The Microbiome and Food Allergies

Total Page:16

File Type:pdf, Size:1020Kb

The Microbiome and Food Allergies The Microbiome and Food Allergies Presented by Wayne Shreffler, MD PhD June 2020 Today’s Presenter Wayne Shreffler, MD PhD Chief, Pediatric Allergy & Immunology Director, Food Allergy Center Principal Investigator, Center for Immunology & Inflammatory Diseases Massachusetts General Hospital 2 Disclosures § Aimmune Therapeutics – Scientific Advisory Board § FARE – Medical Advisory Board § Bulmann Laboratories AG – Consulting § Sanofi USA – Consulting § Vedanta Biosciences – Research support § NIAID – Research support § Food Allergy Science Initiative / Broad Institute – Research support § Massachusetts General Hospital -- Employer Disclosures Overview § Food allergy 101 • Epidemiology, hygiene and tolerance § Cohort studies indirectly suggesting a role for the microbiome § Building the case for the importance of the microbiome • Association, Functional, Intervention (in progress) § Why it matters and what the future may bring • ‘Sutton’s Law’, Prevention, Secondary Prevention and Treatment § Questions 5 H.A. Sampson / Allergology International 65 (2016) 363e369 365 Food allergy 101:Fig. 1. The percentage Epidemiology of children 0e17 years of age in the United States with a reported allergic condition in the past 12 months; 1997e2011. From Jackson KD et al. National Child Health Services Data Brief #121; May 2013. H.A. Sampson / Allergology International 65 (2016) 363e369 365 Fig. 1. The percentage of children 0e17 years of age in the United States with a reported allergic condition in the past 12Fig. months; 2. Food-induced 1997e2011. From hospital Jackson anaphylaxis KD et al. admissionsNational Child in Australia by age group from 1994 to 2005. From WK Liew et al. J Allergy Clin Immunol 2009; 123:434e42. Health Services Data Brief #121;Jackson May 2013. KD et al. National Child Health Services Data Brief #121; May 2013 Liew WK et al. J Allergy Clin Immunol 2009; 123:434e42 IgE in the serum and the likelihood that a patient would react to a food challenges, whereas today oral food challenges are the specific food.28,29 Since then, numerous studies in different patient accepted “gold standard”27,39 and efforts have been made to stan- populations have been undertaken in an attempt to refine the dardize the procedure worldwide.15 diagnostic accuracy of quantitative serum food-specific IgE mea- For decades allergists and clinicians have been aware that many surements.30,31 More recently, the advent of quantitative IgE mea- young infants “outgrow” their food allergies, especially to foods Sampson HA. Allergol Int. 2016 Oct;65(4):363–9. surements to major allergenic proteins within certain foods, e.g. Ara such as milk, egg, soy and wheat, whereas allergies to other foods, h 2 in peanut32,33 and Cor a 9 and 14 in hazelnut,34,35 has further e.g. peanuts, tree nuts and seafood, are more likely to persist improved the diagnostic accuracy of in vitro testing. In the mid- throughout life. However, it was not until6 the late 1990's when 1970's, May and Bock reported that prick skin test wheal diameters investigators began mapping allergenic (IgE-binding) epitopes on less than 3 mm greater than the negative control were unlikely to food proteins that an immunologic mechanism underlying this indicate symptomatic IgE-mediated food allergy and that OFCs phenomenon became more apparent. These studies showed that were necessary in patients with larger wheal diameters in order to children who outgrew their egg or milk allergy, i.e. about 80% of this establish symptomatic food allergy.14,36 However, in 2000, Sporik population, produced IgE antibodies primarily to conformational and colleagues reported that analogous to results with food- (3-dimensional) epitopes whereas those with persistent (lifelong) specific IgE values, the larger the prick skin test wheal diameter, allergy also generated significant quantities of IgE antibodies to the greater the likelihood that a patient would experience allergic sequential (linear) epitopes,40,41 suggesting different phenotypes of symptoms to a food and suggested wheal diameter cut-off values IgE-mediated food allergy in children. In contrast, most children that were highly