US 201600.40215A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0040215 A1 Henn et al. (43) Pub. Date: Feb. 11, 2016
(54) METHODS FOR PATHOGEN DETECTION Related U.S. Application Data AND ENRICHMENT FROM MATERALS AND (60) Provisional application No. 61/781,854, filed on Mar. COMPOSITIONS 14, 2013. (71) Applicant: SERES THERAPEUTICS, INC., Publication Classification Cambridge, MA (US) (51) Int. Cl. (72) Inventors: Matthew R. Henn, Somerville, MA CI2O I/68 (2006.01) (US); John Grant Aunins, Doylestown, GOIN33/569 (2006.01) PA (US); David Arthur Berry, (52) U.S. Cl. Brookline, MA (US); David N. Cook CPC ...... CI2O 1/689 (2013.01); G0IN33/56911 Brooklyn, NY (US) (2013.01) (21) Appl. No.: 14/776,676 (57 ) ABSTRACT Provided are methods and compositions for characterization (22) PCT Filed: Mar. 14, 2014 of bacterial compositions for the maintenance or restoration of a healthy microbiota in the gastrointestinal tract of a mam (86). PCT No.: PCT/US1.4/29539 malian Subject, and the resulting characterized compositions. Provided are methods of characterizing bacterial composi S371 (c)(1), tions including Subjecting the compositions to various detect (2) Date: Sep. 14, 2015 ing processes. Patent Application Publication Feb. 11, 2016 Sheet 1 of 19 US 2016/0040215 A1
FIGURE 1
Patent Application Publication Feb. 11, 2016 Sheet 2 of 19 US 2016/0040215 A1
FIGURE 2
1 AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTA 51 ACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTCTTTGCTGACGA 1 O1 GTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATA 151 ACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGG 2O1 GGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAG 251 TAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAG 3 O1 GATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGG 351 CAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCC 4 O1 GCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGA 451 AGGGAGTAAAGT'TAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGC 5 O1 ACCGGCTAACTCGTGCCCAGGCATGCGCAGGAATACGGAGGTGCAAGCGT 551 TAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAG 6 O1 ATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGC 651 TTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGT 7 O1 AGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACGAAGACT 751. CACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGT 8O1 AGTCCACGCCGTAAACGATGTCGACTTGGAGGTTGTGCCCTTGAGGCGTG 851 GCTTCCGGAGCTAACGCGTTAAGTCGACCGCCTGGGGAGTACGGCCGCAA 9 O1 GGTTAAAACT CAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATG 951 TGGTTTAATTCGATGCAACGCGAAGAACCTTACCTGGTCTTGACATCCAC 1 OO1 GGAAGTTTTCAGAGATGAGAATGTGCCTTCGGGAACCGTGAGACAGGTGC 1 O 51 TGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCA 11 O1 ACGAGCGCAACCCTTATCCTTTGTTGCCAGCGGTCCGGCCGGGAACT CAA 1151. AGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGACGTCAAGTCA 12 O1. TCATGGCCCTTACGACCAGGGCTACACACGTGCTACAATGGCGCATACAA 1251. AGAGAAGCGACCTCGCGAGAGCAAGCGGACCTCATAAAGTGCGTCGTAGT 13 O1 CCGGATTGGAGTCTGCAACTCGACTCCATGAAGTCGGAATCGCTAGTAAT 1351 CGTGGATCAGAATGCCACGGTGAATACGTTCCCGGGCCTTGTACACACCG 14 O1 CCCGMCACACCATGGGAGTGGGTTGCAAAAGAAGTAGGTAGCTTAACCTT 1451 CGGGAGGGCGCTTACCACTTTGTGATTCATGACTGGGGTGAAGTCGTAAC 15 O1. AAGGTAACCGTAGGGGAACCTGCGGTTGGATCACCTCCTTA
Patent Application Publication Feb. 11, 2016 Sheet 4 of 19 US 2016/0040215 A1
FIGURE 4
x & s SSSs
i
3
Patent Application Publication Feb. 11, 2016 Sheet 5 of 19 US 2016/0040215 A1
FIGURE 5 Pure Spore Strain Standard
S.
25 a 35 a 1.5 s 55 6 65 7 C. bifermentaris Log CFU/mL) Patent Application Publication Feb. 11, 2016 Sheet 6 of 19 US 2016/0040215 A1
FIGURE 6 Donor A
u.
DOnOr B
SS Swiss SS 836SEty: Patent Application Publication Feb. 11, 2016 Sheet 7 of 19 US 2016/0040215 A1
FIGURE 7 i09 Ettifoxgai patetics (SAMfer arritoi & GAMffs rufis: r=83
Patent Application Publication Feb. 11, 2016 Sheet 8 of 19 US 2016/0040215 A1
FIGURE 8 1.00E+07
OE-i-S to
e
: &
+). S v MY
$ : 85C
Donor A for B Door C Donor Sample Patent Application Publication Feb. 11, 2016 Sheet 9 of 19 US 2016/0040215 A1
FIGURE 9
ySQEyrne & + iysozyme
Patent Application Publication Feb. 11, 2016 Sheet 10 of 19 US 2016/0040215 A1
FIGURE 10
eas poYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYYY$ Ss 4.0c x |------
E 2.8 ...... &- s : se : 1.30 : rs&c.S. s 8 s 3. O.E. sooooooo-oooooooooooooooooooooooooooooooooooo------s------5 . O . . s: S.O. S. s spike titer log CFU frn Patent Application Publication Feb. 11, 2016 Sheet 11 of 19 US 2016/0040215 A1
FIGURE 11
Sequences Per Sample Patent Application Publication Feb. 11, 2016 Sheet 12 of 19 US 2016/0040215 A1
FIGURE 12
$33. xOS (sar S$3: , 38&S SE R O9
Ds D14tiss ga: 338 Patent Application Publication Feb. 11, 2016 Sheet 13 of 19 US 2016/0040215 A1
FIGURE 13
Bacteroides fragilis group species
s s s SES s$...... $8 ......
s s S S.E & s Patent Application Publication Feb. 11, 2016 Sheet 14 of 19 US 2016/0040215 A1
FIGURE 14
8 t a 8.8 : 8.8 s s s & 8.8 : x 8.8 : 8.8 s 3. 8. E,&
E. & s: & 8: & 38
S Patent Application Publication Feb. 11, 2016 Sheet 15 of 19 US 2016/0040215 A1
FIGURE 15
& SE& 8335:8:nsists 85-883 : & S.S.S, SH
s3. 8 : S8, St.
8 tiss So Sir & 3 ses. 3 is sis 838 as 13 Fis 8s: & Six cirg is train s :: Seg & 38. & S. Sess
:S 3S Sag is
Patent Application Publication Feb. 11, 2016 Sheet 16 of 19 US 2016/0040215 A1
FIGURE 16
Y S & Saftgie
w w w w w & SFSpse 3
was s : Sarge 3
Sarpie 4
8
Pre heat 5 ming Pre heat is ming Pre heat sec 60c MacConkey (O2) BBA (O2) Bile-escuin (-02) Featre Patent Application Publication Feb. 11, 2016 Sheet 17 of 19 US 2016/0040215 A1
FIGURE 17
s: S.
1. E -: S. S &ssw8SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS &SSSSSSSSSSSS& SS: ,SSS. - ^SS: Risassics is: w8Six Sis: 8
&
Es: 3. R} is 683 2538 336 338 3000 fississioritis Patent Application Publication Feb. 11, 2016 Sheet 18 of 19 US 2016/0040215 A1
FIGURE 18
&&&&&&&&&&&&&&&&&&? Donations Colored by Donor) &&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&
E
ECF
ESES
ES
EE-i
3-3
Donations (Colored by Donor)
Patent Application Publication Feb. 11, 2016 Sheet 19 of 19 US 2016/0040215 A1
FIGURE 19
US 2016/0040215 A1 Feb. 11, 2016
METHODS FOR PATHOGEN DETECTION limited number of species; they also tend to be limited in the AND ENRICHMENT FROM MATERALS AND number of species provided in a given probiotic product. As COMPOSITIONS Such, they do not adequately replace or encourage replace ment of the missing natural microflora of the GI tract in many RELATED APPLICATIONS situations. For example, despite routine inoculation with Bifi dobacterium, Lactobacillus, Lactococcus, and Streptococcus 0001. This application is related to U.S. Provisional Appli species, significant changes in the bacterial species composi cation No. 61/781,854, filed Mar. 14, 2013, which is incor tion of monozygotic twin pairs were not observed (McNulty porated by reference in its entirety. et al. (2011) Sci. Transl. Med. 3(106):106. 0006 Thus practitioners have a need for a method of popu REFERENCE TO ASEQUENCE LISTING lating a subject's gastrointestinal tract, and other niches, with 0002 This application includes a Sequence Listing sub a diverse and useful selection of microbiota in order to altera mitted electronically as a text file named 26335PCT SE dysbiosis. In response to the need for durable, efficient, and QUENCELISTING.TXT, created on Mar. 14, 2014 with a effective compositions and methods for treatment of diseases, size of 4,196,119 bytes. The sequence listing is incorporated restoring or enhancing microbiota functions by providing a by reference. multi-component bacterial composition with a diverse and/or complex microbial composition is a solution. Assessing mul BACKGROUND tivalent compositions to verify their safety, identity, viability, 0003 Mammals are colonized by microbes in the gas potency and purity for the treatment of mammalian Subjects is trointestinal (GI) tract, on the skin, and in other epithelial and required to assure the compositions are of the appropriate tissue niches Such as the oral cavity, eye Surface and vagina. In quality and consistency to meet global regulatory standards. particular, the gastrointestinal tract harbors an abundant and A particular challenge for multi-component compositions is diverse microbial community. It is a complex system, provid the detection of microbial contaminants at low levels in the ing an environment or niche for a community of many differ composition (e.g. see Temmerman etal 2003 Identification of ent species or organisms, including diverse strains of bacteria. antibiotic susceptibility of bacterial isolates from probiotic Hundreds of different species may form a commensal com products. Int J. of Food Microbiology 81:1-10 and Temmer munity in the GI tract in a healthy person, and this comple man etal 2003 Development and Validation of a nested-PCR ment of organisms evolves from the time of birth to ultimately denaturing gradient gel electrophoresis method for taxo form a functionally mature microbial population by about 3 nomic characterization of bifidobacterial communities). Due years of age. Interactions between constituents of these popu to the complex nature of the microbial compositions there is lations, between them and Surrounding environmental com a lack of techniques to appropriately characterize a beneficial ponents, and between microbes and the host, e.g. the host microbial composition for therapeutic and other health uses. immune system, shape the community structure, with avail ability of and competition for resources affecting the distri SUMMARY OF THE INVENTION bution of microbes. Such resources may be food, location and 0007 Methods of the invention are provided for charac the availability of space to grow or a physical structure to terizing a therapeutic composition, comprising the steps of which the microbe may attach. For example, host diet is (a) providing a therapeutic composition comprising at least involved in shaping the GI tract flora. The situation is similar one desired bacterial strain and optionally comprising at least with respect to other human microbial niches, e.g. skin, eye, one undesired bacterial Strain; (b) Subjecting the therapeutic ear, nose, throat, etc. composition to a first detection step and a second detection 0004. A healthy microbiota provides the host with mul step, wherein the first detection step comprises attempting to tiple benefits, including colonization resistance to a broad culture at least one undesired bacterial strain, and wherein the spectrum of pathogens, essential nutrient biosynthesis and second detection step comprises attempting to amplify at absorption, and immune stimulation that maintains a healthy least one target nucleic acid sequence not present in the gut epithelium and an appropriately controlled systemic desired bacterial strain, thereby characterizing the therapeu immunity. In settings of dysbiosis or disrupted Symbiosis, tic composition. microbiota functions can be lost or deranged, resulting in 0008. In one embodiment, the desired bacterial strain increased Susceptibility to pathogens, altered metabolic pro comprises a plurality of desired bacterial strains. In another files, or induction of proinflammatory signals that can result embodiment, the result of the attempt to culture the at least in local or systemic inflammation or autoimmunity. Thus, the one undesired bacterial strain is that the undesired bacterial microbiota plays a significant role in the pathogenesis of strain is not detectably cultured. In other embodiments, the many diseases and disorders. This includes a variety of patho undesired bacterial strain is not known to be present in the genic infections of the gut. For instance, Subjects become therapeutic composition. In yet another embodiment, the more Susceptible to pathogenic infections when the normal undesired bacterial strain is a contaminating bacterial Strain intestinal microbiota has been disturbed due to use of broad derived from the manufacturing environment or process. In spectrum antibiotics. Many of these diseases and disorders some embodiments, the result of the attempt to amplify the at are chronic conditions that significantly decrease a subjects least one target nucleic acid sequence is that the target nucleic quality of life and can be ultimately fatal. acid sequence is not detectably amplified. In one embodi 0005. Manufacturers of probiotics have asserted that their ment, the target nucleic acid sequence is present in i) a bac preparations of bacteria promote mammalian health by pre terial strain derived from a fecal culture, and/or ii) a fecal serving the natural microflora in the GI tract and reinforcing material. the normal controls on aberrant immune responses. See, e.g., 0009. In one aspect, the first detection step has a sensitivity U.S. Pat. No. 8,034,601. Probiotics, however, have been lim for the undesired bacterial strain of at least 1x10, and ited to a very narrow group of genera and a correspondingly wherein the second detection step has a sensitivity for the US 2016/0040215 A1 Feb. 11, 2016 undesired bacterial strain of at least 1x10. In another aspect, desired entity comprises a bacteria. In one embodiment, the at the first detection step has a sensitivity for the undesired least one undesired entity comprises a bacterium, yeast, virus bacterial strain of at least 1x10", and wherein the second or combination thereof. detection step has a sensitivity for the undesired bacterial 0015. In another embodiment, the first detection step and strain of at least 1x10'. In some aspects, the first detection the second detection step are performed simultaneously. In step has a sensitivity for the undesired bacterial strain of at Some embodiments, the first detection step and the second least 1x10, and wherein the second detection step has a detection step are performed sequentially. In another embodi sensitivity for the undesired bacterial strain of at least 1x10. ment, the second detection step detects a product of the first In another aspect, the method includes the step of detecting, detection step. In other embodiments, the undesired entity is or attempting to detect, a non-bacterial microbial contami not detectably present in the characterized therapeutic com nant in the therapeutic composition. In some aspects, the position at a concentration of about greater than or equal to non-bacterial microbial contaminant comprises a phage, 1x107 the concentration of the desired entity. In yet another virus, or eukaryotic contaminant. embodiment, the component of the undesired entity com 0010. In other aspects, the first detection step is performed prises a nucleic acid. prior to the second detection step. In another aspect, the first 0016. In other embodiments, a method is provided for detection step is performed after the second detection step. In characterizing a bacterial composition, comprising the steps certain aspects, the first detection step and the second detec of: (a) providing a composition comprising at least one tion step are performed concurrently. In one embodiment, the desired bacterial species and optionally comprising at least second detection step is carried out using a product of the first one undesired entity; (b) Subjecting the therapeutic composi tion to a first detection step and a second detection step, detection step, the first detection step is carried out using a wherein the first detection step comprises attempting to detect product of the second detection step. In another embodiment, the at least one undesired entity and the first detection step has the therapeutic composition is validated to detect a contami a sensitivity for the undesired entity of at least 1x10, and nant in a background of 1x10 CFU of the product bacteria. In wherein the second detection step comprises attempting to yet another embodiment, the method includes the step of detect the at least one undesired entity and the second detec attempting to enrich at least one undesired bacterial Strain in tion step has a sensitivity for the undesired entity of at least the therapeutic composition. 1x10, wherein the first and second detection steps are not 0011. In some embodiments, the invention includes a vali identical and have a combined sensitivity for the undesired dated therapeutic composition provided by the method entity of at least 1x10. described above. 0017. In some embodiments, the first detection step com 0012. In other embodiments, a method is provided of char prises attempting to detect the at least one undesired entity acterizing atherapeutic composition, comprising the steps of and the first detection step has a sensitivity for the undesired (a) providing a therapeutic composition comprising at least entity of at least 1x10, and wherein the second detection one desired entity and optionally comprising at least one step comprises attempting to detect the at least one undesired undesired entity; (b) Subjecting the therapeutic composition entity and the second detection step has a sensitivity for the to an enrichment step wherein the at least one undesired entity undesired entity of at least 1x10'. In certain embodiments, or component thereof, if present in the therapeutic composi the first detection step comprises attempting to detect the at tion, is enriched; and (c) Subjecting the enriched therapeutic least one undesired entity and the first detection step has a composition to a first detection step and a second detection sensitivity for the undesired entity of at least 1x10, and step, wherein the first detection step comprises attempting to wherein the second detection step comprises attempting to detect the undesired entity at a concentration of about less detect the at least one undesired entity and the second detec than or equal to 1x10 the concentration of the desiredentity, tion step has a sensitivity for the undesired entity of at least and wherein the second detection step comprises attempting 1x10. In one embodiment, the at least one desired bacterial to detect the undesired entity at a concentration of about less species comprises a plurality of desired bacterial species. than or equal to 1x10 the concentration of the desiredentity, 0018. In certain aspects, the first detection step is per wherein the first detection step and the second detection step formed prior to the second detection step. In one aspect, the are not identical, thereby characterizing the therapeutic com first detection step and the second detection step are per position. formed concurrently. In another aspect, the first detection step is carried out using a product of the second detection step. In 0013. In one aspect, the first detection step comprises yet another aspect, second detection step is carried out using attempting to detect the undesired entity at a concentration of a product of the first detection step. about less than or equal to 1x10" the concentration of the 0019. In some embodiments, a method is provided for desired entity, and wherein the second detection step com characterizing a spore population present in a composition prises attempting to detect the undesired entity at a concen comprising the steps of: (a) purifying the spore population tration of about less than or equal to 1x10 the concentration present in a composition from a fecal donation; and (b) deriv of the desired entity. In another aspect, the first detection step ing the spore population present in a composition through comprises attempting to detect the undesired entity at a con culture methods. In one embodiment, the spore population centration of about less than or equal to 1x10 the concen present in a composition is purified via solvent, acid, deter tration of the desired entity, and wherein the second detection gent, or heat treatment, or a density gradient separation, fil step comprises attempting to detect the undesired entity at a tration, or any combination of methods. In certain embodi concentration of about less than or equal to 1x10 the con ments, the purifying increases the purity, potency, and/or centration of the desired entity. concentration of spores in a sample. In certain embodiments, 0014. In some aspects, the desired entity comprises a plu the spore population is derived starting from isolated spore rality of desired entities. In other aspects, the at least one former species or spore former OTUs or from a mixture of US 2016/0040215 A1 Feb. 11, 2016
Such species. In another embodiment, the spore population is Sured at different genomic sampling depths to confirm in vegetative or spore form. In some embodiments, the spores adequate sequence coverage to assay the microbiome in the can be purified from natural Sources including but not limited target samples. The patient pretreatment (purple) harbored a to feces, soil, and water. microbiome that was significantly reduced in total diversity 0020. In some embodiments, the spore population is a as compared to the ethanol treated spore treatment (red) and non-limiting Subset of a microbial composition. In one patient post treatment at days 5 (blue), 14 (orange), and 25 embodiment, the ethanol treated fecal Suspensions are a non (green). limiting additional Subset of a microbial composition 0034 FIG. 12 shows patient microbial ecology was enriched for spores and spore formers. In another embodi shifted by treatment with an ethanol treated spore treatment ment, the spore population comprises spore forming species from a dysbiotic state to a state of health. wherein residual non-spore forming species have been inac 0035 FIG. 13 shows the augmentation of Bacteroides spe tivated by chemical or physical treatments. In yet another cies in patients. embodiment, the chemical or physical treatments include 0036 FIG. 14 shows species engrafting versus species ethanol, detergent, heat or Sonication. augmenting in patients microbiomes after treatment with a 0021. In one aspect, the non-spore forming species have bacterial composition Such as but not limited to an ethanol been removed from the spore preparation by various separa treated spore population. tion steps. In another aspect, the separation steps include 0037 FIG. 15 shows that heat and ethanol treatments density gradients, centrifugation, filtration and chromatogra reduce cell viability. phy. In yet another aspect, the inactivation and separation 0038 FIG. 16 shows reduction in non-spore forming veg methods are combined to make the spore preparation. In some etative cells by treatment at 60° C. for 5 min. aspects, the spore preparation comprises spore forming spe 0039 FIG. 17 shows time course demonstrates ethanol cies that are enriched over viable non-spore formers or Veg reduces both anaerobic and aerobic bacterial CFUs. etative forms of spore formers. 0040 FIG. 18 shows donation spore concentrations from 0022. In another aspect, the spores are enriched by 2-fold, clinical donors. 5-fold, 10-fold, 50-fold, 100-fold, 1000-fold, 10,000 fold or 0041 FIG. 19 shows spores initially present in ethanol greater than 10,000-fold compared to all vegetative forms of treated spore preparation as measured by DPA and CFU/ml bacteria. In some aspects, the spores in the spore preparation grown on specified media. undergo partial germination during processing and formula 0042. The figures depict various embodiments of the tion Such that the final composition comprises spores and present invention for purposes of illustration only. One skilled Vegetative bacteria derived from spore forming species. in the art will readily recognize from the following discussion that alternative embodiments of the structures and methods BRIEF DESCRIPTION OF THE DRAWINGS illustrated herein may be employed without departing from 0023 FIG. 1 shows the hypervariable regions mapped the principles of the invention described herein. onto a 16S sequence and the sequence regions corresponding to these sequences on a sequence map. FIG. 1 shows variable DETAILED DESCRIPTION regions mapped onto the 16S sequence and annotated 16s sequence with bolded variable regions. Definitions 0024 FIG. 2 shows the reference sequence used in FIG.1. 0043. As used herein, the terms “detect,” “detection,” and 0025 FIG. 3 shows the linear range of DPA assay com related terms mean the act or method of identifying an entity, pared to CFU counts/ml. particularly a microbial pathogen or environmental contami 0026 FIG. 4 shows the detection of Tb-DPA complex nant, or the presence thereof (without by necessity knowing fluorescence from a dilution series of a pure sample of dipi the specific entity) in a material. colonic acid. 0044) “Microbiota refers to the community of microor 0027 FIG. 5 shows the detection of Tb-DPA complex ganisms that occur (Sustainably or transiently) in and on an fluorescence from a dilution series of a purified sporulated animal Subject, typically a mammal Such as a human, includ preparation of Clostridium bifermentans. ing single cell and multicellular eukaryotes Such as proto 0028 FIG. 6 shows different germinant treatments having Zoan, helminthic and fungal eukaryotes, archaea, bacteria, variable effects on CFU counts from donor A (top) and donor and viruses (including bacterial viruses, i.e., phage). As used B (bottom). The Y-Axes are spore CFU per ml. herein, “detectably cultured’ mean the state, e.g., of a bacte 0029 FIG. 7 shows that germinants increase the diversity ria, of being cultured as provided herein so that such culture of cultured spore forming OTUs observed by plating. can be detected using the means provided herein or otherwise 0030 FIG. 8 shows heat activation as a germination treat known in the art. ment with BHIS+oxgall. 0045. The term “microorganism' as used herein refers to 0031 FIG. 9 shows the effect of lysozyme and shows a an organism of microscopic or ultramicroscopic size Such as lysozyme treatment enhances germination in a Subset of con a prokaryotic or a eukaryotic microbial species or a virus. The ditions. term “prokaryotic’ refers to a microbial species which con 0032 FIG. 10 shows the correlation between concentra tains no nucleus or other organelles in the cell, which includes tion of E. durans spiked into 20% ethanol treated feces and but is not limited to bacteria and archaea. The term “eukary concentration calculated from colony counts on selective otic” refers to a microbial species that contains a nucleus and media (Enterococcosel Agar). other cell organelles in the cell, which includes but is not 0033 FIG. 11 shows the microbial diversity measured in limited to eukarya Such as yeast and filamentous fungi, pro the ethanol treated spore treatment sample and patient pre tozoa, algae, or higher Protista. and post-treatment samples. Total microbial diversity is 0046. The terms “manufacturing environment” and defined using the Chao 1 Alpha-Diversity Index and is mea “manufacturing process' relate to the environments and pro US 2016/0040215 A1 Feb. 11, 2016 cesses under which the therapeutic compositions and isolated sequence identity to this nucleic acid sequence at the level of bacteria as provided herein are produced, including good species. In some embodiments the specific genetic sequence manufacturing process (GMP) and non-GMP environments may be the 16S sequence or a portion of the 16S sequence. In and processes. other embodiments, the entire genomes of two entities are 0047. “Microbiome' refers to the genetic content of the sequenced and compared. In another embodiment, select communities of microbes that live in and on the human body, regions such as multilocus sequence tags (MLST), specific both Sustainably and transiently, including eukaryotes (in genes, or sets of genes may be genetically compared. In 16S cluding spores), archaea, bacteria (including spores), and embodiments, OTUs that share >97% average nucleotide viruses (including bacterial viruses (i.e., phage)), wherein identity across the entire 16S or some variable region of the “genetic content” includes genomic DNA, RNA such as ribo Somal RNA, the epigenome, plasmids, and all other types of 16S are considered the same OTU (see e.g. Claesson M J. genetic information. Wang Q, O'Sullivan O, Greene-Diniz R. Cole J R, Ross RP. 0048 “Dysbiosis” refers to a state of the microbiome of and O’Toole PW. 2010. Comparison of two next-generation the gut or other body area, including mucosal or skin Surfaces sequencing technologies for resolving highly complex micro in which the normal diversity and/or function of the ecologi biota composition using tandem variable 16S rRNA gene cal network is disrupted. This unhealthy state can be due to a regions. Nucleic Acids Res 38: e200. Konstantinidis KT, decrease in diversity, the overgrowth of one or more patho Ramette A, and Tiede J.M. 2006. The bacterial species defi gens or pathobionts, symbiotic organisms able to cause dis nition in the genomic era. Philos Trans R Soc Lond B Biol Sci ease only when certain genetic and/or environmental condi 361: 1929-1940.). In embodiments involving the complete tions are present in a subject, or the shift to an ecological genome, MLSTs, specific genes, or sets of genes OTUS that network that no longer provides an essential function to the share >95% average nucleotide identity are considered the host and therefore no longer promotes health. A dysbiosis same OTU (see e.g. Achtman M, and Wagner M. 2008. may be induced by illness or treatment with antibiotics or Microbial diversity and the genetic nature of microbial spe other environmental factors. cies. Nat. Rev. Microbiol. 6: 431-440. Konstantinidis KT, 0049. An "enrichment’ oran “enrichment step” means the Ramette A, and Tiede J.M. 2006. The bacterial species defi state of having a higher level of a quality including concen nition in the genomic era. Philos Trans R Soc Lond B Biol Sci tration, amount, percentage weight or dry Volume, or absence 361: 1929-1940.). OTUs are frequently defined by comparing of contaminants as compared to a reference. sequences between organisms. Generally, sequences with 0050. The term "subject” refers to any animal subject less than 95% sequence identity are not considered to form including but not limited to humans, laboratory animals (e.g., part of the same OTU. OTUs may also be characterized by primates, rats, mice) including rodents and other animals any combination of nucleotide markers or genes, in particular useful as models for human disease states, livestock (e.g., highly conserved genes (e.g., "house-keeping genes), or a cows, sheep,goats, pigs, turkeys, chickens, fish), and house combination thereof. Such characterization employs, e.g., hold pets (e.g., dogs, cats, rodents, reptiles, etc.). The Subject WGS data or a whole genome sequence. may be suffering from a dysbiosis, including, but not limited 0055 Table 1 below shows a List of Operational Taxo to, an infection due to a gastrointestinal pathogen or may beat nomic Units (OTU) with taxonomic assignments made to risk of developing or transmitting to others an infection due to Genus, Species, and Phylogenetic Clade. Clade membership a gastrointestinal pathogen. of bacterial OTUs is based on 16S sequence data. Clades are 0051. The term “pathobiont” refer to specific bacterial defined based on the topology of a phylogenetic tree that is species found in healthy hosts that may trigger immune constructed from full-length 16S sequences using maximum mediated pathology and/or disease in response to certain likelihood methods familiar to individuals with ordinary skill genetic or environmental factors. Chow et al., (2011) Curr. in the art of phylogenetics. Clades are constructed to ensure Op. Immunol. Pathobionts of the intestinal microbiota and that all OTUs in a given clade are: (i) within a specified inflammatory disease. 23: 473-80. Thus, a pathobiont is a number of bootstrap Supported nodes from one another, and pathogen that is mechanistically distinct from an acquired (ii) within 5% genetic similarity. OTUs that are within the infectious organism. Thus, the term "pathogen includes both same clade can be distinguished as genetically and phyloge acquired infectious organisms and pathobionts. netically distinct from OTUs in a different clade based on 0052. The terms “pathogen”, “pathobiont' and “patho 16S-V4 sequence data, while OTUs falling within the same genic’ in reference to a bacterium or any other organism or clade are closely related. OTUs falling within the same clade entity includes any such organism or entity that is capable of are evolutionarily closely related and may or may not be causing or affecting a disease, disorder or condition of a host distinguishable from one another using 16S-V4 sequence organism containing the organism or entity. data. Members of the same clade, due to their evolutionary 0053 “Phylogenetic tree' refers to a graphical represen relatedness, play similar functional roles in a microbial ecol tation of the evolutionary relationships of one genetic ogy Such as that found in the human gut. Compositions Sub sequence to another that is generated using a defined set of stituting one species with another from the same clade are phylogenetic reconstruction algorithms (e.g. parsimony, likely to have conserved ecological function and therefore are maximum likelihood, or Bayesian). Nodes in the tree repre useful in the present invention. All OTUs are denoted as to sent distinct ancestral sequences and the confidence of any their putative capacity to form spores and whether they are a node is provided by a bootstrap or Bayesian posterior prob Pathogen or Pathobiont (see Definitions for description of ability, which measures branch uncertainty. “Pathobiont'). NIAID Priority Pathogens are denoted as 0054 “Operational taxonomic units.” “OTU (or plural, Category-A, Category-B, or Category-C, and Opportu “OTUs) refer to a terminal leaf in a phylogenetic tree and is nistic Pathogens are denoted as OP. OTUs that are not defined by a nucleic acid sequence, e.g., the entire genome, or pathogenic or for which their ability to exist as a pathogen is a specific genetic sequence, and all sequences that share unknown are denoted as N. The SEQID Number denotes US 2016/0040215 A1 Feb. 11, 2016 the identifier of the OTU in the Sequence Listing File and 0060. In one embodiment, the spore preparation com Public DB Accession denotes the identifier of the OTU in a prises spore forming species wherein residual non-spore public sequence repository. forming species have been inactivated by chemical or physi 005.6 16s Sequencing, 16s, 16s-rRNA, 16s-NGS: In cal treatments including ethanol, detergent, heat, Sonication, microbiology, “16S sequencing or “165-rRNA' or “16S” and the like; or wherein the non-spore forming species have refers to sequence derived by characterizing the nucleotides been removed from the spore preparation by various separa that comprise the 16S ribosomal RNA gene(s). The bacterial tions steps including density gradients, centrifugation, filtra 16S rDNA is approximately 1500 nucleotides in length and is tion and/or chromatography; or wherein inactivation and used in reconstructing the evolutionary relationships and separation methods are combined to make the spore prepara sequence similarity of one bacterial isolate to another using tion. In yet another embodiment, the spore preparation com phylogenetic approaches. 16S sequences are used for phylo prises spore forming species that are enriched over viable genetic reconstruction as they are in general highly con non-spore formers or vegetative forms of spore formers. In served, but contain specific hyperVariable regions that harbor this embodiment, spores are enriched by 2-fold, 5-fold, sufficient nucleotide diversity to differentiate genera and spe 10-fold, 50-fold, 100-fold, 1000-fold, 10,000-fold or greater cies of most bacteria. than 10,000-fold compared to all vegetative forms ofbacteria. 0057 The “V1-V9 regions” of the 16S rRNA refers to the first through ninth hypervariable regions of the 16S rRNA In yet another embodiment, the spores in the spore prepara gene that are used for genetic typing of bacterial samples. tion undergo partial germination during processing and for These regions in bacteria are defined by nucleotides 69-99, mulation Such that the final composition comprises spores 137-242, 433-497, 576-682,822-879,986-1043, 1117-1173, and vegetative bacteria derived from spore forming species. 1243-1294 and 1435-1465 respectively using numbering 0061 The term "isolated encompasses a bacterium or based on the E. coli system of nomenclature. Brosius et al., other entity or substance that has been (1) separated from at Complete nucleotide sequence of a 16S ribosomal RNA gene least Some of the components with which it was associated from Escherichia coli, PNAS 75(10):4801-4805 (1978). In when initially produced (whether in nature or in an experi some embodiments, at least one of the V1,V2, V3, V4, V5, mental setting) and/or (2) produced, prepared, purified, and/ V6, V7, V8, and V9 regions are used to characterize an OTU. or manufactured by the hand ofman. Isolated bacteria include In one embodiment, the V1,V2, and V3 regions are used to those bacteria that are cultured, even if such cultures are not characterize an OTU. In another embodiment, the V3, V4, and monocultures. Isolated bacteria may be separated from at V5 regions are used to characterize an OTU. In another least about 10%, about 20%, about 30%, about 40%, about embodiment, the V4 region is used to characterize an OTU. A 50%, about 60%, about 70%, about 80%, about 90%, or more person of ordinary skill in the art can identify the specific of undesired bacteria, or, alternatively, one or more of the hypervariable regions of a candidate 16S rRNA by comparing other components with which they were initially associated. the candidate sequence in question to a reference sequence In some embodiments, isolated bacteria are more than about and identifying the hyperVariable regions based on similarity 80%, about 85%, about 90%, about 91%, about 92%, about to the reference hyperVariable regions, or alternatively, one 93%, about 94%, about 95%, about 96%, about 97%, about can employ Whole Genome Shotgun (WGS) sequence char 98%, about 99%, or more than about 99% pure. In some acterization of microbes or a microbial community. embodiments, the isolated bacteria are 99.5%, 99.6%, 99.7%, 0058. The term “phenotype” refers to a set of observable 99.8%, 99.9%, or at least 99.99%, or at least 99.999% pure. characteristics of an individual entity. As example an indi As used herein, a substance is “pure' if it is substantially free vidual subject may have a phenotype of “health' or “disease'. of other components. The terms “purify.” “purifying and Phenotypes describe the state of an entity and all entities “purified’ refer to a bacterium or other material that has been within a phenotype share the same set of characteristics that separated from at least Some of the components with which it describe the phenotype. The phenotype of an individual was associated either when initially produced or generated results in part, or in whole, from the interaction of the entities (e.g., whether in nature or in an experimental setting), or genome and/or microbiome with the environment. during any time after its initial production. A bacterium or a 0059 A “spore population” refers to a plurality of spores bacterial population may be considered purified if it is iso and spore forming organisms present in a composition. Syn lated at or after production, such as from a material or envi onymous terms used herein include spore composition, spore ronment containing the bacterium or bacterial population, or preparation, ethanol treated spore fraction and spore ecology. by passage through culture, and a purified bacterium or bac A spore population may be purified from a fecal donation, e.g. terial population may contain other materials (exclusive of via solvent, acid, detergent, or heat treatment, or a density water) up to about 10%, about 20%, about 30%, about 40%, gradient separation, centrifugation, chromatographic separa about 50%, about 60%, about 70%, about 80%, about 90%, or tion, filtration, or any combination of methods described about 99% or and still be considered "isolated.” In some herein to increase the purity, potency and/or concentration of embodiments, purified bacteria and bacterial populations are spores in a sample. A spore population may be derived more than about 80%, about 85%, about 90%, about 91%, through culture methods starting from isolated spore former about 92%, about 93%, about 94%, about 95%, about 96%, species or spore former OTUs or from a mixture of such about 97%, about 98%, about 99%, or more than about 99% species, either in vegetative or spore form. Spores can be pure. In the instance of bacterial compositions provided purified from natural Sources including but not limited to herein, the one or more bacterial types present in the compo feces, soil, and water. Furthermore a spore population, or sition can be independently purified from one or more other preparation is a non-limiting Subset of a microbial composi bacteria produced and/or present in the material or environ tion. Additional, ethanol treated fecal Suspensions are a non ment containing the bacterial type. Microbial compositions, limiting additional Subset of a microbial composition bacterial compositions, and the bacterial components thereof enriched for spores and spore formers. are generally purified from residual habitat products. US 2016/0040215 A1 Feb. 11, 2016
0062 “Residual habitat products” refers to material 0065. A “sporulation induction agent' is a material or derived from the habitat for microbiota within or on a human physical-chemical process that is capable of inducing sporu or animal. For example, microbiota live in feces in the gas lation in a bacterium, either directly or indirectly, in a host trointestinal tract, on the skin itself, in saliva, mucus of the organism and/or in vitro. respiratory tract, or secretions of the genitourinary tract (i.e., 0066. To “increase production of bacterial spores' biological matter associated with the microbial community). includes an activity or a sporulation induction agent. "Pro Substantially free of residual habitat products means that the duction' includes conversion of vegetative bacterial cells into bacterial composition no longer contains the biological mat spores and augmentation of the rate of Such conversion, as ter associated with the microbial environment on or in the well as decreasing the germination of bacteria in spore form, human or animal subject and is 100% free, 99% free, 98% decreasing the rate of spore decay in vivo, or ex vivo, or to free, 97% free, 96% free, or 95% free of any contaminating increasing the total output of spores (e.g. via an increase in biological matter associated with the microbial community. volumetric output of fecal material). Residual habitat products can include abiotic materials (in 0067. A “cytotoxic' activity or bacterium includes the cluding undigested food) or it can include unwanted micro ability to kill a bacterial cell. Such as a pathogenic bacterial organisms. Substantially free of residual habitat products cell. A “cytostatic' activity or bacterium includes the ability may also mean that the bacterial composition contains no to inhibit, partially or fully, growth, metabolism, and/or pro detectable cells from a human or animal and that only micro liferation of a bacterial cell. Such as a pathogenic bacterial bial cells are detectable. In one embodiment, substantially cell. free of residual habitat products may also mean that the bac 0068 Compositions and Methods of the Invention terial composition contains no detectable viral (including 0069. Materials and Compositions Suitable for Testing bacterial viruses (i.e., phage)), fungal, mycoplasmal contami 0070 Encompassed by the present invention are any mate nants. In another embodiment, it means that fewer than 1x10 rials in Solid or liquid form Suitable for testing using the 2%, 1x10%, 1x10%, 1x10%, 1x10%, 1x107%, methods and systems described herein. Non-limiting 1x10 of the viable cells in the bacterial composition are examples of Such materials include Solids or liquids from a human or animal, as compared to microbial cells. There are biological environment, foods or beverages including medi multiple ways to accomplish this degree of purity, none of cal foods or beverages, specimens, therapeutic compositions, which are limiting. Thus, contamination may be reduced by nutraceuticals and probiotics, organ and tissue transplants, isolating desired constituents through multiple steps of sterile products such as bandages and dressings, synthetic streaking to single colonies on solid media until replicate compounds, and any material in an environment requiring a (such as, but not limited to, two) streaks from serial single determination of the presence, and optionally the concentra colonies have shown only a single colony morphology. Alter tion of microbial and other pathogens or a measurement of the natively, reduction of contamination can be accomplished by potency, purity, identity or safety of said materials. multiple rounds of serial dilutions to single desired cells (e.g., 0071. In some embodiments the invention provides vali a dilution of 10 or 10), such as through multiple 10-fold dated therapeutic compositions, meaning compositions serial dilutions. This can further be confirmed by showing that intended for administration to a mammalian Subject to treator multiple isolated colonies have similar cell shapes and Gram prevent a disease, disorder or condition. Such therapeutic staining behavior. Other methods for confirming adequate compositions include one or more bacteria, yeast, virus, (e.g., purity include genetic analysis (e.g. PCR, DNA sequencing), phage), or combinations thereof. In particular, provided are serology and antigen analysis, enzymatic and metabolic combinations of bacteria of the human gut microbiota with analysis, and methods using instrumentation Such as flow the capacity to meaningfully provide functions of a healthy cytometry with reagents that distinguish desired constituents microbiota or to catalyze the formation of a healthy micro from contaminants. biota when administered to mammalian hosts. 0072 Microbial compositions may contain at least two 0063 “Inhibition' of a pathogen encompasses the inhibi types of bacteria, yeast, virus (e.g., phage) or combinations tion of any desired function or activity of the bacterial com thereof. For instance, a bacterial composition may comprise positions of the present invention. Demonstrations of patho at least 2, at least 3, at least 4, at least 5, at least 6, at least 7. gen inhibition, Such as decrease in the growth of a pathogenic at least 8, at least 9, at least 10, at least 11, at least 12, at least bacterium or reduction in the level of colonization of a patho 13, at least 14, at least 15, at least 16, at least 17, at least 18, genic bacterium are provided herein and otherwise recog at least 19, or at least 20 or more than 20 types of bacteria, as nized by one of ordinary skill in the art. Inhibition of a defined by species or an operational taxonomic unit (OTU) pathogenic bacterium’s “growth' may include inhibiting the encompassing such species. increase in size of the pathogenic bacterium and/or inhibiting 0073 Microbial compositions may consist essentially of the proliferation (or multiplication) of the pathogenic bacte no greater than a number of types of bacteria, yeast, virus rium. Inhibition of colonization of a pathogenic bacterium (e.g., phage) or combinations thereof. For instance, a bacte may be demonstrated by measuring the amount or burden of rial composition may comprise no more than 2, no more than a pathogen before and after a treatment. An “inhibition” or the 3. no more than 4, no more than 5, no more than 6, no more act of “inhibiting includes the total cessation and partial than 7, no more than 8, no more than 9, no more than 10, no reduction of one or more activities of a pathogen, Such as more than 11, no more than 12, no more than 13, no more than growth, proliferation, colonization, and function. 14, no more than 15, no more than 16, no more than 17, no 0064. A “germinant' is a material or composition or more than 18, no more than 19, or no more than 20 types of physical-chemical process capable of inducing vegetative bacteria, as defined by species or an operational taxonomic growth of a bacterium that is in a dormant spore form, or unit (OTU) encompassing such species. In some embodi group of bacteria in the spore form, either directly or indi ments, the number of OTUs can range from 5 to 150, in others rectly in a host organism and/or in vitro. from 5-15, and in still others 40-80 OTUs may be present in US 2016/0040215 A1 Feb. 11, 2016
