporidia are characterized by a distinct cyst stage that encloses three ovoid cells and a single elongate ®lamentous cell. Bioassays have demonstrated that the cysts of this isolate infect various insect species, including the lepidopterans, Helicoverpa zea, Galleria mellonella, and Manduca sexta, and the dipterans, Musca domestica, Aedes taeniorhynchus, Anopheles albimanus, and An. quadrimaculatus. The cysts attach to the insect peritrophic matrix prior to dehiscence, which releases the ®lamentous cell and the three ovoid cells. The ovoid cells are short-lived in the insect gut with infection mediated by the penetration of the ®lamentous cell into the host. Furthermore, these ®lamentous cells are covered with projections that anchor them to the midgut lining. Unlike most entomopathogenic protozoa, this Helicosporidium sp. can be propagated in simple nutritional media under de®ned in vitro conditions, providing a system to conduct detailed analysis of the developmental biology of this poorly known taxon. The morphology and development of the in vitro produced cells are similar to that reported for the achorophyllic algae belonging to the genus Prototheca.
    [Show full text]
  • Fatal Algaemia in Patient with Chronic Lymphocytic Leukemia
    LETTERS References Fatal Algaemia in eramide. Voriconazole (400 mg/day) was used from day 17 to day 27. On 1. Chang WH. Current status of tsutsuga- Patient with Chronic mushi disease in Korea. J Korean Med day 21, Cryptosporidium parvum was Sci. 1995;10:227–38. Lymphocytic detected on parasitologic stool exami- 2. Cook GC, Warrell DA, Bryceson AD. Leukemia nation. Symptoms persisted on day Royal Society of Tropical Medicine and 26, with strong asthenia and deteriora- Hygiene meeting at Manson House, Lon- don, 17 October 1996. Debate: tropical To the Editor: Prototheca spe- tion of general state. At that time, the 9 medicine as a formal discipline is dead and cies are achlorophyllic lower algae, leukocyte count was 178 × 10 /L with should be buried. Trans R Soc Trop Med ubiquitous in nature, which can cause 3.56 × 109/L polymorphonuclear neu- Hyg. 1997;91:372–4, discussion 374–5. human infections, particularly in im- trophils and 172 × 109/L lymphocytes. DOI: 10.1016/S0035-9203(97)90244-3 3. Watt G, Parola P. Scrub typhus and tropi- munocompromised patients (1). Hu- Three peripheral blood samples were cal rickettsioses. Curr Opin Infect Dis. man protothecosis is mostly caused by cultured for detection of bacteria and 2003;16:429–36. DOI: 10.1097/00001432- P. wickerhamii and P. zopfii. Although fungi. On day 27, septic shock devel- 200310000-00009 such infections are infrequent, they oped in the patient. A blood culture 4. Ogawa M, Hagiwara T, Kishimoto T, Shiga S, Yoshida Y, Furuya Y, et al. Scrub can manifest themselves clinically showed an Escherichia coli strain sus- typhus in Japan: epidemiology and clini- as cutaneous lesions, olecranon bur- ceptible to piperacillin-tazobactam, cal features of cases reported in 1998.
    [Show full text]
  • Genome Sequencing of Prototheca Zopfii Genotypes 1 and 2 Provides
    www.nature.com/scientificreports OPEN Genome sequencing of Prototheca zopfi genotypes 1 and 2 provides evidence of a severe reduction in Received: 9 February 2018 Accepted: 12 September 2018 organellar genomes Published: xx xx xxxx Marco Severgnini 1, Barbara Lazzari 2,3, Emanuele Capra3, Stefania Chessa3, Mario Luini4, Roberta Bordoni1, Bianca Castiglioni3, Matteo Ricchi 5 & Paola Cremonesi 3 Prototheca zopfi (P. zopfi, class Trebouxiophyceae, order Chlorellales, family Chlorellaceae), a non- photosynthetic predominantly free-living unicellular alga, is one of the few pathogens belonging to the plant kingdom. This alga can afect many vertebrate hosts, sustaining systemic infections and diseases such as mastitis in cows. The aim of our work was to sequence and assemble the P. zopfi genotype 1 and genotype 2 mitochondrial and plastid genomes. Remarkably, the P. zopfi mitochondrial (38 Kb) and plastid (28 Kb) genomes are models of compaction and the smallest known in the Trebouxiophyceae. As expected, the P. zopfi genotype 1 and 2 plastid genomes lack all the genes involved in photosynthesis, but, surprisingly, they also lack those coding for RNA polymerases. Our results showed that plastid genes are actively transcribed in P. zopfi, which suggests that the missing RNA polymerases are substituted by nuclear-encoded paralogs. The simplifed architecture and highly- reduced gene complement of the P. zopfi mitochondrial and plastid genomes are closer to those of P. stagnora and the achlorophyllous obligate parasite Helicosporidium than to those of P. wickerhamii or P. cutis. This similarity is also supported by maximum likelihood phylogenetic analyses inferences. Overall, the P. zopfi sequences reported here, which include nuclear genome drafts for both genotypes, will help provide both a deeper understanding of the evolution of Prototheca spp.
    [Show full text]