predictive of positive OFCs.37 However, given the with peanut allergy, who typically do not outgrow their peanut variability in skin test extracts, methods and interpretation, and the allergy, i.e. 80%e85%, make large quantities of IgE antibodies to selected high-risk populations used in Sporik's and subsequent sequential epitopes. In addition it was shown more recently that Fig. 2. Food-induced hospital anaphylaxis admissions in Australia by age group from 1994 to 2005. From WKstudies, Liew et the al. J generalizability Allergy Clin Immunol of 2009; these 123:434 valuese42. have to be interpreted the greater a patient's IgE-binding diversity to allergenic epitopes with caution.38 Three decades ago few allergists performed oral on peanut proteins, i.e. the more different allergenic epitopes IgE in the serum and the likelihood that a patient would react to a food challenges, whereas today oral food challenges are the specific food.28,29 Since then, numerous studies in different patient accepted “gold standard”27,39 and efforts have been made to stan- populations have been undertaken in an attempt to refine the dardize the procedure worldwide.15 diagnostic accuracy of quantitative serum food-specific IgE mea- For decades allergists and clinicians have been aware that many surements.30,31 More recently, the advent of quantitative IgE mea- young infants “outgrow” their food allergies, especially to foods surements to major allergenic proteins within certain foods, e.g. Ara such as milk, egg, soy and wheat, whereas allergies to other foods, h 2 in peanut32,33 and Cor a 9 and 14 in hazelnut,34,35 has further e.g. peanuts, tree nuts and seafood, are more likely to persist improved the diagnostic accuracy of in vitro testing. In the mid- throughout life. However, it was not until the late 1990's when 1970's, May and Bock reported that prick skin test wheal diameters investigators began mapping allergenic (IgE-binding) epitopes on less than 3 mm greater than the negative control were unlikely to food proteins that an immunologic mechanism underlying this indicate symptomatic IgE-mediated food allergy and that OFCs phenomenon became more apparent. These studies showed that were necessary in patients with larger wheal diameters in order to children who outgrew their egg or milk allergy, i.e. about 80% of this establish symptomatic food allergy.14,36 However, in 2000, Sporik population, produced IgE antibodies primarily to conformational and colleagues reported that analogous to results with food- (3-dimensional) epitopes whereas those with persistent (lifelong) specific IgE values, the larger the prick skin test wheal diameter, allergy also generated significant quantities of IgE antibodies to the greater the likelihood that a patient would experience allergic sequential (linear) epitopes,40,41 suggesting different phenotypes of symptoms to a food and suggested wheal diameter cut-off values IgE-mediated food allergy in children. In contrast, most children that were highly predictive of positive OFCs.37 However, given the with peanut allergy, who typically do not outgrow their peanut variability in skin test extracts, methods and interpretation, and the allergy, i.e. 80%e85%, make large quantities of IgE antibodies to selected high-risk populations used in Sporik's and subsequent sequential epitopes. In addition it was shown more recently that studies, the generalizability of these values have to be interpreted the greater a patient's IgE-binding diversity to allergenic epitopes with caution.38 Three decades ago few allergists performed oral on peanut proteins, i.e. the more different allergenic epitopes Food allergy 101: Epidemiology FIGURE 3 Comparing rates of parent-reported versus convincing versus physician-confirmed FAs. Lieberman J, et al.Ann Asthma All Immunol; 2018121(5):S13. Gupta RS, et al. Pediatrics. 