a bacterial composition. In preferred embodiments, the com repopulation of other bacteria in the intestinal lumen to rees position contains 5-10 organisms comprising at least 90% of tablish ecological control over potential pathogens. In one the microbial composition. embodiment preferred OTUs include those found in Table 1 0074 Bacterial compositions may consist essentially of a and OTUs with 16S sequences that are 97% similar to these range of numbers of species of these preferred bacteria, but OTUS and corresponding sequences. In other embodiments the precise number of species in a given composition is not OTUS are from the same phylogenetic clade as present in known. For instance, a bacterial composition may consist Table 1. essentially of between 2 and 10, 3 and 10, 4 and 10, 5 and 10. 0078. In other embodiments preferred microbial species 6 and 10, 7 and 10, 8 and 10, or 9 and 10; or 2 and 9, 3 and 9, include but are not limited to: Eubacterium rectale, Alistipes 4 and 9, 5 and 9, 6 and 9, 7 and 8 or 8 and 9; or 2 and 8, 3 and putredinis, Coprococcus comes, Eubacterium ventriosum, 8, 4 and 8, 5 and 8, 6 and 8 or 7 and 8; or 2 and 7, 3 and 7, 4 Faecalibacterium prausnitzii, Odoribacter splanchnicus, and 7, 5 and 7, or 6 and 7; or 2 and 6,3 and 6, 4 and 6 or 5 and Ruminococcus bromii, Bacteroides caccae, Bacteroides fine 6; or 2 and 5,3 and 5 or 4 and 5; or 2 and 4 or 3 and 4; or 2 and goldii, Coprococcus catus, Dorea longicatena, Ruminococ 3, as defined by species or operational taxonomic unit (OTU) cus torques, Subdoligranulum variabile, Alistipes Shahi, encompassing Such species. In some embodiments, the num Eubacterium eligens, Roseburia inulinivorans, Ruminococ ber of OTUs can range from 5 to 150, in others from 5-15, and cus obeum, Eubacterium hallii, Roseburia intestinalis, in still others 40-80 OTUs may be present in a bacterial Bacteroides dorei, Bacteroides ovatus, Collinsella aerofa composition. In preferred embodiments, the composition ciens, Dorea formicigenerans, Ruminococcus lactaris, Strep contains 5-10 organisms comprising at least 90% of the viable tococcus thermophilus, Bacteroides stercoris, Bacteroides material (e.g., bacterial cells) present in the microbial com xylamisolvens, Ruminococcus gnavus, Gordonibacter pan position. elaeae, Veillonella parvula, Holdermania filiformis, Strepto 0075 Microbial compositions containing a plurality of coccus mitis, Butyricicoccus pullicaecorum, Clostridiales species may be provided Such that the relative concentration bacterium, Lachnospiraceae bacterium 3 1 57FAA CT1, of a given species in the composition to any other species in Oscillibacter valericigenes, Roseburia hominis, Eubacte the composition is known or unknown. Such relative concen rium Siraeum, Ruminococcaceae bacterium D16, Alistipes sp trations of any two species, or OTUS, may be expressed as a HGB5, Blautia stercoris, Clostridiales sp SM4/1, ratio, where the ratio of a first species or OTU to a second Clostridium symbiosum, Eubacterium hadrum, Bacteroides species or OTU is 1:1 or any ratio other than 1:1, such as 1:2. fragilis, Bacteroides galacturonicus, Blautia welerae, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25; 1:50: Faecalibacterium cf. Bacteroides sp 3 l 19, Blautia luti, 1:75, 1:100, 1:200, 1:500; 1:1000, 1:10,000, 1:100,000 or Christensenella minuta, Eubacterium cellulosolvens, greater than 1:100,000. The ratio of strains present in a micro Bacteroides sp D20, Bacteroides vulgatus, Clostridium lep bial composition may be determined by the ratio of the strains tum, Anaerotruncus colihominis, Bacteroides thetaiotaomi in a reference mammalian Subject or population, e.g., healthy cron, Bacteroides sp. 1 1 30, Clostridium clostridioforme, humans not suffering from or at known risk of developing a Burkholderiales bacterium, Parabacteroides distasonis, dysbiosis. Blautia producta, Escherichia coli, Flavonifactor plautii, 0076 Microbial compositions containing a plurality of Bacteroidespectinophilus, Clostridium spYIT 12069, Rumi bacteria, yeast and/or virus (e.g., phage) may be provided nococcus albus, Bacteroides Sp 91 42FAA, Bacteroides sp Such that the amount of a given bacteria, yeast and/or virus WAL 11050, Clostridium botulinum, Clostridium sp. L250, (e.g., phage), or the aggregate of all such entities, is between Clostridium spNML 04A032, Coprococcus eutacitus, Crono 1x104 and 1x1015 viable microbes per gram of composition bacter turicensis, Desulfovibrio piger; Eubacterium brachy, or per administered dose. For example the amount of a given Eubacterium ramulus, Lachnospiraceae 4, Oscillibacter sp bacteria, yeast and/or virus (e.g., phage), or the aggregate of G2, Roseburia faecalis, Alistipes indistinctus, Bacteroides all such entities, is e.g., 1x104.1 x 105, 1x106, 1x107, 1x108, eggerthii, Bacteroides sp 2 156FAA, Bacteroides sp. 203, 1x109, 1x1010, 1x1011, 1x1012, 1x1013, 1x1014, 1x1015, Bacteroides sp 3 1 23, Bifidobacterium longum, Blautia or greater than 1x1015 viable microbes per gram of compo hydrogenotrophica, Butyricinomas virosa, Clostridiales sp sition or per administered dose. Alternatively, the amount of a SS3 4, Clostridium saccharolyticum, Clostridium sp. D5, given bacteria, yeast and/or virus (e.g., phage), or the aggre Bacteroides sp. 4 3 47FAA, Bifidobacterium adolescentis, gate of all bacteria, yeast and/or virus (e.g., phage), is below Clostridium hathewayi, Clostridium nexile, Ethanoligenens a given concentration e.g., below 1x104, 1x105, 1x106, harbinense, Lachnospiraceae 5, Parabacteroides goldsteinii, 1x107, 1x108, 1x109, 1x1010, 1x1011, 1x1012, 1x1013, Parabacteroides merdae, Acidaminococcus Sp D21, Akker 1x1014, or below 1x1015 viable microbes per gram of com mansia muciniphila, Anaerostipes sp3 256FAA, Bacteroides position or per administered dose. cellulosilyticus, Blautia hansenii, Campylobacter concisus, 0077. Without being limited to a specific mechanism, it is Clostridium asparagiforme, Clostridium bartlettii, thought that the validated therapeutic compositions, when Clostridium bolteae, Clostridium scindens, Clostridium sp administered to a mammalian Subject in need thereof, inhibit YIT 12070, Lactobacillus johnsonii, Lactobacillus reuteri, the growth of a pathogen Such as C. difficile, Salmonella spp., Pantoea ananatis, Parasutterella excrementihominis, enteropathogenic E. coli, Enterococcus spp., Vibrio spp., Bacteroides intestinalis, Bacteroides uniformis, Bilophila Yersinia spp., Streptococcus spp., Shigella spp., Vancomycin Wadsworthia, Citrobacter koseri, Citrobacter youngae, resistant Enterococcus spp., Klebsiella spp., carbapenem Clostridiales 1, Desulfovibrio desulfuricans, Edwardsiella resistant Klebsiella and other carbapenem resistant Gram tarda, Enterobactersp SCSS, Enterococcus faecalis, Entero negative species or OTUS, Candida spp. So that a healthy, coccus gallinarum, Enterococcus hirae, Fusobacterium sp diverse and protective microbiota can be maintained or, in the CM1, Klebsiella sp. SRC DSD6, Lachnospiraceae 6, Lacto case of pathogenic bacterial infections such as recurrent C. bacillus casei, Lactobacillus fermentum, Lactobacillus gas difficile infection, and either directly repopulate or cause the seri, Lactobacillus plantarum, Leminorella grimontii, Leu US 2016/0040215 A1 Feb. 11, 2016 conostoc Citreum, Morganella sp JB T16, Streptococcus methylpentosum, Clostridium nexile, Clostridium Orbiscin salivarius, Bacteroides sp 3 2 5, Citrobacter amalomaticus, dens, Clostridium perfingens, Clostridium ramosum, Citrobacter sp KMSI 3, Enterococcus durans, Enterococcus Clostridium saccharolyticum, Clostridium scindens, rafinosus, Fusobacterium sp. 1132, Klebsiella pneumoniae, Clostridium sordellii, Clostridium spiroforme, Clostridium Klebsiella sp Co9935, Lactobacillus salivarius, Megas sporogenes, Clostridium Sticklandii, Clostridium symbiosum, phaera micronuciformis, Proteus penneri, Proteus vulgaris, Clostridium tetani, Collinsella aerofaciens, Coprococcus Shigella flexneri, Streptococcus parasanguinis, Veillonella catus, Coprococcus comes, Coprococcus eutactus, Des atypica, Klebsiella sp enrichment culture clone, Clostridium ulfo vibrio piger; Dorea formicigenerans, Dorea longicatena, difficile, A. hydrogenalis, A. Pleuropneumonaie, A. Stercori Enterococcus durans, Enterococcus faecalis, Enterococcus hominis, B. adolescentis, B. angulatum, B. animalis, B. bifi faecium, Enterococcus hirae, Escherichia coli, Eubacterium dum, B. breve, B. capillosus, B. catenulatum, B. Coprophilus, biforme, Eubacterium cylindroides, Eubacterium desmolans, B. crossotus, B. dertium, B. fibrisolvens, B. gallicum, B. ple Eubacterium dolichum, Eubacterium eligens, Eubacterium beius, B. pseudocatenulatum, Bacteroides sp2 17, Bacteroi hadrum, Eubacterium halli, Eubacterium limosum, Eubac des sp 2 24, Bacteroides sp D1, Bacteroides sp D4, Blautia terium rectale, Eubacterium Siraeum, Eubacterium ventrio cocccoides, C. aerofaciens, C. concisus, C. hylemonae, C. sum, Eubacterium yuri, Faecalibacterium prausnitzii, Fili intestinalis, C. methylpentosum, C. perfingens, C. phytofer factor alocis, Finegoldia magna, Flavonifactor plautii, mentans, C. ramosum, C. Stercoris, C. Sulcia muelleri, Cit Holdemania filiformis, Lachnospira pectinoshiza, Lactoba robacter so.30 2, Citrobacter sp., Clostridiales sp SS2 1, cillus acidophilus, Lactobacillus amylolyticus, Lactobacillus Clostridium indolis, Clostridium lavalense, Clostridium sac brevis, Lactobacillus bulgaricus, Lactobacillus casei, Lacto charogumia, Clostridium sp., Clostridium sp. MLG0555, bacillus fermentum, Lactobacillus gasseri, Lactobacillus Clostridium sp. 7243FAA, Clostridium cocleatum, D. vul helveticus, Lactobacillus johnsonii, Lactobacillus paracasei, garis, E. cancerogenus, E. dolichum, E. fergusonii, E. Saka Lactobacillus plantarum, Lactobacillus reuteri, Lactobacil zakii, Enterobacter sp 638, Eubacterium contortum, Eubac lus rhamnosus, Lactobacillus salivarius, Lactococcus lactis, terium desmolans, Eubacterium limosum, F. magna, H. Odoribacter laneus, Odoribacter splanchnicus, Oxalobacter influenzae, H. parasuis, L. helveticus, L. ultunensis, lachno formigenes, Parabacteroides distasonis, Parabacteroides spira bacterium DJFVP30, Lachnospira pectinoshiza, Lach johnsonii, Parabacteroides merdae, Parasutterella excre no spiraceae bacterium DJF VP30, M. formatexigens, Molli mentihominis, Parvimonas micra, Pediococcus acidilactici, cutes bacrium D7, P gingivalis, P. mirabilis, P. multocida, P. Pediococcus pentosaceus, Peptostreptococcus anaerobius, pentosaceus, Routella sp., Ruminococcus sp. ID8, Rumino Peptostreptococcus stomatis, PrevOtella copri, PrevOtella coccus sp. Srl 5, S. enterica, S. gordonii, S. infantarius, S. oralis, Prevotella salivae, Propionibacterium feudenreichii, mutans, S. pneumoniae, S. pyogenes, S. Sanguinis, S. Suis. Pseudoflavonifactor capillosus, Rhodopseudomonas palus tris, Roseburia faecis, Roseburia intestinalis, Roseburia 0079. In some embodiments, bacterial species and combi inulinivorans, Ruminococcus bromii, Ruminococcus gnavus, nations thereofare selected from Acidaminococcus intestine, Ruminococcus lactaris, Ruminococcus obeum, Ruminococ Adlercreutzia equolifaciens, Akkermansia muciniphila, Alis cus torques, Shigella flexneri, Staphylococcus aureus, Sta tipes putredinis, Alistipes Shahi, Alkaliphilus metalliredi phylococcus pasteuri, Staphylococcus warneri, Streptococ genes, Alkaliphilus Oremlandii, Anaerococcus hydrogenalis, cus anginosus, Streptococcus mitis, Streptococcus salivarius, Anaerofustis Stercorihominis, Anaerostipes caccae, Streptococcus thermophiles, Subdoligranulum variabile, Anaerotruncus colihominis, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus cereus, Bacillus circulans, Sutterella wadsworthensis, and Veillonella parvula. Bacillus coagulans, Bacillus licheniformis, Bacillus pumilis, 0080. In some embodiments, bacterial species and combi Bacillus subtilis, Bacteroides caccae, Bacteroides cellulosi nations thereof are provided in Hamilton M.J. Weingarden A lyticus, Bacteroides coprocola, Bacteroides coprophilus, R, Unno T, Khoruts A, Sadowsky MJ (2013) High-through Bacteroides dorei, Bacteroides eggerthii, Bacteroides fine put DNA sequence analysis reveals stable engraftment of gut goldii, Bacteroides fragilis, Bacteroides intestinalis, microbiota following transplantation of previously frozen Bacteroides ovatus, Bacteroides pectinophilus, Bacteroides fecal bacteria. Gut Microbes 4: 125-135; Nishio J. Atarashi K, plebeius, Bacteroides stercoris, Bacteroides thetaiotaomi Tanoue T, Baba M, Negishi H, et al. (2013) Impact of TCR cron, Bacteroides uniformis, Bacteroides vulgatus, Bacteroi repertoire on intestinal homeostasis. Keystone Symposium. des xylamisolvens, Barnesiella intestinihominis, Bifidobacte The Gut Microbiome: The Effector/Regulatory Immune Net rium adolescentis, Bifidobacterium animalis, work; PetrofEO, Gloor GB, Vanner SJ, Weese SJ, Carter D, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobac et al. (2013) Stool substitute transplant therapy for the eradi terium catenulatum, Bifidobacterium infantis, Bifidobacte cation of Clostridium difficile infection: “RePOOPulating rium longum, Bifidobacterium pseudocatenulatum, Bifido the gut. Microbiome 1: 3; Lozupone C, Faust K. Raes J. Faith bacterium thermophilum, Bilophila wadsworthia, Blautia JJ, Frank D N, et al. (2012) Identifying genomic and meta hansenii, Blautia hydrogenotrophica, Blautia luti, Blautia bolic features that can underlie early successional and oppor producta, Blautia welerae, Bryantella formatexigens, Butyr tunistic lifestyles of human gut symbionts. Genome Res. 22: ivibrio crossotus, Butyrivibrio fibrisolvens, Campylobacter 1974-1984; Lawley T D, Clare S, Walker A. W. Stares MD, concisus, Campylobacter curvus, Catenibacterium mitsuo Connor T R, et al. (2012) Targeted Restoration of the Intes kai, Clostridium asparagiforme, Clostridium bartlettii, tinal Microbiota with a Simple, Defined Bacteriotherapy Clostridium bifermentans, Clostridium bolteae, Clostridium Resolves Relapsing Clostridium difficile Disease in Mice. butyricum, Clostridium cellatum, Clostridium citroniae, PLoS Pathog. 8: e1002995: Hell M, Bernhofer C, Stalzer P. Clostridium clostridioforme, Clostridium cocleatum, Kern J M, and Claassen E. 2013. Probiotics in Clostridium Clostridium hathewayi, Clostridium hiranonis, Clostridium difficile infection: reviewing the need for a multistrain probi hylemonae, Clostridium indolis, Clostridium innocuum, otic. Benef Microbes 4:39-51; Faust K. Sathirapongsasuti. F. Clostridium lavalense, Clostridium leptum, Clostridium Izard J, Segata N. Gevers D, et al. (2012) Microbial co US 2016/0040215 A1 Feb. 11, 2016
occurrence relationships in the human microbiome. PLoS embodiment, at least one of the preceding species is not Comput. Biol. 8: e1002606; Van Nood E. Vrieze A, Nieuw Substantially present in the bacterial composition. dorp M. Fuentes S. Zoetendal EG, et al. (2012) Duodenal I0084. In one embodiment, the microbial composition Infusion of Donor Feces for Recurrent Clostridium difficile. comprises at least one and preferably more than one of the New England Journal of Medicine (anejm.org/doi/full/10. following: Clostridium bifermentans, Clostridium innocuum, 1056/NEJMoa1205037 on 17 Jan. 2013: Shahinas D, Silver Clostridium butyricum, three strains of Escherichia coli, man M. Sittler T. Chiu C, Kim P. et al. (2012) Toward an three strains of Bacteroides, and Blautia producta. In an Understanding of Changes in Diversity Associated with Fecal alternative embodiment, at least one of the preceding species Microbiome Transplantation Based on 16S rRNA Gene Deep is not substantially present in the composition. Sequencing. MBio 3:5; Khoruts A, Dicksved J. Jansson JK, I0085. In one embodiment, the microbial composition Sadowsky MJ (2010) Changes in the composition of the comprises at least one and preferably more than one of the human fecal microbiome after bacteriotherapy for recurrent following: Bacteroides sp., Escherichia coli, and non-patho Clostridium difficile-associated diarrhea. J. Clin. Gastroen genic Clostridia, including Clostridium innocuum, terol. 44; 354-360; Chang JY. Antonopoulos DA, Kalra A. Clostridium bifermentans and Clostridium ramosum. In an Tonelli A, Khalife WT, et al. (2008) Decreased diversity of alternative embodiment, at least one of the preceding species the fecal Microbiome in recurrent Clostridium difficile-asso is not substantially present in the bacterial composition. ciated diarrhea. J. Infect. Dis. 197: 435-438; and Tvede M, I0086. In one embodiment, the microbial composition Rask-Madsen J (1989) Bacteriotherapy for chronic relapsing comprises at least one and preferably more than one of the Clostridium difficile diarrhoea in six patients. Lancet 1: 1156 following: Bacteroides species, Escherichia coli and non 1160. The contents of these references are incorporated by pathogenic Clostridia, such as Clostridium butyricum, reference herein in their entireties. Clostridium bifermentans and Clostridium innocuum. In an 0081. In one embodiment, the microbial composition alternative embodiment, at least one of the preceding species comprises at least one and preferably more than one of the is not substantially present in the microbial composition. following: Barnesiella intestinihominis, Lactobacillus reu I0087. In certain embodiments, provided are microbial teri; a species characterized as one of Enterococcus hirae, compositions containing a plurality of Bacteroides species. In Enterococus faecium, or Enterococcus durans; a species Such exemplary embodiments, the microbial composition characterized as one of Anaerostipes caccae or Clostridium comprises at least one and preferably more than one of the indolis; a species characterized as one of Staphylococcus following: Bacteroides caccae, Bacteroides capillosus, warneri or Staphylococcus pasteuri; and Adlercreutzia Bacteroides coagulans, Bacteroides distasonis, Bacteroides equolifaciens. In an alternative embodiment, at least one of eggerthii, Bacteroides forsythus, Bacteroides fragilis, the preceding species is not substantially present in the com Bacteroides fragilis-ryhn, Bacteroides gracilis, Bacteroides position. levi, Bacteroides macacae, Bacteroides merdae, Bacteroides 0082 In one embodiment, the microbial composition ovatus, Bacteroides pneumosintes, Bacteroides putredinis, comprises at least one and preferably more than one (e.g., 2. Bacteroides pyogenes, Bacteroides splanchnicus, Bacteroi 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) of the following: des Stercoris, Bacteroides tectum, Bacteroides thetaiotaomi Clostridium absonium, Clostridium argentinense, cron, Bacteroides uniformis, Bacteroides ureolyticus, and Clostridium baratii, Clostridium bartlettii, Clostridium bifer Bacteroides vulgatus. In an alternative embodiment, at least mentans, Clostridium botulinum, Clostridium butyricum, one of the preceding species is not substantially present in the Clostridium cadaveris, Clostridium Camis, Clostridium cella composition. tum, Clostridium chauvoei, Clostridium clostridioforme, I0088. In one embodiment, the microbial composition Clostridium cochlearium, Clostridium difficile, Clostridium comprises at least one and preferably more than one of the fallax, Clostridium felsineum, Clostridium ghonii, following: Bacteroides, Eubacteria, Fusobacteria, Propioni Clostridium glycolicum, Clostridium haemolyticum, bacteria, Lactobacilli, anaerobic cocci, Ruminococcus, Clostridium hastiforme, Clostridium histolyticum, Escherichia coli, Gemmiger; Desulfomonas, and Peptostrep Clostridium indolis, Clostridium innocuum, Clostridium tococcus. In an alternative embodiment, at least one of the irregulare, Clostridium limosum, Clostridium malenomina preceding species is not Substantially present in the microbial tum, Clostridium novyi, Clostridium Oroticum, Clostridium composition. paraputrificum, Clostridium perfingens, Clostridium pili I0089. In one embodiment, the microbial composition forme, Clostridium putrefaciens, Clostridium putrificum, comprises at least one and preferably more than one of the Clostridium ramosum, Clostridium sardiniense, Clostridium following: Bacteroides fragilis SS. Vulgatus, Eubacterium Sartagoforme, Clostridium scindens, Clostridium septicum, aerofaciens, Bacteroides fragilis SS. Thetaiotaomicron, Blau Clostridium sordellii, Clostridium sphenoides, Clostridium tia producta (previously known as Peptostreptococcus pro spiroforme, Clostridium sporogenes, Clostridium subtermi ductus II), Bacteroides fragilis SS. Distasonis, Fusobacterium male, Clostridium symbiosum, Clostridium tertium, prausnitzii, Coprococcus eutactus, Eubacterium aerofaciens Clostridium tetani, Clostridium welchii, and Clostridium vil III, Blautia producta (previously known as Peptostreptococ losum. In an alternative embodiment, at least one of the pre cus productus I), Ruminococcus bronii, Bifidobacterium ado ceding species is not substantially present in the bacterial lescentis, Gemmiger formicilis, Bifidobacterium longum, composition. Eubacterium Siraeum, Ruminococcus torques, Eubacterium 0083. In one embodiment, the microbial composition rectale III-H, Eubacterium rectale IV. Eubacterium eligens, comprises at least one and preferably more than one of the Bacteroides eggerthii, Clostridium leptum, Bacteroides fra following: Clostridium innocuum, Clostridum bifermentans, gilis SS. A., Eubacterium biforme, Bifidobacterium infantis, Clostridium butyricum, Bacteroides fragilis, Bacteroides Eubacterium rectale III-F. Coprococcus comes, Bacteroides thetaiotaomicron, Bacteroides uniformis, three Strains of capillosus, Ruminococcus albus, Eubacterium formicigener Escherichia coli, and Lactobacillus sp. In an alternative ans, Eubacterium hallii, Eubacterium ventriosum I, Fuso US 2016/0040215 A1 Feb. 11, 2016 10 bacterium russii, Ruminococcus obeum, Eubacterium rectale 0094 Provided herein are therapeutic compositions con II, Clostridium ramosum I, Lactobacillus leichmanii, Rumi taining a purified population of bacterial spores. As used nococcus Cailidus, Butyrivibrio crossotus, Acidaminococcus herein, the terms “purify”, “purified’ and “purifying refer to fermentans, Eubacterium ventriosum, Bacteroides fragilis SS. the state of a population (e.g., a plurality of known or fragilis, Bacteroides AR, Coprococcus catus, Eubacterium unknown amount and/or concentration) of desired bacterial hadrum, Eubacterium cylindroides, Eubacterium ruminan spores, that have undergone one or more processes of purifi tium, Eubacterium CH-1, Staphylococcus epidermidis, Pep cation, e.g., a selection or an enrichment of the desired bac to streptococcus BL, Eubacterium limosum, Bacteroides terial spore, or alternatively a removal or reduction of residual praeacutus, Bacteroides L., Fusobacterium mortiferum I. Fusobacterium naviforme, Clostridium innocuum, habitat products as described herein. In some embodiments, a Clostridium ramosum, Propionibacterium acnes, Rumino purified population has no detectable undesired activity or, coccus flavefaciens, Ruminococcus AT, Peptococcus AU-1. alternatively, the level or amount of the undesired activity is at Eubacterium AG, -AK, -AL -AL-1, -AN; Bacteroides fragi or below an acceptable level or amount. In other embodi lis SS. ovatus, -SS. d, -SS. f. Bacteroides L-1, L-5. Fusobacte ments, a purified population has an amount and/or concentra rium nucleatum, Fusobacterium mortiferum, Escherichia tion of desired bacterial spores at or above an acceptable coli, Streptococcus morbilliorum, Peptococcus magnus, Pep amount and/or concentration. In other embodiments, the ratio tococcus G, AU-2; Streptococcus intermedius, Ruminococ of desired-to-undesired activity (e.g. spores compared to Veg cus lactaris, Ruminococcus CO Gemmiger X, Coprococcus etative bacteria), has changed by 2-, 5-, 10-, 30-, 100-, 300 BH, -CC, Eubacterium tenue, Eubacterium ramulus, Eubac 1x104, 1x105, 1x106, 1x107, 1x108, or greater than 1x108. terium AE, -AG-H, -AG-M, -AJ, -BN-1; Bacteroides clostri In other embodiments, the purified population of bacterial diiformis SS. clostridliformis, Bacteroides coagulans, spores is enriched as compared to the starting material (e.g., a Bacteroides Orails, Bacteroides ruminicola SS. brevis, -SS. fecal material) from which the population is obtained. This ruminicola, Bacteroides splanchnicus, Desuifomonas pigra, enrichment may be by 10%, 20%, 30%, 40%, 50%, 60%, Bacteroides L-4, -N-i: Fusobacterium H, Lactobacillus G, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, and Succinivibrio A. In an alternative embodiment, at least 99.99%, 99.999%, 99.9999%, 99.9999%, or greater than one of the preceding species is not substantially present in the 99.999999% as compared to the starting material. composition. 0095. In certain embodiments, the purified populations of 0090 Heterogeneous Bacterial Compositions bacterial spores have reduced or undetectable levels of one or 0091 Also provided are compositions containing material more pathogenic activities, such as toxicity, an ability to obtained or derived from natural sources containing micro cause infection of the mammalian recipient Subject, an undes bial materials, and Such compositions are in Some embodi ired immunomodulatory activity, an autoimmune response, a ments Substantially heterogeneous in the microbial and non metabolic response, or an inflammatory response or a neuro microbial components contained therein. For example, Such logical response. Such a reduction in a pathogenic activity natural sources may be fecal material obtained from one or may be by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, more healthy Subjects, or one or more subjects having or at 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99%, 99.999%, risk of developing a disease, disorder or condition associated 99.9999%, or greater than 99.9999% as compared to the with a dysbiosis. Other Such natural or manipulated sources starting material. In other embodiments, the purified popula include environmental samples, e.g., ground water, open tions of bacterial spores have reduced sensory components as freshwater and Sea water, soils, earth and rocks, plants, compared to fecal material. Such as reduced odor, taste, mosses, lichens and other natural microbial communities, appearance, and umami. non-human animals (other than animals included as 'Sub 0096 Provided are purified populations ofbacterial spores jects” as defined herein, and their microbiota), raw foods, that are substantially free of residual habitat products. In fermented foods, fermented beverages, animal feeds, or certain embodiments, this means that the bacterial spore com Silage. position no longer contains a Substantial amount of the bio 0092. In one embodiment the microbial compositions are logical matter associated with the microbial community therapeutic compositions containing non-pathogenic, germi while living on or in the human or animal Subject, and the nation-competent bacterial spores, for the prevention, con purified population of spores may be 100% free, 99% free, trol, and treatment of gastrointestinal diseases, disorders and 98% free, 97% free, 96% free, or 95% free of any contami conditions and for general nutritional health. These compo nation of the biological matter associated with the microbial sitions are advantageous in being Suitable for safe adminis community. Substantially free of residual habitat products tration to humans and other mammalian Subjects and are may also mean that the bacterial spore composition contains efficacious in numerous gastrointestinal diseases, disorders no detectable cells from a human or animal, and that only and conditions and in general nutritional health. While spore microbial cells are detectable, in particular, only desired based compositions are known, these are generally prepared microbial cells are detectable. In another embodiment, it according to various techniques such as lyophilization or means that fewer than 1x10-2%, 1x10-3%, 1x10-4%, 1x10 spray-drying of liquid bacterial cultures, resulting in poor 5%, 1x10-6%, 1x10-7%, 1x10-8% of the cells in the bacterial efficacy, instability, substantial variability and lack of composition are human or animal, as compared to microbial adequate safety and efficacy. cells. In another embodiment, the residual habitat product 0093. It has now been found that populations of bacterial present in the purified population is reduced at least a certain spores can be obtained from biological materials obtained level from the fecal material obtained from the mammalian from mammalian Subjects, including humans. These popula donor subject, e.g., reduced by at least about 10%, 20%, 30%, tions are formulated into compositions as provided herein, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, and administered to mammalian Subjects using the methods 99%, 99.9%, 99.99%, 99.999%, 99.9999%, or greater than as provided herein. 99.9999%. US 2016/0040215 A1 Feb. 11, 2016
0097. In one embodiment, substantially free of residual these genera or species. In other embodiments, donors are habitat products or substantially free of a detectable level of a preferred that produce relatively higher concentrations of pathogenic material means that the bacterial composition spores in fecal material than other donors. In further embodi contains no detectable viral (including bacterial viruses (i.e., ments, donors are preferred that provide fecal material from phage)), fungal, or mycoplasmal or toxoplasmal contami which spores having increased efficacy are purified; this nants, or a eukaryotic parasite Such as a helminth. Alterna increased efficacy is measured using in vitro or in animal tively, the purified spore populations are substantially free of studies as described below. In some embodiments, the donor an acellular material, e.g., DNA, viral coat material, or non may be subjected to one or more pre-donation treatments in viable bacterial material. Alternatively, the purified spore order to reduce undesired material in the fecal material, and/ population may processed by a method that kills, inactivates, or increase desired spore populations. or removes one or more specific undesirable viruses, such as 0103. It is advantageous to screen the health of the donor an enteric virus, including norovirus, poliovirus or hepatitis A Subject prior to and optionally, one or more times after, the W1US. collection of the fecal material. Such screening identifies 0098. As described herein, purified spore populations can donors carrying pathogenic materials such as viruses (HIV, be demonstrated by genetic analysis (e.g., PCR, DNA hepatitis, polio) and pathogenic bacteria. Post-collection, sequencing). Serology and antigen analysis, microscopic donors are screened about one week, two weeks, three weeks, analysis, microbial analysis including germination and cul one month, two months, three months, six months, one year or turing, and methods using instrumentation Such as flow more than one year, and the frequency of such screening may cytometry with reagents that distinguish desired bacterial be daily, weekly, bi-weekly, monthly, bi-monthly, semi spores from non-desired, contaminating materials. yearly or yearly. Donors that are screened and do not test 0099 Exemplary biological materials include fecal mate positive, either before or after donation or both, are consid rials such as feces or materials isolated from the various ered “validated donors. segments of the Small and large intestines. Fecal materials are 0104 Solvent Treatments obtained from a mammalian donor Subject, or can be obtained 0105 To purify the bacterial spores, the fecal material is from more than one donor subject, e.g.,2,3,4,5,6,7,8,9, 10. Subjected to one or more solvent treatments. A solvent treat 15, 20, 25, 30,35,40, 45,50, 75, 100, 200,300,400,500, 750, ment is a miscible solvent treatment (either partially miscible 1000 or from greater than 1000 donors, where such materials or fully miscible) or an immiscible solvent treatment. Misci are then pooled prior to purification of the desired bacterial bility is the ability of two liquids to mix with each to form a spores. In another embodiment, fecal materials can be homogeneous solution. Water and ethanol, for example, are obtained from a single donor Subject over multiple times and fully miscible Such that a mixture containing water and etha pooled from multiple samples e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, nol in any ratio will show only one phase. Miscibility is 15, 20, 25, 30, 32, 35, 40, 45, 48, 50, 100 samples from a provided as a wit/wt %, or weight of one solvent in 100 g of single donor. final solution. If two solvents are fully miscible in all propor 0100. In alternative embodiments, the desired bacterial tions, their miscibility is 100%. Provided as fully miscible spores are purified from a single fecal material sample Solutions with water are alcohols, e.g., methanol, ethanol, obtained from a single donor, and after Such purification are isopropanol, butanol, propanediol, butanediol, etc. The alco combined with purified spore populations from other purifi hols can be provided already combined with water; e.g., a cations, either from the same donorata different time, or from solution containing 10%, 20%, 25%, 30%, 35%, 40%, 45%, one or more different donors, or both. 50%, 55%, 60%, 65%, 70%, 75%, 89%, 85%, 90%, 95% or 0101 Mammalian donor subjects are generally of good greater than 95%. Other solvents are only partially miscible, health and have microbiota consistent with Such good health. meaning that only some portion will dissolve in water. Often, the donor subjects have not been administered antibi Diethyl ether, for example, is partially miscible with water. otic compounds within a certain period prior to the collection Up to 7 grams of diethyl ether will dissolve in 93 g of water to of the fecal material. In certain embodiments, the donor sub give a 7% (wit/wt %) solution. If more diethyl ether is added, jects are not obese or overweight, and may have body mass a two-phase solution will result with a distinct diethyl ether index (BMI) scores of below 25, such as between 18.5 and layer above the water. Other partially miscible materials 24.9. In other embodiments, the donor subjects are not men include ethers, propanoate, butanoate, chloroform, tally ill or have no history or familial history of mental illness, dimethoxyethane, or tetrahydrofuran. In contrast, an oil Such Such as anxiety disorder, depression, bipolar disorder, autism as an alkane and water are immiscible and form two phases. spectrum disorders, schizophrenia, panic disorders, attention Further, immiscible treatments are optionally combined with deficit (hyperactivity) disorders, eating disorders or mood a detergent, eitheranionic detergent or a non-ionic detergent. disorders. In other embodiments, the donor subjects do not Exemplary detergents include Triton X-100. Tween 20, have irritable bowel disease (e.g., crohn's disease, ulcerative Tween 80, Nonidet P40, a pluronic, or a polyol. The solvent colitis), irritable bowel syndrome, celiac disease, colorectal treatment steps reduces the viability of non-spore forming cancer or a family history of these diseases. In other embodi bacterial species by 10%, 20%, 30%, 40%, 50%, 60%, 70%, ments, donors have been screened for blood borne pathogens 80%, 85%, 90%, 95%, 99%, 99.9%, 99.99%, 99.999%, or and fecal transmissible pathogens using standard techniques 99.9999%, and it may optionally reduce the viability of con known to one in the art (e.g. nucleic acid testing, serological taminating protists, parasites and/or viruses. testing, antigen testing, culturing techniques, enzymatic 0106 Chromatography treatments. To purify spore popu assays, assays of cell free fecal filtrates looking for toxins on lations, the fecal materials are Subjected to one or more chro susceptible cell culture substrates). matographic treatments, either sequentially or in parallel. In a 0102. In some embodiments, donors are also selected for chromatographic treatment, a solution containing the fecal the presence of certain genera and/or species that provide material is contacted with a solid medium containing a hydro increased efficacy of therapeutic compositions containing phobic interaction chromatographic (HIC) medium or an US 2016/0040215 A1 Feb. 11, 2016 affinity chromatographic medium. In an alternative embodi tency of the spores. In other preferred embodiments, the ment, a Solid medium capable of absorbing a residual habitat temperature and duration of the thermal treatment is short product present in the fecal material is contacted with a solid enough to reduce the germination of the spore population. medium that adsorbs a residual habitat product. In certain 0111 Irradiation Treatments embodiments, the HIC medium contains Sepharose or a 0112 Provided are methods of treating the fecal material derivatized Sepharose Such as butyl Sepharose, octyl or separated contents of the fecal material with ionizing radia Sepharose, phenyl Sepharose, or butyl-S Sepharose. In other tion, typically gamma irradiation, ultraviolet irradiation or embodiments, the affinity chromatographic medium contains electron beam irradiation provided at an energy level suffi material derivatized with mucin type I, II, III, IV, V, or VI, or cient to kill pathogenic materials while not substantially dam oligosaccharides derived from or similar to those of mucins aging the desired spore populations. For example, ultraviolet type I, II, III, IV, V, or VI. Alternatively, the affinity chromato radiation at 254 nm provided at an energy level below about graphic medium contains material derivatized with antibod 22,000 microwatt seconds per cm2 will not generally destroy ies that recognize spore-forming bacteria. desired spores. 01.07 Mechanical Treatments 0113 Centrifugation and Density Separation Treatments 0108 Provided herein is the physical disruption of the 0114 Provided are methods of separating desired spore fecal material, particularly by one or more mechanical treat populations from the other components of the fecal material ment Such as blending, mixing, shaking, Vortexing, impact by centrifugation. A solution containing the fecal material is pulverization, and Sonication. As provided herein, the Subjected to one or more centrifugation treatments, e.g., at mechanical disrupting treatment Substantially disrupts a non about 200xg, 1000xg, 2000xg, 3000xg, 4000xg, 5000xg, spore material present in the fecal material and does not 6000xg, 7000xg,8000xgorgreater than 8000xg. Differential Substantially disrupt a spore present in the fecal material, or it centrifugation separates desired spores from undesired non may disrupt the spore material less than the non-spore mate spore material; at low forces the spores are retained in solu rial, e.g. 2-fold less, 5-, 10-, 30-, 100-, 300-, 1000- or greater tion, while at higher forces the spores are pelleted while than 1000-fold less. Furthermore, mechanical treatment Smaller impurities (e.g., virus particles, phage, microscopic homogenizes the material for Subsequent sampling, testing, fibers, biological macromolecules such as free protein, and processing. Mechanical treatments optionally include nucleic acids and lipids) are retained in Solution. For example, filtration treatments, where the desired spore populations are a first low force centrifugation pellets fibrous materials; a retained on a filter while the undesirable (non-spore) fecal second, higher force centrifugation pellets undesired eukary components to pass through, and the spore fraction is then otic cells, and a third, still higher force centrifugation pellets recovered from the filter medium. Alternatively, undesirable the desired spores while Smaller contaminants remain in Sus particulates and eukaryotic cells may be retained on a filter pension. In some embodiments density or mobility gradients while bacterial cells including spores pass through. In some or cushions (e.g., step cushions). Such as CsCl, Percoll, Ficoll, embodiments the spore fraction retained on the filter medium NycodenZ. Histodenz or Sucrose gradients, are used to sepa is subjected to a diafiltration step, wherein the retained spores rate desired spore populations from other materials in the are contacted with a wash liquid, typically a sterile Saline fecal material. containing Solution or other diluent such as a water compat 0115 Also provided herein are methods of producing ible polymer including a low-molecular polyethylene glycol spore populations that combine two or more of the treatments (PEG) solution, in order to further reduce or remove the described herein in order to synergistically purify the desired undesirable fecal components. spores while killing or removing undesired materials and/or 0109. Thermal Treatments activities from the spore population. It is generally desirable 0110 Provided herein is the thermal disruption of the fecal to retain the spore populations under non-germinating and material. Generally, the fecal material is mixed in a saline non-growth promoting conditions and media, in order to containing solution such as phosphate-buffered saline (PBS) minimize the growth of pathogenic bacteria present in the and Subjected to a heated environment, Such as a warm room, spore populations and to minimize the germination of spores incubator, water-bath, or the like, such that efficient heat into vegetative bacterial cells. transfer occurs between the heated environment and the fecal 0116 Purified Spore Populations material. Preferably the fecal material solution is mixed dur 0117. As described herein, purified spore populations con ing the incubation to enhance thermal conductivity and dis tain combinations of commensal bacteria of the human gut rupt particulate aggregates. Thermal treatments can be modu microbiota with the capacity to meaningfully provide func lated by the temperature of the environment and/or the tions of a healthy microbiota when administered to a mam duration of the thermal treatment. For example, the fecal malian subject. Without being limited to a specific mecha material or a liquid comprising the fecal material is subjected nism, it is thought that such compositions inhibit the growth to a heated environment, e.g., a hot water bath of at least about of a pathogen Such as C. difficile, Salmonella spp., entero 20, 25, 30,35, 40, 45,50,55,60, 65,70, 75,80, 85,90,95, 100 pathogenic E. coli, Fusobacterium spp., Klebsiella spp. and or greater than 100 degrees Celsius, for at least about 1, 5, 10. Vancomycin-resistant Enterococcus spp., so that a healthy, 15, 20, 30, 45 seconds, or 1,2,3,4,5,6,7,8,9, 10, 15, 20, 25, diverse and protective microbiota can be maintained or, in the 30, 40, or 50 minutes, or 1,2,3,4,5,6,7,8,9, 10 or more than case of pathogenic bacterial infections such as C. difficile 10 hours. In certain embodiments the thermal treatment infection, repopulate the intestinal lumen to reestablish eco occurs at two different temperatures, such as 30 seconds in a logical control over potential pathogens. In one embodiment, 100 degree Celsius environment followed by 10 minutes in a the purified spore populations can engraft in the host and 50 degree Celsius environment. In preferred embodiments remain present for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, the temperature and duration of the thermal treatment are 7 days, 10 days, 14 days, 21 days, 25 days, 30 days, 60 days, sufficient to kill or remove pathogenic materials while not 90 days, or longer than 90 days. Additionally, the purified Substantially damaging or reducing the germination-compe spore populations can induce other healthy commensal bac US 2016/0040215 A1 Feb. 11, 2016
teria found in a healthy gut to engraft in the host that are not from a fecal material treated as described herein or otherwise present in the purified spore populations or present at lesser known in the art. In alternative embodiments, one or more levels and therefore these species are considered to “aug than one bacterial spores or types of bacterial spores are ment the delivered spore populations. In this manner, com generated in culture and combined to form a purified spore mensal species augmentation of the purified spore population population. In other alternative embodiments, one or more of in the recipient's gut leads to a more diverse population of gut these culture-generated spore populations are combined with microbiota then present initially. a fecal material-derived spore population to generate a hybrid 0118 Preferred bacterial genera include Acetanaerobac spore population. Bacterial compositions may contain at least terium, Acetivibrio, Alicyclobacillus, Alkaliphilus, Anaero two types of these preferred bacteria, including strains of the fiastis, Anaerosporobacter, Anaerostipes, Anaerotruncus, same species. For instance, a bacterial composition may com Anoxybacillus, Bacillus, Bacteroides, Blautia, Brachyspira, prise at least 2, at least 3, at least 4, at least 5, at least 6, at least Brevibacillus, Bryantella, Bulleidia, Butyricicoccus, Butyr 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least ivibrio, Catenibacterium, Chlamydiales, Clostridiaceae, 13, at least 14, at least 15, at least 16, at least 17, at least 18, Clostridiales, Clostridium, Collinsella, Coprobacillus, at least 19, or at least 20 or more than 20 types of bacteria, as Coprococcus, Coxiella, Deferribacteres, Desulfitobacte defined by species or operational taxonomic unit (OTU) rium, Desulfotomaculum, Dorea, Eggerthella, Erysipelo encompassing such species. thrix, Erysipelotrichaceae, Ethanoligenens, Eubacterium, I0123 Thus, provided herein are methods for production of Faecalibacterium, Filifactor, Flavonifactor, Flexistipes, a composition containing a population of bacterial spores Fulvimonas, Fusobacterium, Gemmiger, Geobacillus, Suitable for therapeutic administration to a mammalian Sub Gloeobacter; Holdemania, Hydrogenoanaerobacterium, ject in need thereof. And the composition is produced by Kocuria, Lachnobacterium, Lachnospira, Lachnospiraceae, generally following the steps of: (a) providing a fecal material Lactobacillus, Lactonifactor, Leptospira, Lutispora, Lysini obtained from a mammalian donor Subject; and (b) Subjecting bacillus, Mollicutes, Moorella, Nocardia, Oscillibacter, the fecal material to at least one purification treatment or step Oscillospira, Paenibacillus, Papillibacter, Pseudoflavoni under conditions such that a population of bacterial spores is fractor; Robinsoniella, Roseburia, Ruminococcaceae, Rumi produced from the fecal material. The composition is formu nococcus, Saccharomonospora, Sarcina, Solobacterium, lated Such that a single oral dose contains at least about 1x104 Sporobacter; Sporolactobacillus, Streptomyces, Subdo colony forming units of the bacterial spores, and a single oral ligranulum, Sutterella, Syntrophococcus, Thermoanaero dose will typically contain about 1x104, 1x105, 1x106, bacter. Thermobifida, Turicibacter 1x107, 1x108, 1x109, 1x1010, 1x1011, 1x1012, 1x1013, 0119 Preferred bacterial species are provided at Table 1 1x1014, 1x1015, or greater than 1x1015 CFUs of the bacte and demarcated as spore formers. Where specific strains of a rial spores. The presence and/or concentration of a given type species are provided, one of skill in the art will recognize that of bacterial spore may be known or unknown in a given other strains of the species can be substituted for the named purified spore population. If known, for example the concen strain. tration of spores of a given strain, or the aggregate of all 0120 In some embodiments, spore-forming bacteria are strains, is e.g., 1x104, 1x105, 1x106, 1x107, 1x108, 1x109, identified by the presence of nucleic acid sequences that 1x1010, 1x1011, 1x1012, 1x1013, 1x1014, 1x1015, or modulate sporulation. In particular, signature sporulation greater than 1x1015 viable bacterial spores per gram of com genes are highly conserved across members of distantly position or per administered dose. related genera including Clostridium and Bacillus. Tradi 0.124. In some formulations, the composition contains at tional approaches of forward genetics have identified many, if least about 0.5%, 1%, 2%. 5%, 10%, 20%, 30%, 40%, 50%, not all, genes that are essential for sporulation (spo). The 60%, 70%, 80%, 90% or greater than 90% spores on a mass developmental program of sporulation is governed in part by basis. In some formulations, the administered dose does not the Successive action of four compartment-specific sigma exceed 200, 300, 400, 500, 600, 700, 800, 900 milligrams or factors (appearing in the order OF, OE, OG and OK), whose 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 grams in mass. activities are confined to the forespore (OF and OG) or the 0.125. The bacterial spore compositions are generally for mother cell (OE and OK). In other embodiments, spore-form mulated for oral orgastric administration, typically to a mam ing bacteria are identified by the biochemical activity of DPA malian Subject. In particularembodiments, the composition is producing enzymes or by analyzing DPA content of cultures. formulated for oral administration as a solid, semi-solid, gel. As part of the bacterial sporulation, large amounts of DPA are or liquid form, such as in the form of a pill, tablet, capsule, or produced, and comprise 5-15% of the mass of a spore. lozenge. In some embodiments, such formulations contain or Because not all viable spores germinate and grow under are coated by an enteric coating to protect the bacteria through known media conditions, it is difficult to assess a total spore the stomach and Small intestine, although spores are generally count in a population of bacteria. As such, a measurement of resistant to the stomach and Small intestines. In other embodi DPA content highly correlates with spore content and is an ments, the bacterial spore compositions may be formulated appropriate measure for characterizing total spore content in with a germinant to enhance engraftment, or efficacy. In yet a bacterial population. other embodiments, the bacterial spore compositions may be 0121 Provided are spore populations containing more co-formulated or co-administered with prebiotic Substances, than one type of bacterium. As used herein, a “type' or more to enhance engraftment or efficacy. than one “types of bacteria may be differentiated at the genus 0.126 The bacterial spore compositions may be formu level, the species, level, the sub-species level, the strain level lated to be effective in a given mammalian Subject in a single or by any other taxonomic method, as described herein and administration or over multiple administrations. For example, otherwise known in the art. a single administration is substantially effective to reduce Cl. 0122. In some embodiments all or essentially all of the difficile and/or Cl. difficile toxin content in a mammalian bacterial spores present in a purified population are obtained Subject to whom the composition is administered. US 2016/0040215 A1 Feb. 11, 2016 14
0127 Substantially effective means that Cl. difficile and/or ing materials can be detected and, optionally, quantified. In Cl. difficile toxin content in the subject is reduced by at least embodiments of the invention, contaminating bacterial 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, strains presentata ratio of about 10, 10, 107, 10, 10, 98%, 99% or greater than 99% following administration of 10', or below 10' compared to the non-contaminating the composition. Alternatively, efficacy may be measured by strains. In some embodiments, the undesired bacteria are the absence of diarrheal symptoms or the absence of carriage enriched from a bacterial composition prior to performing of C. difficile or C. difficile toxin after 2 day, 4 days, 1 week, one or more detection steps on the composition, as provided 2 weeks, 4 weeks, 8 weeks or longer than 8 weeks. herein. Multiple methods of enrichment and detection are 0128 Microbial Compositions Described by Operational provided, and one of skill in the art would recognize that one Taxonomic Unit (OTU) or more enrichment steps can be combined with one or more 0129. A microbial composition may be prepared compris detection steps. Additionally, the methods of enrichment and/ ing at least two types of isolated bacteria, wherein a first type or detection may be repeated one or more times for the same is a first OTU comprising a bacterial species herein, and the undesired bacterial strain or to address multiple undesired second type is a second OTU characterized by, i.e., at least bacterial strains (e.g., one configuration of enrichment steps 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or and detection steps may be performed for the detection of including 100% sequence identity to the first OTU. Alterna anaerobic contaminants whereas another configuration may tively, the first and second type of OTU may share less than be performed for the detection of aerobic contaminants). 93% sequence identity. In some embodiments, two types of I0135) In a first method, an enrichment step may be carried bacteria are provided in a composition, and the first bacteria out as follows: an antibody or other protein, lectin or other and the second bacteria are not the same OTU. ligand (such as a DNA or RNA aptamer) specific for each of 0130. A microbial composition may be prepared compris the desired bacterial strains (i.e., the strains intended to be ing at least an isolated bacteria, wherein a first type is a first present in the microbial composition) can be attached to a OTU comprising a bacterial species herein, and the second solid support and used to selectively bind to or remove the type is a second OTU characterized by, i.e., at least 93%, 94%, product strains. The selective removal process may be con 95%, 96%, 97%, 98%, 99%, 99.9%, 99.99% or including ducted in: a batch mode, whereby the bacterial composition is 100% sequence identity to the first OTU. In some embodi contacted with the solid support material to which the anti ments, two types of bacteria are provided in a composition, bodies are bound. After an appropriate incubation period, the and the first bacteria and the second bacteria are not the same Solid Support is removed by filtration, centrifugation or any OTU other method of separation to selectively remove the bound 0131 Genetic similarity among OTUs is determined by product strains and selectively enrich for the contaminants in comparison of one or more nucleic acid sequences represent the supernatant that is left behind; or a flow mode, whereby ing a given OTU with nucleic acid sequences representing the bacterial composition is flowed over the solid support to other OTUs. OTUs are defined and compared using both which the antibody is bound, with the contaminants being sequence similarity and position in phylogenetic tree. A phy selectively enriched in the eluate. In an alternative embodi logenetic tree refers to a graphical representation of the evo ment a spore fraction can be selectively enriched or removed lutionary relationships of one genetic sequence to another from a microbial mixture by using a chromatographic sepa that is generated using a defined set of phylogenetic recon ration based on hydrophobic interactions. This can be per struction algorithms (e.g. parsimony, maximum likelihood, formed in batch mode or flow mode. In yet another alternative or Bayesian). Nodes in the tree represent distinct ancestral embodiment, the antibody may selectively bind to the sus sequences and the confidence of any node is provided by a pected contaminant, with Subsequent filtration, centrifuga bootstrap or Bayesian posterior probability, which is a mea tion or separation designed to enrich the solid Support from sure of branch uncertainty. OTUs are terminal leaves in a which the contaminant can be detected by methods described phylogenetic tree (i.e. branch end points) and are defined by below. a specific genetic sequence and all sequences that share 0.136. In a second method, an enrichment step may be sequence identity to this sequence at the level of species. The carried out as follows: adding to the bacterial composition an specific genetic sequence may be the 16S sequence, portion antibody specific for each desired bacterial strain, followed of the 16S sequence, full genome sequence, or some portion by the addition of serum complement to selectively kill or of the full genome sequence. OTUs share at least 95%, 96%, inactivate the desired bacterial Strains, thus enriching the 97%, 98%, or 99% sequence identity. OTUs are frequently undesired bacterial strains. In this method, it is important to defined by comparing sequences between organisms. select an antibody whose Fc region is capable of being rec Sequences with less than 95% sequence identity are not con ognized by complement when bound to its target. Thus, IgM sidered to form part of the same OTU. Further, genetic would be particularly useful, as would any other IgG subtype sequences representing a single OTU will form a monophyl that is capable of being recognized by activated complement, etic clade (i.e. set of sequences all originating from a single but an IgG4 Subtype antibody would not generally be appro node in the tree). priate. The method provides for altering parameters of the 0132) Detection of Pathogens or Undesired Contaminants method based on the number of bacteria in the bacterial 0133 A. Enrichment of Undesired Bacterial Strains and/ composition, e.g., antibody concentration, ionic strength, or Pathogens in Bacterial Compositions serum complement concentration and temperature, in order 0134. The methods of the invention provide mechanisms to maximize the killing of the desired bacterial strains and the by which contaminating bacterial strains (herein “undesired enrichment of viable contaminants. bacteria' or “undesired bacterial strains') or other pathogens 0.137 In a third method, a conjugated antibody may be or contaminating materials such as yeast, viruses including used in a homogenous format to bind to and inactivate the phage, or eukaryotic parasites, present at very low levels in a desired bacterial strains. In particular, the use of antibodies therapeutic bacterial composition or other bacteria-contain conjugated to toxins is a means of localizing the toxin activity US 2016/0040215 A1 Feb. 11, 2016
in the region of the bacteria that one desires to deplete. Many <2022>), and in Wadsworth-KTL Anaerobic Bacteriology forms of toxins can be envisioned. For instance, the antibody Manual (Star Publishing Company, 6th Edition), Manual of can be covalently paired with an enzyme that converts a Clinical Microbiology (ASM Press, 10th Edition). By way of non-toxic Substrate into a toxin, which then acts locally. The non-limiting example, undesired microbes include conjugate may be toxic itselfor it may be hydrolyzed from the Pseudomonas aeruginosa, Salmonella spp., Candida albi antibody to yield a toxic product. The toxin may be a photo cans, Klebsiella pneumoniae, Aspergillus brasiliensis, Sta activatable agent, Such as a porphyrin derivative, that forms phylococcus aureus, Clostridium sporogenes, Clostridium activated singlet oxygen species in the presence of an appro difficile, E. coli spp., and Bacillus subtilis, and combinations priate wavelength of light. The enzymatic and photosensitizer thereof. Such selective media and their combinations may be approaches have the advantage of temporal separation used to selectively detect contamination with undesired between the antibody binding event and the toxin activation pathogens and microbes. Media may be validated to detect event. Thus, excess free antibody or antibody that is non pathogenic bacteria by testing using model organisms that specifically adsorbed to contaminants can be removed by mimic undesired bacteria. washing before activating the toxin. In the case of using a 0.141. In a seventh method, mixed populations may be photosensitizer, the wavelength of light is chosen Such that enriched by depletion of classes of microbes that are ame the light by itself has no effect on bacterial viability. nable to separations, or sensitive to treatments. As an 0.138. In a fourth method, biological means are provided example, bacteria of different sizes or morphologies may be for selectively enriching for the contaminant (or a product of Sorted from others by flow cytometry using light scattering the contaminant). For example, bacterial viruses (or phage) properties or sorting in a flow cytometer after binding of can be identified that have exquisite sensitivity for replicating fluorescently labeled antibodies using distinct fluorophores, in bacteria of a specific genus, species or Strain. Thus, phage or imaged via microscopy and destroyed in situ (see e.g.— may be selected that are specific to the product strains but do Cytometry Part A, 61A:153-161, 2004). Antibiotic treat not replicate in the undesired bacterial strain(s). For instance, ments and their combinations can selectively deplete major phage that replicate in and lyse Bacteroides vulgatus would populations, for example gram negative desired strains can be not have the same effect on Salmonella contaminants. Thus, depleted by certain aminoglycoside antibiotics to enrich for an appropriately selected population of bacteriophage could gram positive contaminants. Contact with bacteriocins, may be used to selectively enrich the undesired bacterial strains by also be used for selective depletion of populations (e.g. killing or lysing the desired bacterial strains. Another method colicins against E. coli). employing phage is to selectively enrich the contaminants (or 0142. In an eighth method, elements of the innate immune a product of the contaminants) by using phage that grow in an system such as pattern recognition receptors may be used to undesired bacterial species. Thus, a coliphage could be added recognize and selectively trap and thus enrich contaminating to a mixed bacterial product (i.e., a product known or believed populations, e.g. mannose binding lectin to bind yeast and to contain one or more undesired bacterial strains) that is not other cells, L-ficolin to trap gram positive cells. Enzymatic itself intended to have a coliform bacterium. If the E. coli treatment of the sample to enhance binding of the target were present as a contaminant, the phage would bind to and population, e.g. treatment with sialidase to enhance binding replicate in these contaminating organisms. The phage itself to asialoglycoprotein receptor, may be performed to enhance is amplified through this procedure and the amplification binding and depletion/enrichment of populations. Recogni product could be detected in a Subsequent step. tion and depletion strategies may be combined with selective 0.139. In a fifth method, bacteriophage can be introduced killing methods such as combination of mannose binding into a population to induce growth of one or more specified lectin with complement. host undesired bacteria. In specific embodiments, phage are 0143. In a ninth method, nucleic acid sequences, e.g., engineered to target one or more than one undesired bacteria, sequences representative of undesired bacterial strains, are and to control the rate of growth of the host bacteria. enriched, using methods known in the art. For example, 0140. In a sixth method, selective culture conditions can nucleic acid probes may be utilized to selectively deplete the be employed to address mixed populations of aerobic and sequence of the desired bacterial Strains, thus enriching the anaerobic bacteria. For example, the mixed population is nucleic acid sequences of the undesired bacterial strains. As selectively cultured under or exposed to aerobic conditions. an example, hybrid selection using nucleic acid mixtures Resulting from this, obligate anaerobes will be killed over a comprised of DNA, cDNA and/or RNA from a bacterial period of time dependent on their oxygen sensitivity. For culture or clinical patient infected with the bacterial strain of example, ifin a mixed population containing desired bacterial interest can be used to selectively enrich, or deplete a target as strains and undesired bacterial Strains, 4 of 5 strains present appropriate. (See, e.g., Melnikov et al., 2011. Genome Biol are anaerobes, this aerobic cultivation step selectively elimi ogy, 12:R73). In another embodiment, depletion may target nates the viable anaerobes. As a result, the remaining con nucleic acids known to be in the sample at high concentra taminant is detected as one would for a non-mixed bacterial tions. As a non-limiting example, tRNAS in a sample are product containing one desired bacterium and potential non derived from a mammalian Subject could be viewed as con product contaminants. Optionally, aerobic exposure is fol taminating nucleic acid sequences in a nucleic acid prepara lowed by one or more selective growth conditions (e.g., tion searching for pathogenic species including but not lim selecting against the growth of the remaining aerobic organ ited to bacterial 16S sequences, antibiotic resistance genes, ism) to selectively grow the undesired bacteria. It is then pathogenic island sequences, toxin genes or other pathoge straightforward to define one or more selective media, and netic nucleic acid signatures known to one skilled in the art each of these are utilized separately to detect the presence of (e.g. see Hacker etal Pathogenicity islands of virulent bacte undesired bacterial strains. Examples of selective media are ria: structure, function and impact on microbial evolution. given in the United States Pharmacopeia (USP) Chapters 61, Mol Microbiology 23(6): 1089-1097. 1997). In order to 62, 2021 and 2022 (herein USP <61>, <62>, <2021 >, and obtain nucleic acid sequences of interest, all bacteria in a US 2016/0040215 A1 Feb. 11, 2016
bacterial composition are lysed, e.g., through a combination viruses, and fungi, or more than two classes, are simulta of heat, detergent, enzymatic digestion and/or alkaline pH, neously or sequentially determined in a composition. followed by steps to purify the total DNA or RNA from other 0147 Sensitivity of Detection macromolecules. To obtain RNA, cDNA is amplified using 0.148. In some embodiments provided are methods that methods known in the art, and the DNA and/or cDNA is then comprise one or more steps of detecting, or attempting to Subjected to shearing or enzymatic digestion to fragments of detect, an undesired entity in a material. In some embodi appropriate size, in the range of 1000-10,000 base pairs on ments, these detection steps individually have a sensitivity for average. The DNA is denatured by transiently heating. To this the undesired entity of at least about 1x10°, such as 1x10, denatured DNA mixture, a variety of DNA captures probes 1x10, 1x10, 1x10, or greater than 1x10'. When more than are added (alternatively the probes are added prior to heating). one detection step is employed, the combination of two or These capture probes are designed to bind to known more detection steps provides a combined sensitivity for the sequences on both Strands of the genes of the desiredbacterial undesired entity of at least about 1x10, such as 1x10, strains. Furthermore, the capture probes are tagged (e.g.— 1x10, 1x10, 1x10, 1x10, 1x10, 1x10', 1x10'', or biotinylated), typically on a 5' or 3' end. After an appropriate greater than 1x10'. incubation period to form duplexes between the capture 0149. In other embodiments, the detection steps individu probes and target sequences, the mixture is incubated with a ally have a sensitivity to detect the undesired entity at a Solid matrix to which a tag-binding component (e.g. Strepta concentration below that concentration required to detect the vidin or any other biotin-binding reagent) is attached. Mul desired entity. For example, one detection step, or a combi tiple different incubation periods and annealing temperature nation of two or more detection steps, has the sensitivity to profiles may be used during the annealing process to selec detect the undesired entity, if present in the material, at a tively capture nucleic acid fragments harboring specific char concentration below about 1x10° the concentration of the acteristics. The tag-binding matrix selectively binds to the desired entity, such as below about 1x10, 1x10, 1x10, target DNA sequence and removes it from solution. The 1x10, 1x107, 1x10, or below about 1x10 the concen matrix is removed through a number of means including tration of the desired entity. filtration or centrifugation. The remaining DNA sequences 0150 Polymerase chain reaction (PCR), culture and are significantly enriched in contaminant sequences. This colony counting methods, immunology-based methods and procedure may be carried out multiple times in series to biosensor methods are useful detection steps for detection of achieve successive enrichment of contaminant DNA. By way pathogen or other undesired biological entities as described of non-limiting example, an enrichment using 16S rDNA herein. Such detection steps can be performed individually, sequences from the desired bacterial strains enriches for the combinatorially, serially, or sequentially. Such detection 16S sequences of contaminating undesired bacterial strains. steps require amplified DNA, RNA, cDNA analysis; counting The resulting enriched mixture may then be evaluated by 16S of bacteria; antigen-antibody interactions; and detection of rDNA deep sequencing to detect the contaminant 16S biological recognition elements (e.g., enzymes, antibodies sequences. Similarly, one may select capture probes that and nucleic acids), respectively. selectively target any other region of the product strain 0151 Polymerase chain reaction. PCR is a nucleic acid genome. An additional example includes the use of CRISPRs amplification technology based on the isolation, amplifica (clustered regularly interspaced short palindromic repeats) to tion and quantification of one or more DNA sequences selectively enrich for specific bacterial targets or classes of including the undesired bacteria's genetic material. bacteria. Examples of different PCR methods developed for bacterial 0144. In a tenth method, one can selectively amplify the detection are: (i) real-time PCR, (ii) multiplex PCR and (iii) nucleic acids in the sample, either as a stand-alone process or reverse transcriptase PCR (RT-PCR). There are also methods after using any of the enrichment methods described herein. coupling PCR to other techniques. Multiplex PCR is very Amplification may involve polymerase chain reaction (PCR) useful as it allows the simultaneous detection of several or related methods using degenerate primers for highly con undesired bacteria by introducing different primers to served genes, targeted primers for specific genes known to be amplify DNA regions coding for specific genes of each harbored by contaminants of interest, or linker ligation strat undesiredbacteria or bacterial strain. One of the limitations of egies for non-specific amplification of all the (remaining) PCR is that the user cannot discriminate between viable and genomes in a sample. An example using degenerate primers non-viable undesired bacteria because DNA is generally would be the set of primers used for 16S rDNA sequencing of present regardless of the viability of the undesired bacteria. microbial specimens—using this method after one or more of Reverse transcriptase PCR (RT-PCR) was developed may be the enrichment steps above will selectively amplify contami adapted in order to preferentially detect viable cells. PCR nant rNA sequences. Nucleic acid sequences can be may also be augmented by additional technologies and tech detected by sequencing, hybridization to targets, restriction niques such as “the most probable number counting method fragment polymorphism or any method for identifying a (MPN-PCR), surface plasmon resonance and PCR-acoustic nucleic acid molecule. wave sensors, LightCycler real-time PCR (LC-PCR) and PCR-enzyme-linked immunosorbent assay (PCR-ELISA), a (0145 B. Detection in Microbial Compositions. sandwich hybridization assay (SHA) or FISH (fluorescence 0146 The methods described herein are useful for detect in situ hybridization) detection, and digital color-coded bar ing one or more species, strains, or other related group of code technologies. pathogenic or otherwise undesired (i.e., contaminating) 0152 Culture and Colony Counting Methods microbes. Additionally multiple classes of undesired entities 0153. The culturing and plating method is generally cited can be simultaneously detected in a material Such as a thera as a standard detection method. Generally, selective and/or peutic bacterial composition. For example, the presence of differential media are used to detect particular undesired bac any two classes of pathogens including pathogenic bacteria, teria species or strains. The selective media may contain US 2016/0040215 A1 Feb. 11, 2016 inhibitors (in order to stop or delay the growth of strains other man and Company, 1993); A. L. Lehninger, Biochemistry than undesired bacterial strains) or particular Substrates that (Worth Publishers, Inc., current addition); Sambrook, et al., only the undesired bacteria can degrade or that confers a Molecular Cloning. A Laboratory Manual (2nd Edition, particular color to the growing colonies. The selective media 1989); Methods In Enzymology (S. Colowick and N. Kaplan may contain inhibitors (for example, antibiotics or bile salts) eds. Academic Press, Inc.); Remington's Pharmaceutical that to prevent or delay the growth of certain species, Sub Sciences, 18th Edition (Easton, Pa.; Mack Publishing Com strates that allow growth of only certain organisms (for pany, 1990); Carey and Sundberg Advanced Organic Chem example, cellibiose as the key carbon Source such that only istry 3" Ed. (Plenum Press) Vols A and B (1992). cellibiose-utilizing species can grow), and/or particular Sub strates that yield differential colony morphologies (for Example 1 example, only the undesired bacteria can degrade a substrate which confers a particular color to the growing colonies). Species Identification Detection is then carried out using optical methods, mainly by 0162 The identity of the bacterial species which grew up ocular inspection or the use of automated colony counters, from a complex fraction can be determined in multiple ways. Sometimes in combination with image analysis, e.g., to iden First, individual colonies can be picked into liquid media in a tify particular colony morphologies, and color-coded barcode 96 well format, grown up and saved as 15% glycerol stocks at technologies. -80°C. Aliquots of the cultures can be placed into cell lysis 0154 Immunology-Based Methods buffer and colony PCR methods can be used to amplify and 0155 The field of immunology-based methods for undes sequence the 16S rDNA gene (Example 3). Alternatively, ired bacteria detection provides analytical tools for a wide colonies may be streaked to purity in several passages on Solid range of targets. For example, immunomagnetic separation media. Well separated colonies are streaked onto the fresh (IMS) can be used to capture and extract the undesired bac plates of the same kind and incubated for 48-72 hours at 37° terial strain from the therapeutic composition by introducing C. The process is repeated multiple times in order to ensure antibody coated magnetic beads. IMS is useful in combina purity. Pure cultures can be analyzed by phenotypic- or tion with almost any detection method, e.g., optical, magnetic sequence-based methods, including 16S rDNA amplification force microscopy, magnetoresistance and Hall effect. Other and sequencing as described in Examples 3 & 4. Sequence detection methods are based on immunological techniques, characterization of pure isolates or mixed communities e.g. e.g., the enzyme-linked immunosorbent assay (ELISA). plate scrapes and spore fractions can also include whole 0156 Biosensor-Based Methods in Pathogenic Bacteria genome shotgun sequencing. The latter is valuable to deter or Other Contaminating Material Detection mine the presence of genes associated with sporulation, anti 0157 Biosensors are analytical devices incorporating a biotic resistance, pathogenicity, and virulence. Colonies can biological material, a biologically derived material, or a bio also be scraped from plates en masse and sequenced using a mimic associated with or integrated within a physicochemi massively parallel sequencing method as described in cal transducer or transducing microSystem, Such as an optical, Examples 3 & 4 such that individual 16S signatures can be electrochemical, thermometric, piezoelectric, magnetic or identified in a complex mixture. Optionally, the sample can be micromechanical systems. There are four main classes of sequenced prior to germination (if appropriate DNA isolation biological recognition elements that are used in biosensor procedures are used to lsye and release the DNA from spores) applications: (i) enzymes, (ii) antibodies, (iii) nucleic acids, in order to compare the diversity of germinable species with and (iv) phage. the total number of species in a spore sample. As an alterna 0158. See, e.g., the following, which are incorporated by tive or complementary approach to 16S analysis, MALDI reference in their entireties. Abdel-Hamid, 1999. Biosens. TOF-mass spec can also be used for species identification (as Bioelectron. 14.309-316; Blais, 2004. Lett. Appl. Microbiol. reviewed in Anaerobe 22:123). Daly, 2004. J. Appl. Microbiol. 96.419–429: Fu, 2005. Int. J. Food Microbiol. 99,47-57: Higgins, 2003. Biosens. Bioelec Example 2 tron. 18, 1115-1123: Tims, 2003. J. Microbiol. Methods 55, 141-147: Radke, 2005. Biosens. Bioelectron. 20, 1662-1667. Microbiological Strain Identification Approaches 0159) Other embodiments will be apparent to those skilled 0163 Pure bacterial isolates can be identified using micro in the art from consideration of the specification and practice biological methods as described in Wadsworth-KTL Anaero of the embodiments. bic Microbiology Manual (Jousimies-Somer, et al 2002) and EXAMPLES The Manual of Clinical Microbiology (ASM Press, 10th Edi tion). These methods rely on phenotypes of strains and 0160 Below are examples of specific embodiments for include Gram-staining to confirm Gram positive or negative carrying out the present invention. The examples are offered staining behavior of the cell envelope, observance of colony for illustrative purposes only, and are not intended to limit the morphologies on Solid media, motility, cell morphology scope of the present invention in any way. Efforts have been observed microscopically at 60x or 100x magnification made to ensure accuracy with respect to numbers used (e.g., including the presence of bacterial endospores and flagella. amounts, temperatures, etc.), but some experimental error Biochemical tests that discriminate between genera and spe and deviation should, of course, be allowed for. cies are performed using appropriate selective and differen 0161 The practice of the present invention will employ, tial agars and/or commercially available kits for identification unless otherwise indicated, conventional methods of protein of Gram negative and Gram positive bacteria and yeast, for chemistry, biochemistry, recombinant DNA techniques and example, RapD tests (Remel) or API tests (bioMerieux). pharmacology, within the skill of the art. Such techniques are Similar identification tests can also be performed using explained fully in the literature. See, e.g., T. E. Creighton, instrumentation such as the Vitek 2 system (bioMerieux). Proteins: Structures and Molecular Properties (W.H. Free Phenotypic tests that discriminate between genera and spe US 2016/0040215 A1 Feb. 11, 2016
cies and strains (for example the ability to use various carbon 18S and 5.8S and 5.8S and 28S regions are removed by and nitrogen sources) can also be performed using growth and splicing and contain significant variation between species for metabolic activity detection methods, for example the Biolog barcoding purposes as previously described (Schoch et al Microbial identification microplates. The profile of short Nuclear ribosomal internal transcribed spacer (ITS) region as chain fatty acid production during fermentation of particular a universal DNA barcode marker for Fungi. PNAS 109:6241 carbon Sources are used as a way to discriminate between 6246. 2012). 18S rDNA is traditionally used for phylogenetic species (Wadsworth-KTL Anaerobic Microbiology Manual, reconstruction however the ITS can serve this function as it is Jousimies-Somer, et al 2002). MALDI-TOF-mass spectrom generally highly conserved but contains hyperVariable etry can also be used for species identification (as reviewed in regions that harbor sufficient nucleotide diversity to differen Anaerobe 22:123). tiate genera and species of most fungus. 0.168. Using well known techniques, in order to determine Example 3 the full 18S and ITS sequences or a smaller hypervariable section of these sequences, genomic DNA is extracted from a Sequence-Based Genomic Characterization of microbial sample, the rDNA amplified using polymerase Operational Taxonomic Units (OTU) and Functional chain reaction (PCR), the PCR products cleaned, and nucle Genes otide sequences delineated to determine the genetic compo sition rDNA gene or Subdomain of the gene. The sequencing Method for Determining 16S rDNA Gene Sequence method used may be, but is not limited to, Sanger sequencing 0164 OTUs are defined either by full 16S sequencing of or using a next-generation sequencing method. Such as an the rRNA gene, by sequencing of a specific hyperVariable Illumina (sequencing by synthesis) method using barcoded region of this gene (i.e. V1,V2, V3, V4, V5, V6, V7, V8, or primers allowing for multiplex reactions. V9), or by sequencing of any combination of hyperVariable (0169 Method for Determining Other Marker Gene regions from this gene (e.g. V1-3 or V3-5). The bacterial 16S Sequences rRNA gene is approximately 1500 nucleotides in length and 0170 In addition to the 16S and 18S rRNA gene, one may is used in reconstructing the evolutionary relationships and define an OTU by sequencing a selected set of genes that are sequence similarity of one bacterial isolate to another using known to be marker genes for a given species or taxonomic phylogenetic approaches. 16S sequences are used for phylo group of OTUS. These genes may alternatively be assayed genetic reconstruction as they are in general highly con using a PCR-based screening strategy. As example, various served, but contain specific hypervariable regions that harbor strains of pathogenic Escherichia coli can be distinguished sufficient nucleotide diversity to differentiate genera and spe using DNAs from the genes that encode heat-labile (LTI, cies of most microbes. rRNA gene sequencing methods are LTIIa, and LTIIb) and heat-stable (STI and STII) toxins, applicable to both the analysis of non-enriched samples, but verotoxin types 1, 2, and 2e (VT1, VT2, and VT2e, respec also for identification of microbes after enrichment steps that tively), cytotoxic necrotizing factors (CNF 1 and CNF2). either enrich the microbes of interest from the microbial attaching and effacing mechanisms (eaeA), enteroaggrega composition and/or the nucleic acids that harbor the appro tive mechanisms (Eagg), and enteroinvasive mechanisms priate rDNA gene sequences as described below. For (Einv). The optimal genes to utilize for taxonomic assignment example, enrichment treatments prior to 16S rDNA gene of OTUs by use of marker genes are familiar to one with characterization will increase the sensitivity of 16S as well as ordinary skill of the art of sequence based taxonomic identi other molecular-based characterization nucleic acid purified fication. from the microbes. (0171 Genomic DNA Extraction 0.165. Using well known techniques to determine the full 0172 Genomic DNA is extracted from pure microbial 16S sequence or the sequence of any hyperVariable region of cultures using a hot alkaline lysis method. 1 ul of microbial the 16S rRNA sequence, genomic DNA was extracted from a culture is added to 9 ul of Lysis Buffer (25 mM NaOH, 0.2 bacterial sample, the 16S rDNA (full region or specific hyper mM EDTA) and the mixture is incubated at 95° C. for 30 variable regions) amplified using polymerase chain reaction minutes. Subsequently, the samples are cooled to 4°C. and (PCR), the PCR products cleaned, and nucleotide sequences neutralized by the addition of 10 ul of Neutralization Buffer delineated to determine the genetic composition of 16S gene (40 mM Tris-HCl) and then diluted 10-fold in Elution Buffer or Subdomain of the gene. If full 16S sequencing is per (10 mM Tris-HCl). Alternatively, genomic DNA is extracted formed, the sequencing method used may be, but is not lim from pure microbial cultures using commercially available ited to, Sanger sequencing. If one or more hyperVariable kits such as the Mo Bio Ultraclean R. Microbial DNA Isola regions are used. Such as the V4 region, the sequencing may tion Kit (Mo Bio Laboratories, Carlsbad, Calif.) or by stan be, but is not limited to being, performed using the Sanger dard methods known to those skilled in the art. For fungal method or using a next-generation sequencing method. Such samples, DNA extraction can be performed by methods as an Illumina (sequencing by synthesis) method using bar described previously (US20120135127) for producing coded primers allowing for multiplex reactions. lysates from fungal fruiting bodies by mechanical grinding (0166 Method for Determining 18S rDNA and ITS Gene methods. Sequence 0173 Amplification of 16S Sequences for Downstream 0167 Methods to assign and identify fungal OTUs by Sanger Sequencing genetic means are accomplished by analyzing 18S sequences (0174) To amplify bacterial 16S rDNA (FIG. 1A), 2 ul of and the internal transcribed spacer (ITS). The rRNA of fungi extracted g|DNA is added to a 20 ul final volume PCR reac that forms the core of the ribosome is transcribed as a signal tion. For full-length 16 sequencing the PCR reaction also gene and consists of the 8S, 5.8S and 28S regions with ITS4 contains 1x HotMasterMix (SPRIME, Gaithersburg, Md.), and 5 between the 8S and 5.8S and 5.8S and 28S regions, 250 nM of 27f (AGRGTTTGATCMTGGCTCAG, IDT, Cor respectively. These two intercistronic segments between the alville, Iowa), and 250 nM of 1492r (TACGGYTACCTTGT US 2016/0040215 A1 Feb. 11, 2016
TAYGACTT, IDT, Coralville, Iowa), with PCR Water (Mo formed. Alternatively other universal bacterial primers or Bio Laboratories, Carlsbad, Calif.) for the balance of the thermostable polymerases known to those skilled in the art volume. Alternatively, other universal bacterial primers or are used to obtain different amplification and sequencing thermostable polymerases known to those skilled in the art error rates as well as results on alternative sequencing tech are used. For example primers are available to those skilled in nologies. the art for the sequencing of the the “V1-V9 regions of the 0180. The PCR amplification is performed on commer 16S rRNA (FIG. 1A). These regions refer to the first through cially available thermocyclers such as a BioRad MyCyclerTM ninth hypervariable regions of the 16S rRNA gene that are Thermal Cycler (BioRad, Hercules, Calif.). The reactions are used for genetic typing of bacterial samples. These regions in run at 94° C. for 3 minutes followed by 25 cycles of 94° C. for bacteria are defined by nucleotides 69-99, 137-242,433-497, 45 seconds, 50° C. for 1 minute, and 72° C. for 1 minute 30 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and seconds, followed by a 10 minute extension at 72° C. and a 1435-1465 respectively using numbering based on the E. coli indefinite hold at 4°C. Following PCR, gel electrophoresis of system of nomenclature. Brosius et al., Complete nucleotide a portion of the reaction products is used to confirm Success sequence of a 16S ribosomal RNA gene from Escherichia ful amplification of a ~1.5 kb product. PCR cleanup is per coli, PNAS 75(10):4801-4805 (1978). In some embodiments, formed as specified in the previous example. at least one of the V1,V2, V3, V4, V5, V6, V7, V8, and V9 0181 Sanger Sequencing of Target Amplicons from Pure regions are used to characterize an OTU. In one embodiment, Homogeneous Samples the V1,V2, and V3 regions are used to characterize an OTU. 0182 To detect nucleic acids for each sample, two In another embodiment, the V3, V4, and V5 regions are used sequencing reactions are performed to generate a forward and to characterize an OTU. In another embodiment, the V4 reverse sequencing read. For full-length 16S sequencing region is used to characterize an OTU. A person of ordinary primers 27f and 1492r are used. 40ng of ExoSap-IT-cleaned skill in the art can identify the specific hypervariable regions PCR products are mixed with 25 pmol of sequencing primer of a candidate 16S rRNA (in FIG. 1) by comparing the can and Mo Bio Molecular Biology Grade Water (Mo Bio Labo didate sequence in question to the reference sequence (FIG. ratories, Carlsbad, Calif.) to 15ul total volume. This reaction 2) and identifying the hyperVariable regions based on simi is Submitted to a commercial sequencing organization such as larity to the reference hypervariable regions. Genewiz (South Plainfield, N.J.) for Sanger sequencing. 0175 FIG. 1 shows the hypervariable regions mapped 0183 Amplication of 18S and ITS Regions for Down onto a 16S sequence and the sequence regions corresponding stream Sequencing to these sequences on a sequence map. 0184) To amplify the 18S or ITS regions, 2 uI, fungal 0176 The PCR is performed on commercially available DNA were amplified in a final volume of 30 ul, with 15 uL. thermocyclers such as a BioRad MyCyclerTM Thermal Cycler AmpliTaq Gold 360 Mastermix, PCR primers, and water. The (BioRad, Hercules, Calif.). The reactions are run at 94°C. for forward and reverse primers for PCR of the ITS region are 2 minutes followed by 30 cycles of 94° C. for 30 seconds, 51° 5'-TCCTCCGCTTATTGATATGC-3 and 5'-GGAAG C. for 30 seconds, and 68° C. for 1 minute 30 seconds, TAAAAGTCGTAACAAGG-3' and are added at 0.2 uM con followed by a 7 minute extension at 72° C. and an indefinite centration each. The forward and reverse primers for the 18s hold at 4°C. Following PCR, gel electrophoresis of a portion region are 5'-GTAGTCATATGCTTGTCTC-3' and 5'-CTTC of the reaction products is used to confirm Successful ampli CGTCAATTCCTTTAAG-3' and are added at 0.4 uM con fication of a ~ 1.5 kb product. centration each. PCR is performed with the following proto 0177. To remove nucleotides and oligonucleotides from col: 95 C for 10 min, 35 cycles of 95 C for 15 seconds, 52C the PCR products, 2 ul of HT ExoSap-IT (Affymetrix, Santa for 30 seconds, 72 C for 1.5s; and finally 72 C for 7 minutes Clara, Calif.) is added to 5ul of PCR product followed by a 15 followed by storage at 4 C. All forward primers contained the minute incubation at 37° C. and then a 15 minute inactivation M13F-20 sequencing primer, and reverse primers included at 80° C. the M13R-27 sequencing primer. PCR products (3 uL) were 0.178 Amplification of 16S Sequences for Downstream enzymatically cleaned before cycle sequencing with 1 uL. Characterization by Massively Parallel Sequencing Tech ExoSap-IT and 1 uL, Tris EDTA and incubated at 37°C. for nologies 20 min followed by 80° C. for 15 min. Cycle sequencing 0179 Amplification performed for downstream sequenc reactions contained 5uL, cleaned PCR product, 2 LL, BigDye ing by short read technologies such as Illumina require ampli Terminator v3.1 Ready Reaction Mix, 1 uL, 5x Sequencing fication using primers known to those skilled in the art that Buffer, 1.6 pmol of appropriate sequencing primers designed additionally include a sequence-based barcoded tag. As by one skilled in the art, and water in a final volume of 10 uL. example, to amplify the 16S hyperVariable region V4 region The standard cycle sequencing protocol is 27 cycles of 10s at of bacterial 16S rDNA, 2 ul of extracted gldNA is added to a 96° C., 5 s at 50° C., 4 min at 60° C., and hold at 4° C. 20 ul final volume PCR reaction. The PCR reaction also Sequencing cleaning is performed with the BigDye XTermi contains 1x HotMasterMix (5PRIME, Gaithersburg, Md.), nator Purification Kit as recommended by the manufacturer 200 nM of V4 515 fadapt (AATGATACGGCGACCAC for 10-uL volumes. The genetic sequence of the resulting 18S CGAGATCTACACTATGGTAATTGTGTGC and ITS sequences is performed using methods familiar to CAGCMGCCG CGGTAA, IDT, Coralville, Iowa), and 200 one with ordinary skill in the art using either Sanger sequenc nM of barcoded 806rbc (CAAGCAGAAGACGGCATAC ing technology or next-generation sequencing technologies GAGAT 12bpGolayBarcode AGTCAGTCAGCCGGACT such as but not limited to Illumina. ACHVGGGTWTCTAAT, IDT, Coralville, Iowa), with PCR 0185. Preparation of Extracted Nucleic Acids for Metage Water (MoBio Laboratories, Carlsbad, Calif.) for the balance nomic Characterization by Massively Parallel Sequencing of the volume. These primers incorporate barcoded adapters Technologies for Illumina sequencing by Synthesis. Optionally, identical 0186 Extracted nucleic acids (DNA or RNA) are purified replicate, triplicate, or quadruplicate reactions may be per and prepared by downstream sequencing using standard US 2016/0040215 A1 Feb. 11, 2016 20 methods familiar to one with ordinary skill in the art and as databases include, but are not limited to the Human Micro described by the sequencing technology's manufactures biome Project, NCBI non-redundant database, Greengenes, instructions for library preparation. In short, RNA or DNA are RDP, and Silva for taxonomic assignments. For functional purified using standard purification kits such as but not lim assignments reads are mapped to various functional data ited to Qiagen's RNeasy Kit or Promega's Genomic DNA bases such as but not limited to COG, KEGG, BioCyc, and purification kit. For RNA, the RNA is converted to cDNA MetaCyc. Further functional annotations can be derived from prior to sequence library construction. Following purification 16S taxonomic annotations using programs such as of nucleic acids, RNA is converted to cDNA using reverse PICRUST (M. Langille, et al 2013. Nature Biotechnology transcription technology Such as but not limited to Nugen 31,814-821). Phylogenetic methods can be used in combina Ovation RNA-Seq System or Illumina Truseq as per the tion with sequence similarity methods to improve the calling manufacturers instructions. Extracted DNA or transcribed accuracy of an annotation or taxonomic assignment. Here tree cDNA are sheared using physical (e.g. Hydroshear), acoustic topologies and nodal structure are used to refine the resolu (e.g. Covaris), or molecular (e.g. Nextera) technologies and tion of the analysis. In this approach we analyze nucleic acid then size selected as per the sequencing technologies manu sequences using one of numerous sequence similarity facturer's recommendations. Following size selection, approaches and leverage phylogenetic methods that are well nucleic acids are prepared for sequencing as per the manu known to those skilled in the art, including but not limited to facturers instructions for sample indexing and sequencing maximum likelihood phylogenetic reconstruction (see e.g. adapter ligation using methods familiar to one with ordinary Liu K, Linder CR, and Warnow T. 2011. RAXML and Fast skill in the art of genomic sequencing. Tree: Comparing Two Methods for Large-Scale Maximum 0187 Massively Parallel Sequencing of Target Amplicons Likelihood Phylogeny Estimation. PLoS ONE 6: e27731. from Heterogeneous Samples McGuire G. Denham MC, and Balding DJ. 2001. Models of 0188 DNA Quantification & Library Construction sequence evolution for DNA sequences containing gaps. 0189 The cleaned PCR amplification products are quan Mol. Biol. Evol 18: 481-490. Wrobel B. 2008. Statistical tified using the Quant-iTTM PicoGreen(R) dsDNA Assay Kit measures of uncertainty for branches in phylogenetic trees (Life Technologies, Grand Island, N.Y.) according to the inferred from molecular sequences by using model-based manufacturers instructions. Following quantification, the methods. J. Appl. Genet. 49: 49-67.) Sequence reads (e.g. barcoded cleaned PCR products are combined such that each 16S, 18S, or ITS) are placed into a reference phylogeny distinct PCR product is at an equimolar ratio to create a comprised of appropriate reference sequences. Annotations prepared Illumina library. are made based on the placement of the read in the phyloge 0190. Nucleic Acid Detection netic tree. The certainty or significance of the OTU annotation 0191 The prepared library is sequenced on Illumina is defined based on the OTU’s sequence similarity to a refer HiSeq or MiSeq sequencers (Illumina, San Diego, Calif.) ence nucleic acid sequence and the proximity of the OTU with cluster generation, template hybridization, isothermal sequence relative to one or more reference sequences in the amplification, linearization, blocking and denaturation and phylogeny. As an example, the specificity of a taxonomic hybridization of the sequencing primers performed according assignment is defined with confidence at the the level of to the manufacturer's instructions. 16SV4SeqFw (TATGG Family, Genus, Species, or Strain with the confidence deter TAATTGTGTGCCAGCMGCCGCGGTAA), mined based on the position of bootstrap Supported branches 16SV4SeqRev (AGTCAGTCAGCCGGACTACH in the reference phylogenetic tree relative to the placement of VGGGTWTCTAAT), and 16SV4Index (ATTAGAWAC the OTU sequence being interrogated. Nucleic acid CCBDGTAGTCCGGCTGACTGACT) (IDT, Coralville, sequences can be assigned functional annotations using the Iowa) are used for sequencing. Other sequencing technolo methods described above. gies can be used such as but not limited to 454, Pacific Bio 0193 Clade Assignments Sciences, Helicos, Ion Torrent, and Nanopore using protocols (0194 The ability of 16S-V4 OTU identification to assign that are standard to someone skilled in the art of genomic an OTU as a specific species depends in part on the resolving sequencing. power of the 16S-V4 region of the 16S gene for a particular species or group of species. Both the density of available Example 4 reference 16S sequences for different regions of the tree as well as the inherent variability in the 16S gene between dif Sequence Read Annotation ferent species will determine the definitiveness of a taxo nomic annotation. Given the topological nature of a phyloge Primary Read Annotation netic tree and the fact that tree represents hierarchical 0.192 Nucleic acid sequences are analyzed and annotated relationships of OTUs to one another based on their sequence to define taxonomic assignments using sequence similarity similarity and an underlying evolutionary model, taxonomic and phylogenetic placement methods or a combination of the annotations of a read can be rolled up to a higher level using two strategies. A similar approach can be used to annotate a clade-based assignment procedure. Using this approach, protein names, protein function, transcription factor names, clades are defined based on the topology of a phylogenetic and any other classification schema for nucleic acid tree that is constructed from full-length 16S sequences using sequences. Sequence similarity based methods include those maximum likelihood or other phylogenetic models familiar familiar to individuals skilled in the art including, but not to individuals with ordinary skill in the art of phylogenetics. limited to BLAST, BLASTX, thBLASTn, tBLASTX, RDP Clades are constructed to ensure that all OTUs in a given classifier, DNAclust, and various implementations of these clade are: (i) within a specified number of bootstrap Sup algorithms such as Qilime or Mothur. These methods rely on ported nodes from one another (generally, 1-5 bootstraps), mapping a sequence read to a reference database and select and (ii) within a 5% genetic similarity. OTUs that are within ing the match with the best score and e-value. Common the same clade can be distinguished as genetically and phy US 2016/0040215 A1 Feb. 11, 2016