2018 Dec;142(6):e20181235. ’ cohort,20 and higher than Sicherer for FA diagnosis, such methods issue resulting in relatively high 7 et al s national estimate of 1.4% were not employed in the current rates of severe allergic reactions and in 2008. Although our data suggest study because of their expense, ED use. Previous findings of racial that the burden of childhood peanut impracticality, and concerns about differences in FA prevalence were allergy has increased over the past nonparticipation20 bias. As in past also supported here with elevated decade, the authors of a recent study work to strengthen the rigor of rates identified among non-Hispanic demonstrated that introducing our parent-reported questionnaire, African American children. Overall, peanut-containing foods alongside stringent criteria were established these findings provide critical typical complementary foods between in collaboration with an expert panel epidemiologic information that 4 and 11 months can achieve relative to exclude FAs where corresponding improves understanding of the public – reductions13 in peanut allergy risk of symptom report was not consistent health impact of childhood FA. up to 80% among high-risk infants. with immunoglobulin E mediated ACKNOWLEDGMENTS – Consequently, the National Institute FA. Nevertheless, by relying “ of Allergy and Infectious Diseases exclusively on parent-report and sponsored 2017 Addendum not directly observing symptoms ” We thank Michael Dennis, PhD, and Guidelines for the Prevention of immediately after allergenic food Nada Ganesh,
Recommended publications
  • WO 2018/064165 A2 (.Pdf)
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2018/064165 A2 05 April 2018 (05.04.2018) W !P O PCT (51) International Patent Classification: Published: A61K 35/74 (20 15.0 1) C12N 1/21 (2006 .01) — without international search report and to be republished (21) International Application Number: upon receipt of that report (Rule 48.2(g)) PCT/US2017/053717 — with sequence listing part of description (Rule 5.2(a)) (22) International Filing Date: 27 September 2017 (27.09.2017) (25) Filing Language: English (26) Publication Langi English (30) Priority Data: 62/400,372 27 September 2016 (27.09.2016) US 62/508,885 19 May 2017 (19.05.2017) US 62/557,566 12 September 2017 (12.09.2017) US (71) Applicant: BOARD OF REGENTS, THE UNIVERSI¬ TY OF TEXAS SYSTEM [US/US]; 210 West 7th St., Austin, TX 78701 (US). (72) Inventors: WARGO, Jennifer; 1814 Bissonnet St., Hous ton, TX 77005 (US). GOPALAKRISHNAN, Vanch- eswaran; 7900 Cambridge, Apt. 10-lb, Houston, TX 77054 (US). (74) Agent: BYRD, Marshall, P.; Parker Highlander PLLC, 1120 S. Capital Of Texas Highway, Bldg. One, Suite 200, Austin, TX 78746 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • The Isolation of Novel Lachnospiraceae Strains and the Evaluation of Their Potential Roles in Colonization Resistance Against Clostridium Difficile
    The isolation of novel Lachnospiraceae strains and the evaluation of their potential roles in colonization resistance against Clostridium difficile Diane Yuan Wang Honors Thesis in Biology Department of Ecology and Evolutionary Biology College of Literature, Science, & the Arts University of Michigan, Ann Arbor April 1st, 2014 Sponsor: Vincent B. Young, M.D., Ph.D. Associate Professor of Internal Medicine Associate Professor of Microbiology and Immunology Medical School Co-Sponsor: Aaron A. King, Ph.D. Associate Professor of Ecology & Evolutionary Associate Professor of Mathematics College of Literature, Science, & the Arts Reader: Blaise R. Boles, Ph.D. Assistant Professor of Molecular, Cellular and Developmental Biology College of Literature, Science, & the Arts 1 Table of Contents Abstract 3 Introduction 4 Clostridium difficile 4 Colonization Resistance 5 Lachnospiraceae 6 Objectives 7 Materials & Methods 9 Sample Collection 9 Bacterial Isolation and Selective Growth Conditions 9 Design of Lachnospiraceae 16S rRNA-encoding gene primers 9 DNA extraction and 16S ribosomal rRNA-encoding gene sequencing 10 Phylogenetic analyses 11 Direct inhibition 11 Bile salt hydrolase (BSH) detection 12 PCR assay for bile acid 7α-dehydroxylase detection 12 Tables & Figures Table 1 13 Table 2 15 Table 3 21 Table 4 25 Figure 1 16 Figure 2 19 Figure 3 20 Figure 4 24 Figure 5 26 Results 14 Isolation of novel Lachnospiraceae strains 14 Direct inhibition 17 Bile acid physiology 22 Discussion 27 Acknowledgments 33 References 34 2 Abstract Background: Antibiotic disruption of the gastrointestinal tract’s indigenous microbiota can lead to one of the most common nosocomial infections, Clostridium difficile, which has an annual cost exceeding $4.8 billion dollars.