logenetically distinct from OTUs in a different clade based on MicroAmp(R) Fast Optical 96-well Reaction Plate with Bar 16S-V4 sequence data. OTUs falling within the same clade code (0.1 mL) (Life Technologies, Grand Island, N.Y.) and are evolutionarily closely related and may or may not be performed on a BioRad C1000TM Thermal Cycler equipped distinguishable from one another using 16S-V4 sequence with a CFX96TM Real-Time System (BioRad, Hercules, data. The power of clade based analysis is that members of the Calif.), with fluorescent readings of the FAM and ROX chan same clade, due to their evolutionary relatedness, are likely to nels. The Cd value for each well on the FAM channel is play similar functional roles in a microbial ecology Such as determined by the CFX ManagerTM software version 2.1. The that found in the human gut. Compositions substituting one log 10 (cfu/ml) of each experimental sample is calculated by species with another from the same clade are likely to have inputting a given sample's Cd value into linear regression conserved ecological function and therefore are useful in the model generated from the standard curve comparing the Cd present invention. Notably in addition to 16S-V4 sequences, values of the standard curve wells to the known log 10 (cfu/ clade-based analysis can be used to analyze 18S, ITS, and ml) of those samples. The skilled artisan may employ alter other genetic sequences. native qPCR modes. This technique is employed as an (0195 Notably, 16S sequences of isolates of a given OTU optional alternative detection technique with optional nucleic are phylogenetically placed within their respective clades, acid enrichment steps before qPCR or optional microbial Sometimes in conflict with the microbiological-based assign enrichment steps before cell lysis. ment of species and genus that may have preceded 16S-based assignment. Discrepancies between taxonomic assignment Example 6 based on microbiological characteristics versus genetic sequencing are known to exist from the literature. Germinating Spores 0196. Metaenomic Read Annotation 0199 Microbial compositions comprising bacteria can 0.197 Metagenomic or whole genome shotgun sequence include species that are in spore form and to culture and data is annotated as described above, with the additional step enrich these a germination procedure can increase the diver that sequences are either clustered or assembled prior to sity and counts of bacteria cultivated for detection purposes. annotation. Following sequence characterization as Germinating a spore fraction increases the number of viable described above, sequence reads are demultiplexed using the bacteria that will grow on various media types. To germinate indexing (i.e. barcodes). Following demultiplexing sequence a population of spores, the sample is moved to the anaerobic reads are either: (i) clustered using a rapid clustering algo chamber, resuspended in prereduced PBS, mixed and incu rithm such as but not limited to UCLUST (http://drive5.com/ bated for 1 hour at 37 C to allow for germination. Germinants usearch/manual/uclust algo.html) or hash methods such can include amino-acids (e.g., alanine, glycine), Sugars (e.g., VICUNA (Xiao Yang, Patrick Charlebois, Sante Gnerre, Mat fructose), nucleosides (e.g., inosine), bile salts (e.g., cholate thew G Coole, Niall J. Lennon, Joshua Z. Levin, James Qu, and taurocholate), metal cations (e.g., Mg2+, Ca2+), fatty Elizabeth M. Ryan, Michael C. Zody, and Matthew R. Henn acids, and long-chain alkylamines (e.g., dodecylamine, Ger (2012) De novo assembly of highly diverse viral populations. mination of bacterial spores with alkyl primary amines' J. BMC Genomics 13:475). Following clustering a representa Bacteriology, 1961.). Mixtures of these or more complex tive read for each cluster is identified based and analyzed as natural mixtures. Such as rumen fluid or Oxgall, can be used described above in “Primary Read Annotation'. The result of to induce germination. Oxgall is dehydrated bovine bile com the primary annotation is then applied to all reads in a given posed of fatty acids, bile acids, inorganic salts, sulfates, bile cluster. (ii) A second strategy for metagenomic sequence pigments, cholesterol, mucin, lecithin, glycuronic acids, por analysis is genome assembly followed by annotation of phyrins, and urea. The germination can also be performed in genomic assemblies using a platform such as but not limited a growth medium like prereduced BHIS/oxgall germination to MetAMOS (T.J. Treangen et al. 2013 Geneome Biology medium, in which BHIS (Brain heart infusion powder (37 14:R2) and other methods familiar to one with ordinary skill g/L), yeast extract (5 g/L), L-cysteine HCl (1 g/L)) provides in the art. peptides, amino acids, inorganic ions and Sugars in the com plex BHI and yeast extract mixtures and Oxgall provides Example 5 additional bile acid germinants. 0200. In addition, pressure may be used to germinate qPCR Detection of a Microbial Contaminant in a spores (Gould and Sale (1970) J. Gen. Microbiol. 60:335). Microbial Composition The selection of germinants can vary with the microbe being 0198 qPCR primers are specifically designed to a the sought. Different species require different germinants and genome of a pathogen of interest and thus detect the pathogen different isolates of the same species can require different in a microbial composition by presence of its nucleic acid germinants for optimal germination. Finally, it is important to after an appropriate preparation. Standard techniques are fol dilute the mixture prior to plating because Some germinants lowed to generate a standard curve for the pathogen of interest are inhibitory to growth of the vegetative-state microorgan from a known concentration of DNA from that pathogen for isms. For instance, it has been shown that alkylamines must comparison. Genomic DNA is extracted from samples using be neutralized with anionic lipophiles in order to promote commercially-available kits, such as the Mo BioPowersoil(R)- optimal growth. Bile acids can also inhibit growth of some htp 96 Well Soil DNA. Isolation Kit (Mo Bio Laboratories, organisms despite promoting their germination, and must be Carlsbad, Calif.), the Mo BioPowersoil(R) DNA Isolation Kit diluted away prior to plating for viable cells. (Mo BioLaboratories, Carlsbad, Calif.), or the QIAamp DNA 0201 For example, BHIS/oxgall solution is used as a ger Stool Mini Kit (QIAGEN, Valencia, Calif.) according to the minant and contains 0.5xBHIS medium with 0.25% oxgall manufacturers instructions. The qPCR is conducted using (dehydrated bovine bile) where 1xEHIS medium contains the HotMasterMix (SPRIME, Gaithersburg, Md.) and primers following per L of solution: 6 g Brain Heart Infusion from specific for the pathogen of interest, and is conducted on a Solids, 7 g peptic digest of animal tissue, 14.5g of pancreatic US 2016/0040215 A1 Feb. 11, 2016 22 digest of casein, 5g of yeast extract, 5 g sodium chloride, 2g 0204 Plates were incubated anaerobically or aerobically glucose, 2.5g disodium phosphate, and 1 g cysteine. Addi at 37 C for 48-72 or more hours, targeting anaerobic or aero tionally, Ca-DPA is a germinant and contains 40 mM CaCl2, bic spore formers, respectively. and 40 mM dipicolinic acid (DPA). Rumen fluid (Bar Dia 0205 Solid plate media include Gifu Anaerobic Medium mond, Inc.) is also a germinant. Simulated gastric fluid (Ricca (GAM, Nissui) without dextrose supplemented with fructoo Chemical) is a germinant and is 0.2% (w/v) Sodium Chloride ligosaccharides/inulin (0.4%), mannitol (0.4%), inulin in 0.7% (v/v) Hydrochloric Acid. Mucin medium is a germi (0.4%), or fructose (0.4%), or a combination thereof, Sweet nant and prepared by adding the following items to 1 L of GAM Gifu Anaerobic Medium (GAM, Nissui) modified, distilled sterile water: 0.4 g KH2PO4, 0.53 g Na2HPO4, 0.3 Supplemented with glucose, cellobiose, maltose, L-arabi g NH4C1, 0.3 g NaCl, 0.1 g MgCl2x6H2O, 0.11g CaCl2, 1 nose, fructose, fructooligosaccharides/inulin, mannitol and ml alkaline trace element solution, 1 ml acid trace element sodium lactate), Brucella Blood Agar (BBA, Atlas, Hand Solution, 1 ml vitamin Solution, 0.5 mg resaZurin, 4 g. book of Microbiological Media, 4th ed, ASM Press, 2010), NaHCO3, 0.25 g Na2Sx9 H2O. The trace element and vita PEA sheep blood (Anaerobe Systems; 5% Sheep Blood Agar min Solutions prepared as described previously (Stams et al., with Phenylethyl Alcohol), 1993). All compounds were autoclaved, except the vitamins, 0206 Egg Yolk Agar (EYA) (Atlas, Handbook of Micro which were filter-sterilized. The basal medium was supple biological Media, 4th ed, ASM Press, 2010), Sulfite poly mented with 0.7% (v/v) clarified, sterile rumen fluid and myxin milk agar (Mevissen-Verhage et al., J. Clin. Microbiol. 0.25% (v/v) commercial hog gastric mucin (Type III: Sigma), 25:285-289 (1987)), Mucinagar (Derrien et al., IJSEM 54: purified by ethanol precipitation as described previously 1469-1476 (2004)), (Miller & Hoskins, 1981). This medium is referred herein as 0207 Polygalacturonate agar (Jensen & Canale-Parola, mucin medium. Appl. Environ. Microbiol. 52:880-997 (1986)), 0202 Fetal Bovine Serum (Gibco) can be used as a ger (0208 M2GSC (Atlas, Handbook of Microbiological minant and contains 5% FBS heat inactivated, in Phosphate Media, 4th ed, ASM Press, 2010), Buffered Saline (PBS, Fisher Scientific) containing 0.137M 0209 M2 agar (Atlas, Handbook of Microbiological Sodium Chloride, 0.0027M Potassium Chloride, 0.01 19M Media, 4th ed. ASM Press, 2010), supplemented with starch Phosphate Buffer. Thioglycolate is a germinant as described (1%), mannitol (0.4%), lactate (1.5 g/L) or lactose (0.4%), previously (Kamiya et al Journal of Medical Microbiology 0210 Sweet B. Brain Heart Infusion agar (Atlas, Hand 1989) and contains 0.25M (pH10) sodium thioglycollate. book of Microbiological Media, 4th ed, ASM Press, 2010) Dodecylamine solution containing 1 mM dodecylamine in supplemented with yeast extract (0.5%), hemin, cysteine PBS is a germinant. A Sugar Solution can be used as a germi (0.1%), maltose (0.1%), cellobiose (0.1%), soluble starch nant and contains 0.2% fructose, 0.2% glucose, and 0.2% (sigma, 1%), MOPS (50 mM, pH 7), mannitol. Amino acid solution can also be used as a germi 0211 PY-salicin (peptone-yeast extract agar supple nant and contains 5 mM alanine, 1 mM arginine, 1 mM mented with salicin) (Atlas, Handbook of Microbiological histidine, 1 mM lysine, 1 mM proline, 1 mM asparagine, 1 Media, 4th ed, ASM Press, 2010). Modified Brain Heart mMaspartic acid, 1 mM phenylalanine Agerminant mixture Infusion (M-BHI) sweet and sour contains the following referred to herein as Germix 3 can be a germinant and con per L: 37.5 g Brain Heart Infusion powder (Remel), 5 g yeast tains 5 mMalanine, 1 mMarginine, 1 mM histidine, 1 mM extract, 2.2g meat extract, 1.2 g liver extract, 1 g cystein HCl, lysine, 1 mM proline, 1 mMasparagine, 1 mMaspartic acid, 0.3 g Sodium thioglycolate, 10 mg hemin, 2 g soluble starch, 1 mM phenylalanine, 0.2% taurocholate, 0.2% fructose, 0.2% 2 gFOS/Inulin, 1 g cellobiose, 1 g L-arabinose, 1 g mannitol, mannitol, 0.2% glucose, 1 mMinosine, 2.5 mM Ca-DPA, and 1 Na-lactate, 1 mL Tween 80, 0.6 g. MgSO4x7H2O, 0.6 g. 5 mM KC1. BHIS medium+DPA is a germinant mixture and CaCl2, 6 g(NH4)2SO4, 3 g KH2PO4, 0.5g K2HPO4, 33 mM contains BHIS medium and 2 mM Ca-DPA. Escherichia coli Acetic acid, 9 mM propionic acid, 1 mM Isobutyric acid, 1 spent medium supernatant referred to herein as EcSN is a mM isovaleric acid, 15 gagar, and after autoclaving add 50 germinant and is prepared by growing E. coli MG 1655 in mL of 8% NaHCO3 Solution and 50 mL 1MMOPS-KOH SweetB/Fos inulin medium anaerobically for 48 hr, spinning (pH 7). down cells at 20,000 rcf for 20 minutes, collecting the super 0212 Noack-Blaut Eubacterium agar (See Noacket al. J. natant and heating to 60 C for 40 min. Finally, the solution is Nutr. (1998) 128: 1385-1391), filter sterilized and used as a germinant Solution. 0213 BHIS azl/ge2-BHIS az/ge agar (Reeves et. al. Infect. Immun. 80:3786-3794 (2012)) Brain Heart Infusion Example 7 agar (Atlas, Handbook of Microbiological Media, 4th ed, ASM Press, 2010) supplemented with yeast extract 0.5%, Selection of Media for Growth cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, 0203. It is important to select appropriate media to support aztreonam 1 mg/L, gentamycin 2 mg/L. growth, including preferred carbon sources. For example, 0214 BHISCIn Mazl/ge2-BHISCInMBrain Heart Infu Some organisms prefer complex Sugars such as cellobiose sionagar (Atlas, Handbook of Microbiological Media, 4th ed, over simple Sugars. Examples of media used in the isolation ASM Press, 2010) supplemented with yeast extract 0.5%, of sporulating organisms include EYA, BHI, BHIS, and cysteine 0.1%, 0.1% cellobiose, 0.1% inulin, 0.1% maltose, GAM (see below for complete names and references). Mul aztreonam 1 mg/L, gentamycin 2 mg/L. tiple dilutions were plated out to ensure that some plates had well isolated colonies on them for analysis, or alternatively Example 8 plates with dense colonies were scraped and Suspended in PBS to generate a mixed diverse community. Various medias Qualification of Fecal Donor as Healthy will enrich for certain organisms and thus culturing itself is a 0215. To determine that a donor of fecal material is a method of selection and enrichment. healthy, normal individual, testing is performed to determine US 2016/0040215 A1 Feb. 11, 2016
their general health and the state of the individuals micro bowel disease including Crohn's disease and ulcerative coli biome. Briefly, the individual is questioned on risk factors for tis, Irritable bowel syndrome, colon, stomach or other gas dSybiosis and exposure to pathogens ensuring no oral antibi trointestinal malignancies, or gastrointestinal polyposis Syn otic use in the past 3 to 6 months, no recent bouts of diarrhea, dromes, or recent use of yogurt or commercial probiotic no travel outside of the united States, canada, or to locations at materials in which an organism(s) is a primary component. risk for malaria exposure, and other questions contained on the AABB questionnaire as previously described (e.g. see Example 9 http://www.aabb.org/resources/donation/questionnaires/ Pages/dhqaabb.aspx). A medical history will be assessed with Purification and Isolation of a Spore Forming a focus on gastrointestinal history including a history of IBD. Fraction From Feces colitis, colorectal cancer, C. difficile infection, diarrhea. A 0217. To enrich a spore fraction or generate an ethanol rectal exam is also performed to assess colorectal health. treated fecal Suspension from a greater microbial composi Optionally, donors will also be assessed for drug use includ tion e.g. stool or other composition, for further testing the ing Smoking, alcohol use, and other common illicit drugs following non-limiting example presents a protocol for iso known to one skilled in the art. A fecal sample will be lating a spore forming fraction from a microbial composition assessed for spore content using methods described herein e.g. feces. To purify and selectively isolate efficacious spores (e.g. see examples 14 and 15). Additionally fecal based patho from fecal material a stool donation was first blended with gens will be tested for using standard culture and moleculer saline using a homogenization device (e.g., laboratory tests that are commercially available and performed in clini blender) to produce a 20% slurry (w/v). 100% ethanol was cal microbiological labs (e.g. see Versalovic et al 2011 added for an inactivation treatment that lasts 10 seconds to 1 Manual of Clinical Microbiology. American Society for hour. The final alcohol concentration ranged from 30-90%. Microbiology, 10th edition or http://www.questdiagnostics. preferably 50-70%. High speed centrifugation (3200 rcf for com/testcenter/TestCenterHome.action). Tests performed on 10 min) was performed to remove solvent and the pellet was feces are obtained and are tested for infectious agents includ retained and washed. ing but not limited to C. difficile, E. coli 0157, camplvobacter, 0218. Once the washed pellet was resuspended, a low versinia, Salmonella, Shigella, cryptosporidium, cyclospora, speed centrifugation step (200 rcffor 4 min) was performed to isospora, rotavirus, norovirus, ova and parasite testing on a remove large particulate vegetative matter and the Superna fecal Smear with acid fast staining, giardia, vibrio cholera. tant containing the spores was retained. Low-speed centrifu Health donors may also be qualified by having regular bowel gation selectively removes large particles, and therefore movements with stool appearance typically Type 2, 3, 4, 5 or removes up to 7-61% of fibrous material, with a recovery of 6 on the Bristol Stool Scale, and having a BMI -18 kg/m2 and spores of between 50 and 85%. Alternatively, the resuspended <25 kg/m2. Blood may optionally be drawn and tested for the pellet can be filtered through 600 um, 300 um, 200 um, 150 presence of infectious agents including but not limited to um, 100 um, 75um, 60 um, 50 um, 20 um pore-size filters. treponema pallidum, HAV, HBV, HCV. HIV 1/2 HTLV I/II, This similarly selectively removes large particles, allowing westnile virus by methods known to one skilled in the art (e.g. spores to pass through the filters, removing 15-80% of solids see http://www.questdiagnostics.com/testcenter/TestCenter while retaining 80–99% of spores, as measured by DPA. Home.action and http://www.fda.gov/BiologicsBlood Vac 0219. High speed centrifugation (3200 rcf for 10 min) was cines/BloodBloodProducts/ApprovedProducts/Licens performed on the Supernatant to concentrate the spore mate edProductsBLAS/BloodDonorScreening/Infectious Disease/ rial. The pellet was then washed and resuspended to generate ucm080466.htm). Finally normal blood biochemistry can a 20% slurry. This was the ethanol treated fecal suspension. also be assessed to demonstrate a donor is healthy by evalu The concentrated slurry was then separated with a density ating the biochemical and chemical blood metabolite markers based gradient e.g. a CsCl gradient. Sucrose gradient or com including but not limited to complete blood count with plate bination of the two generating a ethanol treated, gradient lets, Sodium, potassium, chloride, albumin, total protein, glu purified spore preparation. For example, a CsCl gradient was cos, blood urea nitrogen (BUN), creatinine, uric acid, aspar performed by loading a 20% Volume of spore suspension on tate aminotrasferase (AST), Alanine aminotransferase top a 80% volume of a stepwise CsCl gradient (w/v) contain (ALT), gamma-glutamyltranspeptidase (GGT), creatine ing the steps of 64%, 50%, 40% CsCl (w/v) and centrifuging kinase (CK), alkaline phosphatase, total bilirubin, direct for 20 min at 3200 rcf. The spore fraction was then run on a bilirubin, lactate dehrogenase, calcium, cholesterol, triglyc sucrose step gradient with steps of 67%, 50%, 40%, and 30% erides by methods known to one skilled in the art and com (w/v). When centrifuged in a swinging bucket rotor for 10 mercially available (e.g. see http://www.questdiagnostics. min at 3200 rcf. The spores ran roughly in the 30% and 40% com/testcenter/TestCenterHome.action). A complete sucrose fractions. The lower spore fraction was then removed urinalysis can also be performed to assess health. Addition and washed to produce a concentrated ethanol treated, gradi ally one or more specific OTUs or Clades desired in the ent-purified spore preparation. Taking advantage of the microbial composition can be detected by methods described refractive properties of spores observed by phase contrast herein using genetic e.g. PCR, qPCR, 16S, etc., biochemical microscopy (spores are bright and refractive while germi e.g. serological testing with antibodies, enzymatic activity, nated spores and vegetative cells are dark) one could see an etc., microbiological techniques e.g. culturing, etc. or a com enrichment of the spore fraction from a fecal bacterial cell bination thereof described herein. Suspension compared to an ethanol treated, CsCl gradient 0216. Other exclusion criteria generally included signifi purified, spore preparation, and to an ethanol treated, CsCl cant chronic or acute medical conditions including renal, gradient purified. Sucrose gradient purified, spore prepara hepatic, pulmonary, gastrointestinal, cardiovascular, geni tion. tourinary, endocrine, immunologic, metabolic, neurologic or 0220. Furthermore, growth of spores after treatment with a hematological disease, a family history of inflammatory germinant was used to quantify a viable spore population. US 2016/0040215 A1 Feb. 11, 2016 24
Samples were incubated with a germinant (Oxgall, 0.25% for plating serial dilutions of the RCB to Brucella blood agar or up to 1 hour), diluted and plated anaerobically on BBA (Bru other solid media, and varied from 106 to 1010 cfu/ml. The cella Blood Agar) or similar media as described herein. Indi impact of freezing on viability was determined by titering the vidual colonies were picked and DNA isolated for full-length banks after one or two freeze-thaw cycles on dry ice or at -80° 16S sequencing to identify the species composition. This C., followed by thawing in an anaerobic chamber at room microbial composition e.g. ethanol treated spore preparation temperature. Some strains displayed a 1-3 log drop in viable or any preparation combination of steps described above cfu/ml after the 1st and/or 2nd freeze thaw, while the viability served as test material for Subsequent enrichment and detec of others were unaffected. tion of microbes of interest. 0221 Fibrous material in a stool Suspension can be quan Example 12 tified, most easily by taking dry weight measurements. A stool Suspension was divided into two equal 3-5 mL samples. Treatment of Fecal Suspensions with Ethanol or One was centrifuged at 3200 rcf for ten minutes, and the Heat Reduces Vegetative Cell Numbers and Results Supernatant was retained. Three to five mL of the homog in an Enrichment of Spore Forming Species enous stool Suspension was loaded onto a moisture analyzer 0224 Treatment of a sample, preferably a human fecal and baked until the mass levels off, and the moisture analyzer sample, in a manner to inactivate or kill Substantially all of the automatically calculated the percent solids in the sample. The Vegetative forms of bacteria present in the sample results in Supernatant of the pelleted Stool Suspension was run as a selection and enrichment of the spore fraction. Methods for control to measure dissolved solids. Quantifying undissolved inactivation can include heating, Sonication, detergent lysis, Solids was accomplished by Subtracting dissolved solids from enzymatic digestion (such as lysozyme and/or proteinase K). total Solids. This gave an estimate of fibrous contaminants in ethanol or acid treatment, exposure to Solvents (Tetrahydro a stool Suspension, as the non-spore, non-bacterial Solids furan, 1-butanol, 2-butanol, 1.2 propanediol. 1.3 propanediol. make up the bulk of a stool Suspension. Quantifying bacterial butanoate, propanoate, chloroform, dimethyl ether and a spores is most easily done by measuring the DPA contents of detergent like tritonX-100, diethyl ether), or a combination of a sample, and comparing this DPA content to a sample of these methods. To demonstrate the efficacy of ethanol known spore content (see example above). Expressing DPA induced inactivation of vegetative cells, a 10% fecal suspen content per unit dry material in a suspension gives a measure sion was mixed with absolute ethanol in a 1:1 ratio and of the purity of the spore Suspension. Eliminating dry material Vortexed to mix for 1 min. The Suspension was incubated at that doesn't contain spores (i.e. fibre) will increase this met room temperature for 30 min, 1 h, 4 hor 24h. After incubation 1C. the suspension was centrifuged at 13,000 rpm for 5 minto Example 10 pellet spores. The Supernatant was discarded and the pellet was resuspended in equal volume of PBS. Viable cells were Enrichment and Purification of Bacteria measured as described below. 0225. To demonstrate the efficacy of heat treatment on 0222 To purify individual bacterial strains for subsequent vegetative cell inactivation a 10-20% fecal suspension was detection and identification, dilution plates are selected in incubated at 70 C, 80 C, 90 C or 100 C for 10 min or 1 h. which the density enables distinct separation of single colo 0226. After ethanol or heat treatment, remaining viable nies. Colonies are picked with a sterile implement (either a cells were measured after 24h incubation on plates by deter sterile loop or toothpick) and re-streaked to BBA or other mining the bacterial titer on Brucella blood agar (BBA) as a solid media. Plates are incubated at 37°C. for 3-7 days. One function of treatment and time (See FIG. 15). Ethanol treat or more well-isolated single colonies of the major morphol ment for 1 h and 25 h have similar effects, reducing the ogy type are re-streaked. This process is repeated at least three number of viable cells by approximately 4 logs, while times until a single, stable colony morphology is observed. increasing temperature and time at high temperature leads to The isolated microbe is then cultured anaerobically in liquid higher losses in viable cell number, with no colonies detect media for 24 hours or longer to obtain a pure culture of able at 100° C. at either 10 min or 1 h. No germinants were 106-1010 cfu/ml. Liquid growth medium might include Brain used. After several days of additional growth on plates, a Heart Infusion-based medium (Atlas, Handbook of Micro number of colonies were picked from these treated samples biological Media, 4th ed, ASM Press, 2010) supplemented and identified by 16S rDNA analysis (e.g. see Examples 3 and with yeast extract, hemin, cysteine, and carbohydrates (for 4). These included known spore forming Clostridium spp. as example, maltose, cellobiose, soluble starch) or other media well as species not previously reported to be spore formers described previously (e.g. see example 7). The culture is including Ruminococcus bromii, and Anaerotruncus coli centrifuged at 10,000xg for 5 minto pellet the bacteria, the hominis (Lawson, et al 2004), and a Eubacterium sp. (Table spent culture media is removed, and the bacteria were resus 16). See FIG. 15: Heat and ethanol treatments reduce cell pended insterile PBS. Sterile 75% glycerol is added to a final viability concentration of 20%. An aliquot of glycerol stock is titered 0227. To demonstrate that vegetative cells are reduced by by serial dilution and plating. The remainder of the stock is ethanol treatment, known non-spore forming bacteria were frozen on dry ice for 10-15 min and then placed at -80C for ethanol treated as described previously (e.g. see Example 9) long term storage. and viability was determined by plating on BBA in anaerobic conditions (e.g. see Example 7). Fecal material from four Example 11 independent donors was exposed to 60 C for 5 min and Subsequently plated on three types of selective media under Titer Determination either aerobic (+O2) or anaerobic conditions ( O2) (BBA+ 0223) The number of viable cells per ml were determined aerobic, MacConkey lactose--aerobic, Bacteroides Bile escu on the freshly harvested, washed and concentrated culture by lin+anaerobic) to identify known nonsporeforming Entero US 2016/0040215 A1 Feb. 11, 2016 25 bacteria (Survivors on MacConkey agar) and Bacteroides titrations to determine the spore content of the donation. fragilis group species (survivors on Bacteroides Bile Esculin Furthermore, DPA assays were used to assess spore content plates). The detectable limit for these assays was roughly 20 (expressed as spore equivalents) as described in Example 14. cfu/mL. Germinants were not used in this experiment (FIG. As seen in FIG. 18, there is as much as two logs difference in 16). Both ethanol and heatinactivation reduces the cell viabil an individual donor over time and can be up to three logs ity from fecal material to the limit of detection under using difference between donors. The difference in spore content MacConkey lactose agar and BBE agar. The remaining cells measures is that nonviable spores and non-germinable spores identified on BBA media grown in anaerobic conditions com will not be observed by plating but will have measurable DPA prise the non-germinant dependent spore forming species. content. The variability between species of DPA content in See FIG.16: Reduction in non-spore forming vegetative cells spores making some complex mixtures containing high DPA by treatment at 60° C. for 5 min spores while other mixtures contain low DPA content spores. 0228. The ethanol treatment was shown to rapidly kill both Selecting donors with high spore counts is important in deter aerobic and non-spore forming anaerobic colony forming mining productivity of isolating spores from fecal donations units in 10% fecal Suspensions as determined by plating on by identifying preferred donors. rich (BBA) media. The reduction of plated CFUs decreases 0234. A fresh fecal sample from donor F was treated as four orders of magnitude in seconds as shown in FIG. 17. described in Example 15 to generate an ethanol treated spore 0229. See FIG. 17: Time course demonstrates ethanol fraction, germinated with BHIS/Oxgall for 1 has a described reduces both anaerobic and aerobic bacterial CFUs (e.g. see Example 6), then plated to a variety of media (e.g. See example 7). Colonies were picked with a focus on picking Example 13 several of each type of morphologically distinct colony on each plate to capture as much diversity as possible. Colonies Species Identified and Isolated as Spore Formers by were counted on a plate of each media type with well isolated Ethanol Treatment colonies such that the number of colony forming units per ml 0230. To demonstrate that spore-forming species were can be calculated (Table 24). Colonies were picked into one of enriched by heat or ethanol treatment methods, a comparison several liquid media and the 16S rDNA sequences (e.g. see of-7000 colony isolates was performed to identify species in Examples 3 and 4) were determined and analyzed as a repeatable fashion (e.g., identified independently in mul described above. The number of unique OTUs for each media tiple preparations, see examples 1, 3, and 4) only isolated type is shown below with the media with the most unique from fecal suspensions treated with 50% ethanol or heat OTUs at the top (Table 24). Combinations of 3 to 5 of the top treatment and not from untreated fecal Suspensions (Table 5 media types capture diversity, and some other can be chosen 17). These data demonstrate the ability to select for spore to target specific species of interest. Colony forming units forming species from fecal material, and identify organisms were calculated for a given species using the 16S data, and as spore formers not previously described as such in the were used to determine whether a sufficient level of a given literature. In each case, organisms were picked as an isolated organism is present. The spore complement from Donor F colony, grown anaerobically, and then Subjected to full-length includes these 52 species as determined by 16S sequencing 16S sequencing in order to assign species identity. (Table 24). 0231. To further identify spore formers, ethanol treated 0235. To screen human donors for the presence of a diver fecal samples from donors A, B, C, D, E and F were plated to sity of spore forming bacteria and/or for specific spore-form a variety of Solid media types, single colonies were picked ing bacteria, fecal samples were prepared using germinants and grown up in broth in a 96 well format (Tables 18-23). The and selective plating conditions and colonies were picked 16S rRNA gene was then amplified by PCR and direct cycle (e.g. see Examples 6 and 7) and analyzed for 16S diversity as sequencing was performed (See examples 3 and 4). The ID is described previously (see Examples 3 and 4). An assessment based on the forward read from direct cycle sequencing of the of donor diversity included the cfu/ml of ethanol resistant 16S rRNA gene. cells on a given media type, or cfu/ml of a given species using 0232. There is surprising heterogeneity in the microbiome the 16S analysis of colonies picked from that media to deter from one individual to another (Clemente et al., 2012) and mine the level of spores of a given species of interest. This this has consequences for determining the potential efficacy culture-based analysis was complemented by culture-inde of various donors to generate useful spore compositions. The pendent methods such as qPCR with probes specific to spe method described below is useful for screening donors when, cies or genera of interest or metagenomic sequencing of spore for instance, a particular quantity or diversity of spore form preparations, or 16S profiling of spore preparations using ing organisms is useful or desired for repopulating the micro Illumina 16S variable region sequencing approaches (e.g. see biome following antibiotic treatment or treating a particular Examples 3 and 4). disease or condition. Further, Such screening is useful when there is a need to screen donors for the purpose of isolating Example 14 microorganisms capable of spore formation, or when a puri fied preparation of spore forming organisms is desired from a Quantification of Spore Concentrations in a particular donor. Microbial Composition Using DPA Assay 0233 Total spore count is also a measure of potency of a 0236 Methods to assess spore concentration in microbial particular donation or purified spore preparation and is vital compositions typically require the separation and selection of to determine the quantity of material required to achieve a spores and Subsequent growth of individual species to deter desired dose level. To understand the variability in total spore mine the colony forming units. The art does not teach how to counts, donor samples were collected and processed as quantitatively germinate all the spores in Such a microbial described in prior examples. Donor spore counts in CFU/g composition as there are many species for which appropriate were then determined by growth on media plates at various germinants have not been identified. Furthermore, sporula US 2016/0040215 A1 Feb. 11, 2016 26 tion is thought to be a stochastic process as a result of evolu patients suffering from recurrent C. difficile infection. The tionary selection, meaning that not all spores from a single spore content of each spore preparation is characterized using species germinate with same response to germinant concen the two described methods. tration, time and other environmental conditions. Alterna 0242 Spore content varies per 30 capsules. As measured tively, a key metabolite of bacterial spores, dipicolinic acid by germinable SCFU, spore content varies by greater than (DPA) has been developed to quantify spores particles in a 10,000-fold. As measured by DPA, spore content varies by sample and avoid interference from fecal contaminants. This greater than 100-fold. In the absence of the DPA assay, it method can also be used to determine the presence of spores would be difficult to set a minimum dose for administration to in other products including but not limited to liquid cultures, a patient. For instance, without data from the DPA assay, one liquid beverages, resuspended powders and other products would conclude that a minimum effective dose of spores is not designed to contain spore forming microbes. Thus, the 4x105 or less using the SCFU assay (e.g. Preparation 1, Table DPA assay described provides a sensitive way of detecting 2). If that SCFU dose was used to normalize dosing in a contaminating spores in a complex product in addition to the clinical setting, however, then the actual spore doses given to utility described herein. The assay utilizes the fact that DPA patients would be much lower for other ethanol treated spore chelates Terbium3+ to form a luminescent complex (Fichtel preparations as measured as by the DPA assay (Table 3). etal, FEMS Microbiology Ecology, 2007; Kort et al. Applied 0243 Table 3 shows the DPA doses in Table 2 normalized and Environmental Microbiology, 2005; Shafaat and Ponce, to 4x105 sCFU per dose. Applied and Environmental Microbiology, 2006; Yang and 0244. It becomes clear from the variability of SCFU and Ponce, International Journal of Food Microbiology, 2009: DPA counts across various donations that using SCFU as the Hindle and Hall, Analyst, 1999). A time-resolved fluores measure of potency would lead to significant underdosing or cence assay detects terbium luminescence in the presence of overdosing in certain cases. For instance, setting a dose speci DPA giving a quantitative measurement of DPA concentra fication of 4x105 SCFU (the apparent effective dose from tion in a solution. donor Preparation 1) for product Preparation 3 would lead to a potential underdosing of more than 100-fold. This can be 0237. The assay was performed by taking 1 mL of the rectified only by setting potency specifications based on the spore standard to be measured and transferring it to a 2 mL DPA assay, which better reflects total spore counts in an microcentrifuge tube. The samples were centrifuged at 13000 ethanol treated spore preparation. The unexpected finding of RCF for 10 min and the samples were washed in 1 mL sterile this work is that the DPA assay is uniquely suited to set deionized H2O. The samples were washed an additional time potency and determine dosing for an ethanol treated spore by repeating the centrifugation. The 1 mL solutions were preparation and potentially other microbial compositions. transferred to hungate tubes and samples were autoclaved on 0245. Because DPA is a constituent only of bacterial a steam cycle for 30 min at 250 C. 100 uL of 30 uMTbCl3 spores and not of vegetative cells, detection of DPA using solution (400 mM sodium acetate, pH 5.0, 30 MTbC13) was terbium chloride can be used to determine if a composition or added to each sample. Serial dilutions of the autoclaved mate sample contains contaminating bacterial spores. Once free rial were made and the fluorescence of each sample was DPA was washed from the sample and the sample was heated measured by exciting with 275 nm light and measuring the to release DPA from any spores present, it was shown that a emission wavelength of 543 nm for an integration time of given sample that has a DPA content that is above the limit of 1.25 ms and a 0.1 ms delay. detection (LOD) is an indication that bacterial spores are 0238 Purified spores were produced as described previ present. FIG. 4 shows a dilution series of a pure sample of ously (e.g. see http://www.epa.gov/pesticides/methods/MB DPA and indicates that the LOD for DPA is approximately 0.5 28-00.pdf). Serial dilutions of purified spores from C. bifer nM. FIG. 5 shows a dilution series of a purified, sporulated mentans, C. Sporogenes, and C. butyricum cultures were strain Clostridium bifermentans and indicates a LOD for prepared and measured by plating on BBA media and incu bacterial spores ofapproximately 1*10 spores/mL. bating overnight at 37 C to determine CFU/ml. FIG.3 shows the linear correspondence across different spore producing Example 15 bacteria across several logs demonstrating the DPA assay as means to assess spore content. Demonstration of Enhanced Growth with a 0239 FIG. 3 shows the linear range of DPA assay com Germinant pared to CFU counts/ml. Purified spores of C. bifermentans, 0246 To enhance the detection of spore forming microbes C. sporogenes, and C. butyricum were titered by assessing in a microbial composition, adding a germination step to the spore CFU through a germination procedure and by the DPA culturing increases the enrichment of this method. As a non assay and compared. limiting example, a microbial composition of ethanol treated spores is enriched by various germination strategies. To dem 0240. The discrepancy for complex spore populations onstrate the ethanol treated spore germination capability and between spore counts measured by germinable spore CFU spore viability, spores from three different donors were ger and by DPA has important implications for determining the minated by various treatments and plated on various media. potency of an ethanol treated spore preparation for clinical Germination with BHIS/oxgall (BHIS ox), Ca-DPA, rumen use. Table 2 shows spore content data from 3 different ethanol fluid (RF), simulated gastric fluid (SGF), mucin medium treated spore preparations used to Successfully treat 3 patients (Muc), fetal bovine serum (FBS), or thioglycolate (Thi) for 1 suffering from recurrent C. difficile infection. The spore con hour at 37 C in anaerobic conditions was performed as tent of each spore preparation is characterized using the two described previously (e.g. see Examples 6 and 7) with described methods. samples derived from two independent donors (FIG. 6). The 0241 Table 2 shows spore content data from 3 different spore-germinant mixture was serially diluted and plated on ethanol treated spore preparations used to Successfully treat 3 different plate media including BBA, Sweet B, Sweet US 2016/0040215 A1 Feb. 11, 2016 27
B+lysozyme (tug/ml), M2GSC and M2GSC+lysozyme (tug/ protocols), and the resulting bacterial Suspension was treated ml) as previously described (e.g. see Examples 6 and 7) to with 50% ethanol to derive a population of “sporulatable' determine spore germination. Colony forming units were tal spores, or species that were capable of forming spores. In lied and titers were determined using standard techniques by preparing these fractions, fecal material from donor A was one skilled in the art. As FIG. 6 shows, maximum colony used to generate an ethanol treated spore preparation as pre forming units were derived from BHI-oxgall treatment. This viously described herein; then spore content was determined germination treatment also increases the diversity as mea by DPA assay and CFU/ml grown on various media (FIG. 19) sured by the number of OTUs identified when samples were as previously described (see Example 14 and 15). See FIG. Submitted for 16S sequencing (e.g. see Examples 3 and 4) 19: Spores initially present in ethanol treated spore prepara compared to plating without a germination step (FIG. 7). tion as measured by DPA and CFU/ml grown on specified 0247 FIG. 6 depicts different germinant treatments hav media. ing variable effects on CFU counts from donor A (top) and 0254 To characterize the fraction that is sporulatable, the donor B (bottom). The Y-Axes are spore CFU per ml. 2 day and 7 day “germinable' fractions were assessed for 0248 FIG. 7 depicts germinates increase the diversity of CFU and DPA content before and after ethanol treatment to cultured spore forming OTUs observed by plating. generate a spore fraction. Bacterial Suspensions were treated 0249. To test the effect of heat activation to promoteger with ethanol, germinated with Oxgall, and plated on the same mination, ethanol treated fecal samples were treated for 15 types of media that the 'germinable fraction was grown on. minat room temperature, 55C, 65C, 75 C or 85C from three DPA data showed that growth on plates for 2 and 7 days different donors and germinated subsequently with BHIS+ produced the same amount of total spores. Colonies on the Oxgall for 1 hr at 37 C then plated on BBA media (FIG. 8) as several types of media were picked for 16S sequence analysis previously described (e.g. see Examples 6 and 7). Pretreat to identify the spore forming bacteria present (Table 7). ment at room temperature produced equal if not more spores 0255 A 2 day “germinable' fraction and a 7 day “sporu than the elevated temperatures in all three donors. The tem latable' fraction were used as a treatment in the mouse pro perature of germinating was also examined by incubating phylaxis assay as follows. As a control, a 10% fecal Suspen samples at room temperature or 37 C for 1 hr in anaerobic sion prepared from a donor (Donor B) was also administered conditions before plating on BBA. No difference in the num to mice to model fecal microbiota transplant (FMT) (e.g. see ber of CFUs was observed between the two conditions. example 17). Weight loss and mortality of the various testand Lysozyme addition to the plates (2 ug/ml) was also tested on control arms of the study are plotted in Figure S17 and sum a single donor Sample by the testing of various activation marized in Table 8 which also contains the dosing informa temperature followed by an incubation in the presence or tion. Clinical score is based on a combined phenotypic assess absence of lysozyme. The addition of lysozyme had a small ment of the mouse's health on a scale of 0-4 in several areas effect when plated on Sweet B or M2GSC media but less so including appearance (0-2 pts based on normal, hunched, than treatment with BHIS oxgall without lysozyme for 1 hr piloerection, or lethargic), and clinical signs (0-2 points based (FIG.9). on normal, wet tail, cold-to-the-touch, or isolation from other 0250 FIG.8 depicts heat activation as a germination treat animals). The data show both the “germinable' and “sporu ment with BHIS+oxgall. latable fractions are efficacious in providing protection 0251 See FIG.9 depicts the effect of lysozyme and shows against C. difficile challenge in a prophylaxis mouse model a lysozyme treatment enhances germination in a Subset of (e.g. see Example 17). The efficacy of these fractions further conditions. demonstrates that the species present are responsible for the 0252 Germination time was also tested by treating a 10% efficacy of the spore fraction, as the fractionation further Suspension of a single donor ethanol treated feces (e.g. see dilutes any potential contaminant from the original spore Example 9) incubated in either BHIS, taurocholate, oxgall, or preparation. germix for 0, 15, 30, or 60 minutes and subsequently plated (0256 See FIG.S16: Titer of “germinable' fraction after 2 on BHIS, EYA, or BBA media (e.g. see Examples 6 and 7). 60 days (left) and Sporulatable fraction (right) by DPA and CFU/ minutes resulted in the most CFU units across all various ml. The “sporulatable' fraction made following 7 days of combinations germinates and plate media tested. growth was measured as previously described using germi nation and growth assays or DPA content as previously Example 16 described (see Example 14). 0257 The species present in the “germinable' and “sporu Demonstrating Efficacy of Terminable and latable' fractions were determined by full length 16S Sporulatable Fractions of Ethanol Treated Spores sequencing of colony picks and by 16S NGS sequencing of 0253) To define methods for characterization and purifica the fractions themselves. The colony pick data indicate tion, and to improve (e.g., Such as by modulating the diversity Clostridium species are very abundant in both fractions, of the compositions) the active spore forming ecology derived while the NGS data reveal other spore forming organisms that from fecal donations, the ethanol treated spore population (as are typically found in ethanol treated spore preparations are described in Example 9) was further fractionated. A 'ger present. minable fraction' was derived by treating the ethanol-treated (0258 Results are shown in the following: See Table 7. spore preparation with oxgall, plating to various solid media, Species identified as “germinable' and “sporulatable” by and then, after 2 days or 7 days of growth, scraping all the colony picking approach. See Table 5. Species identified as bacterial growth from the plates into 5 mL of PBS per plate to “germinable” using 16S-V4 NGS approach. See Table 6. generate a bacterial Suspension. A 'sporulatable fraction” Species identified as “sporulatable” using 16s-V4 NGS was derived as above except that the cells were allowed to approach. See Figure S17: Mouse prophylaxis model dem grow on Solid media for 2 days or 7 days (the time was onstrates “germinable' and “sporulatable' preparations are extended to allow sporulation, as is typical in sporulation protective against C. difficile challenge. Each plot tracks the US 2016/0040215 A1 Feb. 11, 2016 28 change in the individual mouse's weight relative to day -1 or weight loss on Day 3 (Table 15). EtOH-treated feces pre over the course of the experiment. The number of deaths over vents mortality and weight loss at three dilutions, while the the course of the experiment is indicated at the top of the chart heat-treated fraction was protective at the only dose tested. and demonstrated by a line termination prior to day 6. The top These data indicate that the spore fraction is efficacious in panels (from left to right) are the vehicle control arm, the fecal preventing C. difficile infection in the mouse. Suspension arm, and the untreated naive control arm, while the bottom panels are the ethanol treated, gradient purified Example 18 spore preparation; the ethanol treated, gradient purified, 'ger minable' preparation, and ethanol treated, gradient purified, Assay for Environmental Contaminants. During “sporulatable' preparation. See Table 8: Results of the pro Processing of Microbial Compositions phylaxis mouse model and dosing information 0262 The presence of contaminating organisms from the Example 17 processing environment can be assessed following the guide lines of USP <62>, Microbial examination of nonsterile prod Bacterial Compositions Prevent C. difficile Infection ucts: Tests for specified organisms, and USP <61>, Microbial examination of nonsterile products: Microbial Enumeration in a Mouse Model Tests, although these guidelines are directed towards prod 0259. To test the therapeutic potential of the bacterial com ucts that do not include viable organisms. Detecting contami positions a prophylactic mouse model of C. difficile infection nants in a complex background of product species means that (model based on Chen, et al. A mouse model of Clostridium USP <61> and <62> cannot be directly applied. Potential difficile associated disease, Gastroenterology 135(6):1984 environmental contaminants of regulatory interest that might 1992) was used. Two cages of five mice each were tested for be introduced during the manufacture of microbial composi each arm of the experiment. All mice received an antibiotic tions include, without limitation, the following organisms: cocktail consisting of 10% glucose, kanamycin (0.5 mg/ml), Bile-Tolerant Gram negative organisms, Escherichia coli, gentamicin (0.044 mg/ml), colistin (1062.5 U/ml), metron Salmonella, Pseudomonas aeruginosa, Staphylococcus idazole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), ampi aureus, and Candida albicans. In other settings (i.e. non cillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their spore comprising complex microbial mixtures), clostridia are drinking water on days -14 through -5 and a dose of 10 a class of organisms of interest as well. As known to one mg/kg. Clindamycin by oral gavage on day -3. On day -1, skilled in the art, there is no such entity as a perfect medium, they received either the test article or vehicle control via oral so species other than those targeted by the selective condi gavage. On day 0 they were challenged by administration of tions may be encountered that can grow on a given medium; approximately 4.5 log 10 cfu of C. difficile (ATCC 43255) via the nature of the specimens and the physiologic state of the oral gavage. Optionally a positive control group received organisms can influence recovery of desired species, as well Vancomycin from day -1 through day 3 in addition to the as modify the effects of inhibitory characteristics of this antibiotic protocol and C. difficile challenge specified above. medium. Feces were collected from the cages for analysis of bacterial 0263 For Bile-Tolerant Gram negative organisms, their carriage, mortality was assessed every day from day 0 to day presence can be determined in two modes. The first mode is a 6 and the weight and Subsequent weight change of the animal “test for absence' in which the sensitivity for detection is was assessed with weight loss being associated with C. diffi enhanced via an enrichment growth step that allows Small cile infection. Mortality and reduced weight loss of the test numbers of organisms to expand into a larger detectable article compared to the vehicle were used to assess the Suc population. The second mode is a "quantitative test” in which cess of the test article. Additionally, a C. difficile symptom organisms in the product are directly cultured and their levels scoring was performed each day from day -1 through day 6. can be quantitatively determined. To “Test for Absence' of Clinical Score was based on a 0-4 Scale by combining scores Bile-Tolerant Gram negative organisms, 1 g of the test mate for Appearance (0-2 pts based on normal, hunched, piloerec rial was inoculated into Soybean-casein broth and incubated tion, or lethargic), and Clinical Signs (0-2 points based on at 20-25°C. for at least two hours to resuscitate the bacteria normal, wet tail, cold-to-the-touch, or isolation from other (but less than 5 h, to avoid bacterial growth), after which it animals). was it was either used to inoculate the enrichment broth 0260. In a naive control arm, animals were challenged Enterobacteria Enrichment Broth Mossel and incubated at with C. difficile. In the Vancomycin positive control arm ani 30-35°C. for 24-48 h, and then plated to Violet Red Bile agar mals were dosed with C. difficile and treated with Vancomycin and incubated at 30-35°C. for 18-24 h to detect colonies. The from day -1 through day 3. The negative control was gavaged absence of colonies indicates the absence of Bile-Tolerant with PBS alone and no bacteria. The test arms of the experi Gram negative organisms in the product. In a "Quantitative ment tested 1x, 0.1x, 0.01 x dilutions derived from a single Test' for Bile-Tolerant Gram negative organisms, 1 g of the donor preparation of ethanol treated spores (e.g. see example test material (ethanol treated Suspension or final product 6) or the heat treated feces prepared by treating a 20% slurry material) was inoculated into Soybean-casein broth and incu for 30 min at 80 C. Dosing for CFU counts was determined bated at 20-25° C. for at least two hours to resuscitate the from the final ethanol treated spores and dilutions of total bacteria (but less than 5 h, to avoid bacterial growth) after spores were administered at 1x, 0.1x, 0.01x of the spore which it is diluted into Enterobacteria Enrichment Broth mixture for the ethanol treated fraction and a 1x dose for the Mossel to the equivalent of 0.1 g, 0.01 g and 0.001 g of heat treated fraction. material (or 0.1 mL, 0.01 mL and 0.001 mL) and incubated at 0261 Weight loss and mortality were assessed on day 3. 30-35C for 24-48 h, after which 100 ul is plated to Violet Red The negative control, treated with C. difficile only, exhibits Bile Glucose Agar, and incubated at 30-35C for 18-24 h. 20% mortality and weight loss on Day 3, while the positive Growth of colonies for any of the 3 dilutions plated indicates control of 10% human fecal Suspension displays no mortality the presence of a presumptive contaminant. A table from USP US 2016/0040215 A1 Feb. 11, 2016 29
<62> was then used to determine a probable number of Bac treated fecal Suspension was assayed for the presence of teria per g or mL or product as below (Table 4 from USP residual bile-tolerant Gram-negative species by plating to <62>). Colonies may be picked and their identities are deter Cetrimide Agar aerobically, which is recommended for the mined by either 16S rDNA sequencing or by microbiological detection and enumeration of Pseudomonas aeruginosa (in analysis cluding in USP <62>, Microbial examination of nonsterile 0264. The above methods for Bile-Tolerant Gram negative products: Tests for specified organisms, and USP <61>. organisms were performed with different broths and selective Microbial examination of nonsterile products: Microbial agars to detect Salmonella (broth, Rappaport Vassiliadis Enumeration Tests). Cetrimide is a quaternary ammonium Salmonalla Enrichment Broth; selective agar, Xylose Lysine compound with bactericidal activity against a broad range of Deoxycholate Agar), Pseudomonas (broth, Soybean-Casein Gram-positive organisms and some Gram-negative organ Digest Broth; selective agar, Cetrimide Agar), and Staphyllo isms. Aerobic incubation prevents the growth of anaerobes. coccus aureus (broth, Soybean-Casein Digest Broth; selec Presumptive Pseudomonas colonies are yellow-green or yel tive agar, Mannitol Salt Agar). Colonies that appear on these low brown in colour and fluoresce under UV light. A 20% media are picked and their identities are determined by either suspension of feces treated with 50% Ethanol for 1 hr was 16S rRNA sequencing or by microbiological analysis. assayed by creating 10-fold serial dilutions and plating (100 uL) to Cetrimide Agar (BD #285.420). A pre-ethanol treat Example 19 ment sample was plated in parallel. Plates are incubated aero bically at 37°C. for 48 hr, at which time colonies are counted Residual Assay for Bile-Tolerant Gram Negative to determine cfu/g pre and post-ethanol treatment. Inactiva Aerobic Organisms tion of presumptive Pseudomonas is indicated by reduced 0265. As a non-limiting example of a microbial composi cfu/ml. As known to one skilled in the art, there is no such tion, an ethanol treated fecal Suspension is used to test the bile entity as a perfect medium, so species other than those tar acid tolerance of gram negative aerobic organisms. An etha geted by the selective conditions may be encountered that can nol treated fecal Suspension was assayed for the presence of grow on a given medium; the nature of the specimens and the residual bile-tolerant Gram-negative species by plating to physiologic state of the organisms can influence recovery of Violet Red Bile Glucose Agar aerobically, which is recom desired species, as well as modify the effects of inhibitory mended for the detection and enumeration of Enterobacteri characteristics of this medium. Presumptive Pseudomonas aceae (including in USP <62>, Microbial examination of colonies are picked and their identities are determined by nonsterile products: Tests for specified organisms, and USP either 16S rDNA sequencing or by microbiological analysis. <61 >, Microbial examination of nonsterile products: Micro bial Enumeration Tests). Organisms that grow on this selec Example 21 tive medium include Escherichia spp., Salmonella spp. Pseudomonas spp., while Gram positive organisms such as Residual Assay for the Presence of the Gram Streptococcus and Enterococcus spp. do not. Bile salts and Positive Staphylococci crystal violet inhibitgram-positive bacteria, and neutral red is 0267 As a non-limiting example of a microbial composi a pH indicator that allows glucose fermenters to produce red tion, an ethanol treated fecal Suspension is used. An ethanol colonies with red-purple halos of precipitated bile. Aerobic treated fecal Suspension was assayed for the presence of incubation prevents the growth of bile-tolerant anaerobes. A residual Gram positive Staphylococcus species by plating to 20% suspension of feces treated with 50% Ethanol for 1 hr Mannitol Salt Agar aerobically, which is recommended for was assayed by creating 10 fold serial dilutions and plating the detection and enumeration of Staphylococcus species (100 uL) to Violet Red Bile Glucose Agar (BD #218661). A including Staphylococcus aureus and Staphylococcus epider pre-ethanol treatment sample was plated in parallel. Plates are midis (including in USP <62>, Microbial examination of incubated aerobically at 37° C. for 48 hr, at which time nonsterile products: Tests for specified organisms, and USP colonies are counted to determine cfu/g pre and post-ethanol <61>, Microbial examination of nonsterile products: Micro treatment. Inactivation of presumptive bile-tolerant Gram bial Enumeration Tests). Mannitol Salt Agar is a nutritive negative aerobes is indicated by reduced cfu/ml. Colonies medium due to its content of peptones and beef extract, which from the ethanol treated Sample are considered presumptive Supply essential growth factors, such as nitrogen, carbon, bile-tolerant Gram-negative aerobe, but as known to one sulfur and trace nutrients. The 7.5% concentration of sodium skilled in the art, there is no such entity as a perfect medium, chloride results in the partial or complete inhibition of bacte so species other than those targeted by the selective condi rial organisms other than staphylococci. Mannitol fermenta tions may be encountered that can grow on a given medium; tion, as indicated by a change in the phenol red indicator, aids the nature of the specimens and the physiologic state of the in the differentiation of staphylococcal species. Presumptive organisms can influence recovery of desired species, as well Staphylococcus aureus and Staphylococcus epidermidis as modify the effects of inhibitory characteristics of this colonies have yellow Zones and red/purple Zones, respec medium. Colonies are picked and their identities are deter tively. A 20% suspension of feces treated with 50% Ethanol mined by either 16S rDNA sequencing or by microbiological for 1 hr was assayed by creating 10 fold serial dilutions and analysis. plating (100 uL) to Mannitol Salt Agar (BD #221173). A pre-ethanol treatment sample was plated in parallel. Plates are Example 20 incubated aerobically at 37° C. for 48 hr, at which time Residual Assay for the Presence of the Gram colonies are counted to determine cfu/g pre and post ethanol Negative Organism Pseudomonas aeruginosa treatment. Inactivation of presumptive Staphylococci is indi cated by reduced cfu/ml. As known to one skilled in the art, 0266. As a non-limiting example of a microbial composi there is no Such entity as a perfect medium, so species other tion, an ethanol treated fecal Suspension is used. An ethanol than those targeted by the selective conditions may be US 2016/0040215 A1 Feb. 11, 2016 30 encountered that can grow on a given medium; the nature of and enumeration of Salmonella spp (including in USP <62>. the specimens and the physiologic state of the organisms can Microbial examination of nonsterile products: Tests for speci influence recovery of desired species, as well as modify the fied organisms, and USP <61>, Microbial examination of effects of inhibitory characteristics of this medium. Presump nonsterile products: Microbial Enumeration Tests), and tive Staphylococci colonies are picked and their identities are allows the growth of other Gram negative species as well. determined by either 16S rDNA sequencing or by microbio XLD Agar is both a selective and differential medium. It logical analysis. contains yeast extract as a Source of nutrients and vitamins. It utilizes sodium desoxycholate as the selective agent and, Example 22 therefore, is inhibitory to gram-positive microorganisms. Xylose is incorporated into the medium since it is fermented Residual Assay for the Presence of Fungi Including by practically all enterics except for the shigellae and this Candida spp property enables the differentiation of Shigella species. 0268 As a non-limiting example of a microbial composi Lysine is included to enable the Salmonella group to be dif tion, an ethanol treated fecal Suspension is used. An ethanol ferentiated from the non pathogens since without lysine, Sal treated fecal Suspension was assayed for the presence of monellae rapidly would ferment the xylose and be indistin residual Candida spp by plating to Sabouraud Dextrose Agar guishable from nonpathogenic species. After the salmonellae which is used for the enumeration of pathogenic and non exhaust the Supply of Xylose, the lysine is attacked via the pathogenic fungi, particularly dermatophytes (including in enzyme lysine decarboxylase, with reversion to an alkaline USP <62>, Microbial examination of nonsterile products: pH which mimics the Shigella reaction. To prevent similar Tests for specified organisms, and USP <61 >, Microbial reversion by lysine decarboxylase-positive coliforms, lactose examination of nonsterile products: Microbial Enumeration and Sucrose are added to produce acid in excess. To add to the Tests). The high glucose concentration in Sabouraud Dex differentiating ability of the formulation, an H2S indicator trose Agar provides an advantage for the growth of the (os system, consisting of sodium thiosulfate and ferric ammo motically stable) fungi while most bacteria do not tolerate the nium citrate, is included for the visualization of the hydrogen high Sugar concentration. In addition, the low pH is optimal sulfide produced, resulting in the formation of colonies with for fungi, but not for many bacteria. Other medium used in black centers. The non pathogenic H2S-producers do not isolation of fungi include Potato Dextrose agar, Czapeck dox decarboxylate lysine; therefore, the acid reaction produced agar (Sigma-Aldrich) supplemented with chloramphenicol by them prevents the blackening of the colonies which takes (0.05 g/l) and gentamycin (0.1 g/l), Dixon agar supplemented place only at neutral or alkaline pH. Aerobic incubation pre with chloramphenicol (0.05 mg/mL) and cycloheximide (0.2 vents the growth of anaerobes. Differential colony morpholo mg/mL). Candida spp that may be isolated from human feces gies are as follows: E. coli, large, yellow, flat; Enterobacter/ include Candida albicans, Candida tropicalis, Candida Klebsiella, mucoid, yellow; Proteus, Red to yellow. Most krusei, Candida glabrata, and Candida guileirmondii. A strains have black centers; Salmonella, H2S-positive, Red 15% suspension of feces treated with 50% Ethanol for 1 hr yellow with black centers, Red-yellow with black centers, was assayed by creating 10-fold serial dilutions and plating Red: Pseudomonas, Red. (100 uL) to Sabouraud Dextrose Agar (BD #211584). A pre (0270 A 20% suspension of feces treated with 50% Etha ethanol treatment sample was plated in parallel. Plates are nol for 1 hr was assayed by creating 10 fold serial dilutions incubated aerobically at 20-25° C. for up 5 days, at which and plating (100 uL) to XLD Agar (BD #254055). A pre time colonies are counted to determine cfu/g pre and post ethanol treatment sample was plated in parallel. Plates were ethanol treatment. Inactivation of presumptive fungi Candida incubated aerobically at 37° C. for 48 hr, at which time is indicated by reduced cfu/ml. As known to one skilled in the colonies were counted to determine cfu/gpre and post ethanol art, there is no Such entity as a perfect medium, so species treatment. Inactivation of presumptive Gram negative spp other than those targeted by the selective conditions may be was indicated by reduced cfu/ml. As known to one skilled in encountered that can grow on a given medium; the nature of the art, there is no such entity as a perfect medium, so species the specimens and the physiologic state of the organisms can other than those targeted by the selective conditions may be influence recovery of desired species, as well as modify the encountered that can grow on a given medium; the nature of effects of inhibitory characteristics of this medium. Presump the specimens and the physiologic state of the organisms can tive fungal colonies are picked and their identities are deter influence recovery of desired species, as well as modify the mined by either 18S rNA or internal transcribed spacer effects of inhibitory characteristics of this medium. Presump region (ITS) sequencing or by microbiological analysis. tive colonies of different species were picked based on their morphologies and their identities are determined by either Example 23 16S rRNA sequencing or by microbiological analysis. Residual Assay for the Presence of the Gram Example 24 Negative Organisms Escherichia, Salmonella Spp, Shigella Spp, Enterobacter Spp, Klebsiella spp and Detection of Undesired Gram-Negative Organisms Pseudomonas spp Via LPS 0269. As a non-limiting example of a microbial composi tion, an ethanol treated fecal Suspension is used. An ethanol 0271 Gram-negative organisms contain lipopolysaccha treated fecal Suspension was assayed for the presence of ride (LPS) in their outer membranes. LPS is expressed on the residual Gram-negative species including Escherichia, Sal cell Surface and is also referred to as endotoxin, as it elicits a monella, Shigella, Enterobacter, Klebsiella and Pseudomo variety of inflammatory responses, and is toxic to animals, nas by plating to Xylose-Lysine-Desoxycholate (XLD) Agar causing fever and disease when in the bloodstream. LPS can aerobically, which is the agar recommended for the detection be used as the basis of an assay to detect the presence of US 2016/0040215 A1 Feb. 11, 2016 undesired Gram-negative organisms in a mixed bacterial Example 26 community that consists of only Gram positive organisms. 0272 Endotoxin can be detected via a limulous amoeb Rapid Detection of Spore Forming Organisms ocyte lysate test (LAL test). This assay is based in the biology 0277 Degenerate qPCR primers for the spo0A gene of the horseshoe crab (Limulous), which produces LAL (primers described in Bueche et al., AEM, 2013), which enzymes in blood cells (amoebocytes) to bind and inactivate encodes the master regulator of sporulation in spore forming endotoxin from invading bacteria. A gel clot based assay is organisms, may be used to detect the presence of sporeform performed as follows: equal Volumes of LAL reagents are ing organisms in a mixed community, or to determine whether mixed with undiluted or diluted test article and observed for an organism which forms a colony in a microbiological clot formation. The dilutions are selected to cover the poten colony forming unit QC assay is a spore former or not. tial range of endotoxin in the sample and to reduce interfer ence by the test material making the gel clot LAL test semi Example 27 quantitative. The sensitivity of this assay is 0.06 EU/ml. The USP chromogenic method of the LAL test is based on the Rapid Determination of Gram Positive or Gram activation of a serine protease (coagulase) by the endotoxin, Negative Status of Individual Cultures or Mixed which is the rate-limiting step of the clotting cascade. The Communities assay measures the activation of the serine protease as opposed to the end result of this activation, which is clotting. 0278 Gram negative and gram positive cells respond dif The natural Substrate, coagulogen, is replaced by a chro ferentially to treatment with detergent under alkaline condi mogenic Substrate. On cleavage of this Substrate a chro tions, with Gram negative organisms typically displaying mophore is released from the chromogenic peptide and is rapid lysis, while Gram positives are more resistant. This is measured by spectrophotometry. The USP chromogenic well known, and alkaline lysis of gram negatives is standard method is quantitative and can provide a greater sensitivity in DNA preparations, as is the need for additional treatments overa wider range. The sensitivity of this assay is 0.10 EU/ml. to achieve efficient lysis and DNA recovery from Gram posi This assay could be performed on the mixed community in its tives. Differential lysis can be used to determine whether a product form, or to increase sensitivity, it could be performed community of only Gram negative organisms contains an after a sample of the product has been grown in enrichment undesired Grampositive component, or to determine whether culture to expand the population of any contaminant Gram a colony in a microbiological colony forming units assay is negative organism that might be present. Gram positive or negative. In one version of this assay, the mixed community culture or a single colony derived from said community is resuspended in 1 mL of buffer and ana Example 25 lyzed on an automated urine particle analyzer UF-1000i (Sys mex Corporation). The UF-1000i has a dedicated analytical Detection of Undesired Gram-Positive Organisms flow channel named “BACT channel, which employs spe cialized reagents and algorithm for bacteria detection and 0273. The cell walls of Gram positive organisms consist of counting. These aspects of UF-1000i realize precise counting peptidoglycan and teichoic acids. Teichoic acids are poly of bacteria in urine specimen or other samples in a short time mers with glycerol or ribitol joined together through phos (Wada et al PLoS One 2012). This is a rapid assay in which a phodiesterlinkages. Many of these polymers have glucosyl or 5 minute treatment with alkaline SDS followed by flow D-alanyl residues and are located exclusively in the walls, cytometry yields cell counts indicating lysis of Gram negative capsules or membranes of gram-positive bacteria. The cells relative to untreated control samples, or resistance to teichoic acids may be divided into two groups by their cellular lysis indicating the presence of Gram positive cells. For localization—the membrane teichoic acids or lipoteichoic acids linked covalently to lipids, and the wall teichoic acids colony identification, this could be combined with subse linked covalently to the peptidoglycan. Wall teichoic acids quent microbiological identification strategies targeted at may be composed of glycerol phosphate, ribitol phosphate either Gram positives or Gram negatives. and Sugar-1-phosphate residues. Most of the ribitol contain Example 28 ing teichoic acids also contain D-alanine residues. 0274 As teichoic acids are a discriminating feature of Residual Assay for Gram-Positive Aerobic Gram-positive cells, and are not found in Gram negative Organisms (Enterococcus spp) organisms they can thus be used as an indicator of the pres ence of undesired Gram positive organisms in a mixed bac 0279. As a specific non-limiting example, a microbial terial community that consists of only Gram negative organ composition e.g. an ethanol treated fecal Suspension can be isms, such as a community solely comprising Gram negative assayed for the presence of residual Enterococcus species by commensal Bacteroides spp. plating to selective media. Two 20% suspensions of feces (Sample1 and Sample2) were treated with 50% ethanol for 1 0275 Teichoic acids can be detected in the supernatant of hr and assayed by creating 10 fold serial dilutions and plated a mixed bacterial community using an antiteichoic acid (100 uL) to Enterococcosel Agar (BD #212205). A pre-etha ELISA. Antiteichoic antibodies may also be used to detect nol treatment sample was also plated in parallel. Similar Gram positive organisms via flow cytometry (e.g. see, Jung et media selective for Enterococcus species such as m-Entero all JImmunology, 2012). coccus Agar (BD #274610) can also be used. Enterococcosel 0276 Anti-teichoic acid antibodies with varying specifici Agar is suitable for the growth of Enterococcus faecalis and ties may be used to detect different Gram positive organisms, Enterococcus faecium and other Enterococcus spp. The including environmental contaminants such as Staphylococ selective and differential properties of this media are as fol cus epidermidis or Bacillus spp. lows. Enterococci hydrolyze the glycoside, esculin, to escu US 2016/0040215 A1 Feb. 11, 2016 32 letin and dextrose. Esculetin reacts with an iron salt, ferric ethanol sample and 1.90 Log CFU/mL for the ethanol treated ammonium citrate, to form a dark brown or black complex. sample (3.34 Log reduction in titer) (Table 12). Any colonies Oxgall is used to inhibit gram-positive bacteria other than which appear are considered presumptive Streptococcus spe enterococci. Sodium azide is inhibitory for gram-negative cies until confirmed by identification by 16S rDNA amplifi microorganisms. Other organisms that may grow on these cation and sequencing. Colonies were picked from pre-etha plates include Listeria monocytogenes, Streptococcus bovis nol plates and from ethanol treated and identified by 16S Group, pediococci and staphylococci. Plates were incubated rDNA amplification and sequencing for each sample (Tables aerobically at 37°C. for 48 hr. After incubation colonies were 9 and 10). Selective media does not always counter select all counted and used to back calculate the concentration of other species that might be present in the sample being plated. residual viable cells of Enterococcus. Any colonies with a Any colonies that grow need to be identified by amplification black or brown precipitate are considered presumptive and sequencing of the 16S rDNA gene. Enterococcus species until confirmed by identification by 16S rDNA amplification and sequencing. No colonies were Example 30 detected on the ethanol treated Enterococcosel plates (limit of detection 10 CFU/mL). Selective media does not always Residual Assay for Gram-Positive Anaerobic counter select all other species that might be present in the Organisms (Bifidobacterium spp Assay) sample being plated. Any colonies that grow need to be iden 0281. As a specific non-limiting example, a microbial tified by amplification and sequencing of the 16S rRNA gene. composition e.g. an ethanol treated fecal Suspension can be For Sample1, colonies were counted on plates from the pre assayed for the presence of residual Bifidobacterium species ethanol 20% Suspension and used to back-calculate a concen by plating to selective media. A 20% suspension of feces tration of 4.75 Log CFU/mL of presumptive Enterococcus treated with 50% ethanol for 1 hr was assayed by creating 10 (3.75 Log reduction in titer to limit of detection) (Table 11). fold serial dilutions and plated to Bifidobacterium Selective Four presumptive Enterococcus colonies from the pre-etha Agar (BIFIDO) (Anaerobe Systems #AS-6423) and Rafi nol 20% suspension were picked for 16S rDNA amplification nose-Bifidobacterium Agar (Hartemink, et. al., Journal of and sequencing and identified as Streptococcous bovis and Microbiological Methods, 1996). Bifidobacterium Selective Streptococcus pasteurianus (Table 9). For Sample2, colonies Agar (BIFIDO) is a selective medium for the isolation and were counted on plates from the pre-ethanol 20% suspension enumeration of Bifidobacterium species. BIFIDO contains and used to back-calculate a concentration of 5.14 Log CFU/ Reinforced Clostridial Agar as the basal medium and Poly mL of presumptive Enterococcus (4.14 Log reduction in titer mixin, Kanamycin, and Nalidixic acid as selective agents. to limit of detection) (Table 12). Four presumptive Entero The differential compounds of iodoacetate and 2, 3, 5-triph coccus colonies from the pre-ethanol 20% suspension were enyltetrazolium chloride are also added. Raffinose-Bifido picked for 16S rDNA amplification and sequencing and iden bacterium Agar medium owes its selectivity to the presence tified as Enterococcus faecium (Table 10). of propionate (15 g/L) and lithium chloride (3 g/L) as inhibi tory agents, and raffinose (7.5 g/L) as a selective carbon Example 29 Source. In addition, casein (5 g/L) is used as a protein source, which results in a Zone of precipitation around the colonies of Residual Assay for Gram-Positive Aerobic bifidobacteria. Plates were incubated anaerobically at 37° C. Organisms (Streptococcus spp Assay) for 48 hr. After incubation colonies were counted and used to 0280. As a specific non-limiting example, a microbial back calculate the concentration of residual viable cells of composition e.g. an ethanol treated fecal Suspension can be Bifidobacterium. Any colonies which appear are considered assayed for the presence of residual Streptococcus species by presumptive Bifidobacterium species until confirmed by plating to selective media. A 20% suspension of feces treated identification by 16S rDNA amplification and sequencing. with 50% ethanol for 1 hr was assayed by creating 10 fold Colonies appearing on ethanol treated 20% fecal Suspension serial dilutions and plated to Mitis Salivarius Agar (BD were identified by 16S rDNA amplification and sequencing #229810). Enzymatic Digest of Casein and Enzymatic Digest (Tables 9 and 10). Selective media does not always counter of Animal Tissue provide carbon, nitrogen, and amino acids select all other species that might be present in the sample used for general growth requirements in Mitis Salivarius being plated. Any colonies that grow need to be identified by Agar. Sucrose and Dextrose are carbohydrate sources. Dipo amplification and sequencing of the 16S rRNA gene. tassium Phosphate is the buffering agent. Trypan Blue is absorbed by the colonies, producing a blue color. Crystal Example 31 Violet and Potassium Tellurite inhibit most Gram-negative bacilli and Gram-positive bacteria except streptococci. Agar Residual Assay for Determining the Limit of is the Solidifying agent. A pre-ethanol treatment sample was Detection of Gram-Positive Anaerobic Organisms in also plated in parallel. Plates were incubated aerobically at Ethanol Treated Feces (Enterococcus Assay) 37° C. for 48 hr. After incubation colonies were counted and 0282. A spiking experiment was performed to determine used to back calculate the concentration of residual viable the limit of detection of a representative Enterococcus isolate cells of Streptococcus. Based on colony counts for Sample 1 (Enterococcus durans) added to a microbial composition e.g. from the appropriate dilution plate a concentration of pre ethanol treated 20% fecal suspension. A 20% suspension of sumptive Streptococcus was determined to be 4.92 Log CFU/ feces was treated with ethanol for 1 hr. split into multiple mL for the pre-ethanol sample and 1 Log CFU/mL for the aliquots and then spiked with 0.77, 1.77, 2.77, 3.77 and 4.77 ethanol treated sample (3.92 Log reduction in titer) (Table Log CFU/mL of Enterococcus durans. Each sample was seri 11). Based on colony counts for Sample2 from the appropri ally diluted and 100 u, of each dilution was plated to Entero ate dilution plate a concentration of presumptive Streptococ coccosel Agar and then incubated aerobically for 48 hr. Based cus was determined to be 5.25 Log CFU/mL for the pre on colony counts a limit of detection of 58 CFU/mL was US 2016/0040215 A1 Feb. 11, 2016
determined for the assay in current format. The limit of detec etative cells via ethanol treatment, after multiple steps of tion could be reduced by plating additional Volume of sample washing to remove residual ethanol, Samples were collected to multiple plates and checking for colonies. The concentra for plating on Bacteroides Bile Esculin (BBE) agar and Mac tion of spiked E. durans was plotted against the value calcu Conkey II lactose agar. BBEagar is selective for the B. fragilis lated for colony counts on selective media (FIG. 10). Selec group of Gram-negative bacteria. MacConkey agar is selec tive media does not always prevent growth of all other species tive for Enterobacteriaceae and a variety of other Gram nega that might be present in the sample being plated. Any colonies tive bacteria. 100 uL of sample were plated on each plate type that grow need to be identified by amplification and sequenc and spread with a sterile spreader. The BBE agar plates were ing of the 16S rDNA gene. incubated anaerobically at 37° C. for 48 hours. The MacCo nkey plates were incubated aerobically at 37°C. for 48 hours. Example 32 After 48 hours, plates were inspected for the presence of colonies. The results are shown in this table: Selective Enrichment Through Addition of a Live 0290 Table 13 depicts the results of plating an ethanol Bacterial Culture treated fecal suspension on BBE and MacConkey II lactose 0283. The selective enrichment of a bacterial species or agar showing no residual colonies observed. The limit of clade can be achieved by first pre-treating a bacterial mixture detection of this method is ten colonies per ml of sample. with a pure culture of a particular bacterial or fungal species 0291 Table 14 depicts the results from Sabouraud Dex before plating to general or selective agarplates. The bacterial trose agar plating of fecal Suspensions before and after treat Suspension is mixed with a pure culture of a species which can ment with 50%. Ethanol. produce an antibiotic, bacteriocin, short chain fatty acid, Vita 0292 15% suspension samples from 4 different donors min, acidic end product, Sugar or other compounds which were treated with 50% ethanol for 1 hour. Samples were serial alter the media in a way to enrich for the bacterial species of diluted in 1xEBS and spot plated on Sabouraud Dextrose interest. The sample is then plated to a general nutrient or Agar both before and after ethanol treatment. Ethanol was selective media and incubated at 37 C for 1-5 days to grow washed out of each sample by centrifuging the sample at colonies. Plates are incubated either aerobically or anaerobi 13000 rpm, removing the Supernatant fluid, and resuspending cally depending on the growth requirements of the species the pellet in fresh 1xPBS. Plates were incubated at 30° C. being selected (See Tables 9-12 and FIG. 10. aerobically for 48 hours before analyzing colony counts. 0284 Table 9 depicts the 16S rDNA identification of Colonies were counted to determine the reduction in cfu/mL colony picks from plating a 20% fecal suspension (Sample1) due to treatment with ethanol. or from plating a ethanol treated Suspension to selective media (number of colony picks matching each species in 0293. The sensitivity of this method can be increased by parentheses). plating additional Volume of sample for enumeration. Alter 0285 Table 10 depicts the 16S rDNA identification of natively, an enrichment step can be added in which the sample colony picks from plating a 20% fecal Suspension (Sample2) is inoculated into growth medium and incubated for 24-48 h, or from plating a ethanol treated Suspension to selective followed by plating to BBE or MacConkey lactose agar. media (number of colony picks matching each species in Detection of any colony forming units would indicate the parentheses). presence of organisms. 0286 Table 11 depicts the estimated concentration of a 20% fecal Suspension and the ethanol treated spore compo Example 34 sition Colonies were counted from plating a 20% feces sus pension (Sample 1) or ethanol treated Suspension to selective Enrichment of a Spore Fraction by Chromatographic media and used to back-calculate the concentration of pre Separation from a Microbial Compositions Sumptive cells in each sample (Log CFU/mL). 0294. A microbial composition sample is pelleted by cen 0287 Table 12 depicts the estimated concentration of a trifugation at 15,000xg for 15 minutes at 4°C. and is resus 20% fecal Suspension and the ethanol treated spore compo pended phosphate buffered saline supplemented with NaCl to sition Colonies were counted from plating a 20% feces sus a final concentration of 4M total salt and contacted with octyl pension (Sample2) or ethanol treated Suspension to selective Sepharose 4 Fast Flow to bind the hydrophobic sporefraction. media and used to back-calculate the concentration of pre The resin is washed with 4MNaCl to remove less hydropho Sumptive cells in each sample (Log CFU/mL). bic components, and the spores are eluted with distilled water, 0288 FIG. 10 depicts the correlation between concentra and the desired enriched spore fraction is collected via UV tion of E. durans spiked into 20% ethanol treated feces and absorbance. Bacterial identification in the spore fraction can concentration calculated from colony counts on selective then proceed by the genomic and microbiological methods media (Enterococcosel Agar). described herein. Example 33 Example 35 Screening of Ethanol-Treated Fecal Samples for the Presence of Ethanol-Sensitive Gram-Negative Spore Purification by Chromatographic Separation Aerobic and Anaerobic Bacteria of Fecal Material 0289. As a specific non-limiting example, a microbial 0295) A spore-enriched population such as obtained from composition e.g. spore fraction derived from fecal material as Examples 1-5 above, is mixed with NaCl to a final concen previously described was used. Briefly, the suspensions of tration of 4M total salt and contacted with octyl Sepharose 4 fecal material were treated with 200-proof ethanol at a 50% Fast Flow to bind the hydrophobic sporefraction. The resin is V/v concentration for 1 hour. To characterize killing of veg washed with 4MNaCl to remove less hydrophobic compo US 2016/0040215 A1 Feb. 11, 2016 34 nents, and the spores are eluted with distilled water, and the 0299 Two species-specific MAbs of pathogen specific desired enriched spore fraction is collected via UV absor Surface marker e.g. E. bieneusi spore walls are produced as bance. described previously (e.g. see Harlow and Lane, Antibodies: a laboratory Manual, 1988 or Accoceberry, I., M. Thellier, I. Example 36 Desportes-Livage, A. Achbarou, S. Biligui, M. Danis, and A. Datry. 1999. Production of monoclonal antibodies directed Spore Purification by Filtration of Fecal Material against the microsporidium Enterocytozoon bieneusi. J. Clin. Microbiol. 37: 4107-4112). Briefly, 6E52D9, isotyped as 0296 To reduce residual habitat products from a microbial IgG2a, is directed against the exospore, and 3B82H2, iso composition filtration protocol is used. As a specific non typed as IgM, is directed against the endospore. The MAbs limiting example the ethanol treated fecal Suspension is used are purified from hybridoma culture supernatants by affinity as the microbial composition. The ethanol treated fecal sus protein A chromatography for the 6E52D9 MAb and with pension (e.g. see example 9) above is diluted 1:10 with PBS, Dynabead M-450 rat anti-mouse IgM (Dynal, Compiegne, and placed in the reservoir vessel of a tangential flow micro France), according to the manufacturers instructions, for the filtration system. A 0.2 um pore size mixed cellulose ester 3B82H2MAb. The purified supernatants are stored at -20°C. hydrophilic tangential flow filter is connected to the reservoir until their use. The 6E52D9 IgG2a can be used as ligand in the Such as by a tubing loop. The diluted spore preparation is immunoaffinity process. A total of 2x 106 cells from the recirculated through the loop by pumping, and the pressure hybridoma line are injected via the intraperitoneal route into gradient across the walls of the microfilter forces the super pristane-primed female BALB/c mice (Charles River Labo natant liquid through the filter pores. By appropriate selection ratories, Saint-Aubain-les-Elbeuf, France) to produce ascitic of the filter pore size the desired bacterial spores are retained, fluid that is collected 10 to 15 days later. The ascitic fluids while Smaller contaminants such as cellular debris, and other generated are incubated 1 h at 37° C. and overnight at 4°C. contaminants in feces Such as bacteriophage pass through the and then centrifuged at 3,000xg for 10 min. The supernatants filter. Fresh PBS buffer is added to the reservoir periodically are collected and Screened by an immunofluorescence anti to enhance the washout of the contaminants. At the end of the body test (see below) using purified E. bieneusispores or the diafiltration, the spores are concentrated approximately ten antigen to which the antibodies are raised against, as previ fold to the original concentration. The purified spores are ously described (e.g. see Harlow and Lane, Antibodies: a collected from the reservoir and stored as provided herein. laboratory Manual, 1988 or Accoceberry, I., M. Thellier, I. Desportes-Livage, A. Achbarou, S. Biligui, M. Danis, and A. Example 37 Datry. 1999. Production of monoclonal antibodies directed against the microsporidium Enterocytozoon bieneusi. J. Clin. Enrichment of Microbes by Affinity Microbiol. 37: 4107-4112). Asciitic fluids yielding high titers Chromatography are pooled, precipitated by adding an equal Volume of Satu 0297 Microbes including but not limited to bacteria, fun rated ammonium sulfate, and incubated at 4°C. for 4 h. The gus, virus, and phage contain immunogenic proteins, lipids, purified mouse immunoglobulin is recovered by centrifuga and other chemical moieties on their surfaces that can be used tion at 10,000xg at 4°C. for 20 min. The pellet is dissolved in to specifically identify and serve as means to purify these a small volume of 0.05 M Tris-HCl (pH 9) and injected into a components from a composition. With an appropriate affinity desalting Sephadex G-25 column (Amersham Pharmacia reagent including e.g. antibody, receptor, etc, specific Biotech, Saclay, France) equilibrated with 1 MNaCl-0.05 M microbes are selectively enriched from a microbial mixture as Tris-HCl (pH 9) to remove the residual ammonium sulfate previously described (Accoceberry et al One Step Purifica and condition the MAb in the binding buffer. Alternatively, if tion of Enterocytozoon bieneusi Spores from Human Stools recombinant antigen is used to generate the antibody, an by immunoaffinity expanded bed adsorption (EBA). J. of affinity matrix of the antigen can be used to purify antibodies Clinical Microbiology, 39(5). 2001). As a specific, non-lim from the Supernatant of the hybridomas. Immunoglobulin iting example of the method, Enterocytozoon bieneusispores content can be determined by absorbance at 280 nm using a can be enriched by from a microbial composition e.g. stool. UV spectrophotometer or by Bradford assay. Briefly a 1 kg scale, and a stomacher BagMixer (Inter 0300 Immunofluorescence Antibody Test science, cat #023 230) is placed in the hood to allow all work 0301 Briefly, the antigen is applied to 18-well slides (2 ml to be done within containment. A 125 g stool sample is per 5-mm well) and incubated sequentially with purified transferred to a filter bag. 475 mL of suspension solution supernatants, diluted at 1:64 in 0.1% bovine serum albumin in (0.9% saline, 18.75% glycerol) is added to the bag. The bag is PBS, and fluorescein isothiocyanate-labeled goat antimouse clamped in place in an Interscience BagMixer for 30 seconds IgG-IgM-IgA (1:200 dilution; Sigma Laboratories). Slides to produce a slurry. The microbial sample is then removed are washed, mounted with buffered glycerol mounting fluid, from the filtered side of the bag for further enrichment. The and examined with epifluorescence microscope using stan microbial sample is centrifuged at 500xg for 6 minto elimi dard techniques. Alternatively a western blot or ELISA assay nate large particles, and the sieved spores in the Supernatant is used to determine the antibody production of a hybridoma are pelleted by centrifugation at 2,500xg for 20 min. The Supernatant using the antigen e.g. recombinant protein from pellet was resuspended in PBS (/3 vol/voll) to produce a the Surface of the pathogen, purified protein from Surface of 25% slurry. Penicillin (5 IU/ml) and streptomycin (100 the pathogen, whole pathogen (ELISA only). mg/ml) are added to the final slurry. For a microbial compo 0302 Chromatographic System and EBA Method sition one can simply resuspend the the material in buffer to 0303. The chromatographies are performed with fast-pro generate an appropriate Suspension for further enrichment. tein liquid chromatography and Biopilot workstations (Am 0298 Production of Monoclonal Antibodies (MAbs) to a ersham Pharmacia Biotech). The Streamline rProtein A Microbial Contaminant or Pathogen matrix (Amersham Pharmacia Biotech) is used for EBA of US 2016/0040215 A1 Feb. 11, 2016 immunoglobulins. rProtein A is a recombinant protein. The antibody or receptor to a surface marker can be generated base matrix is a 4% agarose derivative with an inert metal (e.g. see example 37) and fluorescently labeled by a variety of alloy core that provides the density required to use the adsor methods known to one skilled in the art via biochemical bent in expanded-bed mode. These porous beads have a size conjugation techniques previously described (e.g. see Her distribution of 80 to 165mmanda particle density of 1.3 g/ml. manson. Bioconjugation, 2008) to commercially available The matrix is poured into a Streamline 25 column (Amer fluorescent dyes, quantum dots, and fluorescent proteins. The sham Pharmacia Biotech). This is a glass column with an process can be multiplexed to identify and enrich multiple inner diameter of 25 mm, with a specially designed liquid different specific bacteria in the same microbial composition distributor at the base of the column and a top mobile adapter. by labeling different specific antibody reagents with different The bed is expanded by upward liquid flow. Adsorbent par color dyes. The single or multiple fluorescent antibody mix is ticles are suspended in equilibrium due to the balance incubated with a microbial composition for 16 hours at 4°C. between particle sedimentation velocity and upward flow. to allow the fluorescent labeled antibodies to bind the specific The sample is applied to the expanded bed with an upward bacteria of interest. Multiple wash steps are performed by flow. Target molecules and cells are captured on the adsorbent pelleting the cells at 16,000xg for 5 minutes, resuspending while cell debris, cells, particulates, and contaminants pass with PBS, and repeating the process 5 times. The microbial through unhindered. Flow is then reversed. The adsorbent composition can then be sorted on a flow cytometer enriching particles settle quickly and target molecules are desorbed by the population of fluorescently labeled microbes. Unlabeled an elution buffer, as in conventional packed-bed chromatog cells can serve as controls to establish appropriate gates to raphy. The column is prepared by flowing the purified anti identify fluorescent signal from background. Additionally, body specific to the microbe to be purified and enriched e.g. recombinant cells expressing ectopic Surface antigens can be an antibody specific to Enterocytozoons bieneusi and allow used as positive controls in a mixture of labeled cells and ing it to bind to the rProtein A matrix. It is then crosslinked known ratios of antigen positive cells and antigen negative and quenched. The column is then washed with PBS buffer to cells can be mixed to establish and validate the technique. The remove excess antibody and cross linker as previously sorted cells can then be cultured or directly assessed via described (Reeves, H. C., R. Heeren, and P. Malloy. 1981. genetic techniques e.g. 16S sequencing to confirm the sero Enzyme purification using antibody crosslinked to protein A logical identity of the enriched cells. Furthermore, a nonspe agarose: application to Escherichia coli NADP-isocitrate cific dye or light scattering properties can be used to assess dehydrogenase. Anal. Biochem. 115:194-196) total microbial cell counts in a separate sample of cells from 0304 Purifying Bacterial Spores from a Microbial Sus the microbial Suspension. pension 0307 As an alternative method, a microbial suspension 0305. A microbial suspension (75 ml) is injected into the sample can be fixed, permeabilized, labeled by fluorescent in prepared column and incubated with the gel at room tempera situ hybridization (FISH) with specific fluorescently labeled ture overnight. The gel is then expanded and washed, to oligonucleotide probes to specific 16S rRNA hypervariable remove all large particles and unbound spores, at an upward sequences and Submitted for flow cytometry as previously flow velocity of 32 ml/min, until the UV baseline is reached. described (e.g. see Zoetendal, E. G. et al. Quantification of PBS buffer (pH 7.2) is used during expansion and washing. Uncultured Ruminococcus obeum-Like Bacteria in Human The workstation pump is then turned off to allow the bed to Fecal Samples by Fluorescent InSitu Hybridization and Flow settle. The column adapter was moved down toward the sedi Cytometry Using 16S rRNA-Targeted Probes. Applied Envi mented bed surface. After a wash with PBS, the run is per ronmental Microbiology (2002)). Nonspecific dyes like pro formed at a downward flow rate of 15 ml/min. The elution pidium iodide can be used to count total cell number in one buffer is run at the same flow rate. Several potential elution sample and unlabeled cells can be used as negative controls to buffers are tested to determine the proper conditions empiri establish gates for Fluorescence Assisted Cell Sorting cally. The conditions that can be tested include the following: (FACS). glycine at 50 mM (pH 2.49), ethylene glycol at 25%, 4 M 0308. Once sorted these enriched cells can be submitted guanidine HCl, and 6 M guanidine HC1. The elution fractions for 16S sequence analysis to further validate and confirm the are then collected into 50-ml Falcon centrifuge tubes, sedi cell identity. mented at 2,500xg for 20 min, and washed four times by centrifugation in PBS to remove residual elution buffer. The Example 39 pellets are pooled, resuspended in 5 ml of PBS, and stored at 4°C. Resulting spores or bacteria can be further analyzed by Use of Phage to Destroy Abundant Microbes genetic or serological methods. Resulting in Enrichment of Resistant Microbes of Interest from a Microbial Composition Example 38 0309. A major issue in detecting low levels of a contami Serological Identification and Enrichment by Flow nant of interest is the relatively high levels of other microbes Cytometry in a microbial composition. One method of enriching a patho gen for further isolation and identification involves using a 0306 Single cells and microbes including but not limited bacteriophage to lyse the abundant microbes in the composi to bacteria and fungi are isolated, enriched, and identified by tion leaving only phage resistant microbes including the con flow cytometry from a microbial composition using fluores taminants of interest. As a specific example, phage phi-CD27 cently labeled tags. These methods have been described pre isolated previously (e.g. see Mayer, M. J., Narbad, A. & viously (Nebe-von-Caron, G., Stephens, P. J. & Hewitt, C.J. Gasson, M. J. Molecular Characterization of a Clostridium Analysis of bacterial function by multi-colour fluorescence difficile Bacteriophage and Its Cloned Biologically Active flow cytometry and single cell sorting. Journal of Microbio Endolysin. Journal of Bacteriology 190, 6734-6740, 2008) is logical Methods, 2000). Briefly, a specific affinity reagent e.g. used to clear out clostridium species from a mixed microbial US 2016/0040215 A1 Feb. 11, 2016 36 composition. Additionally, phage identified from various ods are used to build other phage to detect other microbes Sources known to infect Bacteroides species (e.g. Payan, A. et permissive to othorthogal phage infection. al. Method for Isolation of Bacteroides Bacteriophage Host Strains Suitable for Tracking Sources of Fecal Pollution in Example 41 Water. Applied and Environmental Microbiology 71, 5659 5662, 2005) is isolated and used to clear abundant bacteria in Selective Removal of Microbes by Targeting a Toxic a microbial composition leaving behind viable, enriched con Substrate to Undesired Cells taminant microbes resistant to the exogenously added phage. 0312 Abundant and unwanted species of microbes con The procedure involves mixing high titer of known phage to tained in a microbial composition can be selectively inacti a microbial sample, incubating for a period of time for infec vated by targeting a toxin or toxigenic Substances to these tion and lysis to occur. Afterward, the remaining microbes can bacteria via an affinity reagent. Specifically, a Nile blue be pelleted and washed of extraneous cell debris repeatedly EtNBS compound, 5-ethylamino-9-diethylaminobenzo a leaving only viable microbes of interest behind. Alternatively phenthiazinium chloride described previously (see Vecchio, washes are performed by using a 1 um filter trapping larger D. et al. Structure-function relationships of Nile blue (Et microbes of interest while allowing phage and Small lysed NBS) derivatives as antimicrobial photosensitizers. Euro particulate to be washed away. Subsequent microbes can be pean Journal of Medicinal Chemistry (2014). doi:10.1016/j. further cultured, enriched or identified and detected by other ejmech.2014.01.064) is conjugated to an affinity reagent e.g. methods described herein. antibody selective for a particular microbe as described (see e.g. example 37 and Hermanson, Bioconjugation. Pierce, Example 40 2008). This reagent is added to a sample of the microbial composition and incubated for 16 hours at 4°C. in the dark. Use of Phage to Detect Pathogens of Interest from The microbial composition can then be pelleted by centrifu Microbial Composition gation at 10,000xg for 10 min and washed by repeating this 0310. As a specific non-limiting example of the use of a procedure five times to remove excess antibody conjugate. phage for detection and biosensor, recombinant phage Resuspending the microbial composition in PBS and expos expressing reporter genes are used to detect a pathogen of ing the sample to 635 nm light at 50 mW/cm2 for 1 minute to interest at low levels in a microbial composition as previously 1 hour will result in the production of radical oxygen species described (e.g. see Loessner, M.J., Rudolf, M. & Scherer, S. that can damage cellular components. The high local concen Evaluation of luciferase reporterbacteriophage A511:luxAB tration of the photosensitizer results in damage preferentially for detection of Listeria monocytogenes in contaminated occurring to the unwanted cells bound by the antibody con foods. Applied and environmental Microbiology, 1997). jugate. The microbial composition can then be washed of Briefly, the bacteriophage A511::luxAB detects listeria by inactivated cells or further enriched and analyzed by tech transducing the bioluminescence protein bacterial luciferase niques presented herein. (luxAB) generating a luminescence when decanal or other Substrate is added to the sample. To test a microbial compo Example 42 sition for the presence of listeria, test samples of the micro bial composition are added to Brain heart infusion (BHI) Selective Killing of Microbes Recognized by medium (Oxoid) and incubated for 2 days at 30° C. as an Antibodies when Serum is Added initial enrichment step. Samples of 1 mL are removed from 0313 To enrich the pathogenic or contaminant microbes the enrichment cultures and are transferred to 4 mL of 0.5x to be detected in a microbial composition, serum based inac BHI broth, and incubated at 30° C. for 2 h. Duplicate 1-mL tivation is used to eliminate the microbial composition that portions of each sample are mixed with 30 ul of phage would interfere with downstream assays. As a non-limiting, suspension (3x108 A511:lux AB Plaque forming units specific example, Pseudomonas aeruginosa is removed from (PFU), which are pre-dispensed into clear polystyrene tubes a mixture containing Salmonella as previously described (75 by 12 mm; Sarstedt) suitable for the luminometer. For (Xiao et al New role of antibody in bacterial isolation J of expression of phage-encoded luciferase, samples are incu AOAC Int. 95: 1. 