    [Show full text]
  • Modulation of the Gut Microbiota Alters the Tumour-Suppressive Efficacy of Tim-3 Pathway Blockade in a Bacterial Species- and Host Factor-Dependent Manner
    microorganisms Article Modulation of the Gut Microbiota Alters the Tumour-Suppressive Efficacy of Tim-3 Pathway Blockade in a Bacterial Species- and Host Factor-Dependent Manner Bokyoung Lee 1,2, Jieun Lee 1,2, Min-Yeong Woo 1,2, Mi Jin Lee 1, Ho-Joon Shin 1,2, Kyongmin Kim 1,2 and Sun Park 1,2,* 1 Department of Microbiology, Ajou University School of Medicine, Youngtongku Wonchondong San 5, Suwon 442-749, Korea; [email protected] (B.L.); [email protected] (J.L.); [email protected] (M.-Y.W.); [email protected] (M.J.L.); [email protected] (H.-J.S.); [email protected] (K.K.) 2 Department of Biomedical Sciences, The Graduate School, Ajou University, Youngtongku Wonchondong San 5, Suwon 442-749, Korea * Correspondence: [email protected]; Tel.: +82-31-219-5070 Received: 22 August 2020; Accepted: 9 September 2020; Published: 11 September 2020 Abstract: T cell immunoglobulin and mucin domain-containing protein-3 (Tim-3) is an immune checkpoint molecule and a target for anti-cancer therapy. In this study, we examined whether gut microbiota manipulation altered the anti-tumour efficacy of Tim-3 blockade. The gut microbiota of mice was manipulated through the administration of antibiotics and oral gavage of bacteria. Alterations in the gut microbiome were analysed by 16S rRNA gene sequencing. Gut dysbiosis triggered by antibiotics attenuated the anti-tumour efficacy of Tim-3 blockade in both C57BL/6 and BALB/c mice. Anti-tumour efficacy was restored following oral gavage of faecal bacteria even as antibiotic administration continued. In the case of oral gavage of Enterococcus hirae or Lactobacillus johnsonii, transferred bacterial species and host mouse strain were critical determinants of the anti-tumour efficacy of Tim-3 blockade.
    [Show full text]
  • ( 12 ) United States Patent
    US009956282B2 (12 ) United States Patent ( 10 ) Patent No. : US 9 ,956 , 282 B2 Cook et al. (45 ) Date of Patent: May 1 , 2018 ( 54 ) BACTERIAL COMPOSITIONS AND (58 ) Field of Classification Search METHODS OF USE THEREOF FOR None TREATMENT OF IMMUNE SYSTEM See application file for complete search history . DISORDERS ( 56 ) References Cited (71 ) Applicant : Seres Therapeutics , Inc. , Cambridge , U . S . PATENT DOCUMENTS MA (US ) 3 ,009 , 864 A 11 / 1961 Gordon - Aldterton et al . 3 , 228 , 838 A 1 / 1966 Rinfret (72 ) Inventors : David N . Cook , Brooklyn , NY (US ) ; 3 ,608 ,030 A 11/ 1971 Grant David Arthur Berry , Brookline, MA 4 ,077 , 227 A 3 / 1978 Larson 4 ,205 , 132 A 5 / 1980 Sandine (US ) ; Geoffrey von Maltzahn , Boston , 4 ,655 , 047 A 4 / 1987 Temple MA (US ) ; Matthew R . Henn , 4 ,689 ,226 A 8 / 1987 Nurmi Somerville , MA (US ) ; Han Zhang , 4 ,839 , 281 A 6 / 1989 Gorbach et al. Oakton , VA (US ); Brian Goodman , 5 , 196 , 205 A 3 / 1993 Borody 5 , 425 , 951 A 6 / 1995 Goodrich Boston , MA (US ) 5 ,436 , 002 A 7 / 1995 Payne 5 ,443 , 826 A 8 / 1995 Borody ( 73 ) Assignee : Seres Therapeutics , Inc. , Cambridge , 5 ,599 ,795 A 2 / 1997 McCann 5 . 648 , 206 A 7 / 1997 Goodrich MA (US ) 5 , 951 , 977 A 9 / 1999 Nisbet et al. 5 , 965 , 128 A 10 / 1999 Doyle et al. ( * ) Notice : Subject to any disclaimer , the term of this 6 ,589 , 771 B1 7 /2003 Marshall patent is extended or adjusted under 35 6 , 645 , 530 B1 . 11 /2003 Borody U .