2012). Briefly, a rabbit polyclonal antibody bated at 20° C. for 140 min, before bioluminescence is mea against P aeruginosa is prepared by inoculating four New Sured in a photon-counting, single-tube luminometer (Lumat Zealand rabbits with the pathogen P. aeruginosa. The antise LB 95.01/16; Berthold). Following injection of 50ul of 0.25% rum is purified using Saturated ammonium Sulfate and added nonanal (Aldrich) in 70% ethanol, light emission was deter into Rappaport-Vassiliadis medium with soya (RVS) broth mined with a 0.5-s delay and the output was integrated over a and Muller-Kauffmann tetrathionate novobiocin broth 10-s period. Results are expressed in relative light units (MKTTn broth) to evaluate whether it could inhibit the (RLU), as a mean value from the duplicate tubes. Negative growth of P aeruginosa. Alternatively, methods previously controls are samples without the lux phage added and vehicle described for producing monoclonal antibodies could be used with lux phage only. A sample is considered positive for (e.g. see example 37) and added to the medias above to Listeria when the phage-infected tube yields RLU at least 100 observe inhibition. Observations by scanning electron above the background level indicated by the negative control. microscopy are used to demonstrate that P aeruginosa is 0311 Recombinant methods for building such a phage attacked and destroyed by the antibody when incubated for 10 starting with a wild-type strain are known to one skilled in the minat37°C. The activity of the antibody is also tested against art and have been previously described (e.g. see Loessner, M. other strains of P aeruginosa. Twenty-six strains of Salmo J., Rees, C. E., Stewart, G. S. & Scherer, S. Construction of nella are mixed with Paeruginosa in RVS and MKTTnbroth luciferase reporterbacteriophage A511::luxAB for rapid and at 37 C for 12 h, respectively, and the cultures are plated on sensitive detection of viable Listeria cells. Applied and Envi Salmonella chromogenic medium (SCM; Oxoid, Basing ronmental Microbiology 62, 1133-1140, 1996). These meth stoke, UK) to validate the effectiveness of the antibody in a US 2016/0040215 A1 Feb. 11, 2016 37 defined microbial composition. The experiment is then Example 44 repeated in other microbial compositions as a mechanism for enriching Salmonella. It is expected that only Salmonella will Removal of Contaminating DNA Sequences. Using grew on SCM; five colonies are randomly selected for iden the CRISPrSystem tification by VITEK 2 (bioMerieux, Lyon, France) or other previously defined methods (e.g. see examples 1, 3, 4). Addi 0317. The CRISPr system can specifically cleave undes tionally, this method can be multiplexed for multiple patho ired nucleic acid sequences and thus reduce their contaminat gens of interest by adding a cocktail of antibodies to the ing effects on downstream DNA detection methods. Systems microbial composition to inactivate other non-pathogens. like those described previously (e.g. see Jinek et al. A pro Other methods previously described herein are used to iden grammable Dual-RNA-Guided DNA endonuclease in adap tify and further enrich pathogens for detection purposes. tive bacterial immunity. Science. 2012) are used to perform this cleavage of contaminating DNA in vitro. Briefly, the Example 43 CRISPr protein complex is purified, synthetic RNAs designed to guide the system to cleave target sequences are loaded onto the system, and the complex is incubated with the Purification of DNA Sequences on a Bead Matrix DNA sample of interest to allow cleavage to ensue. Alterna tively, there are several commercial sources for the generation 0314. The limit of detection for determining the presence of specific custom CRISPr systems to perform cleavage and of a particular nucleic acid sequence can be problematic if the these are amenable to in vitro cleavage techniques (e.g. see abundance of a sequence of interest is so low that it is not Sigma and Blue Heron). present in 1-2 ug for PCR amplification. Using techniques described above, DNA is purified from a microbial sample. 0318 Purification of the Cas9 System To enrich sequences of interest, an amount of greater than 0319. The Cas9-CRISPR is commercially available and used for PCR is enriched for sequences of interest by contact reagents are purchased from Sigma and all reagents can be ing the sample with a solid phase comprising bound DNA designed according to the manufacturers instructions. oligonucleotides that selectively bind to sequences of interest (http://www.sigmaaldrich.com/catalog/product/sigma/ via hybridization and thus enrich them. Suitable solid phase crispr?lang=en®ion=US). Alternatively, the following materials include, by way of example and without limitation, protocol contains the protocol to produce a custom system polystyrene or magnetic beads, silicon chip surfaces, silica based on the work previously published. Briefly, the sequence beads, or other suitable systems known to one skilled in the encoding Cas9 (residues 1-1368) on a custom pET-based art. As a specific non-limiting example, short oligonucle expression vector using ligation-independent cloning (LIC) otides (20-60 bp) are synthesized with biotin at the 5' or 3' is used for this protocolas previously described (Jineketal A ends and are bound to magnetic streptavidin beads (Life programmable Dual-RNA-Guided DNA endonuclease in Sciences). Alternatively, longer probes are developed by adaptive bacterial immunity. Science. 2012.) The resulting using the biotinylated oligonucleotides as PCR primers to fusion construct contained an N-terminal hexahistidine-mal amplify sequences of interest, purifying these longer probes, tose binding protein (His6-MBP) tag, followed by a peptide attaching them to the bead matrix and washing away the sequence containing a tobacco etch virus (TEV) protease complementary strand not labeled with biotin under condi cleavage site is expressed in in E. coli strain BL21 Rosetta 2 tions that denature DNA but not the biotin streptavidin link (DE3) (EMDBiosciences), grown in 2xTY medium at 18°C. age (Holmberget al. The biotin streptavidin interaction can be for 16h following induction with 0.2 mM IPTG. The protein reversibly broken using water at elevated temperatures, Elec was purified by a combination of affinity, ion exchange and trophoresis 26:501-510, 2005). Alternative methods for size exclusion chromatographic steps. Briefly, cells are lysed attaching probes to beads are also possible and have been in 20 mM Tris pH 8.0, 500 mM. NaCl, 1 mMTCEP (supple previously described (e.g. see U.S. Pat. No. 6,288,220 B1, mented with protease inhibitor cocktail (Roche)) in a homog Biophysical Journal 71, 1079-1086 (1996), and Analytical enizer (Avestin). Clarified lysate is bound in batch to Ni-NTA Biochemistry 247, 96-101 (1997)). agarose (Qiagen). The resin is washed extensively with 20 mM Tris pH 8.0, 500 mM NaCl and the bound protein is 0315. With the probe-bead complex generated, one can eluted in 20 mM Tris pH 8.0, 250 mM. NaCl, 10% glycerol. contact nucleic acid derived from the sample with the beads The His6-MBP affinity tag is removed by cleavage with TEV and incubate the mixture at a suitable temperature to allow the protease, while the protein is dialyzed overnight against 20 probes to capture the nucleic acid sequences of interest. The mM HEPES pH 7.5, 150 mM KC1, 1 mM TCEP, 10% glyc undesired, non-hybridizing nucleic acid can then be washed erol. The cleaved Cas9 protein is separated from the fusion away. The captured DNA can be separated from the substrate tag by purification on a 5 ml SP Sepharose HiTrap column using conditions that denature the hybrid including heat or (GE Life Sciences), eluting with a linear gradient of 100 alkaline pH, known to one skilled in the art, or by detaching mM-1 M KC1. The protein is further purified by size exclu the probe from the bead by treating the sample with condi sion chromatography on a Superdex 200 16/60 column in 20 tions that break the biotin streptavidin interaction (Holmberg mM HEPES pH 7.5, 150 mM KCl and 1 mM TCEP. Eluted et al. The biotin streptavidin interaction can be reversibly protein is concentrated to -8 mg ml-1, flash-frozen in liquid broken using water at elevated temperatures, Electrophoresis nitrogen and stored at -80°C. Optionally, all four Cas9 pro 26:501-510, 2005). teins are purified by an additional heparin Sepharose step 0316 The enriched DNA sequences can then be prior to gel filtration, eluting the bound protein with a linear sequenced by techniques described (see e.g. examples 3 and gradient of 100 mM-2M KC1. All proteins are concentrated to 4) or detected by qPCR based techniques to quantify the 1-8 mg ml-1 in 20 mM HEPES pH 7.5, 150 mM KCl and 1 amount of a particular DNA sequence present. mMTCEP flash-frozen in liquid N2 and stored at -80° C. US 2016/0040215 A1 Feb. 11, 2016
0320 Template RNA Generation using this method, the Volume of liquid or resuspended 0321 Templates for cleaving undesired sequences are sample used for this technique should be chosen to ensure less cloned onto an appropriate plasmid based vector containing a than 300 cfu are present. To ensure this concentration in an T7 flash transcription site by standard molecular biological unknown sample, multiple dilutions of the test Suspension techniques known to one skilled in the art (Sambrook and should be performed and tested to determine the appropriate Russell, Molecular Cloning, a laboratory manual, third edi dilution factor and back calculate the concentration of micro tion, 2001). As a non-limiting specific example, short 16S organisms. For example if 10 ml of sample is to be applied to sequences from bacteria found in the microbial composition the filter then less than 30 cfu/ml should be present in the can be cloned and Subsequently generate RNA based tem Solution. As a nonlimiting example a culture of A. brasiliensis plates to remove dominant 16S sequences leaving behind 16S and C. albicans is prepared and tested with the EZ-FluoTM sequences that are derived from pathogenic species. These Rapid Detection System (EMD Millipore, Billerica, Mass.) sequences are designed as follows: ~21 nucleotides of as previously described (e.g. see http://www.foodsafet complementarity to the 16S region to be cleaved with an extra ymagazine.com/signature-series/rapid-detection-of-micro GG sequence at the followed by the tracrRNA sequence organisms-in-food-and-beverage-by-fluorescence?). Briefly, described previously (see Sigma, http://www.sigmaaldrich. C. albicans and A. brasiliensis are spiked are spiked into comitechnical-documents/articles/biology/crispr-cas9-ge sterile liquid media at 50-70 cfu/mL. 2 and 3 ml of solution is nome-editing.html). The short 16S regions will be cloned into used on culture or optionally 2 and 3 ml are diluted to 10 ml the CRISPr gene in the spacer regions with the appropriate in sterile culture and applied to the membrane. RNA based motifs in the repeat regions required for proper 0325 The following steps are performed in accordance Cas9 processing. Importantly the protospacer adjacent motif with the EZ-Fluo rapid detection method. The sample is fil (PAM) must be considered when designing where the tem tered over the appropriate membrane according to the manu plate will cut and must be present in the DNA sequence that facturing instructions with a vacuum manifold device as pre will be cut. Various cas9 systems have different PAM viously describe (e.g. see Microfilr) & S-PakR Membrane sequences to further expand the utility of this method. RNA Filters/Microfil R & EZ-Pak(R) Systems User Guide and EZ templates are in vitro transcribed using T7 Flash in vitro StreamTM Pump User Guide, EMD Millipore). The mem Transcription Kit (Epicentre, Illumina company) and PCR brane is then transferred into a Petri-Pad Petridish containing generated DNA templates carrying a T7 promoter sequence. EZ-Fluo reagent for 30 minutes at 30-35° C. Fluorescent RNAS are gel-purified and quality-checked prior to use. micro-colonies are counted using the EZ-fluo reader and 0322 Cleavage of Undesired Sequences camera reading assistance (optionally) to facilitate counting. 0323 Synthetic or in vitro-transcribed RNAs are pre-an As a confirmatory test the membrane can be incubated on a nealed prior to the reaction by heating to 95°C. and slowly petri dish with various media to transfer colonies and these cooling down to room temperature. The DNA sample is incu colonies can be grown as previously described in aforemen bated for 60 min at 37°C. with purified Cas9 protein mixture tioned examples for Subsequent analysis and detection by (50-500 nM) and RNA duplex (50-500 nM, 1:1) in a Cas9 genomic or microbiological mechanisms described herein. plasmid cleavage buffer (20 mM HEPES pH 7.5, 150 mM KC1, 0.5 mM DTT, 0.1 mM EDTA) with or without 10 mM Example 46 MgCl2. Higher concentrations of Cas9 and guide RNA can be added to Scale the process up or longer incubation times can Identifying Pathogenicity Islands and Molecular allow for more complete cleavage of undesired DNA Detection of Components in a Microbial sequences. The reactions are stopped with 5x loading buffer Composition containing 50 mM Tris PH8.0 and 250 mM EDTA with 50% 0326 To validate the microbial composition is substan glycerol, and are resolved by 0.8 or 1% agarose gel electro tially free of pathogens, virulence factors and mechanisms of phoresis and visualized by ethidium bromide staining by pathogenic horizontal gene transfer including but not limited standard techniques known to one skilled in the art. Alterna to pathogenicity island identification, plasmid identification, tively the DNA can be gel purified by phenol chloroform and transposon elements can be examined by genetic tech extraction, ethanol extraction or other comparable methods niques. As a non-limiting specific example, pathogenicity described herein or known to one skilled in the art. DNA can islands are identified in E. faecalis, validated by genetic then be further enriched, PCR amplified or sequenced by manipulation of the genome and tested in animal toxicology methods described herein. models, and finally developed into a screenable test using Example 45 PCR or other similar molecular tests. 0327. In the literature, a handful of E. faecalis genes have been characterized as virulence factors. They include the Rapid Detection of Microorganisms by Fluorescence genes in the cytolysin operon that encode a cytolytic toxin Methods (Coburnet al., 2003), the esp gene encoding a surface protein 0324. To enable the rapid detection of microorganisms that contributes to urinary tract colonization and biofilm for diluted to countable colonies a rapid detection test based on mation (Shankar et al., Infection derived Enterococcus faeca the EZ-fluo rapid detection system is described. The tech lis strains are enriched in esp., a gene encoding a novel Surface nique is a test for viable microorganisms and is not intrinsi protein, Infect Immun. 67(1) 1999 and Tendolkar et al., cally specific to any particular organism. One skilled in the art Enterococcal Surface protein, Esp, enhances biofilm forma will recognize many embodiments where a combination of tion by Enterococcus faecalis. Infect Immun. 72010). 2004), previous examples generating specific enrichment of micro and the agg gene encoding a surface protein necessary for organisms as previous steps to this Subsequent detection step conjugative gene transfer that also seems to enhance adher will produce specificity for detection of various organisms. ence to and internalization into eukaryotic cells (Rakita et al., To ensure appropriate quantification of microorganisms 1999; Vanek et al. 1999; Kreft et al., 1992; Olmsted et al., US 2016/0040215 A1 Feb. 11, 2016 39
1994; Waters et al., 2004). These traits are enriched in clinical techniques using affinity chromatography. The protein is then isolates as compared to isolates from healthy individuals used to produce two orthogonal antibodies by methods (Lempiainen et al., 2005), but the correlation between infec described herein (e.g. see Example 37 or Harlow and Lane, tion and characterized virulence traits is not absolute. Simi Antibodies: a laboratory Manual, 1988 or Accoceberry, I., M. larly, genetic loci that confer resistance to antibiotics such as Thellier, I. Desportes-Livage, A. Achbarou, S. Biligui, M. gentamicin and Vancomycin (Zervos et al., 1987; Boyce et al., Danis, and A. Datry. 1999. Production of monoclonal anti 1992) are enriched in clinical isolates, but are not essential for bodies directed against the microsporidium Enterocytozoon infection. bieneusi. J. Clin. Microbiol. 37: 4107-4112). The two anti 0328. Using esp gene to identify a possible larger cassette bodies are derived from two different organisms e.g. mouse conferring virulence, further elucidation of the pathogenicity and rabbit, or rabbit and rat and must be able to simulta island is determined by using one of the E. faecalis virulence neously bind to the toxin or protein product in order to con factors, esp. and sequencing 1000 random clones derived struct a sandwich ELISA assay. Monoclonal antibodies can from the genome of a Madison hospital outbreak strain also be used but should be derived from different animals and MMH594. Closer examination of the esp locus in MMH594 have unique, non-overlapping binding sites. Polyclonal anti and related Strains that turned up in a St. Louis hospital bodies derived from two different species from the a large outbreak revealed the presence of a pathogenicity island. antigenic fragment will have likely have this property. With a size of approximately 150 kb, a G+C content of 32% Optionally, the antibody reagents are generated from two (as compared to 38% for the rest of the genome), and termi different recombinant subunits of the same protein to ensure nally repeated 10 by flanking sequences, this element pos they can both bind and recognize non overlapping antigenic sesses all of the hallmarks of a typical pathogenicity island sites. (Shankar et al., 2002). The PAI codes for 129 open reading 0332 Kits are commercially available to generate an frames (ORFs), and includes a number of genes of unknown ELISA assay (Pierce Protein Biology Products, http://www. function in addition to the known virulence traits cytolysin, piercenet.com/cat/western-blotting-elisa-cell-imaging). Esp, and aggregation Substance. Importantly, the island Briefly, to perform an ELISA a first antibody or polyclonal encodes additional, previously unstudied genes with putative antibody preparation is immobilized to the surface of a 96 functions that could have important roles in adaptation and well plate by chemical conjugation or physical adsorption Survival in hostile environments. The lack of these genes in techniques known to one skilled in the art, and excess is most non-infection-derived E. faecalis isolates Suggests a washed away (e.g. see Hermanson. Bioconjugation, 2008). class of potential new targets associated with disease, that are Various dilutions of the test article, PBS buffer (negative not essential for the commensal behavior of the organism. As control), or buffer containing various concentrations of the Such, this genetic marker can serve as a molecular marker of recombinant protein or toxin (positive control), are then incu pathogenicity in a microbial composition. bated in separate wells of the plate for 16 hours at 4°C. with 0329. The roles of genes and gene products, including gentle rocking The wells are thenwashed to remove unbound toxins, in pathogenicity can be validated by deleting or dis material and the second orthogonal antibody is added, incu rupting these genes by standard genetic techniques and test bated for 1 hour, then washed five times. Finally the detection ing these strains in appropriate toxicology animal models. A antibody (e.g. rabbit anti-mouse) or probe (e.g. Streptavidin given gene may be deleted via recombination with a DNA with a label if the second antibody is biotinylated) is added molecule carrying a deletion of that gene (a molecule in containing either the fluorescent, chemiluminescent, enzyme which the coding region of the gene has been deleted and or other detection probe for 1 hour and subsequently washed flanking sequences have been joined to create a novel junc per the manufacturers instructions. Detection probe is used tion). The gene deletion sequence is created in vitro using to determine the quantitative amount of toxin present and standard molecular methods (e.g. see Sambrook and Russell, standard curves based on the positive control dilution are used Molecular cloning: a laboratory manual) and introduced into to estimate the amount of protein or toxin present in a test E. faecalis using conjugation or transformation (e.g., see solution. Test solutions derived from microbial compositions Kristich, et al. 2005). include but are not limited to the lysate of such microbial 0330. Once a specific gene or genomic loci is identified compositions, the spent media of a liquid culture from a and validated as important for conferring pathogenicity or as microbial composition, and other embodiments are easily being associated with a clinical isolates, or as a marker of a recognizable by one skilled in the art. One skilled in the art horizontal gene transfer element that carries pathogenicity will also recognize several embodiments of the antigen based factors, a molecular test is developed to detect the gene detection techniques or the genetic based techniques that are directly through qPCR techniques. Probes and appropriate provided herein. primers are designed by one skilled in the art (e.g. see example 3 and 5). The protocol described herein for qPCR is Example 47 then be performed on a microbial composition to identify the presence or absence of the pathogenic elements. Detection of C. difficile Toxin 0331 Alternatively, if the specific gene is a toxin or other 0333. To detect pathogenicity, toxins and other genes protein product e.g. esp that is highly expressed in the patho products unique to pathogens are used to detect the presence gen or present on the Surface, a recombinant version of the of a pathogen in a microbial composition. As a non-limiting whole gene or a smaller antigenic piece (e.g. the external example the following protocol demonstrates this methodol facing region of the gene of esp) of the gene is affinity tagged ogy for detecting C. difficile toxin in a microbial composition by a 6xHis tag, MBP or other common tags of the protein is as previously described (see e.g. Russman et al Evaluation of expressed in a common expression system e.g. E. coli, S. three rapid assays for detections of clostridium difficile toxin cerevisiae, S2 insect cells, or baculovirus infected SF9 A and toxin B in stool specimens. EurJ Clin Microbiol Infect expression systems and purified by standard biochemical Dis. 26: 115-119, 2007). The commercially available kits are US 2016/0040215 A1 Feb. 11, 2016 40 the rapid enzyme immunoassay Ridascreen Clostridium dif buffer concentrate with 9 parts distilled water. Any crystals ficile Toxin A/B (R-Biopharm, Darmstadt, Germany) test, the present in the concentrate must be dissolved beforehand by C. difficile Tox A/B II Assay (TechLab. Blacksburg, Va., warming in a water bath at 37° C. Place 1 ml RIDAS USA) and the ProSpecT C. difficile Toxin A/B Microplate CREENR sample dilution buffer Diluent-1 in a labelled test Assay (Remel, Lenexa, Kans., USA). Similar assays can be tube. Suck up liquid stool in a disposable pipette (Article no adapted for other toxin products and will be recognized as Z0001) until it passes the second thickening (approx. 100 ul) other embodiments of this protocol by one skilled in the art. and suspend it in the sample dilution buffer. With solid stools, All three enzyme immunoassays (EIA) used are qualitative take an equivalent amount (100 mg) with a spatula or a dis 96-well microplate assays to detect toxin A and toxin B of C. posable inoculation loop and Suspend it in solution. Homoge difficile. Assays are carried out and interpreted according to nise the stool Suspension by Suction and ejection from a the manufacturers’ instructions. All three tests are performed disposable pipette or, alternatively, by mixing in a Vortex from the same portion of stool homogenized with a wooden mixer. After leaving for a short time for the coarse stool applicator Stick on the same day, after a single thaw at room particles to settle, the clarified Supernatant of the stool Sus temperature of the stored specimen or alternatively by meth pension can be used directly in the test. If the test procedure is ods previously described herein. Optionally, other microbial carried out in an automated ELISA System, the Supernatant compositions are produced by alternative methods described must be particle-free. In this case, it is advisable to centrifuge hereinto generate a Suspension for testing. Washing of micro the sample at 2500 G for 5 minutes. In order to test colonies plates between steps is done manually. Microplates for all after culturing them on solid media (CCF agar or Schaedler assays are read spectrophotometrically. The C. difficile strain agar), remove them from the agar plate with an inoculation VPI 10463 (ATCC 43255) is used as an internal positive loop and suspend them in 1 ml sample dilution buffer Dilu control. ent-1 and mix well. After this, centrifuge the suspension (5 0334. In the RIDASCREENR) Clostridium difficile Toxin minutes at 2500 g). The clear supernatant can be used in the A/B test, monoclonal antibodies are used in a sandwich-type test directly. To test liquid cultures, suspend 100 ul of this in method. Monoclonal antibodies against toxins A and B of 1 ml sample dilution buffer Diluent 1 and mix well. After Clostridium difficile are bound to the surface of the microw this, centrifuge the suspension (5 minutes at 2500 g). The ells of the microtiterplate. A suspension of the stool sample to clear supernatant can be used in the test directly. After select be examined and the controls, together with biotinylated ing a Sufficient number of wells in the frame, pipette 2 drops monoclonal anti-toxin A and B antibodies (Conjugate 1), are (or 100 l) of positive control Control+, the sample dilution pipetted into the well in the microwell plate at ambient tem buffer Diluent 1 (negative control) or the stool suspension in perature (20-25° C.) for incubation. After a wash step, the wells. Then add 2 drops (100 ul) of the biotin-conjugated polystreptavidin peroxidase conjugate (Conjugate 2) is added antibody Conjugate 1 and, after mixing thoroughly (by lightly and the microwell plate incubated again at ambient tempera tapping on the edge of the plate), incubate at room tempera ture (20-25° C.). If toxin A and B are present in the stool ture (20-25°C.) for 60 minutes. Careful washing is important sample, a sandwich complex is formed made up of the immo in order to achieve the correct results and should therefore bilised antibodies, the toxins and the antibodies conjugated take place strictly according to the instructions. The incu with the biotine streptavidin peroxidase complex. Unbound bated substance in the wells must be emptied into a waste enzyme-labelled antibodies are removed in another washing container containing hypochlorite for disinfection. After this, step. After adding Substrate, the bound enzyme with positive knock out the plate onto absorbent paper in order to remove samples transforms the colourless Solution in the microwells the residual moisture. Then wash the plate 5 times using 300 in a blue Solution. By addition of stop reagent a colour ul wash buffer each time. RIDASCREENR) Clostridium difficile Toxin A/B 12-05-243 0336 Make sure that the wells are emptied completely by change from blue to yellow occurs. The measured absorbance knocking them out after each wash on a part of the absorbent of the colour is proportional to the concentration of the exist paper which is still dry and unused. Add 2 drops (100 ul) of ing Toxins A and B in the sample. The following protocol is the polystreptavidin peroxidase conjugate Conjugate 2 to the from the manufacturer instructions (e.g. see http://www.r- wells and incubate at room temperature (20-25°C.) for 30 biopharm.com/wp-content/uploads/items/ridascreen minutes. Repeat washing step then proceed. Add 2 drops (100 clostridium-difficile-toxin-ab-3865/C0801-Clostridium-dif ul) of substrate Substrate to each well. Then incubate the plate ficileToxin-AB 12-05-24 GB.pdf) and all references to at room temperature (20-25°C.) for 15 minutes in the dark. buffers are commercially available to allow the procedure to After this, stop the reaction by adding 1 drop (50 ul) of stop be performed) reagent Stop to each well. After carefully mixing (slight tip 0335 All reagents and the microwell plate Plate must be ping on the plate frame) the absorbance is measured at 450 nm brought to room temperature (20-25° C.) before use. The (optional: reference wavelength >600 nm). Then calibrate the microwell strips must not be removed from the aluminium Zero against air, that means without microtiter plate. In order bag until they have reached room temperature. The reagents to establish the cut-off, 0.15 extinction units are added to the must be thoroughly mixed immediately before use. After use, measured extinction for the negative control. Cut the microwell Strips (in sealed bags) and the reagents must be off=Extinction for the negative control+0.15. The quantita stored at 2-8°C. Once used, the microwell strips must not be tive change in color of the reagent can be measured with a used again. The reagents and microwell Strips must not be standard plate reader and positives are evaluated by standard used if the packaging is damaged or the vials are leaking. In techniques known to one skilled in the art e.g. 3 standard order to prevent cross contamination, the samples must be deviations above the negative control or significantly differ prevented from coming into direct contact with the kit com ent after multiple replicates are performed. ponents. The test must not be carried out in direct sunlight. We 0337 The CBA (C. difficile TOX-B Test: TechLab) is per recommend that the microwell plate becovered or sealed with formed either with Supernatants from stool suspensions. The film in order to prevent evaporation losses. Mix 1 part wash cytotoxin assay is carried out in 96-well plates according to US 2016/0040215 A1 Feb. 11, 2016
the manufacturer's instructions using Vero cells (ATCCCCL Keystone node is defined as one that occurs in a sample 81). Briefly, Vero cells are incubated with the respective phenotype of interest such as but not limited to “health' and supernatants for 48 h. Cells are checked for cytotoxic effects simultaneously does not occur in a sample phenotype that is after 24 and 48 h. not of interest such as but not limited to “disease. Optionally, a Keystone Node is defined as one that is shown to be signifi Example 47 cantly different from what is observed using permuted test datasets to measure significance. Identification of Keystone OTUs and Functions Example 48 0338. The human body is an ecosystem in which the microbiota, and the microbiome, play a significant role in the Microbial Population (Engraftment and basic healthy function of human systems (e.g. metabolic, Augmentation) and Reduction of Pathogen Carriage immunological, and neurological). The microbiota and resulting microbiome comprise an ecology of microorgan in Patients Treated with Spore Compositions isms that co-exist within single subjects interacting with one 0340. The following example is a non-limiting example of another and their host (i.e., the mammalian Subject) to form a how one could determine what is present in the microbial dynamic unit with inherent biodiversity and functional char composition using genomic techniques. Complementary acteristics. Within these networks of interacting microbes genomic and microbiological methods were used to charac (i.e. ecologies), particular members can contribute more sig terize the composition of the microbiota from Patient 1, 2, 3, nificantly than others; as such these members are also found 4, and 5, 6, 7,8,9, and 10 at pretreatment (pretreatment) and in many different ecologies, and the loss of these microbes on up to 4 weeks post-treatment. To determine the OTUs that from the ecology can have a significant impact on the func engraft from treatment with an ethanol treated spore prepa tional capabilities of the specific ecology. Robert Paine ration in the patients and how their microbiome changed in coined the concept "Keystone Species” in 1969 (see Paine R response, the microbiome was characterized by 16S-V4 T. 1969. A note on trophic complexity and community stabil sequencing prior to treatment (pretreatment) with an ethanol ity. The American Naturalist 103: 91-93.) to describe the treated spore preparation and up to 25 days after receiving existence of Such lynchpin species that are integral to a given treatment. Alternatively, one might use a bacterial composi ecosystem regardless of their abundance in the ecological tion in the vegetative state, or a mixture of vegetative bacteria community. Paine originally describe the role of the starfish and bacterial spores. For example, the treatment of patient 1 Pisaster ochraceus in marine systems and since the concept with an ethanol treated spore preparation led to microbial has been experimentally validated in numerous ecosystems. population via the engraftment of OTUs from the spore treat 0339 Keystone OTUs and/or Functions are computation ment and augmentation in the microbiome of the patient ally-derived by analysis of network ecologies elucidated from (FIG. 11 and FIG. 12). By day 25 following treatment, the a defined set of Samples that share a specific phenotype. total microbial carriage was dominated by species of the Keystone OTUs and/or Functions are defined as all Nodes following taxonomic groups: Bacteroides, Sutterella, Rumi within a defined set of networks that meet two or more of the nococcus, Blautia, Eubacterium, Gemmiger/Faecalibacte following criteria. Using Criterion 1, the node is frequently rium, and the non-sporeforming Lactobacillus (see Table 26 observed in networks, and the networks in which the node is for specific OTUs). The first two genera represent OTUs that observed are found in a large number of individual subjects: do not form spores while the latter taxonomic groups repre the frequency of occurrence of these Nodes in networks and sent OTUs that are believed to form spores. the pervasiveness of the networks in individuals indicates 0341 Table 26 shows bacterial OTUs associated with these Nodes perform an important biological function in engraftment and ecological augmentation and establishment many individuals. Using Criterion 2, the node is frequently of a more diverse microbial ecology in patients treated with observed in networks, and each the networks in which the an ethanol treated spore preparation. OTUS that comprise an node is observed contain a large number of Nodes—these augmented ecology are not present in the patient prior to Nodes are thus 'super-connectors', meaning that they form a treatment and/or exist at extremely low frequencies such that nucleus of a majority of networks and as such have high they do not comprise a significant fraction of the total micro biological significance with respect to their functional con bial carriage and are not detectable by genomic and/or micro tributions to a given ecology. Using Criterion 3, the node is biological assay methods. OTUs that are members of the found in networks containing a large number of Nodes (i.e. engrafting and augmented ecologies were identified by char they are large networks), and the networks in which the node acterizing the OTUs that increase in their relative abundance is found occur in a large number of Subjects; these networks post treatment and that respectively are: (i) present in the are potentially of high interest as it is unlikely that large ethanol treated spore preparation and absent in the patient networks occurring in many individuals would occur by pretreatment (engrafting OTUs), or (ii) absent in the ethanol chance alone strongly suggesting biological relevance. treated spore preparation, but increase in their relative abun Optionally, the required thresholds for the frequency at which dance through time post treatment with the preparation due to a node is observed in network ecologies, the frequency at the formation of favorable growth conditions by the treatment which a given network is observed across Subject samples, (augmenting OTUs). Notably, the latter OTUs can grow from and the size of a given network to be considered a Keystone low frequency reservoirs in the patient, or be introduced from node are defined by the 50th, 70th, 80th, or 90th percentiles of exogenous sources Such as diet. OTUS that comprise a “core” the distribution of these variables. Optionally, the required augmented or engrafted ecology can be defined by the per thresholds are defined by the value for a given variable that is centage of total patients in which they are observed to engraft significantly different from the mean or median value for a and/or augment; the greater this percentage the more likely given variable using standard parametric or non-parametric they are to be part of a core ecology responsible for catalyzing measures of statistical significance. In another embodiment a a shift away from a dysbiotic ecology. The dominant OTUs in US 2016/0040215 A1 Feb. 11, 2016 42 an ecology can be identified using several methods including functional roles in a microbial ecology Such as that found in but not limited to defining the OTUs that have the greatest the human gut. Compositions Substituting one species with relative abundance in either the augmented or engrafted another from the same clade are likely to have conserved ecologies and defining a total relative abundance threshold. ecological function and therefore are useful in the present As example, the dominant OTUS in the augmented ecology of invention. Patient-1 were identified by defining the OTUs with the great 0345 Stool samples were aliquoted and resuspended est relative abundance, which together comprise 60% of the 10xvol/wt in either 100% ethanol (for genomic characteriza microbial carriage in this patient's augmented ecology. tion) or PBS containing 15% glycerol (for isolation of 0342 Patient treatment with the ethanol treated spore microbes) and then stored at -80°C. until needed for use. For preparation led to the population of a microbial ecology that genomic 16S sequence analysis colonies picked from plate has greater diversity than prior to treatment (FIG. 11). isolates had their full-length 16S sequence characterized as Genomic-based microbiome characterization confirmed described in Examples 2 and 3, and primary stool samples engraftment of a range of OTUs that were absent in the patient were prepared targeting the 16S-V4 region using the method pretreatment (Table 26). These OTUs comprised both bacte for heterogeneous samples described herein. rial species that were capable and not capable of forming 0346 Notably, 16S sequences of isolates of a given OTU spores, and OTUS that represent multiple phylogenetic are phylogenetically placed within their respective clades clades. Organisms absent in Patient 1 pre-treatment either despite that the actual taxonomic assignment of species and engraft directly from the ethanol treated spore fraction or are genus may suggest they are taxonomically distinct from other augmented by the creation of a gut environment favoring a members of the clades in which they fall. Discrepancies healthy, diverse microbiota. Furthermore, Bacteroides fragi between taxonomic names given to an OTU is based on lis group species were increased by 4 and 6 logs in patients 1 microbiological characteristics versus genetic sequencing are and 2 (FIG. 13). known to exist from the literature. The OTUs footnoted in this 0343 FIG. 12 shows patient microbial ecology is shifted table are known to be discrepant between the different meth by treatment with an ethanol treated spore treatment from a ods for assigning a taxonomic name. dysbiotic state to a state of health. Principle Coordinates 0347 Engraftment of OTUs from the ethanol treated spore Analysis based on the total diversity and structure of the preparation treatment into the patient as well as the resulting microbiome (Bray-Curtis Beta-Diversity) of the patient pre augmentation of the resident microbiome led to a significant and post-treatment delineates that the engraftment of OTUs decrease in and elimination of the carriage of pathogenic from the spore treatment and the augmentation of the patient species other than C. difficile in the patient. 16S-V4 sequenc microbial ecology leads to a microbial ecology that is distinct ing of primary stool samples demonstrated that at pretreat from both the pretreatment microbiome and the ecology of ment, 20% of reads were from the genus Klebsiella and an the ethanol treated spore treatment (Table 26). additional 19% were assigned to the genus Fusobacterium. 0344 FIG.13 shows the augmentation of Bacteroides spe These data are evidence of a profoundly dysbiotic microbiota cies in patients. Comparing the number of Bacteroides fragi associated with recurrent C. difficile infection and chronic lis groups species percfu/g of feces pre-treatment and in week antibiotic use. In healthy individuals, Klebsiella is a resident 4 post treatment reveals an increase of 4 logs or greater. The of the human microbiome in only about 2% of subjects based ability of 16S-V4 OTU identification to assign an OTU as a on an analysis of HMP database (www.hmpdacc.org), and the specific species depends in part on the resolution of the 16S mean relative abundance of Klebsiella is only about 0.09% in V4 region of the 16S gene for a particular species or group of the stool of these people. The 20% relative abundance in species. Both the density of available reference 16S Patient 1 before treatment is an indicator of a proinflamma sequences for different regions of the tree as well as the tory gut environment enabling a "pathobiont' to overgrow inherent variability in the 16S gene between different species and outcompete the commensal organisms normally found in will determine the definitiveness of ataxonomic annotation to the gut. Similarly, the dramatic overgrowth of Fusobacterium a given sequence read. Given the topological nature of a indicates a profoundly dysbiotic gut microbiota. One species phylogenetic tree and that the tree represents hierarchical of Fusobacterium, F. nucleatum (an OTU phylogenetically relationships of OTUs to one another based on their sequence indistinguishable from Fusobacterium sp. 3 1 33 based on similarity and an underlying evolutionary model, taxonomic 16S-V4), has been termed “an emerging gut pathogen' based annotations of a read can be rolled up to a higher level using on its association with IBD, Crohn's disease, and colorectal a clade-based assignment procedure (Table 1). Using this cancer in humans and its demonstrated causative role in the approach, clades are defined based on the topology of a phy development of colorectal cancer in animal models Allen logenetic tree that is constructed from full-length 16S Vercoe, Gut Microbes (2011) 2:294-8. Importantly, neither sequences using maximum likelihood or other phylogenetic Klebsiella nor Fusobacterium was detected in the 16S-V4 models familiar to individuals with ordinary skill in the art of reads by Day 25 (Table 27). phylogenetics. Clades are constructed to ensure that all OTUs 0348. To further characterize the colonization of the gut by in a given clade are: (i) within a specified number of bootstrap Klebsiella and other Enterobacteriaceae and to speciate these Supported nodes from one another (generally, 1-5 bootstraps), organisms, pretreatment and Day 25 fecal samples stored at and (ii) within a 5% genetic similarity. OTUs that are within -80C as PBS-glycerol suspensions were plated on a variety the same clade can be distinguished as genetically and phy of selective media including MacConkey lactose media (se logenetically distinct from OTUs in a different clade based on lective for gram negative enterobacteria) and Simmons Cit 16S-V4 sequence data. OTUs falling within the same clade rate Inositol media (selective for Klebsiella spp) Van Cregten are evolutionarily closely related and may or may not be et al., J. Clin. Microbiol. (1984) 20:936-41. Enterobacteria distinguishable from one another using 16S-V4 sequence identified in the patient samples included K. pneumoniae, data. The power of clade based analysis is that members of the Klebsiella sp. Co. 9935 and E. coli. Strikingly, each Kleb same clade, due to their evolutionary relatedness, play similar siella species was reduced by 2-4 logs whereas E. coli, a US 2016/0040215 A1 Feb. 11, 2016 normal commensal organism present in a healthy microbiota, via oral uptake from food following treatment. We term this was reduced by less than 1 log (Table 28 below). This healthy repopulation of the gut with OTUs that are not present decrease in Klebsiella spp. carriage is consistent across mul in the bacterial composition Such as but not limited to a spore tiple patients. Four separate patients were evaluated for the population or ethanol treated spore population, "Augmenta presence of Klebsiella spp. pre treatment and 4 weeks post tion.” Augmentation is an important phenomenon in that it treatment. Klebsiella spp. were detected by growth on selec shows the ability to use an ethanol treated spore ecology or tive Simmons Citrate Inositol media as previously described. other bacterial composition to restore a healthy microbiota by Serial dilution and plating, followed by determining cfu/mL seeding a diverse array or commensal organisms beyond the titers of morphologically distinct species and 16S full length actual component organisms in the bacterial composition sequence identification of representatives of those distinct Such as but not limited to an ethanol treated spore population morphological classes, allowed calculation of titers of spe itself: specifically the spore composition treatment itself and cific species. the engraftment of OTUs from the spore composition create a 0349 The genus Bacteroides is an important member of niche that enables the outgrowth of OTUs required to shift a the gastrointestinal microbiota; 100% of stool samples from dysbiotic microbiome to a microbial ecology that is associ the Human MicrobiomeProject contain at least one species of ated with health. The diversity of Bacteroides species and Bacteroides with total relative abundance in these samples their approximate relative abundance in the gut of Patient 1 is ranging from 0.96% to 93.92% with a median relative abun shown in Table 30, comprising at least 8 different species. dance of 52.67% (www.hmpdacc.org reference data set 0351 FIG. 14 shows species engrafting versus species HMSMCP). Bacteroides in the gut has been associated with augmenting in patients microbiomes after treatment with a amino acid fermentation and degradation of complex bacterial composition Such as but not limited to an ethanol polysaccharides. Its presence in the gut is enhanced by diets treated spore population. Relative abundance of species that rich in animal-derived products as found in the typical west engrafted or augmented as described were determined based ern diet David, L. A. et al, Nature (2013) doi:10.1038/na on the number of 16S sequence reads. Each plot is from a ture12820. Prior to treatment, fewer than 0.008% of the different patient treated with the bacterial composition such 16S-V4 reads from Patient 1 mapped to the genus Bacteroi as but not limited to an ethanol-treated spore population for des strongly suggesting that Bacteroides species were absent recurrent C. difficile. or that viable Bacteroides were reduced to an extremely 0352. The impact of the bacterial composition such as but minor component of the patient’s gut microbiome. Post treat not limited to an ethanol treated spore population treatment ment, >42% of the 16S-V4 reads were assigned to the genus on carriage of imipenem resistant Enterobacteriaceae was Bacteroides within 5 days of treatment and by Day 25 post assessed by plating pretreatment and Day 28 clinical samples treatment 59.48% of the patients gut microbiome was com from Patients 2, 4 and 5 on MacConkey lactose plus 1 ug/mL prised of Bacteroides. These results were confirmed micro of imipenem. Resistant organisms were scored by morphol biologically by the absence of detectable Bacteroides in the ogy, enumerated and DNA was submitted for full length 16S pretreatment sample plated on two different Bacteroides rDNA sequencing as described above. Isolates were identi selective media: Bacteroides Bile Esculin (BBE) agar which fied as Morganella morganii, Providencia rettgeri and Pro is selective for Bacteroides fragilis group species Living teus pennerii. Each of these are gut commensal organisms; ston, S. J. et al J. Clin. Microbiol (1978). 7: 448-453 and overgrowth can lead to bacteremia and/or urinary tract infec Polyamine Free Arabinose (PFA) agar Noacket al. J. Nutr. tions requiring aggressive antibiotic treatment and, in some (1998) 128: 1385-1391; modified by replacing glucose with cases, hospitalization Kim, B-N, et al Scan J. Inf Dis (2003) arabinose. The highly selective BBE agar had a limit of 35: 98-103; Lee, I-K and Liu, J-W J. Microbiol Immunol detection of <2x103 cfu/g, while the limit of detection for Infect (2006) 39: 328-334; O'Hara et al., Clin Microbiol Rev Bacteroides on PFAagar was approximately 2x 107 cfu/g due (2000) 13: 534. The titer of organisms at pretreatment and to the growth of multiple non-Bacteroides species in the Day 28 by patient is shown in Table 31. Importantly, admin pretreatment sample on that medium. Colony counts of istration of the bacterial composition such as but not limited Bacteroides species on Day 25 were up to 2x1010 cfu/g, to an ethanol treated spore preparation resulted in greater than consistent with the 16S-V4 sequencing, demonstrating a pro 100-fold reduction in 4 of 5 cases of Enterobacteriaceae car found reconstitution of the gut microbiota in Patient 1 (Table riage with multiple imipenem resistant organisms (See Table 29 below). 31 which shows titers (in cfu/g) of imipenem-resistant M. 0350. The significant abundance of Bacteroides in Patient morganii, Prettgeri and P. pennerii from Patients 2, 4 & 5). 1 on Day 25 (and as early as Day 5 as shown by 16S-V4 0353. In addition to speciation and enumeration, multiple sequencing) is remarkable. Viable Bacteroides fragilis group isolates of each organism from Patient 4 were grown over species were not present in the ethanol treated spore popula night in 96-well trays containing a 2-fold dilution series of tion based on microbiological plating (limit of detection of 10 imipenem in order to quantitatively determine the minimum cfu/ml). Thus, administration of the ethanol treated spore inhibitory concentration (MIC) of antibiotic. Growth of population to Patient 1 resulted in microbial population of the organisms was detected by light scattering at 600 nm on a patient's GI tract, not only due to the engraftment of bacterial SpectraMax M5e plate reader. In the clinical setting, these species such as but not limited to spore forming species, but species are considered resistant to imipenem if they have an also the restoration of high levels of non-spore forming spe MIC of 1 lug/mL or greater. M. morganii isolates from pre cies commonly found in healthy individuals through the cre treatment samples from Patient Dhad MICs of 2-4 ug/mL and ation of a niche that allowed for the repopulation of Bacteroi P. pennerii isolates had MICs of 4-8 ug/mL. Thus, the bacte des species. These organisms were most likely either present rial composition, Such as but not limited to, an ethanol treated at extremely low abundance in the GI tract of Patient 1, or spores administered to Patient 4 caused the clearance of 2 present in a reservoir in the GI tract from which they could imipenem resistant organisms (Table 26). While this example rebound to high titer. Those species may also be reinoculated specifically uses a spore preparation, the methods herein US 2016/0040215 A1 Feb. 11, 2016 44 describe how one skilled in the art would use a more general higher frequency are highly likely to be a component of the bacterial composition to achieve the same effects. The spe Core Ecology of the spore preparation or broadly speaking a cific example should not be viewed as a limitation of the scope set bacterial composition. Second, OTUs detected by of this disclosure. sequencing a bacterial composition (as in Table 32 may include non-viable cells or other contaminant DNA mol Example 49 ecules not associated with the composition. The requirement that an OTU was shown to engraft in the patient eliminates Identifying the Core Ecology from the Bacterial OTUs that represent non-viable cells or contaminating Combination sequences. Table 32 also identifies all OTUs detected in the 0354) To identify the composition of microbes in a com bacterial composition that also were shown to engraft in at plex microbial composition, genomic methods were least one patient post-treatment. OTUS that are present in a employed. Ten different bacterial compositions were made large percentage of the bacterial composition e.g. ethanol by the ethanol treated spore preparation methods from 6 spore preparations analyzed and that engraft in a large num different donors (as described in Example 9). The spore ber of patients represent a subset of the Core Ecology that are preparations were used to treat 10 patients, each suffering highly likely to catalyze the shift from a dysbiotic disease from recurrent C. difficile infection. Patients were identified ecology to a healthy microbiome. using the inclusion/exclusion criteria described inherein, and 0357. A third lens was applied to further refine insights donors were identified using the criteria described in AAAJ. into the Core Ecology of the bacterial composition e.g. spore None of the patients experienced a relapse of C. difficile in the preparation. Computational-based, network analysis has 4 weeks of follow up after treatment, whereas the literature enabled the description of microbial ecologies that are would predict that 70-80% of subjects would experience a present in the microbiota of a broad population of healthy relapse following cessation of antibiotic Van Nood, et al. individuals. These network ecologies are comprised of mul NEJM (2013). Thus, the ethanol treated spore preparations tiple OTUs, some of which are defined as Keystone OTUs. derived from multiple different donors and donations showed Keystone OTUs form a foundation to the microbially ecolo remarkable clinical efficacy. These ethanol treated spore gies in that they are found and as such are central to the preparations are a Subset of the bacterial compositions function of network ecologies in healthy Subjects. Keystone described herein and the results should not be viewed as a OTUs associated with microbial ecologies associated with limitation on the scope of the broader set of bacterial compo healthy Subjects are often are missing or exist at reduced sitions. levels in subjects with disease. Keystone OTUS may exist in 0355 To define the Core Ecology underlying the remark low, moderate, or high abundance in subjects. Table 32 further able clinical efficacy of the bacterial compositions e.g. etha notes which of the OTUs in the bacterial composition e.g. nol treated spore preparations, the following analysis was spore preparation are Keystone OTUS exclusively associated carried out. The OTU composition of the spore preparation with individuals that are healthy and do not harbor disease. was determined by 16S-V4 rDNA sequencing and computa 0358. A relatively small number of species, 16 in total, are tional assignment of OTUs per Example 3. A requirement to detected in all of the spore preparations from 6 donors and 10 detect at least ten sequence reads in the ethanol treated spore donations. The HMP database (www.hmpdacc.org) describes preparation was set as a conservative threshold to define only the enormous variability of commensal species across OTUs that were highly unlikely to arise from errors during healthy individuals. The presence of a small number of con amplification or sequencing. Methods routinely employed by sistent OTUs lends support to the concept of a Core Ecology. those familiar to the art of genomic-based microbiome char The engraftment data further Supports this conclusion. A acterization use a read relative abundance threshold of regression analysis shows a significant correlation between 0.005% (see e.g. Bokulich, A. et al. 2013. Quality-filtering frequency of detection in a spore preparation and frequency vastly improves diversity estimates from Illumina amplicon of engraftment in a donor: R=0.43 (p<0.001). There is no a sequencing. Nature Methods 10: 57-59), which would equate priori requirement that an OTU detected frequently in the to 22 reads given the sequencing depth obtained for the bacterial composition e.g. spore preparation will or should samples analyzed in this example, as cut-off which is Sub engraft. For instance, Lutispora thermophila, a spore former stantially lower than the 10 reads used in this analysis. All found in all ten spore preparations, did not engraft in any of taxonomic and clade assignments were made for each OTU as the patients. Bilophila wadsworthia, a gram negative anaer described in Example 4. The resulting list of OTUs, clade obe, is present in 9 of 10 donations, yet it does not engraft in assignments, and frequency of detection in the spore prepa any patient, indicating that it is likely a non-viable contami rations are shown in Table 32. Table 32 shows OTUs detected nant in the ethanol treated spore preparation. Finally, it is by a minimum often 16S-V4 sequence reads in at least a one worth noting the high preponderance of previously defined ethanol treated spore preparation (pan-microbiome). OTUS Keystone OTUs among the most frequent OTUs in the spore that engraft in a treated patients and the percentage of patients preparations. in which they engraft are denoted, as are the clades, spore 0359 These three factors—prevalence in the bacterial forming status, and Keystone OTU status. Starred OTUs composition Such as but not limited to a spore preparation, occur in 80% of the ethanol preps and engraft in 50% of the frequency of engraftment, and designation as a Keystone treated patients. OTUs—enabled the creation of a "Core Ecology Score” 0356. Next, it was reasoned that for an OTU to be consid (CES) to rank individual OTUs. CES was defined as follows: ered a member of the Core Ecology of the bacterial compo sition, that OTU was shown to engraft in a patient. Engraft 0360 40% weighting for presence of OTU in spore ment is important for two reasons. First, engraftment is a sine preparation qua non of the mechanism to reshape the microbiome and 0361 multiplier of 1 for presence in 1-3 spore prepa eliminate C. difficile colonization. OTUs that engraft with rations US 2016/0040215 A1 Feb. 11, 2016 45
0362 multiplier of 2.5 for presence in 4-8 spore in these compositions is that each strain be provided in a preparations minimum amount so that the strain's contribution to the effi 0363 multiplier of 5 for presences in 29 spore prepa cacy of the Core Ecology Subset can be measured. Using the rations principles and instructions described here, it is straightfor 0364) 40% weighting for engraftment in a patient ward for one of skill in the art to make clade-based substitu 0365 multiplier of 1 for engraftment in 1-4 patients tions to test the efficacy of subsets of the Core Ecology. Table 0366 multiplier of 2.5 for engraftment in 5-6 patients 32 describes the clades for each OTU detected in a spore 0367 multiplier of 5 for engraftment in a 7 patients preparation and Table 1 describes the OTUs that can be used 0368. 20% weighting to Keystone OTUs for substitutions based on clade relationships. 0369 multiplier of 1 for a Keystone OTU 0370 multiplier of 0 for a non-Keystone OTU Example 51 0371 Using this guide, the CES has a maximum possible score of 5 and a minimum possible score of 0.8. As an Testing Subsets of the Core Ecology in the Mouse example, an OTU found in 8 of the 10 bacterial composition Model Such as but not limited to a spore preparations that engrafted 0376 Several subsets of the Core Ecology were tested in in 3 patients and was a Keystone OTU would be assigned the the C. difficile mouse model. The negative control was phos follow CES: phate buffered saline and the positive control was a 10% human fecal suspension. The subsets are described in Table 0372 Table 33 ranks the top 20 OTUs by CES with the 34 (Subsets of the Core Ecology tested in the C. difficile further requirement that an OTU was shown to engraft to be a mouse model). considered an element of a core ecology. 0377 Two cages of five mice each were tested for each arm of the experiment. All mice received an antibiotic cock Example 50 tail consisting of 10% glucose, kanamycin (0.5 mg/ml), gen tamicin (0.044 mg/ml), colistin (1062.5 U/ml), metronida Defining Efficacious Subsets of the Core Ecology Zole (0.269 mg/ml), ciprofloxacin (0.156 mg/ml), amplicillin (0.1 mg/ml) and Vancomycin (0.056 mg/ml) in their drinking 0373 The number of organisms in the human gastrointes water on days -14 through -5 and a dose of 10 mg/kg. Clin tinal tract, as well as the diversity between healthy individu damycin by oral gavage on day -3. On day -1, they received als, is indicative of the functional redundancy of a healthy gut either the test articles or control articles via oral gavage. On microbiome ecology (see The Human Microbiome Consor day 0, they were challenged by administration of approxi tia. 2012. Structure, function and diversity of the healthy mately 4.5 log 10 cfu of C. difficile (ATCC 43255) via oral human microbiome. Nature 486: 207-214). This redundancy gavage. Mortality was assessed every day from day 0 to day 6 makes it highly likely that subsets of the Core Ecology and the weight and Subsequent weight change of the animal describe therapeutically beneficial components of the bacte was assessed with weight loss being associated with C. diffi rial composition Such as but not limited to an ethanol treated cile infection. Mortality and reduced weight loss of the test spore preparation and that Such Subsets may themselves be article compared to the empty vehicle was used to assess the useful compositions for populating the GI tract and for the Success of the testarticle. Additionally, a C. difficile symptom treatment of C. difficile infection given the ecologies func scoring was performed each day from day -1 through day 6. tional characteristics. Using the CES, individual OTUs can be Symptom scoring was based on Appearance (0-2 pts based on prioritized for evaluation as an efficacious subset of the Core normal, hunched, piloerection, or lethargic), Respiration (0-2 Ecology. pts based on normal, rapid or shallow, with abdominal breath 0374. Another aspect of functional redundancy is that evo ing), Clinical Signs (0-2 points based on normal, wet tail, lutionarily related organisms (i.e. those close to one another cold-to-the-touch, or isolation from other animals). on the phylogenetic tree, e.g. those grouped into a single 0378. In addition to compiling the cumulative mortality clade) will also be effective substitutes in the Core Ecology or for each arm, the average minimum relative weight is calcu a subset thereof for treating C. difficile. lated as the mean of each mouse's minimum weight relative 0375 To one skilled in the art, the selection of appropriate to Day -1 and the average maximum clinical score is calcu OTU subsets for testing in vitro (e.g. see Example 51 below) lated as the mean of each mouse's maximum combined clini or in vivo is straightforward. Subsets may be selected by cal score with a score of 4 assigned in the case of death. The picking any 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 OTUs results are reported in Table 35 below (Results of bacterial from Table 32, with a particular emphasis on those with compositions tested in a C. difficile mouse model). higher CES, such as the OTUs described Table 33. In addi tion, using the clade relationships defined in Example 3 and Example 52 Table 1 above, related OTUs can be selected as substitutes for OTUs with acceptable CES values. These organisms can be Defining Subsets of the Core Ecology in the In Vitro cultured anaerobically in vitro using the appropriate media C. difficile Inhibition Assay (selected from those described in Example 5 above), and then combined in a desired ratio. A typical experiment in the 0379 Vials of -80° C. glycerol stock banks were thawed mouse C. difficile model utilizes at least 104 and preferably at and diluted to le8 CFU/mL. Selected strains and their clade least 105, 106, 107, 108, 109 or more than 109 colony form assignmentare given in Table 36. Each strain was then diluted ing units of a each microbe in the composition. Variations in 10x (to a final concentration of le7 CFU/mL of each strain) the culture yields may sometimes mean that organisms are into 200 uL of PBS+15% glycerol in the wells of a 96-well combined in unequal ratios, e.g. 1:10, 1:100, 1:1,000, 1:10, plate. Plates were then frozen at -80° C. When needed for the 000, 1:100,000, or greater than 1:100,000. What is important assay, plates were removed from -80°C. and thawed at room US 2016/0040215 A1 Feb. 11, 2016 46 temperature under anaerobic conditions when testing in a in mixture was aliquoted to wells of a Hard-shell Low-Profile vitro C. difficile inhibition assay (CivSim). Thin Wall 96-well Skirted PCR Plate (BioRad, Hercules, 0380. An overnight culture of Clostridium difficile was Calif.). To this reaction mixture, 2 ul of diluted, frozen, and grown under anaerobic conditions in SweetB-Fosin or other thawed samples are added and the plate sealed with a Micro suitable media for the growth of C. difficile. SweetB-Fos.In is seal B. Adhesive Seal (BioRad, Hercules, Calif.). The qPCR a complex media composed of brain heart infusion, yeast is performed on a BioRadC1000TM Thermal Cyclerequipped extract, cysteine, cellobiose, maltose, Soluble starch, and with a CFX96TM Real-Time System (BioRad, Hercules, fructooligosaccharides/inulin, and hemin, and is buffered Calif.). The thermocycling conditions were 95° C. for 15 with MOPs. After 24 hr of growth the culture was diluted minutes followed by 45 cycles of 95°C. for 5 seconds, 60° C. 100,000 fold into a complex media such as SweetB-Foslin for 30 seconds, and fluorescent readings of the FAM channel. which is suitable for the growth of a wide variety of anaerobic Alternatively, the qPCR was performed with other standard bacterial species. The diluted C. difficile mixture was then methods known to those skilled in the art. aliquoted to wells of a 96-well plate (180 uL to each well). 20 0384 The Cd value for each well on the FAM channel was uL of a subset Core Ecology is then added to each well at a determined by the CFX ManagerTM 3.0 software. The log 10 final concentration of le6 CFU/mL of each species. Alterna (cfu/mL) of C. difficile each experimental sample was calcu tively the assay can be tested each species at different initial lated by inputting a given sample's Cd value into a linear concentrations (1e9 CFU/mL, le8 CFU/mL, le7 CFU/mL, le5 regression model generated from the standard curve compar CFU/mL, le4 CFU/mL, le3 CFU/mL, le2 CFU/mL). Control ing the Cd values of the standard curve wells to the known log wells only inoculated with C. difficile were included for a 10 (cfu/mL) of those samples. The log inhibition was calcu comparison to the growth of C. difficile without inhibition. lated for each sample by subtracting the log 10 (cfu/mL) of C. Additional wells were used for controls that either inhibit or difficile in the sample from the log 10 (cfu/mL) of C. difficile do not inhibit the growth of C. difficile. One example of a in the sample on each assay plate used for the generation of positive control that inhibits growth was a combination of the standard curve that has no additional bacteria added. The Blautia producta, Clostridium bifermentans and Escherichia mean log inhibition was calculated for all replicates for each coli. One example of a control that shows reduced inhibition composition. of C. difficile growth was a combination of Bacteroides 0385) A histogram of the range and standard deviation of thetaiotaomicron, Bacteroides ovatus and Bacteroides Vulga each composition was plotted. Ranges or standard deviations tus. Plates were wrapped with parafilm and incubated for 24 of the log inhibitions that are distinct from the overall distri hr at 37°C. under anaerobic conditions. After 24 hr the wells bution are examined as possible outliers. If the removal of a containing C. difficile alone were serially diluted and plated to single log inhibition datum from one of the binary pairs that is determine titer. The 96-well plate was then frozen at -80C identified in the histograms would bring the range or standard before quantifying C. difficile by qPCR assay. deviation in line with those from the majority of the samples, 0381. A standard curve was generated from a well on each that datum is removed as an outlier, and the mean log inhibi assay plate containing only pathogenic C. difficile grown in tion is recalculated. SweetB+FosIn media and quantified by selective spot plat 0386 The pooled variance of all samples evaluated in the ing. Serial dilutions of the culture were performed in sterile assay is estimated as the average of the sample variances phosphate-buffered saline. Genomic DNA was extracted weighted by the sample's degrees of freedom. The pooled from the standard curve samples along with the other wells. standard error is then calculated as the square root of the 0382 Genomic DNA was extracted from 5 ul of each pooled variance divided by the square root of the number of sample using a dilution, freeze? thaw, and heat lysis protocol. samples. Confidence intervals for the null hypothesis are 5uL of thawed samples is added to 45 uL of UltraPure water determined by multiplying the pooled standard error to the z (Life Technologies, Carlsbad, Calif.) and mixed by pipetting. score corresponding to a given percentage threshold. Mean The plates with diluted samples were frozen at -20°C. until log inhibitions outside the confidence interval are considered use for qPCR which includes a heated lysis step prior to to be inhibitory if positive or stimulatory if negative with the amplification. Alternatively the genomic DNA was isolated percent confidence corresponding to the interval used. Ter using the Mo BioPowersoil(R)-htp 96 WellSoil DNAIsolation nary combinations with mean log inhibition greater than Kit (Mo Bio Laboratories, Carlsbad, Calif.), Mo Bio Power 0.312 are reported as ++++(>99% confidence interval (C.I.) soil.R DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, of the null hypothesis), those with mean log inhibition Calif.), or the QIAamp DNA Stool Mini Kit (QIAGEN, between 0.221 and 0.312 as +++(95%
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former S taltu S Bacilius haimapalus 211 R 026144 e 238 Bacilius herbersteinensis 213 R 042286 e 238 Bacilius idriensis 215 R 043268 e 238 Bacilius ienius 216 R 04O792 e 238 Bacilius licheniformis 217 C OO6270 e 238 Bacilius negaterium 218 U2S2124 e 238 Bacilius neaisonii 219 R 044546 e 238 Bacilius niabensis 220 R 043334 e 238 Bacilius niacini 221 R 024.695 e 238 Bacilius pocheonensis 222 R 041377 e 238 Bacilius pumilus 223 R 074977 e 238 Bacilius Safensis 224 Q624766 e 238 Bacilius simplex 225 R 042136 e 238 Bacilius Sonorensis 226 R O25130 e 238 Bacilius Sp. 10403.023 MM10403188 227 AETO1 OOOO89 e 238 Bacilius sp. 2A57 CT2 230 CWDO1 OOOO95 e 238 Bacilius Sp. 20087241.26 228 U2S2108 e 238 Bacilius Sp. 20087241.39 229 U2S2111 e 238 Bacilius sp. 716AIA 231 FN397518 e 238 Bacilius sp. AP8 233 JX101689 e 238 Bacilius sp. B27 (2008) 234 U362173 e 238 Bacilius sp. BT1B CT2 235 CWCO1OOOO34 e 238 Bacilius sp. GB1.1 236 897765 e 238 Bacilius sp. GB9 237 897766 e 238 Bacilius sp. HU19.1 238 897769 e 238 Bacilius Sp. HU29 239 89.7771 e 238 Bacilius sp. HU33.1 240 89.7772 e 238 Bacilius sp. JC6 241 F824.800 e 238 Bacilius sp. oral taxon F79 248 MO99654 e 238 Bacilius sp. SRC DSF1 243 U797.283 e 238 Bacilius sp. SRC DSF10 242 U797.292 e 238 Bacilius sp. SRC DSF2 244 U797284 e 238 Bacilius sp. SRC DSF6 245 U797.288 e 238 Bacilius sp. tc09 249 Q844242 e 238 Bacilius sp. zh168 250 851424 e 238 Bacilius sphaericits 251 Q286318 e 238 Bacilius sporothermodurans 252 R 026010 e 238 Bacilius subtiis 253 U627588 e 238 Bacilius thermoamylovorans 254 R 029151 e 238 Bacilius thuringiensis 255 C O08600 e 238 Bacilius weihenstephanensis 256 RO74926 e 238 Geobacilius kaustophilus 933 RO74989 e 238 Geobacilius Stearothermophilus 936 R 040794 e 238 Geobacilius thermodenitrificans 938 RO74976 e 238 Geobacilius thermoglucosidasius 939 R 043022 e 238 Lysinibacilius sphaericits 1193 RO74883 e 238 Clostridiales sp. SS3 4 543 Y305316 e 246 Clostridium beijerinckii 557 RO74434 e 252 Cliostridium bointinum S60 C O10723 e 252 ategory-A Clostridium butyricum S61 BDTO1OOOO17 e 252 Cliostridium chauvoei 568 U106372 e 252 Clost ridium favososportin 582 76749 e 252 Clostridium histolyticum 592 F558362 e 252 Cliostridium isatidis 597 R O26347 e 252 Cliostridium inosum 6O2 R870444 e 252 Clostridium sartagoforme 622 R 0264.90 e 252 Clostridium septicum 624 R 026020 e 252 Clostridium sp. 7. 2 43FAA 626 CDKO1OOO101 e 252 Clost ridium sporogenes 645 BKWO2OOOOO3 e 252 Cliostridium tertium 653 8174 e 252 Cliostridium carnis S64 R 044716 e 253 Cliostridium ceiatum 565 77844 e 253 Clostridium disporicum 579 R 026491 e 253 Clost ridium gasigenes 585 R 024945 e 253 Clostridium quinii 616 R 026149 e 253 Clostridium hyiemonae 593 B023973 e 260 Cliostridium scindens 623 F262238 e 260 Lachnospiraceae bacterium 5 157FAA 1054 CTRO1 OOOO20 e 260 Clostridium glycyrrhizinilyticum S88 B233O29 e 262 Cliostridium nexile 607 73443 e 262 Coprococci is comes 674 BVRO1 OOOO38 e 262 Lachnospiraceae bacterium 1 157FAA 1048 ACTMO1 OOOO6S e 262 Lachnospiraceae bacterium 14 56FAA 1049 ACTNO1OOOO28 e 262 Lachnospiraceae bacterium 8 157FAA 1057 ACWQ01000079 e 262 US 2016/0040215 A1 Feb. 11, 2016 49
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Ruminococcus iaciaris 1663 ABOUO2OOOO49 e 262 Raiminococci is torques 1670 AAVPO2OOOOO2 e 262 Paenibacilius ialitus 1397 R 04.0882 e 270 Paenibacilius polymyxa 1399 R 037006 e 270 Paenibacillus sp. HGF5 14O2 EXSO1 OOOO95 e 270 Paenibacillus sp. HGF7 1403 FDHO1OOO147 e 270 Eubacterium sp. oral clone JIO12 868 Y3493.79 e 298 Alicyclobacilius contaminans 124 R 041475 e 301 Alicyclobacilius herbarius 126 R O24753 e 301 Alicyclobacilius pomorum 127 R 024801 e 301 Bialitia coccoides 373 B571656 e 309 Bialitia glucerasea 374 BS88O23 e 309 Bialitia glucerasei 375 B439724 e 309 Biatitia hansenii 376 BYUO2OOOO37 e 309 Biatitia initi 378 B691576 e 309 Bialitia producia 379 B600998 e 309 Biatitia Schinki 380 R O26312 e 309 Blautia sp. M25 381 M626178 e 309 Biatitia Stercoris 382 M626177 e 309 Bialitia welerae 383 FO36467 e 309 Bryantella formatexigens 439 CCLO2OOOO18 e 309 Cliostridium coccoides 573 FO2S906 e 309 Eubacterium ceilutioSolvens 839 AY178842 e 309 Lachnospiraceae bacterium 6 163FAA 1056 ACTWO1OOOO14 e 309 Ruminococcus hansenii 1662 MS9114 e 309 Ruminococcus obeum 1664 AY169419 e 309 Ruminococcus sp. 5 139BFAA 1666 ACIIO1 OOO172 e 309 Raiminococci is sp. K. 1 1669 AB222208 e 309 Syntrophococci is sticromatians 1911 NR 036869 e 309 Bacilius alcalophilus 198 X76436 e 327 Bacilius clausii 205 FN397477 e 327 Bacilius gelatini 210 R 025595 e 327 Bacilius halodurans 212 Y144582 e 327 Bacilius sp. oral taxon F26 246 MO99642 e 327 Cliostridium innocuum 595 23732 e 351 Clostridium sp. HGF2 628 ENWO1OOOO22 e 351 Clostridium perfingens 612 BDWO1OOOO23 e 353 Category-B Sarcina ventrictii 1687 R 026.146 e 353 Cliostridium bartietti 556 BEZO2OOOO12 e 354 Clostridium bifermenians 558 73437 e 354 Clostridium ghonii S86 BS42933 e 354 Clostridium glycolicum 587 384385 e 354 Clostridium mayombei 60S R733682 e 354 Cliostridium sordei 625 B448.946 e 354 Clostridium sp. MT4 E 635 159523 e 354 Eubacterium tennie 872 591.18 e 354 Clostridium argentinense 553 R O29232 e 355 Clostridium sp. JC122 630 AEVO1OOO127 e 355 Clostridium sp. NMBHI 1 636 JNO93130 e 355 Cliostridium subterminaie 6SO NR 041795 e 355 Clostridium sulfidigenes 651 NR 044161 e 355 Dorea formicigenerans 773 AAXAO2OOOOO6 e 360 Dorea longicatena 774 AJ132842 e 360 Lachnospiraceae bacterium 2 1 46FAA 1OSO ADLBO1OOOO3S e 360 Lachnospiraceae bacterium 2 158FAA 1051 ACTOO1 OOOOS2 e 360 Lachnospiraceae bacterium 4 137FAA 1053 ADCRO1 OOOO3O e 360 Lachnospiraceae bacterium 9 143BFAA 1058 ACTXO1OOOO23 e 360 Raiminococcus gnavuts 1661 X94967 e 360 Ruminococcus sp. ID8 1668 AY960S64 e 360 Bialitia hydrogenotrophica 377 ACBZO1 OOO217 e 368 Lactonifactor longovifornis 1147 DQ100449 e 368 Robinsoniella peoriensis 1633 AF44S258 e 368 Eubacterium infirmum 849 U13039 e 384 Eubacterium sp. WAL 14571 864 FJ687606 e 384 Erysipelotrichaceae bacterium 5 2 54FAA 823 ACZWO1 OOOOS4 e 385 Eubacterium biforme 835 ABYTO1OOOOO2 e 385 Eubacterium cylindroides 842 FP929O41 e 385 Eubacterium doichum 844 L34682 e 385 Eubacterium sp. 31 31 861 ACTLO1 OOOO45 e 385 Eubacterium tortuosum 873 NR 044648 e 385 Buileidia extrucia 441 ADFRO1 OOOO11 e 388 Soiobacterium moorei 1739 AECQ01000039 e 388 Coprococciis Caius 673 EU266552 e 393 Lachnospiraceae bacterium oral taxon F15 1064 HMO99641 e 393 US 2016/0040215 A1 Feb. 11, 2016 50
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Cliostridium cochlearium 574 R 044717 e 395 Cliostridium maienominatium 604 FRA498.93 e 395 Cliostridium tetani 654 NC OO4557 e 395 Acetivibrio ethanolgigners 6 FR749897 e 396 Anaerosporobacter mobilis 161 N R 042953 e 396 Bacteroidespectinophilus 288 A. BVQ0100.0036 e 396 Cliostridium aminovaiericum 551 N R O29245 e 396 Clostridium phytofermenians 613 N RO74652 e 396 Eubacterium hai 848 L34621 e 396 Eubacterium xylanophilum 875 L34628 e 396 Ruminococcus calidus 1658 N R 029160 e 406 Raiminococci is champanellensis 1659 FP929052 e 406 Ruminococcus sp. 18P13 1665 A. 515913 e 406 Ruminococcus sp. 9SE51 1667 FM954974 e 406 Anaerostipes caccae 162 A. BAXO3OOOO23 e 408 Anaerostipes sp. 3 2 56FAA 163 A.CWBO1OOOOO2 e 408 Clostridiales bacterium 1747FAA 541 A. BQRO1000074 e 408 Clostridiales sp. SM41 S42 FP929060 e 408 Clostridiales sp. SSC 2 544 FP929061 e 408 Cliostridium aerotoierans S46 76.163 e 408 Cliostridium aidenense 547 R 04368O e 408 Clostridium algidiyyianolyticum 550 R 028726 e 408 Clostridium amygdalinum 552 Y353957 e 408 Clost ridium asparagiforme 554 e 408 Cliostridium boiteae 559 e 408 Cliostridium celerecrescens 566 Q246092 e 408 Cliostridium citroniae 569 DLO1OOOOS9 e 408 Clostridium clostridiiformes 571 59089 e 408 Clostridium clostridioforme 572 s R 044715 e 408 Clostridium hathewayi 590 Y552788 e 408 Cliostridium indois 594 FO28351 e 408 Cliostridium iavaiense 600 F564277 e 408 Clostridium saccharolyticum 62O POO2109 e 408 Clostridium sp. M62 1 633 CFXO2OOOO46 e 408 Clostridium sp. SS2 1 638 BGCO3OOOO41 e 408 Clostridium sphenoides 643 73449 e 408 Clostridium symbiosum 652 DLQ01000114 e 408 Clostridium xvianolyticum 658 R 037068 e 408 Eubacterium hadrum 847 FR749933 e 408 Lachnospiraceae bacterium 3 157FAA CT1 1052 ACTPO1OOO124 e 408 Lachnospiraceae bacterium 5 163FAA 1055 ACTSO1OOOO81 e 408 Lachnospiraceae bacterium A4 1059 Q789118 e 408 Lachnospiraceae bacterium DJFVP30 1060 EU728771 e 408 Lachnospiraceae genomosp. C1 106S AY2786.18 e 408 Clostridium difficile 578 C O13315 e 409 Eubacterium sp. AS15b 862 Q616364 e 428 Eubacterium sp. OBRC9 863 Q616354 e 428 Eubacterium sp. oral clone OH3A 871 AY947497 e 428 Eubacterium yuri 876 A. EESO1 OOOO73 e 428 Clostridium acetobutyllicum 545 N R 074511 e 430 Clostridium algidicarnis 549 N R 041746 e 430 Cliostridium cadaveris S62 A. BS42932 e 430 Cliostridium carboxidivorans 563 FR733,710 e 430 Cliostridium esteriheticum S8O R 042153 e 430 Clostridium fallax 581 R 044714 e 430 Clostridium feisineum 583 F2705O2 e 430 Clostridium frigidicarnis S84 R 024919 e 430 Clostridium kluyveri 598 RO74165 e 430 Clostridium magnum 603 77835 e 430 Clostridium putrefaciens 615 R O24995 e 430 Clostridium sp. HPB 46 629 Y862516 e 430 Clostridium tyrobutyricum 656 R 044718 e 430 Sutterella parvirubra 1899 B3OO989 e 432 Acetanaerobacterium elongatum 4 R 042930 e 439 Cliostridium ceiliuliosi 567 R 044624 e 439 Ethanoligenens harbinense 832 Y675965 e 439 Eubacterium reciaie 856 e 444 Eubacterium sp. oral clone GIO38 865 Y349374 e 444 Lachnobacterium bovis 1045 U324.407 e 444 Roseburia Cecicola 1634 U233441 e 444 Roseburia faecalis 1635 Y804149 e 444 Roseburia faecis 1636 Y305310 e 444 Roseburia hominis 1637 270482 e 444 Roseburia intestina is 1638 FP929050 e 444 US 2016/0040215 A1 Feb. 11, 2016 51
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Roseburia intinivorans 1639 A270473 clade 444 Y N Brevibacilius brevis 410 NR 041524 clade 448 Y N Brevibacilius laterosporus 414 NR 037005 clade 448 Y N Bacilius coaglians 206 DQ297928 clade 451 Y OP Sporolactobacilius inulinus 1752 NR 040962 clade 451 Y N Kochiria palustris 1041 EU333884 clade 453 Y N Nocardia farcinica 1353 NC OO6361 clade 455 Y N Bacilius sp. oral taxon F28 247 HMO996SO clade 456 Y OP Catenibacterium mitsuokai 495 ABO3O224 clade 469 Y N Clostridium sp. TM 40 640 AB249652 clade 469 Y N Coprobacilius cateniformis 670 ABO3O218 clade 469 Y N Coprobacilius sp. 29 1 671 ADKXO1000057 clade 469 Y N Cliostridium recium 618 NR 029271 clade 470 Y N Eubacterium nodalium 854 U13O41 clade 476 Y N Etibacterium Saphentin 859 NR 026.031 clade 476 Y N Eubacterium sp. oral clone JHO12 867 AY349373 clade 476 Y N Eubacterium sp. oral clone JS001 870 AY3493.78 clade 476 Y N Faecalibacterium prausnitzii 880 ACOPO2OOOO11 clade 478 Y N Gemmiger formicilis 932 GUS 62446 clade 478 Y N Subdoigranulum variabile 1896 AJS18869 clade 478 Y N Clostridiaceae bacterium JC13 532 JF824.807 clade 479 Y N Clostridium sp. MLGO55 634 AF30443S clade 479 Y N Erysipelotrichaceae bacterium 3 153 822 ACTO1OOO113 clade 479 Y N Cliostridium cocleatum 575 NR 026495 clade 481 Y N Cliostridium ranosum 617 M23731 clade 481 Y N Clostridium saccharogumia 619 DQ100445 clade 481 Y N Clostridium spiroforme 644 X73441 clade 481 Y N Coprobacilius sp. D7 672 ACDTO1000199 clade 481 Y N Clostridiales bacterium SY8519 535 AB477431 clade 482 Y N Clostridium sp. SY8519 639 APO12212 clade 482 Y N Eubacterium ramitius 855 AJO11522 clade 482 Y N Erysipeiothrix inopinata 819 NR 025594 clade 485 Y N Erysipeiothrix rhusiopathiae 820 ACLKO1000021 clade 485 Y N Erysipeiothrix tonsillarum 821 NR 040871 clade 485 Y N Holdemania filiformis 1004 Y11466 clade 485 Y N Mollicutes bacterium pACH93 1258 AY297808 clade 485 Y N Coxieia burnetii 736 CPOOO890 clade 486 Y Category-B Cliostridium hiranonis 591 ABO23970 clade 487 Y N Clostridium irregulare 596 NR 029249 clade 487 Y N Cliostridium orbiscindens 609 Y18187 clade 494 Y N Clostridium sp. NML 04A032 637 EU815224 clade 494 Y N Flavonifactor plautii 886 AY724678 clade 494 Y N Pseudoflavonifactor capiliosus 1591 AY136666 clade 494 Y N Ruminococcaceae bacterium D16 1655 ADDXO1000083 clade 494 Y N Acetivibrio cellulolyticus 5 NR 025917 clade 495 Y N Cliostridium aidrichii 548 NR 026099 clade 495 Y N Clostridium clarifiavum 570 NR 041235 clade 495 Y N Cliostridium Stercorarium 647 NR 0251OO clade 495 Y N Cliostridium straminisolvens 649 NR 024829 clade 495 Y N Cliostridium thermocelium 655 NR 074629 clade 495 Y N Fusobacterium nucleatum 901 ADVKO100.0034 clade 497 Y N Eubacterium barkeri 834 NR 044661 clade 512 Y N Eubacterium caiianderi 838 NR 026330 clade 512 Y N Eubacterium inosum 850 CPOO2273 clade 512 Y N Anaerotruncus coihominis 164 ABGDO2000021 clade 516 Y N Clostridium methylpentosum 606 ACECO1000059 clade 516 Y N Clostridium sp. YIT 12070 642 AB4912O8 clade 516 Y N Hydrogenoanaerobacterium saccharov.orans 1005 NR 044.425 clade 516 Y N Ruminococcus aibus 1656 AY4456OO clade 516 Y N Raiminococci is fiavefaciens 1660 NR 025931 clade 516 Y N Clostridium haemolyticum 589 NR 024749 clade 517 Y N Clostridium novyi 608 NR 074343 clade 517 Y N Clostridium sp. LMG 16094 632 X95274 clade 517 Y N Eubacterium ventriosum 874 L34421 clade 519 Y N Bacteroides galactiironicus 280 DQ497994 clade 522 Y N Etibacterium eigens 845 CPOO1104 clade 522 Y N Lachnospira multipara 1046 FR733699 clade 522 Y N Lachnospira pectinoschiza 1047 L14675 clade 522 Y N Lactobacilius rogosae 1114 GU269544 clade 522 Y N Bacilius horii 214 NR 036860 clade 527 Y OP Bacilius sp. 9 3AIA 232 FN397519 clade 527 Y OP Eubacterium brachy 836 U13038 clade 533 Y N Filifactor alocis 881 CPOO2390 clade 533 Y N Filifactor villosus 882 NR 041928 clade 533 Y N US 2016/0040215 A1 Feb. 11, 2016 52
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Clostridium leptum 6O1 3OS238 Clostridium sp. YIT 12069 641 B4912O7 Clost ridium sporosphaeroides 646 R 044835 Etibacterium coprostanoigenes 841 MO37995 Ruminococcus bromii 1657 U266549 Eubacterium Siraeum 860 BCAO3OOOOS4 Cliostridium viride 657 R 026.204 Oscillibacter sp. G2 1386 M626173 Oscillibacter valericigenes 1387 RO74793 Oscillospira guilliermondii 1388 BO40495 Butyrivibrio crossotus 455 BWNO1 OOOO12 Clostridium sp. L2 50 631 AAYWO2OOOO18 Coprococciis elitacius 675 EFO31543 Coprococcus sp. ART55 1 676 AY350746 Eubacterium ruminantium 857 NR 024661 Collinseila aerofaciens 659 AAVNO2OOOOO7 Alkaliphilus metailinedigenes 137 AY137848 Alkaliphilus oremlandii 138 NR 043674 Cliostridium Stickiandi 648 LO4167 Turicibacter sanguinis 196S AF349724 Fulvimonas sp. NML 060897 892 EF589680 Desulfitobacterium frappieri 753 276,701 Desulfitobacterium hafniense 754 RO74996 Desulfotomaculum nigrificans 756 R 044832 Lutiispora thermophila 1.191 R 041236 Brachyspira pilosicoli 40S R O75069 Eggerihelia lenia 778 F292375 Streptomyces albus 1888 697941 Chlamydiales bacterium NS11 505 JN606074 Anaerofustis stercorihominis 159 BILO2OOOOOS Butyricicoccus pullicaecorum 453 H793440 Eubacterium desmoians 843 R 044644 Papillibacter cinnamivorans 1415 R O25025 Sporobacter termitidis 1751 R 044972 Deferribacteres sp. oral clone JV006 744 Y349371 Cliostridium coinum 577 R 026151 Clostridium lactatifermenians 599 R O25651 Clostridium piliforme 614 4639 Saccharomonospora viridis 1671 S4286 Thermobifida fisca 1921 C O07333 Leptospira licerasiae 1164 F612284 Moorelia thermoacetica 1259 R O75001 Thermoanaerobacter pseudethanolicus 1920 POOO924 Flexistipes sinusarabici 888 RO74881 Gioeobacter violaceus 942 RO74282 Eubacterium sp. oral clone JN088 869 Y349377 Cliostridium oroticum 610 R749922 Clostridium sp. D5 627 DBGO1 OOO142 Eubacterium contorium 840 R749946 Etibacterium fissicatena 846 R74993S Corynebacterium coyleae 692 96497 Corynebacterium mucifaciens 711 R 026396 Corynebacterium ureicelerivorans 733 M397636 Corynebacterium appendicis 684 R 028951 Corynebacterium genitalium 698 CLO1OOOO31 Corynebacterium glauctim 699 R 028971 Corynebacterium imitans 703 F537597 Corynebacterium riegelii 719 U848548 Corynebacterium sp. L. 2012475 723 E575405 Corynebacterium sp. NML 93 0481 724 U2384.09 Corynebacterium sundsvallense 728 O9655 Corynebacterium tuscaniae 730 Y677186 Prevoteia maculosa 1504 GEKO1 OOOO3S Prevoteia or is 1513 DDVO1 OOOO91 Prevoteiia Saivae 1517 B108826 Prevotella sp. ICM55 1521 Q616399 Prevoteila sp. oral clone AA020 1528 YOO5057 Prevoteila sp. oral clone GIO32 1538 Y349396 Prevoteila sp. oral taxon G70 1558 U4321.79 Prevoteila corporis 1491 646S Bacteroides sp. 4 136 312 CTCO1 OOO133 Bacteroides sp. AR20 315 F139524 Bacteroides sp. D20 319 CPTO1000052 Bacteroides sp. F 4 322 B47O322 US 2016/0040215 A1 Feb. 11, 2016 53
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bacteroides uniformis 329 ABOSO110 10 Prevoteia nanceiensis 510 JN867228 27 Prevoteila sp. oral taxon 299 S48 ACWZO1 OOOO26 27 Prevoteila bergensis 485 ACKSO1OOO1 OO 28 Prevoteia buccais 489 JN867261 29 Prevoteia timonensis S64 ADEFO1 OOOO12 29 Prevoteia orais 512 AEPEO1 OOOO21 30 Prevotella sp. SEQ072 525 JN867238 30 LeticonoStoc Carnostin 177 NR 040811 35 Leticonostoc gasicomitatin 179 N822744 35 Leticonostoc inhae 18O R O25.204 35 Leuconostockinchi 181 R O75O14 35 Edwardsielia tarda 777 POO2154 39 Photorhabdus asymbiotica 466 76752 39 Psychrobacter arcticus 607 POOOO82 41 Psychrobacter cibarius 608 Q698586 41 Psychrobacter cryohaiolentis 609 POOO323 41 Psychrobacter faecalis 610 HQ698566 41 Psychrobacter nivimaris 611 HQ698587 41 Psychrobacter pulmonis 612 HQ698.582 41 Pseudomonas aeruginosa 592 AABQ07000001 S4 Pseudomonas sp. 2. 1 26 600 ACWUO1 OOO2S7 S4 Corynebacterium confusum 691 S886 58 Corynebacterium propinquin 712 R 037038 58 Corynebacterium pseudodiphtheriticum 713 84258 58 Bartonella baciliiformis 338 C OO8783 59 Bartonella grahamii 339 POO1562 59 Bartoneia henseiae 340 C OO5956 59 Bartonelia quintana 341 X8977OO 59 Bartoneia tanniae 342 F672728 59 Bartoneia washoensis 343 719017 59 Bruceiia abortus 430 CBO1OOOO75 59 Category-B Bruceiia canis 431 R 044652 59 Category-B Bruceiia ceti 432 CJDO1 OOOOO6 59 Category-B Bruceiia neitensis 433 EOO9462 59 Category-B Bruceiia microti 434 R 042549 59 Category-B Bruceiia ovis 435 C OO9504 59 Category-B Brucella sp. 83 13 436 CBQ01000040 59 Category-B Brucella sp. BO1 437 UO532O7 59 Category-B Bruceiia Suis 438 ACBKO1 OOOO34 59 Category-B Ochrobactrum anthropi 360 NC 009667 59 Ochrobactrum intermedium 361 ACQAO1000001 59 Ochrobactrum pseudintermedium 362 DQ365921 59 Prevoteila genomosp. C2 496 AY278625 64 Prevoteia multisaccharivorax 509 FJEO1OOOO16 64 Prevoteia sp. oral clone IDR CEC O055 543 Y55.0997 64 Prevoteia sp. oral taxon 292 547 Q422735 64 Prevoteia sp. oral taxon 300 549 U4O9549 64 Prevoteia marshii 505 EEIO1OOOO70 66 Prevoteia sp. oral clone IKO53 544 Y3494O1 66 Prevoteia sp. oral taxon 781 554 Q422744 66 Prevoteia sterCorea S62 B244774 66 Prevoteia brevis 487 R 041954 67 Prevoteia ruminicoia S16 POO2006 67 Prevoteila sp. sp24 S60 BOO3384 67 Prevoteila sp. sp34 S61 BOO338S 67 Prevoteia aibensis 483 R O253OO 68 Prevoteila copri 490 CBXO2OOOO14 68 Prevoteia ottiorum S14 6472 68 Prevoteia sp. BI 42 S18 S81354 68 Prevoteia sp. oral clone P4PB 83 P2 S46 Y2O7050 68 Prevoteia sp. oral taxon G60 557 U4321.33 68 Prevoteia annii 484 B547670 69 Bacteroides caccae 268 U1366.86 70 Bacteroides finegoidii 277 B222699 70 Bacteroides intestinais 283 BLO2OOOOO6 71 Bacteroides sp. XB44A 326 M230649 71 Bifidobacteriaceae genomosp. C1 345 Y278612 72 Bifidobacterium adolescentis 346 AAXDO2OOOO18 72 Bifidobacterium angulatum 347 BYSO2OOOOO4 72 Bifidobacterium animalis 348 POO1606 72 Bifidobacterium breve 350 POO2743 72 Bifidobacterium catenulatum 351 BXYO1 OOOO19 72 Bifidobacterium dentium 352 POO1750 72 US 2016/0040215 A1 Feb. 11, 2016 54
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bifidobacterium gallicum 353 BXBO3OOOOO4 Bifidobacterium infantis 3S4 Y151398 Bifidobacterium kashiwanohense 355 B491757 Bifidobacterium longum 356 BQQ01000041 Bifidobacterium pseudocatentiatin 357 BXXO2OOOOO2 Bifidobacterium pseudolongtim 358 R 043442 Bifidobacterium scardovii 359 3.07.005 Bifidobacterium sp. HM2 360 B42S276 Bifidobacterium sp. HMLN12 361 F519685 Bifidobacterium sp. M45 362 M626176 Bifidobacterium sp. MSX5B 363 Q616382 Bifidobacterium sp. TM 7 364 B218.972 Bifidobacterium thermophilum 365 Q340557 LeticonoStoc Citretin 11.78 M1574.44 Leticonostoc lactis 1182 R 040823 Alicyclobacilius acidoterrestris 123 R 040844 Alicyclobacilius cycloheptanicus 125 R O24754 Acinetobacter battmannii 27 CYQ01000014 Acinetobacter Caicoaceticus 28 M157426 Acinetobacter genomosp. C1 29 Y278.636 Acinetobacter haemolyticus 30 DMTO1 OOOO17 Acinetobacter johnsonii 31 CPLO1OOO162 Acinetobacteriinii 32 CPMO1(OOO13S Acinetobacter twofi 33 CPNO1 OOO2O4 Acinetobacter parvus 34 EBO1 OOO124 Acinetobacterschindleri 36 R O25412 Acinetobacter sp. 56A1 37 GQ178049 Acinetobacter sp. CIP 101934 38 JQ638573 Acinetobacter sp. CIP 102143 39 JQ638578 Acinetobacter sp. M16 22 41 HM366447 Acinetobacter sp. RUH2624 42 ACQFO1000094 8 1 Acinetobacter sp. SH024 43 DCHO1 OOOO68 Lactobacilitisiensenii O92 CQD01000066 Alcaligenes faecalis 119 B68O368 Alcaligenes sp. CO14 120 Q643040 Alcaligenes sp. S3 121 Q262549 Oigella ureolytica 366 R 041998 Oigella urethralis 367 R 041753 Eikeneia corrodens 784 CEAO1OOOO28 Kingeila denitrificans O19 EWVO1OOOO47 Kingeila genomosp. P1 oral cone MB2 C20 O20 Q003616 Kingeila kingae O21 FHSO1OOOO73 Kingeila oralis O22 CWO2OOOOOS Kingeila sp. oral clone ID059 O23 Y3 4 9 3 8 1 Neisseria elongata 330 DBFO1 OOOOO3 Neisseria genomosp. P2 oral clone MB5 P15 332 Q003630 Neisseria sp. oral clone JC012 345 34 9 3 8 8 Neisseria sp. SMC A9199 342 763637 Simonsieia matelieri 731 DCYO1OOO105 Corynebacterium glucuronolyticum 700 BYPO1 OOOO81 Corynebacterium pyruviciproducens 716 185225 Rothia aeria 649 Q673320 Rothia dentocariosa 6SO DDWO1 OOOO24 Rothia sp. oral taxon 188 653 J470892 Corynebacterium accolens 681 CGDO1OOOO48 Corynebacterium macginleyi 707 B3593.93 Corynebacterium pseudogenitalium 714 BYQ01000237 Corynebacterium tuberculostearicum 729 CVPO1 OOOOO9 Lactobacilius casei 1074 POOO423 Lactobacilius paracasei 1106 BQVO1000067 Lactobacilius zeae 1143 R 037122 Prevoteia denia is 1492 BS47678 Prevoteila sp. oral clone ASCG10 1529 AY923148 Prevoteila sp. oral clone HF050 1541 AY349399 Prevoteila sp. oral clone ID019 1542 AY3494.OO Prevoteila sp. oral clone IK062 1545 AY3494O2 Prevoteila genomosp. P9 oral clone MB7 G16 1499 DQ003633 Prevoteila sp. oral clone AU069 1531 AYOOSO62 Prevoteila sp. oral clone CY006 1532 AYOOSO63 Prevoteila sp. oral clone FLO19 1534 AY349392 Actinomyces genomosp. C1 56 AY27861O Actinomyces genomosp. C2 57 AY278611 Actinomyces genomosp. P1 oral clone MB6 CO3 58 DQ003632 Actinomyces georgiae 59 GUS 61319 US 2016/0040215 A1 Feb. 11, 2016 55
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Actinomyces israeli 60 AF47927O Actinomyces massiliensis 61 ABS45934 Actinomyces meyeri 62 GUS 61321 Actinomyces Odontolyticits 66 ACYTO1OOO123 Actinomyces orihominis 68 AJS751.86 Actinomyces sp. CCUG 37290 71 AU234058 Actinomyces sp. ICM34 75 HQ616391 Actinomyces sp. ICM41 76 HQ616392 Actinomyces sp. ICM47 77 HQ616395 Actinomyces sp. ICM54 78 HQ616398 Actinomyces sp. oral clone IP081 87 AY349366 Actinomyces sp. oral taxon 178 91 AEUHO1 OOOO60 Actinomyces sp. oral taxon 180 92 AEPPO1OOOO41 Actinomyces sp. TeS 80 GUS 61315 Haematobacter sp. BC14248 968 GU396991 Paracoccus denitrificans 1424 CPOOO490 Paracoccus marchisi 1425 NR 044922 Grimonia hoisae 967 ADAQ01000013 Shewanelia puttrefaciens 1723 CPOO2457 Afipia genomosp. 4 111 EU 117385 Rhodopseudomonas palustris 1626 CPOOO3O1 Methyliobacterium extorquens 1223 NC 01.0172 Methyliobacterium podarium 1224 AY468.363 Methyliobacterium radiotolerans 122S GU294320 Methyliobacterium sp. 1Sub 1226 AY468371 Methyliobacterium sp. MM4 1227 AY468370 Achromobacter denitrificans 18 NR 042021 Achromobacter piechaudii 19 ADMSO1OOO149 : :: Achromobacter xylosoxidans 2O ACRCO1OOOO72 e 224 Bordeteila bronchiseptica 384 NR 025949 e 224 Bordeteia hoinnesii 385 AB6831.87 e 224 Bordeteila parapertissis 386 NR 025950 e 224 Bordeteila pertissis 387 BX64O418 e 224 Microbacterium chocolatum 230 NR 037045 e 225 Microbacterium flavescens 231 EU714363 e 225 Microbacterium iacticum 233 EU714351 e 225 Microbacterium oieivorans 234 EU714381 e 225 Microbacterium oxydans 23S EU714348 e 225 Microbacterium paraOxydans 236 A491806 e 225 Microbacterium phyllosphaerae 237 EU714359 e 225 Microbacterium Schleiferi 238 NR 044936 e 225 Microbacterium sp. 768 239 EU714378 e 225 Microbacterium sp. oral strain C24KA 240 AF287752 e 225 Microbacterium testaceum 241 EU71436S e 225 Corynebacterium atypictim 686 NR 025540 e 229 Corynebacterium mastitidis 708 AB359395 e 229 Corynebacterium sp. NML 97 0186 72S GU2384.11 e 229 Mycobacterium elephantis 275 AF3.85898 e 237 Mycobacterium paraterrae 288 EU919229 e 237 Mycobacteriumphlei 289 GU142920 e 237 Mycobacterium sp. 1776 2.93 EU703152 e 237 Mycobacterium sp. 1781 294 EU703147 e 237 Mycobacterium sp. AQ1GA4 297 HM210417 e 237 Mycobacterium sp. GN 10546 299 FJ497243 e 237 Mycobacterium sp. GN 10827 300 FJ497247 e 237 Mycobacterium sp. GN 11124 301 F652846 e 237 Mycobacterium sp. GN 918.8 302 FJ497240 e 237 Mycobacterium sp. GR 2007 210 3O3 FJS55.538 e 237 Anoxybacilius contaminans 172 NR 029006 e 238 Bacilius aeolitis 195 NR 025557 e 238 Brevibacterium frigoritolerans 422 NR 042639 e 238 Geobacilius sp. E263 934 DQ647387 e 238 Geobacillus sp. WCH70 935 CPOO1638 e 238 Geobacilius thermocatentiaius 937 NR 043020 e 238 Geobacilius thermoleovorans 940 NR 074931 e 238 Lysinibacilius fusiformis 1192 FN397522 e 238 Pianonicrobium koreense 1468 NR 025O11 e 238 Sporosarcina newyorkensis 1754 AFPZO1OOO142 e 238 Sporosarcina sp. 2681 17SS GU994O81 e 238 Ureibacilius composti 1968 NR 043746 e 238 Ureibacilius Suwonensis 1969 NR 043232 e 238 Ureibacilius terrents 1970 NR 025394 e 238 Ureibacilius thermophilus 1971 NR 043747 e 238 Ureibacilius thermosphaericus 1972 NR 040961 e 238 US 2016/0040215 A1 Feb. 11, 2016 56
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Prevoteia micans 1507 AGWKO1OOOO61 e 239 Prevoteila sp. oral clone DAO58 1533 AYOO5065 e 239 Prevotella sp. SEQ053 1523 JN867222 e 239 Treponema Socranski 1937 NR 024868 e 240 P Treponema sp. 6:H:D15A 4 1938 AYOOSO83 e 240 Treponema sp. oral taxon 265 1953 GU4088SO e 240 Treponema sp. oral taxon G85 1958 GU432215 e 240 Porphyromonas endodontalis 1472 ACNNO1OOOO21 e 241 Porphyromonas sp. oral clone BB134 1478 AYOOSO68 e 241 Porphyromonas sp. oral clone FO16 1479 AYOOSO69 e 241 Porphyromonas sp. oral clone P2PB 52 P1 1480 AY2O7054 e 241 Porphyromonas sp. oral clone P4GB 100 P2 1481 AY2O7.057 e 241 Acidovorax sp. 98 63833 26 AY2S806S e 245 Comamonadaceae bacterium NML000135 663 JN5853.35 e 245 Comamonadaceae bacterium NML790751 664 JNS85331 e 245 Comamonadaceae bacterium NML910035 665 JN585332 e 245 Comamonadaceae bacterium NML910036 666 JNS85333 e 245 Comamonas sp. NSP5 668 ABO76850 e 245 Delfia acidovorans 748 CPOOO884 e 245 Xenophilus aeroiatus 2018 JNS85329 e 245 Oribacterium sp. oral taxon 078 1380 ACIQ02000009 e 246 Oribacterium sp. oral taxon 102 1381 GQ422713 e 246 Weisseiia cibaria 2007 NR 036924 e 247 Weissella confusa 2008 NR 040816 e 247 Weisseia heienica 2009 AB680902 e 247 Weisseila kandieri 2010 NR 044659 e 247 Weisseiia koreensis 2011 NR 075058 e 247 Weissella paramesenteroides 2012 ACKUO1OOOO17 e 247 Weissella sp. KLDS 7.0701 2013 EU600924 e 247 Mobiluncus curtisii 1251. AEPZO1 OOOO13 e 249 Enhydrobacter aerosaccus 785 ACYIO1 OOOO81 e 256 Moraxeia Osiloensis 1262 JN17S341 e 256 Moraxella sp. GM2 1264 F837191 e 256 Brevibacterium casei 42O JF951998 e 257 Brevibacterium epidermidis 421 NR 029262 e 257 Brevibacterium sanguinis 426 NR 028O16 e 257 Brevibacterium sp. H15 427 AB177640 e 257 Acinetobacter radioresistens 35 ACVRO1 OOOO10 e 261 Lactobacilius aimentarius O68 NR 044701 e 263 Lactobacilius farciminis O82 NR 044707 e 263 Lactobacilius kimchii O97 NR O25045 e 263 Lactobacilius nodensis 101 NR 041629 e 263 Lactobacilius tucceti 138 NR 042194 e 263 Pseudomonas mendocina 595 AAULO1OOOO21 e 265 Pseudomonas pseudoalcaligenes 598 NR 037OOO e 265 Pseudomonas sp. NP522b 602 EU723211 e 265 Pseudomonas Stutzeri 603 AM905854 e 265 Paenibacilius barcinonensis 390 NR 042272 e 270 Paenibacilius barengoitzi 391 NR 042756 e 270 Paenibacilius chibensis 392 NR 040885 e 270 Paenibacilius cooki 393 NR 025372 e 270 Paenibacilius durus 394 NR 037017 e 270 Paenibacilius glucanolyticus 395 D78470 e 270 Paenibacilius iactis 396 NR 025739 e 270 Paenibacilius pabuli 398 NR 040853 e 270 Paenibacilius popilliae 400 NR 04.0888 e 270 Paenibacillus sp. CIP 101062 401 HM212646 e 270 Paenibacilius sp. JC66 404 JF824.808 e 270 Paenibacilius sp. R 27413 40S HES86333 e 270 Paenibacilius sp. R 27422 406 HES86.338 e 270 Paenibacilius timonensis 408 NR 042844 e 270 Rothia mucilaginosa 651 ACVOO1OOOO20 e 271 Rothia nasimurium 652 NR 025310 e 271 Prevoteila sp. oral taxon 302 SSO ACZKO1OOOO43 e 280 Prevoteila sp. oral taxon F68 SS6 HMO99652 e 280 Prevoteia tannerae S63 ACIJO2OOOO18 e 280 Prevotellaceae bacterium P4P 62 P1 566 AY207061 e 280 Porphyromonas asaccharolytica 471 AENOO1 OOOO48 e 281 Porphyromonas gingivais 473 AEO15924 e 281 Porphyromonas macacae 475 NR 025908 e 281 Porphyromonas sp. UQD 301 477 EUO12301 e 281 Porphyromonas uenonis 482 ACLRO1 OOO152 e 281 Leptotrichia buccalis 16S CPOO1685 e 282 Leptotrichia hofstadii 168 ACVBO2OOOO32 e 282 US 2016/0040215 A1 Feb. 11, 2016 57
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Leptotrichia sp. oral clone HE012 1173 AY349386 Leptotrichia sp. oral taxon 223 1176 GU408547 Bacteroides fitivus 278 AFBNO1 OOOO29 Bacteroides helicogenes 281 CPOO2352 Parabacteroides johnsonii 1419 ABYHO1 OOOO14 Parabacteroides merdae 142O EU136685 Treponema denticola 1926 ADECO1OOOOO2 P Treponema genomosp. P5 oral clone MB3 P23 1929 DQ003624 Treponema pittidum 1935 AJS43428 P Treponema sp. oral clone P2PB 53 P3 1942 AY2O7055 Treponema sp. oral taxon 247 1949 GU408748 Treponema sp. oral taxon 250 1950 GU408776 Treponema sp. oral taxon 251 1951 GU408781 Anaerococciis hydrogenais 144 ABXAO1OOOO39 Anaerococcus sp. 84.04299 148 HMS873.18 Anaerococci is sp. gpac215 156 AM176540 Anaerococcits vaginalis 158 ACXUO1OOOO16 Propionibacterium acidipropionici 1569 NC O19395 Propionibacterium avidium 1571 OO3055 Propionibacterium granulosum 1573 785,716 Propionibacterium jensenii 1574 R 042269 Propionibacterium propionicum 1575 R 025.277 Propionibacterium sp. H456 1577 B177643 Propionibacterium thoenii 1581 R 042270 Bifidobacterium bifidum 349 BQPO1000027 Leticonostoc mesenteroides 11.83 CKVO1OOO113 Leticonostoc pseudomesenteroides 1184 R 040814 Johnsonella ignava 1016 87152 Propionibacterium acnes 1570 DJMO1(OOOO10 Propionibacterium sp. 434 HC2 1576 FILO1 OOOO3S Propionibacterium sp. LG 1578 Y354921 Propionibacterium sp. S555a 1579 B264622 Alicyclobacillus sp. CCUG 53.762 128 E613268 Actinomyces cardiffensis 53 J470888 Actinomyces finkei 55 Q906497 Actinomyces sp. HKU31 74 Q335393 Actinomyces sp. oral taxon C55 MO99646 Kerstersia gyiornim R O25669 Pigmentiphaga daeguiensis JN585327 Aeromonas allosaccharophila S39232 Aeromonas enteropelogenes X71121 Aeromonas hydrophila NC O08570 Aeromonasiandaei X60413 Aeromonas Salmonicida NC 009348 Aeromonastroia X60415 Aeromonas Veronii R 044845 Marvinbryantia formatexigens J505,973 Rhodobacter sp. oral taxon C30 MO9964.8 Rhodobacter sphaeroides POOO144 Lactobacilius aniri CLLO1 OOOO37 Lactobacilius coieohominis COHO1OOOO3O Lactobacilius fermentum POO2O33 Lactobacilius gastrict is CNO1OOOO60 Lactobacilius mucosae R693800 Lactobacilius oris EKLO1 OOOO77 Lactobacilius pontis M21842O Lactobacilius rentieri CGWO2OOOO12 Lactobacilius sp. KLDS 1.0707 600911 Lactobacilius sp. KLDS 1.0709 600913 Lactobacilius sp. KLDS 1.0711 600915 Lactobacilius sp. KLDS 1.0713 600917 Lactobacilius sp. KLDS 1.0716 600921 Lactobacilius sp. KLDS 1.0718 600922 Lactobacilius sp. oral taxon 052 Q422710 Lactobacilius vaginalis CGVO1OOO168 Brevibacterium aurantiacum R 044854 Brevibacterium inens 315491 Lactobacilius peniosits JN813103 Lactobacilius plantarum CGZO2OOOO33 Lactobacilius sp. KLDS 1.0702 600906 Lactobacilius sp. KLDS 1.0703 600907 Lactobacilius sp. KLDS 1.0704 600908 Lactobacilius sp. KLDS 1.0705 600909 Agrobacterium radiobacter POOO628 US 2016/0040215 A1 Feb. 11, 2016 58