    [Show full text]
  • The Effect of Inoculum on the Performance of Sulfatereducing
    ARTICLE IN PRESS WATER RESEARCH 41 (2007) 904– 914 Available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/watres The effect of inoculum on the performance of sulfate- reducing columns treating heavy metal contaminated water A. Prudena, N. Messnerb, L. Pereyraa, R.E. Hansona, S.R. Hiibelb, K.F. Reardonb,Ã aDepartment of Civil and Environmental Engineering, Colorado State University, Fort Collins, CO 80523, USA bDepartment of Chemical and Biological Engineering, Colorado State University, Fort Collins, CO 80523, USA article info abstract Article history: Sulfate-reducing permeable reactive zones (SR-PRZs) are a passive means of immobilizing Received 27 April 2006 metals and neutralizing the pH of mine drainage through microbially mediated reactions. Received in revised form In this bench-scale study, the influence of inoculum on the performance of columns 8 November 2006 simulating SR-PRZs was investigated using chemical and biomolecular analyses. Columns Accepted 10 November 2006 inoculated from two sources (bovine dairy manure (DM) and a previous sulfate-reducing Available online 12 January 2007 column (SRC)) and uninoculated columns (U) were fed a simulated mine drainage and Keywords: compared on the basis of pH neutralization and removal of cadmium, zinc, iron, and Mine drainage treatment sulfate. Cadmium, zinc, and sulfate removal was significantly higher in SRC columns than Sulfate-reducing bacteria in the DM and U columns, while there was no significant difference between the DM and U Microbial ecology columns. Denaturing gradient gel electrophoresis (DGGE) analysis revealed differences in Molecular biology the microbial community composition among columns with different inocula, and Environmental biotechnology indicated that the microbial community in the SRC columns was the first to reach a pseudo-steady state.
    [Show full text]
  • Neocallimastix Californiae G1 36,250,970 NA 29,649 95.52 85.2 SRX2598479 (3)
    Supplementary material for: Horizontal gene transfer as an indispensable driver for Neocallimastigomycota evolution into a distinct gut-dwelling fungal lineage 1 1 1 2 Chelsea L. Murphy ¶, Noha H. Youssef ¶, Radwa A. Hanafy , MB Couger , Jason E. Stajich3, Y. Wang3, Kristina Baker1, Sumit S. Dagar4, Gareth W. Griffith5, Ibrahim F. Farag1, TM Callaghan6, and Mostafa S. Elshahed1* Table S1. Validation of HGT-identification pipeline using previously published datasets. The frequency of HGT occurrence in the genomes of a filamentous ascomycete and a microsporidian were determined using our pipeline. The results were compared to previously published results. Organism NCBI Assembly Reference Method used Value Value accession number to original in the original reported obtained study study in this study Colletotrichum GCA_000149035.1 (1) Blast and tree 11 11 graminicola building approaches Encephalitozoon GCA_000277815.3 (2) Blast against 12-22 4 hellem custom database, AI score calculation, and tree building Table S2. Results of transcriptomic sequencing. Accession number Genus Species Strain Number of Assembled Predicted peptides % genome Ref. reads transcriptsa (Longest Orfs)b completenessc coveraged (%) Anaeromyces contortus C3G 33,374,692 50,577 22,187 96.55 GGWR00000000 This study Anaeromyces contortus C3J 54,320,879 57,658 26,052 97.24 GGWO00000000 This study Anaeromyces contortus G3G 43,154,980 52,929 21,681 91.38 GGWP00000000 This study Anaeromyces contortus Na 42,857,287 47,378 19,386 93.45 GGWN00000000 This study Anaeromyces contortus O2 60,442,723 62,300 27,322 96.9 GGWQ00000000 This study Anaeromyces robustus S4 21,955,935 NA 17,127 92.41 88.7 SRX3329608 (3) Caecomyces sp.
    [Show full text]
  • (1928-2012), Who Revol
    15/15/22 Liberal Arts and Sciences Microbiology Carl Woese Papers, 1911-2013 Biographical Note Carl Woese (1928-2012), who revolutionized the science of microbiology, has been called “the Darwin of the 20th century.” Darwin’s theory of evolution dealt with multicellular organisms; Woese brought the single-celled bacteria into the evolutionary fold. The Syracuse-born Woese began his early career as a newly minted Yale Ph.D. studying viruses but he soon joined in the global effort to crack the genetic code. His 1967 book The Genetic Code: The Molecular Basis for Genetic Expression became a standard in the field. Woese hoped to discover the evolutionary relationships of microorganisms, and he believed that an RNA molecule located within the ribosome–the cell’s protein factory–offered him a way to get at these connections. A few years after becoming a professor of microbiology at the University of Illinois in 1964, Woese launched an ambitious sequencing program that would ultimately catalog partial ribosomal RNA sequences of hundreds of microorganisms. Woese’s work showed that bacteria evolve, and his perfected RNA “fingerprinting” technique provided the first definitive means of classifying bacteria. In 1976, in the course of this painstaking cataloging effort, Woese came across a ribosomal RNA “fingerprint” from a strange methane-producing organism that did not look like the bacterial sequences he knew so well. As it turned out, Woese had discovered a third form of life–a form of life distinct from the bacteria and from the eukaryotes (organisms, like humans, whose cells have nuclei); he christened these creatures “the archaebacteria” only to later rename them “the archaea” to better differentiate them from the bacteria.
    [Show full text]
  • Genome Sequence and Description of Desnuesiella Massiliensis Gen. Nov., Sp. Nov. a New Member of Family Clostridiaceae
    TAXONOGENOMICS: GENOME OF A NEW ORGANISM Genome sequence and description of Desnuesiella massiliensis gen. nov., sp. nov. a new member of family Clostridiaceae L. Hadjadj1, M. Tidjani Alou1, C. Sokhna2, J.-C. Lagier1, D. Raoult1,3 and J.-M. Rolain1 1) Unité de recherche sur les maladies infectieuses et tropicales émergentes (URMITE), UMR CNRS, IHU Méditerranée Infection, Faculté de Médecine et de Pharmacie, Aix-Marseille-Université, Marseille, France, 2) Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes, UM63, CNRS7278, IRD198, InsermU1095, Institut Hospitalo-Universitaire Méditerranée-Infection, Aix-Marseille Université, Marseille, France and Dakar, Senegal and 3) Special Infectious Agents Unit, King Fahd Medical Research Center, King Abdulaziz University, Jeddah, Saudi Arabia Abstract Desnuesiella massiliensis, strain MT10T gen. nov., sp. nov. is a newly proposed genus within the family Clostridiaceae, isolated from the digestive microbiota of a child suffering from kwashiorkor. Desnuesiella massiliensis is a facultatively anaerobic, Gram-positive rod. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 5 503 196-bp long genome (one chromosome but no plasmid) contains 5227 protein-coding and 81 RNA genes, including 14 rRNA genes. New Microbes and New Infections © 2016 The Authors. Published by Elsevier Ltd on behalf of European Society of Clinical Microbiology and Infectious Diseases. Keywords: Culturomics, Desnuesiella massiliensis, genome, kwashiorkor, taxono-genomics Original Submission: 4 February 2016; Revised Submission: 12 March 2016; Accepted: 14 March 2016 Article published online: 19 March 2016 characterization has been demonstrated as a useful approach Corresponding author: J.-M. Rolain, Unité de recherche sur les for the description of new bacterial taxa [2–5].
    [Show full text]
  • WO 2013/171515 Al 21 November 2013 (21.11.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/171515 Al 21 November 2013 (21.11.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12Q 1/04 (2006.01) A61K 38/14 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (21) International Application Number: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, PCT/GB20 13/05 1298 KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (22) International Filing Date: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, 20 May 20 13 (20.05.2013) NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, (25) Filing Language: English TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (26) Publication Language: English ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 1208845.6 18 May 2012 (18.05.2012) kind of regional protection available): ARIPO (BW, GH, 121 1961 .6 5 July 2012 (05.07.2012) GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (71) Applicant: GENOME RESEARCH LIMITED TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, [GB/GB]; Gibbs Building, 215 Euston Road, London, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, Greater London NW1 2BE (GB).
    [Show full text]
  • Thi Na Utaliblat in Un Minune Talk
    THI NA UTALIBLATUS010064900B2 IN UN MINUNE TALK (12 ) United States Patent ( 10 ) Patent No. : US 10 , 064 ,900 B2 Von Maltzahn et al . ( 45 ) Date of Patent: * Sep . 4 , 2018 ( 54 ) METHODS OF POPULATING A (51 ) Int. CI. GASTROINTESTINAL TRACT A61K 35 / 741 (2015 . 01 ) A61K 9 / 00 ( 2006 .01 ) (71 ) Applicant: Seres Therapeutics, Inc. , Cambridge , (Continued ) MA (US ) (52 ) U . S . CI. CPC .. A61K 35 / 741 ( 2013 .01 ) ; A61K 9 /0053 ( 72 ) Inventors : Geoffrey Von Maltzahn , Boston , MA ( 2013. 01 ); A61K 9 /48 ( 2013 . 01 ) ; (US ) ; Matthew R . Henn , Somerville , (Continued ) MA (US ) ; David N . Cook , Brooklyn , (58 ) Field of Classification Search NY (US ) ; David Arthur Berry , None Brookline, MA (US ) ; Noubar B . See application file for complete search history . Afeyan , Lexington , MA (US ) ; Brian Goodman , Boston , MA (US ) ; ( 56 ) References Cited Mary - Jane Lombardo McKenzie , Arlington , MA (US ); Marin Vulic , U . S . PATENT DOCUMENTS Boston , MA (US ) 3 ,009 ,864 A 11/ 1961 Gordon - Aldterton et al. 3 ,228 ,838 A 1 / 1966 Rinfret (73 ) Assignee : Seres Therapeutics , Inc ., Cambridge , ( Continued ) MA (US ) FOREIGN PATENT DOCUMENTS ( * ) Notice : Subject to any disclaimer , the term of this patent is extended or adjusted under 35 CN 102131928 A 7 /2011 EA 006847 B1 4 / 2006 U .S . C . 154 (b ) by 0 days. (Continued ) This patent is subject to a terminal dis claimer. OTHER PUBLICATIONS ( 21) Appl . No. : 14 / 765 , 810 Aas, J ., Gessert, C . E ., and Bakken , J. S . ( 2003) . Recurrent Clostridium difficile colitis : case series involving 18 patients treated ( 22 ) PCT Filed : Feb . 4 , 2014 with donor stool administered via a nasogastric tube .
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2016/0040215 A1 Henn Et Al
    US 201600.40215A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0040215 A1 Henn et al. (43) Pub. Date: Feb. 11, 2016 (54) METHODS FOR PATHOGEN DETECTION Related U.S. Application Data AND ENRICHMENT FROM MATERALS AND (60) Provisional application No. 61/781,854, filed on Mar. COMPOSITIONS 14, 2013. (71) Applicant: SERES THERAPEUTICS, INC., Publication Classification Cambridge, MA (US) (51) Int. Cl. (72) Inventors: Matthew R. Henn, Somerville, MA CI2O I/68 (2006.01) (US); John Grant Aunins, Doylestown, GOIN33/569 (2006.01) PA (US); David Arthur Berry, (52) U.S. Cl. Brookline, MA (US); David N. Cook CPC .......... CI2O 1/689 (2013.01); G0IN33/56911 Brooklyn, NY (US) (2013.01) (21) Appl. No.: 14/776,676 ( 57 ) ABSTRACT Provided are methods and compositions for characterization (22) PCT Filed: Mar. 14, 2014 of bacterial compositions for the maintenance or restoration of a healthy microbiota in the gastrointestinal tract of a mam (86). PCT No.: PCT/US1.4/29539 malian Subject, and the resulting characterized compositions. Provided are methods of characterizing bacterial composi S371 (c)(1), tions including Subjecting the compositions to various detect (2) Date: Sep. 14, 2015 ing processes. Patent Application Publication Feb. 11, 2016 Sheet 1 of 19 US 2016/0040215 A1 FIGURE 1 Patent Application Publication Feb. 11, 2016 Sheet 2 of 19 US 2016/0040215 A1 FIGURE 2 1 AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTA 51 ACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTCTTTGCTGACGA 1 O1 GTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATA
    [Show full text]
  • First Isolation of Clostridium Indolis in a Patient with Chronic
    First isolation of Clostridium indolis in a patient with chronic osteitis: a case report and literature review of human infections related to Clostridium saccharolyticum group species Romain Lotte, Laurène Lotte, Philippe Bouvet, Nicolas Degand, Antonin Bal, Michel Carles, Regis Bernard de Dompsure, Michel-Robert Popoff, Raymond Ruimy To cite this version: Romain Lotte, Laurène Lotte, Philippe Bouvet, Nicolas Degand, Antonin Bal, et al.. First isolation of Clostridium indolis in a patient with chronic osteitis: a case report and literature review of human infections related to Clostridium saccharolyticum group species. Anaerobe, Elsevier Masson, 2016, 42, pp.44 - 49. 10.1016/j.anaerobe.2016.08.001. pasteur-01787653 HAL Id: pasteur-01787653 https://hal-pasteur.archives-ouvertes.fr/pasteur-01787653 Submitted on 31 Jul 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - ShareAlike| 4.0 International License 1 First isolation of Clostridium indolis in a patient with 2 chronic osteitis:
    [Show full text]