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Agrobacterium timefaciens 116 A.J389893 e 316 Corynebacterium argentoratense 685 EF463055 e 317 Corynebacterium diphtheriae 693 C OO2935 e 317 P Corynebacterium pseudotuberculosis 715 R 037070 e 317 Corynebacterium renale 717 R 037069 e 317 Corynebacterium ulcerans 731 RO74467 e 317 Aurantimonas coralicida 191 AYO65627 e 318 Aireimonas aitamirensis 192 FN658986 e 318 Lactobacilius acidipiscis 1066 NR O24718 e 320 Lactobacilius Saivarius 1117 A. EBAO1OOO145 e 320 Lactobacilius sp. KLDS 1.0719 1134 EU600923 e 320 Lactobacilius butchneri 1073 ACGEHO1OOO101 e 321 Lactobacilius genomosp. C1 1086 AY278619 e 321 Lactobacilius genomosp. C2 1087 AY27862O e 321 Lactobacilius hilgardii 1089 ACGPO1 OOO2OO e 321 Lactobacilius kefiri 1096 R 042230 e 321 Lactobacilius parabuchneri 11 OS R 041294 e 321 Lactobacilius parakefiri 1107 R 029039 e 321 Lactobacilius curvatus 1079 R 042437 e 322 Lactobacilius Sakei 1116 Q989236 e 322 Aneurinibacilius aneurinilyticus 167 B101592 e 323 Aneurinibacilius danicus 168 R 028657 e 323 Anetirinibacilius migilantis 169 R 036799 e 323 Aneurinibacilius terranovensis 170 R 042271 e 323 Staphylococcusatiretts 757 POO2643 e 325 ategory-B Staphylococcusatiricularis 758 JQ624774 e 325 Staphylococci is capitis 759 ACFRO1 OOOO29 e 325 Staphylococci is caprae 760 ACRHO1 OOOO33 e 325 Staphylococci is carnostis 761 NR O75003 e 325 Staphylococcus cohnii 762 JN175375 e 325 Staphylococcus condimenti 763 R O29345 e 325 Staphylococci is epidermidis 764 CHEO1OOOOS6 e 325 Staphylococci is equtorum 765 R O2752O e 325 Staphylococciis haemolyticus 767 C 0071.68 e 325 Staphylococcus hominis 768 M157418 e 325 Staphylococci is lugdunensis 769 EQAO1000024 e 325 Staphylococci is pastetiri 770 189773 e 325 Staphylococci is pseudintermedius 771 POO2439 e 325 Staphylococci is saccharolyticus 772 R 029158 e 325 Staphylococci is saprophyticus 773 C O07350 e 325 Staphylococci is sp. clone bottae7 777 F467424 e 325 Staphylococcus sp. H292 775 B177642 e 325 Staphylococcus sp. H780 776 B177644 e 325 Staphylococci is succinus 778 R 028667 e 325 Staphylococciis warneri 780 CPZO1OOOOO9 e 325 Staphylococci is xylost is 781 Y3 9 5 O 1 6 e 325 Cardiobacterium hominis 490 CKYO1OOOO36 e 326 Cardiobacterium vaivarum 491 R 028847 e 326 Pseudomonas fittorescens 593 Y 62 2 2 2 O e 326 Pseudomonas gessardi 594 943496 e 326 Pseudomonas monteii 596 R 024910 e 326 Pseudomonas poae 597 U188951 e 326 Pseudomonas puttida 599 FO94741 e 326 Pseudomonas sp. G1229 6O1 Q910482 e 326 Pseudomonastoiaasi 604 F320988 e 326 Pseudomonas viridifiava 60S R 042764 e 326 Listeria gravi 18S CCRO2OOOOO3 e 328 Listeria innoctia 186 F967625 e 328 Listeria ivanovii 187 56151 e 328 Listeria monocytogenes 188 POO2003 e 328 ategory-B Listeria weishineri 189 M2631.98 e 328 Capnocytophaga sp. oral clone ASCH05 484 Y9 2 3 1 49 e 333 Capnocytophaga splitigena 489 e 333 Leptotrichia genomosp. C1 166 e 334 Leptotrichia Shahi 169 y h e 334 Leptotrichia sp. neutropenicPatient 170 F189244 e 334 Leptotrichia sp. oral clone GTO18 171 34 9 3 8 4 e 334 Leptotrichia sp. oral clone GTO20 172 Y3 4 9 3 8 5 e 334 Bacteroides sp. 20 3 296 CRQ01000064 e 335 Bacteroides sp. 3 119 307 DCJO1 OOOO62 e 335 Bacteroides sp. 3 2 5 311 CIBO1OOOO79 e 335 Parabacteroides distasonis 416 POOO140 e 335 Parabacteroides goldsteinii 417 Y9 7 4O 7 O e 335 Parabacteroides gordonii 418 e 335 US 2016/0040215 A1 Feb. 11, 2016 59
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Parabacteroides sp. D13 1421 ACPWO1 OOOO17 e 335 Capnocytophaga genomosp. C1 477 AY278613 e 336 Capnocytophaga ochracea 480 EOHO1 OOOOS4 e 336 Capnocytophaga sp. GEJ8 481 U561335 e 336 Capnocytophaga sp. oral strain A47ROY 486 YOO5077 e 336 Capnocytophaga sp. S1b 482 42009 e 336 Paraprevoteila clara 1426 FFYO1OOOO68 e 336 Bacteroides heparinolyticus 282 867284 e 338 Prevoteila heparinolytica 1SOO Q422742 e 338 Treponema genomosp. P4 oral clone MB2 G19 1928 Q003618 e 339 Treponema genomosp. P6 oral clone MB4 G11 1930 Q003625 e 339 Treponema sp. oral taxon 254 1952 4.08803 e 339 Treponema sp. oral taxon 508 1956 U413616 e 339 Treponema sp. oral taxon 518 1957 U413640 e 339 Chlamydia muridarum 502 E0O2160 e 341 OP Chlamydia trachomatis SO4 68443 e 341 OP Chlamydia psittaci 503 R 036864 e 342 Category-B Chlamydophila pneumoniae 509 C 002179 e 342 OP Chlamydophila psittaci 510 85.712 e 342 OP Anaerococci is Octavius 146 R 026360 e 343 Anaerococcus sp. 8405254 149 M587319 e 343 Anaerococcus sp. 9401487 150 M587322 e 343 Anaerococcus sp. 9403502 151 M5873.25 e 343 Gardnerella vaginalis 923 POO1849 e 344 Campylobacter lari 466 POOO932 e 346 Anaerobiospiriliim Sticciniciproducers 142 R O26O75 e 347 Anaerobiospirilium thomasii 143 420985 e 347 Ruminobacter amylophilus 1654 R 026450 e 347 Sticcinatimonas hippei 1897 EVOO1 OOOO27 e 347 Actinomyces europaeus S4 R 0263.63 e 348 Actinomyces sp. oral clone GU009 82 Y349.361 e 348 Moraxeiia caiarrhais 1260 POO2005 e 349 Moraxeia incoini 1261 R822735 e 349 Moraxella sp. 16285 1263 JF682466 e 349 Psychrobactersp. 13983 1613 HM2126.68 e 349 Actinobacilium massiae 49 AF487679 e 350 Actinobaculum Schaaiii 50 AY957507 e 350 Actinobaculum sp. BMH 101342 51 AY282578 e 350 Actinobaculum sp. P2P 19 P1 52 AY2O7066 e 350 Actinomyces sp. oral clone IO076 84 AY349363 e 350 Actinomyces sp. oral taxon 848 93 ACUYO1OOOO72 e 350 Actinomyces netiii 65 X71862 e 352 Mobiluncus mutieris 252 ACKWO1 OOOO3S e 352 Biastomonas natatoria 372 NR 040824 e 356 Novosphingobium aromaticivorans 357 AAAVO3OOOOO8 e 356 Sphingomonas sp. oral clone FIO12 745 AY3494.11 e 356 Sphingopyxis alaskensis 749 CPOOO356 e 356 Oxalobacter formigenes 389 ACDQ01000020 e 357 Veillonella atypica 974 AEDSO1 OOOOS9 e 358 Veillonella dispar 975 ACIKO2OOOO21 e 358 Veillonella genomosp. P1 oral clone MB5 P17 976 DQ003631 e 358 Veillonella parvula 978 ADFUO1OOOOO9 e 358 Veillonella sp. 3 1. 44 979 ADCVO1 OOOO19 e 358 Veillonella sp. 6 1 27 98O ADCWO1 OOOO16 e 358 Veillonella sp. ACP1 981 HQ616359 e 358 Veillonella sp. AS16 982 HQ616365 e 358 Veillonella sp. BS32b 983 HQ616368 e 358 Veillonella sp. ICM51a. 984 HQ616396 e 358 Veillonella sp. MSA12 985 HQ616381 e 358 Veillonella sp. NVG 100cf 986 EF108443 e 358 Veillonella sp. OK11 987 JN6956SO e 358 Veillonella sp. oral clone ASCGO1 990 AY923.144 e 358 Veillonella sp. oral clone ASCG02 991 AY95.3257 e 358 Veillonella sp. oral clone OH1A 992 AY947495 e 358 Veillonella sp. oral taxon 158 993 AENUO1 OOOOO7 e 358 Kochiria marina O40 GQ260086 e 365 Kocuria rhizophila O42 AYO3O315 e 365 Kochiria rosea O43 X87756 e 365 Kochiria varians O44 AFS42O74 e 365 Clostridiaceae bacterium END 2 531 EF451053 e 368 Micrococci is antarcticus 242 NR O25285 e 371 Micrococcus luteus 243 NR O75062 e 371 Micrococcus liviae 244 NR O262OO e 371 Micrococcus sp. 185 245 EU714334 e 371 US 2016/0040215 A1 Feb. 11, 2016 60
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Lactobacilius brevis O72 EU194349 e 372 Lactobacilius parabrevis 104 NR 042456 e 372 Pediococcus acidiactici 436 ACXBO1 OOOO26 e 372 Pediococcuspentosaceus 437 NR 075052 e 372 Lactobacilius dextrinicus O81 NR 036861 e 373 Lactobacilius peroiens 109 NR 029360 e 373 Lactobacilius rhamnostis 113 ABWJO1OOOO68 e 373 Lactobacilius Saniviri 118 AB6O2S69 e 373 Lactobacilius sp. BT6 121 HQ616370 e 373 Mycobacterium mageritense 282 FR798914 e 374 Mycobacterium neoaurum 286 AF268445 e 374 Mycobacterium smegmatis 291 CPOOO480 e 374 Mycobacterium sp. HE5 3O4 AJO12738 e 374 Dysgonomonasgadei 775 ADLVO1 OOOOO1 e 377 Dysgonomonas mossi 776 ADLWO1OOOO23 e 377 Porphyromonas levi 474 NR 025907 e 377 Porphyromonas somerae 476 ABS476.67 e 377 Bacteroides barnesiae 267 NR 041446 e 378 Bacteroides coprocola 272 ABIYO2OOOOSO e 378 Bacteroides coprophilus 273 ACBWO1OOOO12 e 378 Bacteroides doei 274 ABWZO1 OOOO93 e 378 Bacteroides massiliensis 284 AB2OO226 e 378 Bacteroides plebeius 289 AB20O218 e 378 Bacteroides sp. 3 133FAA 309 ACPSO1 OOOO85 e 378 Bacteroides sp. 31 40A 310 ACRTO1 OOO136 e 378 Bacteroides sp. 4 3 47FAA 313 ACDRO2OOOO29 e 378 Bacteroides sp. 9 142FAA 314 ACAAO1OOOO96 e 378 Bacteroides sp. NB 8 323 AB11756S e 378 Bacteroides vulgatus 331 CPOOO139 e 378 Bacteroides ovatus 287 ACWHO1 OOOO36 e 38 Bacteroides sp. 1130 294 ADCLO1OOO128 e 38 Bacteroides sp. 21 22 297 ACPQ01000117 e 38 Bacteroides sp. 2 24 299 ABZZO1 OOO168 e 38 Bacteroides sp. 3 1. 23 308 ACRSO1 OOOO81 e 38 Bacteroides sp. D1 318 ACABO2OOOO3O e 38 Bacteroides sp. D2 321 ACGAO1OOOO77 e 38 Bacteroides sp. D22 320 ADCKO1 OOO151 e 38 Bacteroides xvianisolvens 332 ADKPO1OOOO87 e 38 Treponema lecithinolyticum 1931 NR 026247 e 380 Treponema parvin 1933 AF3O2937 e 380 Treponema sp. oral clone JUO25 1940 AY3494.17 e 380 Treponema sp. oral taxon 270 1954 GQ422733 e 380 Parascardovia denticoiens 1428 ADEBO1OOOO20 e 381 Scardovia inopinata 1688 ABO29087 e 381 Scardovia wiggsiae 1689 AY278626 e 381 Clostridiales bacterium 9400853 533 HM58732O e 384 Mogibacterium diversum 1254 NR 027191 e 384 Mogibacterium neglectin 1255 NR 0272O3 e 384 Mogibacterium pumilum 1256 NR 028.608 e 384 Mogibacterium timidium 1257 Z36296 e 384 Borrelia burgdorferi 389 ABGIO1OOOOO1 e 386 Borrelia garinii 392 ABVO1 OOOOO1 e 386 Borrelia sp. NE49 397 AJ224142 e 386 Caidinonas manganoxidans 457 NR 04O787 e 387 Comamonadaceae bacterium oral taxon F47 667 HMO99651 e 387 Lautropia mirabilis 149 AEQPO1000026 e 387 Lautropia sp. oral clone AP009 1SO AYOOSO3O e 387 Peptoniphilus asaccharolyticus 441 D14145 e 389 Peptoniphilus duerdenii 442 EUS2629O e 389 Peptoniphilus harei 443 NR 026358 e 389 Peptoniphilus indolicus 444 AY153431 e 389 Peptoniphilus lacrimalis 446 ADDOO1OOOOSO e 389 Peptoniphilus sp. gpac077 450 AM176527 e 389 Peptoniphilus sp. JC140 447 JF824.803 e 389 Peptoniphilus sp. oral taxon 386 452 ADCSO1 OOOO31 e 389 Peptoniphilus sp. oral taxon 836 453 AEAAO1OOOO90 e 389 Peptostreptococcaceae bacteriumph 1 454 N837.495 e 389 Dialister pneumosinies 765 HM596.297 e 390 Dialister sp. oral taxon 502 767 GQ422739 e 390 Cupriavidus metallidurans 741, GU23O889 e 391 Herbaspirillum seropedicae OO1 CPOO2O39 e 391 Herbaspirillum sp. JC206 OO2 JN657219 e 391 Janthinobacterium sp. SY12 O15 EF455530 e 391 Massilia sp. CCUG 43427A 197 FR773700 e 391 US 2016/0040215 A1 Feb. 11, 2016 61
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Ralstonia picketti 615 NC O10682 e 391 N Ralstonia sp. 5. 7 47FAA 616 ACUFO1 OOOO76 e 391 N Franciselia novicida 889 ABSSO1 OOOOO2 e 392 N Francisella philomiragia 890 AY928.394 e 392 N Franciselia initiatensis 891 ABAZO1OOOO82 e 392 Category-A Ignatzschineria indica O09 HQ823562 e 392 Ignatzschineria sp. NML 95 0260 010 HQ823.559 e 392 Streptococci is mutans 814 APO106SS e 394 Lactobacilitisgasseri O84 ACOZO1OOOO18 e 398 Lactobacilius hominis O90 FR681902 e 398 Lactobacilius iners O91 AEKO1OOOOO2 e 398 Lactobacilius johnsonii O93 AEO171.98 e 398 Lactobacilius senioris 119 AB6O2S70 e 398 Lactobacilius sp. oral clone HT002 135 AY349.382 e 398 Weisseia beninensis 2006 EU439435 e 398 Sphingomonas echinoides 744 NR 0247OO e 399 Sphingomonas sp. oral taxon A09 747 HMO99639 e 399 Sphingomonas sp. oral taxon F71 748 HMO99645 e 399 Zymomonas mobilis 2032 NR 074274 e 399 Arcanobacterium haemolyticum 174 NR 025347 e 400 Arcanobacterium pyogenes 175 GU585578 e 400 Trieperella pyogenes 962 NR 044858 e 400 Lactococci is garvieae 144 AFO 61005 e 401 Lactococci is lactis 145 CPOO236S e 401 Brevibacterium mchreineri 424 ADNUO1OOOO76 e 402 Brevibacterium paucivorans 425 EUO86796 e 402 Brevibacterium sp. JC43 428 JF824.806 e 402 Seienomonas artemidis 692 HMS96274 e 403 Selenomonas sp. FOBRC9 704 HQ616378 e 403 Selenomonas sp. oral taxon 137 71S AENVO1 OOOOO7 e 403 Desmospora activa 751 AM940019 e 404 Desmospora sp. 8437 752 AFHTO1 OOO143 e 404 Paenibacilius sp. oral taxon F45 407 HMO99647 e 404 Corynebacterium ammoniagenes 682 ADNSO1OOOO11 e 405 Corynebacterium aurimucosum 687 ACLHO1OOOO41 e 405 Corynebacterium bovis 688 AFS37590 e 405 Corynebacterium canis 689 GQ871934 e 405 Corynebacterium casei 690 NR 025101 e 405 Corynebacterium durum 694 Z97O69 e 405 Corynebacterium efficiens 695 ACLIO1 OOO121 e 405 Corynebacterium falsenii 696 Y13024 e 405 Corynebacterium flavescens 697 NR 037040 e 405 Corynebacterium glutamicum 701 BAOOOO36 e 405 Corynebacterium jeikeium 704 ACYWO1 OOOOO1 e 405 Corynebacterium kroppenstedtii 705 NR 02638O e 405 Corynebacterium lipophiloflavum 706 ACHO1 OOOO75 e 405 Corynebacterium matriuchotii 709 ACSHO2OOOOO3 e 405 Corynebacterium minutissimum 710 X82O64 e 405 Corynebacterium resistens 718 ADGNO1OOOOS8 e 405 Corynebacterium simulans 720 AFS37604 e 405 Corynebacterium singulare 721 NR 026394 e 405 Corynebacterium sp. 1 ex sheep 722 Y13427 e 405 Corynebacterium sp. NML 99 0018 726 GU238413 e 405 Corynebacterium striatum 727 ACGEO1OOOOO1 e 405 Corynebacterium urealyticum 732 X81913 e 405 Corynebacterium variabile 734 NR 025314 e 405 Aerococci is sanguinicola 98 AY837833 e 407 Aerococci is tirinae 99 CPOO2512 e 407 Aerococci is tirinaeequi 100 NR 043443 e 407 Aerococcus viridians 101 ADNTO1 OOOO41 e 407 Fusobacterium naviforme 898 HQ223106 e 408 Moryella indoligenes 1268 AF527773 e 408 Selenomonas genomosp. P5 1697 AY341820 e 410 Selenomonas sp. oral clone IQ048 1710 AY3494.08 e 410 Selenomonas splitigena 1717 ACKPO2OOOO33 e 410 Hyphomicrobium sulfonivorans 1007 AY468372 e 411 Methylocella silvestris 1228 NR 074237 e 411 Legionella pneumophila 1153 NC OO2942 e 412 Lactobacilius coryniformis 1077 NR 044705 e 413 Arthrobacter agilis 178 NR 026198 e 414 Arthrobacter ariaitensis 179 NR 074608 e 414 Arthrobacter beigerei 180 NR 025612 e 414 Arthrobacter globiformis 181 NR 0261.87 e 414 Arthrobacter nicotianae 182 NR 026190 e 414 US 2016/0040215 A1 Feb. 11, 2016 62
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Mycobacterium abscessus 269 AGQUO1000002 e 418 OP Mycobacterium chelonae 273 ABS4861O e 418 OP Bacteroides saianitronis 291 CPOO2530 e 419 Paraprevoteia xylaniphila 427 AFBRO1OOOO11 e 419 Barnesieia intestinihominis 336 AB37O2S1 e 420 Barnesieia viscericola 337 NR 041508 e 420 Parabacteroides sp. NS31 3 422 JNO29805 e 420 Porphyromonadaceae bacterium NML 06.0648 47O EF184292 e 420 Tannerella forsythia 913 CPOO3191 e 420 Tannerella sp. 6 1 58FAA CT1 914 ACWXO1 OOOO68 e 420 Mycoplasma amphoriforme 311 AYS31656 e 421 Mycoplasma genitalium 317 L43967 e 421 Mycoplasma pneumoniae 322 NC OOO912 e 421 Mycoplasma penetrans 321 NC OO4432 e 422 Ureaplasma parvum 966 AEOO2127 e 422 Ureaplasma trealytictim 967 AAYNO1OOOOO2 e 422 Treponema genomosp. P1 927 AY34.1822 e 425 Treponema sp. oral taxon 228 943 GU40858O e 425 Treponema sp. oral taxon 230 944 GU408.603 e 425 Treponema sp. oral taxon 231 945 GU408631 e 425 Treponema sp. oral taxon 232 946 GU408.646 e 425 Treponema sp. oral taxon 235 947 GU408673 e 425 Treponema sp. ovine footrot 959 AJO10951 e 425 Treponema vincentii 960 ACYHO1OOOO36 e 425 Burkholderiales bacterium 1147 452 ADCQ01000066 e 432 R Parasutterelia excrementihominis 429 AFBPO1 OOOO29 e 432 Parasutterelia Secunda 430 AB491209 e 432 Sutterelia morbirenis 898 A.J832129 e 432 Stitterelia sanguinus 900 AJ748647 e 432 Sutterella sp. YIT 12072 901 AB491210 e 432 Sutterelia Stercoricanis 902 NR 025600 e 432 Sutterelia wadsworthensis 903 ADMFO1OOOO48 e 432 Propionibacterium feudenreichii 572 NR 036.972 e 433 Propionibacterium sp. oral taxon 192 580 GQ422728 e 433 Tessaracoccus sp. oral taxon FO4 917 HMO99640 e 433 Peptoniphilus ivorii 44S YO7840 e 434 Peptoniphilus sp. gpac007 448 AM176517 e 434 Peptoniphilus sp. gpac018A 449 AM176519 e 434 Peptoniphilus sp. gpac148 451 AM176535 e 434 Flexispira rappini 887 AY1264.79 e 436 Helicobacter biis 993 ACDNO1OOOO23 e 436 Helicobacter cinaedi 995 ABQTO1000054 e 436 Helicobacter sp. None 998 U44756 e 436 Brevundimonas sub vibrioides 429 CPOO2102 e 438 Hyphomonas neptunit in 1008 NR 074092 e 438 Phenyiobacterium zucineum 146S AY628697 e 438 Streptococci is downei 1793 AEKNO1 OOOOO2 e 441 Streptococcus sp. SHV515 1848 YO76O1 e 441 Acinetobacter sp. CIP 53.82 40 JQ638584 e 443 Halomonas elongata 990 NR 074782 e 443 Halomonasjohnsoniae 991 FR775979 e 443 Butyrivibriofibrisolvens 456 U41172 e 444 Roseburia sp. 11 SE37 1640 FM954975 e 444 Roseburia sp. 11 SE38 1641 FM954976 e 444 Shuttleworthia satelies 1728 ACIPO2OOOOO4 e 444 Shuttleworthia sp. MSX8B 1729 HQ616383 e 444 Shuttleworthia sp. oral taxon G69 173O GU432167 e 444 Bdellovibrio sp. MPA 344 AY294215 e 445 Desulfobulbus sp. oral clone CH031 755 AYOO5036 e 445 Desulfovibrio desulfuricans 757 DQ092636 e 445 Desulfovibrio fairfieldensis 758 U42221 e 445 Desulfovibrio piger 759 AF1921.52 e 445 Desulfovibrio sp. 3 1 syn3 760 ADDRO1 OOO239 e 445 Geobacter hemidjiensis 941 CPOO1124 e 445 Brachybacterium alimentarium 401 NR O26269 e 446 Brachybacterium conglomeratum 402 ABS37169 e 446 Brachybacterium tyrofermenians 403 NR 026272 e 446 Dernabacter hominis 749 FJ263375 e 446 Aneurinibacilius thermoaerophilus 171 NR 029303 e 448 Brevibacilius agri 409 NR 040983 e 448 Brevibacilius centrosporus 411 NR 043414 e 448 Brevibacilius choshinensis 412 NR 040980 e 448 Brevibacilius invocatus 413 NR 041836 e 448 Brevibacilius parabrevis 415 NR 040981 e 448 US 2016/0040215 A1 Feb. 11, 2016 63
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Brevibacilius reuszeri 416 NR 04O982 clade 448 N. N Brevibacilius sp. phR 417 JN837488 clade 448 N. N Brevibacilius thermoruber 418 NR 026514 clade 448 N. N Lactobacilius murinus 1100 NR 042231 clade 449 N N Lactobacilius Oeni 1102 NR 043095 clade 449 N N Lactobacilius ruminis 1115 ACGSO2000043 clade 449 N N Lactobacilius vini 1141 NR 042196 clade 449 N N Gemella haemolysans 924 ACDZO2OOOO12 clade 450 N. N Gemeia morbilliorum 925 NR 025904 clade 450 N N Gemeia morbilliorum 926 ACRXO1000010 clade 450 N. N Gemeila sanguinis 927 ACRYO1000057 clade 450 N. N Gemella sp. oral clone ASCE02 929 AY923.133 clade 450 N N Gemella sp. oral clone ASCF04 930 AY923.139 clade 450 N N Gemella sp. oral clone ASCF12 931 AY923143 clade 450 N N Gemella sp. WAL 1945J 928 EU427463 clade 450 N N Sporolactobacilius nakayamae 1753 NR 042247 clade 451 N N Giuconacetobacter entani 945 NR 028909 clade 452 N N Gluconacetobacter europaeus 946 NR 026513 clade 452 N N Giuconacetobacter hansenii 947 NR 026133 clade 452 N N Giuconacetobacter oboediens 949 NR 041295 clade 452 N N Gluconacetobacter xylinus 950 NR 074338 clade 452 N N Attritibacter ignavus 193 FNSS4542 clade 453 N. N Dermacoccus sp. Ellin185 750 AEIQ01000090 clade 453 N N Janibacterinosus 1013 NR 026362 clade 453 N. N Janibacter meionis 1014 EFO63716 clade 453 N. N Acetobacter aceti 7 NR 026121 clade 454 N. N Acetobacter fabarum 8 NR 042678 clade 454 N. N Acetobacteriovaniensis 9 NR 040832 clade 454 N. N Acetobacter maiorum 10 NR 025513 clade 454 N. N Acetobacter orientais 11 NR 028625 clade 454 N. N Acetobacter pasteurianus 12 NR 026107 clade 454 N. N Acetobacter pomorum 13 NR 042112 clade 454 N. N Acetobacter Syzygii 14 NR 040868 clade 454 N. N Acetobacter tropicalis 15 NR 036881 clade 454 N. N Gluconacetobacter azotoCaptains 943 NR 028767 clade 454 N. N Gluconacetobacter diazotrophicus 944 NR 074292 clade 454 N. N Gluconacetobacteriohannae 948 NR 024959 clade 454 N. N Nocardia brasiliensis 1351 AIHVO1OOOO38 clade 455 N. N Nocardia cyriacigeorgica 1352 HQ0094.86 clade 455 N N Nocardia puris 1354 NR 028994 clade 455 N N Nocardia sp. 01 Je 025 1355 GU574,059 clade 455 N N Rhodococci is equi 1623 ADNWO1OOOO58 clade 455 N. N Oceanobacilius caeni 1358 NR 041533 clade 456 N. N Oceanobacilius sp. Ndiop 1359 CAERO1000083 clade 456 N. N Ornithinibacilius bavariensis 1384 NR 044923 clade 456 N. N Ornithinibacilius sp. 7 10AIA 1385 FN397526 clade 456 N. N Virgibacilius proomi 2005 NR 025308 clade 456 N. N Corynebacterium amycolatum 683 ABZUO1000033 clade 457 N OP Corynebacterium hansenii 702 AM946639 clade 457 N N Corynebacterium xerosis 735 FN179330 clade 457 N OP Staphylococcaceae bacterium NML 92 0017 756 AY841362 clade 458 N N Staphylococcus fieuretti 766 NR 041326 clade 458 N N Staphylococci is Sciuri 774 NR 02552O clade 458 N N Staphylococciis vitatinus 779 NR 024670 clade 458 N N Stenotrophomonas maliophia 782 AAVZO1000005 clade 459 N N Stenotrophomonas sp. FG 6 783 EFO17810 clade 459 N N Mycobacterium africanum 270 AF480605 clade 46 N. OP Mycobacterium alsiensis 271 AU938169 clade 46 N. OP Mycobacterium avium 272 CPOOO479 clade 46 N. OP Mycobacterium colombiense 274 AMO62764 clade 46 N. OP Mycobacterium gordonae 276 GU142930 clade 46 N. OP Mycobacterium intracellulare 277 GQ153276 clade 46 N. OP Mycobacterium kansasii 278 AF480601 clade 46 N. OP Mycobacterium lacus 279 NR 025 175 clade 46 N. OP Mycobacterium leprae 280 FM211.192 clade 46 N. OP Mycobacterium lepromatosis 281 EU2O3590 clade 46 N. OP Mycobacterium mantenii 283 FJO42897 clade 46 N. OP Mycobacterium marinum 284 NC 01.0612 clade 46 N. OP Mycobacterium microti 285 NR 025234 clade 46 N. OP Mycobacterium parascrofitiacetim 287 ADNVO1000350 clade 46 N. OP Mycobacterium Seoulense 290 DQ536403 clade 46 N. OP Mycobacterium sp. 1761 292 EU703150 clade 46 N. N Mycobacterium sp. 1791 295 EU703148 clade 46 N. N Mycobacterium sp. 1797 296 EU703149 clade 46 N. N US 2016/0040215 A1 Feb. 11, 2016 64
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Mycobacterium sp. B10 07.09.0206 1298 HQ174245 e 46 N Mycobacterium sp. NLA001000736 1305 HM627011 e 46 N Mycobacterium sp. W 1306 DQ437715 e 46 N Mycobacterium tuberculosis 1307 CPOO1658 e 46 Category-C Mycobacterium ulcerans 1308 ABS48725 e 46 OP Mycobacterium vulneris 1309 EU834OSS e 46 OP Xanthomonas Campestris 2016 EF101975 e 461 Xanthomonas sp. kmd 489 2017 EU7231.84 e 461 Dietzia natronoimnaea 769 GQ870426 e 462 Dietzia sp. BBDP51 770 DQ337512 e 462 Dietzia sp. CA149 771 GQ870422 e 462 Dietzia timorensis 772 GQ870424 e 462 Gordonia bronchiais 951 NR O27594 e 463 Gordonia polyisoprenivorans 952 DQ385,609 e 463 Gordonia sp. KTR9 953 DQ068383 e 463 Gordonia Spitti 954 FJS36304 e 463 Gordonia terrae 955 GQ848239 e 463 Leptotrichia goodfellowii 1167 ADAD01OOO110 e 465 Leptotrichia sp. oral clone IK040 1174 AY349387 e 465 Leptotrichia sp. oral clone P2PB 51 P1 1175 AY207053 e 465 Bacteroidales genomosp. P7 oral clone MB3 P19 264 DQ003623 e 466 Butyricimonas virosa 454 AB443949 e 466 Odoribacterianeus 1363 AB4908OS e 466 Odoribacter splanchinicus 1364 CPOO2S44 e 466 Capnocytophaga gingivais 478 ACLQ01000011 e 467 Capnocytophaga granulosa 479 X97248 e 467 Capnocytophaga sp. oral clone AHO15 483 AYOOSO74 e 467 Capnocytophaga sp. oral strain S3 487 AYOO5073 e 467 Capnocytophaga sp. oral taxon 338 488 AEXXO1 OOOOSO e 467 Capnocytophaga caninorsus 476 CPOO2113 e 468 Capnocytophaga sp. oral clone ID062 485 AY3493.68 e 468 Lactobacilius catenaformis 1075 M23729 e 469 Lactobacilius vitatinus 1142 NR 041305 e 469 Cetobacterium somerae 5O1 A4381.SS e 470 Fusobacterium gonidiaformans 896 ACETO1 OOOO43 e 470 Fusobacterium mortiferum 897 ACDBO2OOOO34 e 470 Fusobacterium necrogenes 899 XSS408 e 470 Fusobacterium necrophorum 900 AM905356 e 470 Fusobacterium sp. 12 1B 905 AGWJO1 OOOO70 e 470 Fusobacterium sp. 3 15R 911 ACDDO1OOOO78 e 470 Fusobacterium sp. D12 918 ACDGO2OOOO36 e 470 Fusobacterium ulcerans 921 ACDHO1OOOO90 e 470 Fusobacterium varium 922 ACIEO1 OOOOO9 e 470 Mycoplasma arthritidis 312 NC 011025 e 473 Mycoplasma faticium 314 NR 024983 e 473 Mycoplasma hominis 3.18 AF443616 e 473 Mycoplasma orale 319 AY796060 e 473 Mycoplasma salivarium 324 M24661 e 473 Mitsuokella ialaludinii 247 NR 028840 e 474 Mitsuokeia multacida 248 ABWKO2OOOOOS e 474 Mitsuokella sp. oral taxon 521 249 GU413658 e 474 Mitsuokella sp. oral taxon G68 250 GU432166 e 474 Selenomonas genomosp. C1 695 AY278627 e 474 Selenomonas genomosp. P8 oral clone MB5 P06 700 DQ003628 e 474 Selenomonas riminantium 703 NR O75026 e 474 Veillonellaceae bacterium oral taxon 131 994 GU402916 e 474 Alioscardovia omnicoiens 139 NR 042583 e 475 Alloscardovia sp. OB7196 140 AB42SO70 e 475 Bifidobacterium urinalis 366 AJ278695 e 475 Prevoteia loescheii 503 JN867231 e 48 Prevoteila sp. oral clone ASCG12 530 DQ272511 e 48 Prevoteila sp. oral clone GUO27 S4O AY349398 e 48 Prevoteila sp. oral taxon 472 553 ACZSO1OOO106 e 48 Selenomonas dianae 693 GQ422719 e 480 Selenomonas fitteggei 694 AF2878O3 e 480 Selenomonas genomosp. C2 696 AY278628 e 480 Selenomonas genomosp. P6 oral clone MB3 C41 698 DQ003636 e 480 Selenomonas genomosp. P7 oral clone MB5 C08 699 DQ003627 e 480 Selenomonas infelix 701 AF2878O2 e 480 Selenomonas noxia 702 GU470909 e 480 Selenomonas sp. oral clone FT050 705 AY349403 e 480 Selenomonas sp. oral clone GIO64 706 AY3494.04 e 480 Selenomonas sp. oral clone GTO10 707 AY3494.OS e 480 Selenomonas sp. oral clone HU051 708 AY3494O6 e 480 US 2016/0040215 A1 Feb. 11, 2016 65
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Selenomonas sp. oral clone IK004 709 AY3494O7 e 480 Selenomonas sp. oral clone JIO21 711 AY3494.09 e 480 Selenomonas sp. oral clone JSO31 712 AY3494.10 e 480 Selenomonas sp. oral clone OH4A 713 AY947498 e 480 Selenomonas sp. oral clone P2PA 80 P4 714 AY207052 e 480 Selenomonas sp. oral taxon 149 716 AEEJO1 OOOOO7 e 480 Veillonellaceae bacterium oral taxon 155 995 GU470897 e 480 AgrococcuSienensis 117 NR O26275 e 484 Microbacterium gubbeenense 232 NR O25098 e 484 Pseudoclavibacter sp. Timone 590 FJ375951 e 484 Tropheryma whippiei BX2S1412 e 484 Zimmermannella bifida ABO12592 e 484 Legionelia hackeiae M36O28 e 486 Legionelia longbeachae M36O29 e 486 Legionella sp. D3923 JN380999 e 486 Legionella sp. D4088 JN381O12 e 486 Legionella sp. H63 JF831047 e 486 Legionella sp. NML 93L054 UO627O6 e 486 Legionelia Steelei Q3982O2 e 486 Taiiockia micdadei 36032 e 486 Helicobacter pullorum BQUO1000097 e 489 Acetobacteraceae bacterium AT5844 GEZO1OOOO40 e 490 Roseomonas cervicais DVLO1 OOO363 e 490 Roseomonas inticosa R 028857 e 490 Roseomonas sp. NML94 0193 F533357 e 490 Roseomonas sp. NML97 0121 F533359 e 490 Roseomonas sp. NML98 0009 F533358 e 490 Roseomonas sp. NML98 O157 F533360 e 490 Rickettsia akari POOO847 e 492 Rickettsia Conorii E0O8647 e 492 Rickettsia prowazeki 21789 e 492 Rickettsia rickettsii C O10263 e 492 Rickettsia Siovaca 36.224 e 492 Rickettsia typhi EO171.97 e 492 Anaeroglobits geminati is GCJO1 OOOOS4 e 493 Megasphaera genomosp. C1 Y278622 e 493 Megasphaera micronticifornis ECSO1OOOO20 e 493 Clostridiales genomosp. BVAB3 POO1850 e 495 Tsukamtirella pattrometabola 80628 e 496 Tsukamurella tyrosinosolvens B478958 e 496 Abiotrophia para adiacens BO22027 e 497 Carnobacterium divergens R 044706 e 497 Carnobacterium maitaromaticum C O19425 e 497 Enterococci is a vitin F133535 e 497 Enterococciis Caccae Y94382O e 497 Enterococci is cassellifiavits EWTO1OOOO47 e 497 Enterococci is durans 2763S4 e 497 Enterococci is faecalis EO16830 e 497 Enterococci is faecium M157434 e 497 Enterococci is gallinarum B269767 e 497 Enterococci is gilvis YO33814 e 497 Enterococci is hawaiiensis Y321377 e 497 Enterococcus hirae FO 61011 e 497 Enterococci is italicits EPVO1 OOO109 e 497 Enterococcus mindtii R 024906 e 497 Enterococci is rafinostis FN600541 e 497 Enterococcus sp. BV2CASA2 JN809766 e 497 Enterococcus sp. CCRI 16620 GU457263 e 497 Enterococcus sp. F95 FJ463817 e 497 Enterococcus sp. RfL6 AJ133478 e 497 Enterococcus thailandicus AY321376 e 497 Fusobacterium canifelinum AY162222 e 497 Fusobacterium genomosp. C1 AY278616 e 497 Fusobacterium genomosp. C2 AY278617 e 497 Fusobacterium periodonticum ACYO1 OOOOO2 e 497 Fusobacterium sp. 1141 FAA ADGGO1OOOOS3 e 497 Fusobacterium sp. 113 2 ACUOO1OOOOS2 e 497 Fusobacterium sp. 213 1 ACDCO2OOOO18 e 497 Fusobacterium sp. 3 12 7 ADGFO1OOOO45 e 497 Fusobacterium sp. 3 133 ACQE01.000178 e 497 Fusobacterium sp. 3 136A2 ACPUO1 OOOO44 e 497 Fusobacterium sp. AC18 HQ616357 e 497 Fusobacterium sp. ACB2 HQ616358 e 497 Fusobacterium sp. AS2 HQ616361 e 497 US 2016/0040215 A1 Feb. 11, 2016 66
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Fusobacterium sp. CM1 915 HQ616371 e 497 Fusobacterium sp. CM21 916 HQ616375 e 497 Fusobacterium sp. CM22 917 HQ616376 e 497 Fusobacterium sp. oral clone ASCF06 919 AY923141 e 497 Fusobacterium sp. oral clone ASCF11 920 AY953.256 e 497 Granticateia adiacens 959 ACKZO1OOOOO2 e 497 Granticatella elegans 960 AB2S2689 e 497 Granticatella paradiacens 961 AY879298 e 497 Granulicatella sp. oral clone ASCO2 963 AY923.126 e 497 Granulicatella sp. oral clone ASCA05 964 DQ341469 e 497 Granulicatella sp. oral clone ASCB09 96S AY95.3251 e 497 Granulicatella sp. oral clone ASCG05 966 AY923.146 e 497 Tetragenococciis halophilus 1918 R O75020 e 497 Tetragenococci is koreensis 1919 R 043113 e 497 Vagococcits fiti vialis 1973 R 026489 e 497 Chryseobacterium anthropi S14 M982.793 e 498 Chryseobacterium gleum 515 CKQ02000003 e 498 Chryseobacterium hominis S16 R 042517 e 498 Treponema refingens 1936 F426101 e 499 Treponema sp. oral clone JUO31 1941 Y3 4 9 4 1 6 e 499 Treponema sp. oral taxon 239 1948 408738 e 499 Treponema sp. oral taxon 271 1955 4.08871 e 499 Alistipes finegoidii 129 R 043064 e 500 Alistipes onderdonki 131 R 043318 e 500 Alistipes puttredinis 132 BFKO2OOOO17 e 500 Alistipes shahi 133 FP929O32 e 500 Alistipes sp. HGB5 134 A. ENZO1 OOOO82 e 500 Alistipes sp. JC50 135 JF824.804 e 500 Alistipes sp. RMA 9912 136 Q140629 e 500 Mycoplasma agaiaciae 1310 FO10477 e 501 Mycoplasma hovoculi 1313 R O25987 e 501 Mycoplasma fermenians 1315 POO2458 e 501 Mycoplasmafiocchiare 1316 62699 e 501 Mycoplasma ovipneumoniae 132O R O25989 e 501 Arcobacter buizieri 176 EPTO1OOOO71 e 502 Arcobacter cryaerophilus 177 R O25905 e 502 Campylobacter curvus 461 NC OO9715 e 502 Campylobacter rectus 467 ACFUO1 OOOOSO e 502 Campylobacter Showae 468 ACVQ01000030 e 502 Campylobacter sp. FOBRC14 469 HQ616379 e 502 Campylobacter sp. FOBRC15 470 HQ616380 e 502 Campylobacter sp. oral clone BB120 471 AYOOSO38 e 502 Campylobacter splitorum 472 NR 044839 e 502 Bacteroides tireolyticus 330 GQ167666 e 504 Campylobacter gracilis 463 ACYGO1OOOO26 e 504 Campylobacter hominis 464 NC OO9714 e 504 Dialister invisits 762 ACIMO2OOOOO1 e 506 Dialister micraerophilus 763 FBBO1OOOO28 e 506 Dialister microaerophilus 764 ENTO1 OOOOO8 e 506 Dialister propioniclifaciens 766 R 043231 e 506 Dialister succinatiphilus 768 B370249 e 506 Megasphaera eisdenii 1200 YO 3 8 9 9 6 e 506 Megasphaera genomosp. type 1 12O2 DGPO1OOOO10 e 506 Megasphaera sp. BLPYG 07 1204 M990964 e 506 Megasphaera sp. UPII 1996 12OS FIO1OOOO40 e 506 Chronobacterium violiaceum 513 C O05085 e 507 Laribacter hongkongensis 1148 POO1154 e 507 Methylophilus sp. ECd5 1229 Y436794 e 507 Finegoidia magna 883 CHMO2OOOOO1 e 509 Parvinonas micra 1431 B729O72 e 509 Parvimonas sp. oral taxon 110 1432 FIIO1 OOOOO2 e 509 Peptostreptococci is microS 1456 M176538 e 509 Peptostreptococcus sp. oral clone FJO23 1460 Y3 4 9 3 9 O e 509 Peptostreptococcus sp. P4P 31 P3 1458 Y2O7059 e 509 Helicobacter pylori 997 POOOO12 e 510 P Anaplasma marginale 16S BORO1 OOOO19 e 511 Anaplasma phagocytophilum 166 C 007797 e 511 Ehrlichia chafeensis 783 AAIFO1 OOOO3S e 511 Neorickettsia risticii 1349 CPOO1431 e 511 Neorickettsia Sennetsu 1350 NC 007798 e 511 Pseudoramibacter alactolyticus 1606 ABO36759 e 512 Veillonella montpellierensis 1977 AF473836 e 513 Veillonella sp. oral clone ASCA08 1988 AY923.118 e 513 Veillonella sp. oral clone ASCB03 1989 AY923.122 e 513 US 2016/0040215 A1 Feb. 11, 2016 67
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Inquilinus inostis 1012 NR 029046 Sphingomonas sp. oral clone FZO16 1746 AY34.9412 Anaerococci is lactolyticits 145 ABYOO1 OOO217 Anaerococcits prevotii 147 CPOO1708 Anaerococci is sp. gpac104 152 AM176528 Anaerococci is sp. gpac126 153 AM176530 Anaerococci is sp. gpac155 154 AM176536 Anaerococci is sp. gpac199 1SS AM176539 Anaerococci is tetradius 157 ACGCO1 OOO107 Bacteroides coaglians 271 ABS47639 Clostridiales bacterium 9403326 534 HMS87324 Clostridiales bacterium ph2 539 JN837487 Peptostreptococci is sp. 9Succ1 1457 X90471 Peptostreptococci is sp. oral clone AP24 1459 AB17SO72 Tissierelia praeactita 1924 NR 044860 Helicobacter Canadensis 994 ABQSO1000108 Peptostreptococci is anaerobius 1455 AY326462 Peptostreptococci is Stomatis 1461 ADGQ01000048 : g Biophila wadsworthia 367 ADCPO1 OOO166 e 521 Desulfovibrio vulgaris 761 NR 074897 e 521 Actinomyces nasicola 64 AJSO84S5 e 523 Cellulosimicrobium funkei SOO AYSO1364 e 523 Lactococci is raffinolactis 1146 NR 044359 e 524 Bacteroidales genomosp. 258 AY341819 e 529 Bacteroidales genomosp. P2 oral clone MB1 G13 259 DQ003613 e 529 Bacteroidales genomosp. P3 oral clone MB1. G34 260 DQ003615 e 529 Bacteroidales genomosp. P4 oral clone MB2 G17 261 DQ003617 e 529 Bacteroidales genomosp. P5 oral clone MB2 P04 262 DQ003619 e 529 Bacteroidales genomosp. P6 oral clone MB3 C19 263 DQ003634 e 529 Bacteroidales genomosp. P8 oral clone MB4 G15 26S DQ003626 e 529 Bacteroidetes bacterium oral taxon D27 333 HMO99638 e 530 Bacteroidetes bacterium oral taxon F31 334 HMO99643 e 530 Bacteroidetes bacterium oral taxon F44 335 HMO99649 e 530 Flavobacterium sp. NF2 1 88S F195988 e 530 Myroides odoratimimus 1326 NR 042354 e 530 Myroides sp. MY15 1327 GU253339 e 530 Chlamydiales bacterium NS16 507 JN606O76 e 531 Chlamydophila pecorum SO8 D883.17 e 531 Parachlamydia sp. UWE25 1423 BX908798 e 531 Fusobacterium russi 903 NR 044687 e 532 Streptobacilius moniiformis 1784 NR 027615 e 532 Eubacteriaceae bacterium P4P 50 P4 833 AY2O7O60 e 533 Abiotrophia defectiva 1 ACINO2OOOO16 e 534 Abiotrophia sp. oral clone P4PA 155 P1 3 AY2O7063 e 534 Catonella genomosp. P1 oral clone MB5 P12 496 DQ003629 e 534 Caioneia morbi 497 ACILO2OOOO16 e 534 Catonella sp. oral clone FLO37 498 AY34.9369 e 534 Eremococci is Coleocola 818 AENNO1 OOOOO8 e 534 Fackiania hominis 879 Y10772 e 534 Granulicatella sp. M658 99 3 962 A.271861 e 534 Campylobacter coli 459 AAFLO1OOOOO4 e 535 Campylobacter concisus 460 CPOOO792 e 535 Campylobacter fetus 462 ACLGO1001177 e 535 Campylobacterieitini 46S AL139074 e 535 Category-B Campylobacter upsaliensis 473 AEPUO1 OOOO40 e 535 OP Atopobium minuti in 183 HMOOfS83 e 539 Atopobium parvulum 184 CPOO1721 e 539 Atopobium finae 185 ACFEO1OOOOO7 e 539 Atopobium sp. BS2 186 HQ616367 e 539 Atopobium sp. F0209 187 EUS92966 e 539 Atopobium sp. ICM42b10 188 HQ616393 e 539 Atopobium sp. ICM57 189 HQ616400 e 539 Atopobium vaginae 190 AEDQ01000024 e 539 Coriobacteriaceae bacterium BV3Ac1 677 JN809768 e 539 Actinomyces naeslundi 63 X81062 e 54 Actinomyces Oricola 67 NR 025559 e 54 Actinomyces Oris 69 BABVO1 OOOO70 e 54 Actinomyces sp. 7400942 70 EU484334 e 54 Actinomyces sp. ChDC B197 72 AF543275 e 54 Actinomyces sp. GEJ15 73 GU561313 e 54 Actinomyces sp. M2231. 941 79 AJ234063 e 54 Actinomyces sp. oral clone GU067 83 AY349362 e 54 Actinomyces sp. oral clone IO077 85 AY349364 e 54 Actinomyces sp. oral clone IP073 86 AY349365 e 54 US 2016/0040215 A1 Feb. 11, 2016 68
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Actinomyces sp. oral clone JAO63 88 AY349367 clade 54 N. N Actinomyces sp. oral taxon 170 89 AFBLO1OOOO10 clade 54 N. N Actinomyces sp. oral taxon 171 90 AECWO100.0034 clade 54 N. N Actinomyces tirogenitalis 95 ACFHO1000038 clade 54 N. N Actinomyces viscosits 96 ACREO1000096 clade 54 N. N Orientia tsutsugamishi 383 APOO8981 clade 541 N OP Megamonas finifornis 198 AB300988 clade 542 N. N Megamonas hypermegale 199 A42O107 clade 542 N. N Aeronicrobium marinum 102 NR 025681 clade 544 N N Aeromicrobium sp. JC14 103 JF824798 clade 544 N N Latteococci is sanguinis 190 NR 025507 clade 544 N N Propionibacteriaceae bacterium NML 02 0265 568 EF59.9122 clade 544 N N Rhodococcus corynebacterioides 622 X80615 clade 546 N N Rhodococcus erythropolis 624 ACNOO1000030 clade 546 N. N Rhodococci is fascians 625 NR 037021 clade 546 N N Segniipartis rotundits 690 CPOO1958 clade 546 N N Segniipartis rugostis 691 ACZIO1 OOOO2S clade 546 N N Exigliobacterium acetylictim 878 FJ970O34 clade 547 N N Macrococci is caseolyticits 194 NR 074941 clade 547 N N Streptomyces sp. 1 AIP 2009 890 FJ176782 clade 548 N. N Streptomyces sp. SD 524 892 EUS44234 clade 548 N. N Streptomyces sp. SD 528 893 EUS44233 clade 548 N. N Streptomyces thermo violacetis 895 NR 027616 clade 548 N. N Borrelia afzelii 388 ABCUO1000001 clade 549 N OP Borreia crocidurae 390 DQ057990 clade 549 N OP Borreia dutionii 391 NC 011229 clade 549 N OP Borreia herinsii 393 AY597657 clade 549 N OP Borrelia hispanica 394 DQ057988 clade 549 N OP Borrelia persica 39S HM161645 clade 549 N OP Borreia recurrentis 396 AF107367 clade 549 N OP Borrelia spielmani 398 ABKBO1000002 clade 549 N OP Borreia iuricatae 399 NC 008710 clade 549 N OP Borreia vaiaisiana 400 ABCYO1000002 clade 549 N OP Providencia alcalifaciens 1586 ABXWO1000071 clade 55 N. N Providencia retigeri 1587 AMO40492 clade 55 N N Providencia rustigiani 1588 AMO40489 clade 55 N N Providencia Stuarii 1589 AFOO8581 clade 55 N N Treponema pallidiin 1932 CPOO1752 clade 550 N OP Treponema phagedenis 1934 AEFHO1OOO172 clade 550 N. N Treponema sp. clone DDKL 4 1939 YO8894 clade 550 N N Acholeplasma laidlawii 17 NR 074448 clade 551 N N Mycoplasma pittrefaciens 1323 U26055 clade 551 N N Mycoplasmataceae genomosp. P1 oral clone MB1 G23 1325 DQ003614 clade 551 N N Spiroplasma insolitain 1750 NR 025.705 clade 551 N N Coinseila intestinais 660 ABXHO2OOOO37 clade 553 N N Coinseiia Stercoris 661 ABXJO1OOO150 clade 553 N. N Coinseila tanakaei 662 AB490807 clade 553 N. N Caminicella sporogenes 458 NR 025485 clade 554 N. N Acidaminococci is fermenians 21 CPOO1859 clade 556 N. N Acidaminococcits intestini 22 CPOO3058 clade 556 N. N Acidaminococcus sp. D21 23 ACGBO1000071 clade 556 N. N Phascolarctobacterium faecium 1462 NR 026111 clade 556 N. N Phascolarctobacterium sp. YIT 12068 1463 AB490812 clade 556 N. N Phascoiarctobacterium succinatuiens 1464 AB490811 clade 556 N. N Acidithiobacilius ferrivorans 25 NR 074660 clade 557 N N Xanthomonadaceae bacterium NML 030222 2015 EU313791 clade 557 N N Catabacter hongkongensis 494 AB671763 clade 558 N N Christenseneia minuta S12 AB490809 clade 558 N N Clostridiales bacterium oral clone P4PA 66 P1 536 AY2O7065 clade 558 N N Clostridiales bacterium oral taxon 093 537 GQ422712 clade 558 N N Heliobacterium modesticaidium 1000 NR 074517 clade 560 N N Alistipes indistinctus 130 AB490804 clade 561 N N Bacteroidales bacteriumph 8 257 N837494 clade 561 N N Candidates Suicia matelieri 475 CPOO21 63 clade 561 N N Cytophaga xylanolytica 742 FR733683 clade 561 N N Flavobacteriaceae genomosp. C1 884 AY278614 clade 561 N N Gramella forsetii 958 NR 074707 clade 561 N N Sphingobacterium faecium 1740 NR 025537 clade 562 N N Sphingobacterium mizutai 1741 JF708889 clade 562 N N Sphingobacterium multivorum 1742 NR 040953 clade 562 N N Sphingobacterium spiritivorum 1743 ACHAO2000013 clade 562 N N Jonquetelia anthropi 1017 ACOOO2000004 clade 563 N N Pyramidobacter piscolens 1614 AY2O70S6 clade 563 N N Synergistes genomosp. C1 1904 AY278615 clade 563 N N US 2016/0040215 A1 Feb. 11, 2016 69
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Synergistes sp. RMA 14551 1905 DQ412722 e 563 Synergistetes bacterium ADV897 1906 GQ258968 8. e 563 Candidates Arthromitus sp. 474 NR 074,460 C 8. e 564 S SFB mouse Yit Graciibacter thermotoierans 957 NR 043559 e 564 Brachyspira aalborgi 404 FM178386 e 565 Brachyspira sp. HIS3 406 FM178387 e 565 Brachyspira sp. HIS4 407 FM178388 e 565 Brachyspira sp. HIS5 408 FM178389 e 565 Adlercreutzia equoifaciens 97 AB306661 e 566 Coriobacteriaceae bacterium JC110 678 CAEMO1(OOOO62 e 566 Coriobacteriaceae bacterium phI 679 JN837493 e 566 Cryptobacterium curtum 740 GQ422741 e 566 Eggerihelia Sinensis 779 AY321958 e 566 Eggerthelia sp. 13 56FAA 780 ACWNO1 OOOO99 e 566 Eggerthelia sp. HGA1 781. AEXRO1OOOO21 e 566 Eggerthella sp. YY7918 782 APO12211 e 566 Gordonibacter pameiaeae 680 AM886059 e 566 Gordonibacter pameiaeae 956 FP929047 e 566 Slackia equoifaciens 732 EU377663 e 566 Slackia exiglia CUXO1OOOO29 e 566 Slackia faecicanis R 042220 e 566 Siackia heiotrinireducens RO74439 e 566 Slackia isoflavoniconvertens BS66418 e 566 Slackia piriformis B490806 e 566 Slackia sp. NATTS B505075 e 566 Chlamydiales bacterium NS13 SO6 JN606O75 e 567 Victivallaceae bacterium NML 08.0035 394.915 e 567 Victivais vadensis BDEO2OOOO10 e 567 Streptomyces grisetts 8 89 RO74787 e 573 Streptomyces sp. SD 511 US44231 e 573 Streptomyces sp. SD 534 US44232 e 573 Cloacibacilius eviyensis 530 GQ258966 e 575 Deferribacteres sp. oral clone JV001 743 AY349370 e 575 Deferribacteres sp. oral clone JVO23 745 AY3493.72 e 575 Synergistetes bacterium. LBVCM1157 907 GQ258969 e 575 Synergistetes bacterium oral taxon 362 909 GU410752 e 575 Synergistetes bacterium oral taxon D48 910 GU430992 e 575 Peptococcus sp. oral clone JM048 439 AY34938.9 e 576 Helicobacter winghamensis 999 ACDOO1OOOO13 e 577 Wolinella succinogenes 2014 BXS71657 e 577 Olseneila genomosp. C1 368 AY278623 e 578 Olseneia profitsa 369 FN178466 e 578 Olseneila sp. F0004 370 EUS92964 e 578 Olseneila sp. oral taxon 809 371 ACVEO1OOOOO2 e 578 Olseneia iiii 372 CPOO2106 e 578 Nocardiopsis dassonvillei 356 CPOO2O41 e 579 Peptococci is niger 438 NR 029221 e 580 Peptococcus sp. oral taxon 167 440 GQ422727 e 580 Akkermansia muciniphila 118 CPOO1071 e 583 Opittituts terrae 373 NR 074978 e 583 Clostridiales bacterium oral taxon F32 S38 HMO99644 e 584 Leptospira borg.petersenii 161 NC OO8508 e 585 Leptospira broomi 162 NR 043200 e 585 Leptospira interrogans 163 NC OO5823 e 585 Methanobrevibactergottschalkii 213 NR 04.4789 e 587 Meihanobrevibacter milierrae 214 NR 042785 e 587 Meihanobrevibacter oralis 216 HE654OO3 e 587 Meihanobrevibacter thanieri 219 NR 044787 e 587 Meihanobrevibacter Smithii 218 ABYVO2OOOOO2 e 588 Deinococcus radiodurans 746 AEOOOS13 e 589 Deinococcus sp. R 43890 747 FR682.752 e 589 Thermits aquaticits 923 NR 025900 e 589 Actinomyces sp. c109 81 AB167239 e 590 Syntrophomonadaceae genomosp. P1 912 AY34.1821 e 590 Anaerobaculum hydrogeniformans 141 ACJXO2OOOOO9 e 591 Microcystis aeruginosa 246 NC 0102.96 e 592 Prochiorococcus marinus 567 CPOOO551 e 592 Meihanobrevibacter acididatrans 208 NR 028779 e 593 Methanobrevibacter arboriphilus 209 NR 042783 e 593 Meihanobrevibacter curvatus 210 NR 044796 e 593 Meihanobrevibacter culticularis N R 044776 e 593 Methanobrevibacter filiformis N R 044801 e 593 Meihanobrevibacter woesei N R 044788 e 593 US 2016/0040215 A1 Feb. 11, 2016 70
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Roseiflexus castenholzii 642 CPOOO804 clade 594 N N Methanobrevibacter oileyae 215 NR 043024 clade 595 N N Meihanobrevibacter ruminantium 217 NR 042784 clade 595 N N Meihanobrevibacter woiinii 221 NR 044790 clade 595 N N Meihanosphaera Stadtmanae 222 AY196684 clade 595 N N Chloroflexigenomosp. P1 S11 AY331414 clade 596 N N Haiorubrum lipolyticum 992 AB477978 clade 597 N N Methanobacterium formicicum 207 NR 025O28 clade 597 N N Acidiiobus saccharov.orans 24 AY3SOS86 clade 598 N N Hyperthermus butyllicus O06 CPOOO493 clade 598 N N Ignicocci is islandict is O11 X99562 clade 598 N N Metaliosphaera seditia 2O6 D26491 clade 598 N N Thermofilum pendens 922 X14835 clade 598 N N Prevoteila melaninogenica SO6 CPOO2122 clade 6 N N Prevoteila sp. ICM1 520 HQ616385 clade 6 N N Prevoteila sp. oral clone FU048 535 AY349393 clade 6 N N Prevoteila sp. oral clone GIO30 537 AY349395 clade 6 N N Prevoteila sp. SEQ116 526 JN867246 clade 6 N N Streptococci is anginostis 787 AECTO1000011 clade 60 N N Streptococcus milieri 812 X81023 clade 60 N N Streptococcus sp. 16362 829 JNS90019 clade 60 N N Streptococcus sp. 69130 832 X7882S clade 60 N N Streptococcus sp. AC15 833 HQ616356 clade 60 N N Streptococcus sp. CM7 839 HQ616373 clade 60 N N Streptococcus sp. OBRC6 847 HQ616352 clade 60 N N Burkholderia ambifaria 442 AAUZO1000009 clade 61 N OP Burkholderia cenocepacia 443 AAHIO1OOOO60 clade 61 N OP Burkholderia cepacia 444 NR 041719 clade 61 N OP Burkhoideria maiei 445 CPOOOS47 clade 61 N Category-B Burkhoideria multivorans 446 NC 010086 clade 61 N OP Burkhoideria Okiahomensis 447 DQ108388 clade 61 N OP Burkholderia pseudomaiei 448 CPOO1408 clade 61 N Category-B Burkhoideria rhizoxinica 449 HQ005410 clade 61 N OP Burkholderia sp. 383 450 CPOOO151 clade 61 N OP Burkhoideria xenovorans 451 U86373 clade 61 N OP Prevoteia buccae 1488 ACRBO1OOOOO1 clade 62 N N Prevoteila genomosp. P8 oral clone MB3 P13 1498 DQ003622 clade 62 N N Prevotella sp. oral clone FW035 1536 AY349394 clade 62 N N Prevoteia bivia 1486 ADFOO1000096 clade 63 N N Prevoteia disiens 1494 AEDOO1000026 clade 64 N N Bacteroides faecis 276 GQ496624 clade 65 N N Bacteroides fragilis 279 APOO6841 clade 65 N N Bacteroides nordi 285 NR 043017 clade 65 N N Bacteroides Salversiae 292 EU136690 clade 65 N N Bacteroides sp. 11 14 293 ACRPO1 OOO15S clade 65 N N Bacteroides sp. 11 6 295 ACICO1OOO215 clade 65 N N Bacteroides sp. 2 156FAA 298 ACWIO1OOOO65 clade 65 N N Bacteroides sp. AR29 316 AF13952S clade 65 N N Bacteroides sp. B2 317 EU722733 clade 65 N N Bacteroides theiaioiaomicron 328 NR 074277 clade 65 N N Actinobacilius minor 45 ACFTO1OOOO2S clade 69 N N Haemophilias parastis 978 GU226366 clade 69 N N Vibrio choierae 996 AAURO1000095 clade 71 N Category-B Vibrio fluvialis 997 X76335 clade 71 N Category-B Vibrio furnissi 998 CPOO2377 clade 71 N Category-B Vibrio mimicus 999 ADAFO1OOOOO1 clade 71 N Category-B Vibrio parahaemolyticus 2000 AAWQ01000116 clade 71 N Category-B Vibrio sp. RC341 2001 ACZTO1000024 clade 71 N Category-B Vibrio vulnificus 2002 AEO16796 clade 71 N Category-B Lactobacilius acidophilus O67 CPOOOO33 clade 72 N N Lactobacilius amylolyticuts O69 ADNYO1OOOOO6 clade 72 N N Lactobacilius amylovortis O70 CPOO2338 clade 72 N N Lactobacilius crispatus O78 ACOGO1000151 clade 72 N N Lactobacilius deilbruecki O80 CPOO2341 clade 72 N N Lactobacilius helveticus O88 ACLM010.00202 clade 72 N N Lactobacilius kaixensis O94 NR 029083 clade 72 N N Lactobacilius kefiranofaciens O95 NR 042440 clade 72 N N Lactobacilius leichmannii O98 X986966 clade 72 N N Lactobacilius sp. 66c 120 FR681900 clade 72 N N Lactobacilius sp. KLDS 1.0701 122 EU600905 clade 72 N N Lactobacilius sp. KLDS 1.0712 130 EU6OO916 clade 72 N N Lactobacilius sp. oral clone HTO70 136 AY349383 clade 72 N N Lactobacilius tiltinensis 139 ACGUO1000081 clade 72 N N Prevoteia intermedia SO2 AF414829 clade 81 N N US 2016/0040215 A1 Feb. 11, 2016 71
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Prevotella nigrescens 511 AFPXO1OOOO69 clade 81 N N Prevoteila pallens 515 AFPYO1OOO135 clade 81 N N Prevoteila sp. oral taxon 310 551 GQ422737 clade 81 N N Prevoteila genomosp. C1 495 AY278624 clade 82 N N Prevotella sp. CM38 519 HQ610181 clade 82 N N Prevoteila sp. oral taxon 317 552 ACQHO1000158 clade 82 N N Prevoteila sp. SG12 S27 GUS 61343 clade 82 N N Prevoteia denticoia 493 CPOO2S89 clade 83 N N Prevoteila genomosp. P7 oral clone MB2 P31 497 DQ003620 clade 83 N N Prevoteia histicoia 5O1 JN867315 clade 83 N N Prevoteila multiformis 508 AEWXO1000054 clade 83 N N Prevotella sp. JCM 6330 S22 ABS47699 clade 83 N N Prevoteila sp. oral clone GIO59 539 AY349397 clade 83 N N Prevoteila sp. oral taxon 782 555 GQ422745 clade 83 N N Prevoteila sp. oral taxon G71 S59 GU43218O clade 83 N N Prevotella sp. SEQ065 524 JN867234 clade 83 N N Prevoteia verora is 565 ACVAO1000027 clade 83 N N Bacteroides acidifaciens 266 NR 0286O7 clade 85 N N Bacteroides cellulosilyticus 269 ACCHO1000108 clade 85 N N Bacteroides clarus 270 AFBMO1000011 clade 85 N N Bacteroides eggerthi 275 ACWGO1OOOO65 clade 85 N N Bacteroides Oleicipientis 286 ABS47644 clade 85 N N Bacteroides pyogenes 290 NR 04128O clade 85 N N Bacteroides sp. 315 5 300 FJ848S47 clade 85 N N Bacteroides sp. 31SF15 301 AJS83248 clade 85 N N Bacteroides sp. 31SF18 3O2 AJS83249 clade 85 N N Bacteroides sp. 35AE31 3O3 AJS83244 clade 85 N N Bacteroides sp. 35AE37 3O4 AJS83245 clade 85 N N Bacteroides sp. 35BE34 3OS AJS83246 clade 85 N N Bacteroides sp. 35BE35 306 AJS83247 clade 85 N N Bacteroides sp. WH2 324 AY89518O clade 85 N N Bacteroides sp. XB12B 325 AM230648 clade 85 N N Bacteroides stercoris 327 ABFZO2000022 clade 85 N N Actinobacilius pietiropneumoniae 46 NR 074857 clade 88 N N Actinobacilius tireae 48 AEVGO1000167 clade 88 N N Haemophilus aegyptius 969 AFBCO1000053 clade 88 N N Haemophilus ducreyi 97O AEO17143 clade 88 N OP Haemophilus haemolyticus 973 JN175335 clade 88 N N Haemophilus influenzae 974 AADPO1OOOOO1 clade 88 N OP Haemophilus parahaemolyticus 975 GU561425 clade 88 N N Haemophilus parain fittenzae 976 AEWUO1000024 clade 88 N N Haemophilus paraphrophaemolyticuts 977 M75076 clade 88 N N Haemophilus Somnus 979 NC 008309 clade 88 N N Haemophilus sp. 70334 980 HQ680854 clade 88 N N Haemophilus sp. HK445 981 FJ685624 clade 88 N N Haemophilus sp. oral clone ASCA07 982 AY923.117 clade 88 N N Haemophilus sp. oral clone ASCG06 983 AY923.147 clade 88 N N Haemophilus sp. oral clone BJO21 984 AYOOSO34 clade 88 N N Haemophilus sp. oral clone BJO95 985 AYOO5033 clade 88 N N Haemophilus sp. oral taxon 851 987 AGRKO1000004 clade 88 N N Haemophilus spittortin 988 AFNKO1000005 clade 88 N N Histophilus somni OO3 AFS49387 clade 88 N N Mannheimia haemolytica 195 ACZXO1OOO102 clade 88 N N Pasteurella bettyae 433 LO6088 clade 88 N N Moellereia wisconsensis 2S3 JN175344 clade 89 N N Morganella morgani 26S AJ3O1681 clade 89 N N Morganella sp. JB T16 266 AJ781OOS clade 89 N N Proteus mirabilis 582 ACLEO1000013 clade 89 N N Proteus penneri 583 ABVPO1OOOO2O clade 89 N N Proteus sp. HS7514 584 DQ512963 clade 89 N N Proteus vulgaris 585 A233.425 clade 89 N N Oribacterium sinus 374. ACKX1000142 clade 90 N N Oribacterium sp. ACB1 375 HM120210 clade 90 N N Oribacterium sp. ACB7 376 HM120211 clade 90 N N Oribacterium sp. CM12 377 HQ616374 clade 90 N N Oribacterium sp. ICM51 378 HQ616397 clade 90 N N Oribacterium sp. OBRC12 379 HQ616355 clade 90 N N Oribacterium sp. oral taxon 108 382 AFIHO1 OOOOO1 clade 90 N N Actinobacilius actinomycetemcomitans 44 AY362885 clade 92 N N Actinobacilius Sticcinogenes 47 CPOOO746 clade 92 N N Aggregatibacter actinomycetemcomitans 112 CPOO1733 clade 92 N N Aggregatibacter aphrophilus 113 CPOO16O7 clade 92 N N Aggregatibacter Segnis 114 AEPSO1000017 clade 92 N N Averveila dailhousiensis 194 DQ481464 clade 92 N N US 2016/0040215 A1 Feb. 11, 2016 72
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Bisgaard Taxon 368 AY683487 e 92 Bisgaard Taxon 369 AY6834.89 e 92 Bisgaard Taxon 370 AY683491 e 92 Bisgaard Taxon 371 AY683492 e 92 Buchnera aphidicola 440 NR 074609 e 92 Cedecea davisae 499 AF493976 e 92 Citrobacter amationaicus S17 FR870441 e 92 Citrobacter braaki 518 NR 028687 e 92 Citrobacter farmeni 519 AFO253.71 e 92 Citrobacter fieundi 520 NR 028894 e 92 Citrobacter gillenii S21 AFO2S367 e 92 Citrobacter koseri 522 NC O09792 e 92 Citrobacter muriniae S23 AFO2S369 e 92 Citrobacter rodentium 524 NR 074903 e 92 Citrobactersediaki S25 AFO2S364 e 92 Citrobacter sp. 30 2 526 ACDJO1 OOOOS3 e 92 Citrobacter sp. KMSI 3 527 GQ468398 e 92 Citrobacter werkmani 528 AFO25373 e 92 Citrobacter votingae 529 ABWLO2OOOO11 e 92 Cronobacter maionaticus 737 GU122174 e 92 Cronobacter Sakazaki 738 NC 009778 e 92 Cronobacteriuricensis 739 FN543093 e 92 Enterobacter aerogenes 786 A251468 e 92 Enterobacter as buriae 787 NR 024640 e 92 Enterobacter cancerogenits 788 Z96O78 e 92 Enterobacter cloacae 789 FP929O40 e 92 Enterobacter cowanii 790 NR 025566 e 92 Enterobacter hormaechei 791 AFHRO1 OOOO79 e 92 Enterobacter sp. 247BMC 792 HQ122932 e 92 Enterobacter sp. 638 793 NR 074777 e 92 Enterobacter sp. JC163 794 JN657217 e 92 Enterobacter sp. SCSS 795 HMOOf811 e 92 Enterobacter sp. TSE38 796 HM1561.34 e 92 Enterobacteriaceae bacterium 9 2 54FAA 797 ADCUO1 OOOO33 e 92 Enterobacteriaceae bacterium CFO1Ent1 798 A489826 e 92 Enterobacteriaceae bacterium Smarlab 3302238 799 AYS38694 e 92 Escherichia albertii 824 ABKXO1 OOOO12 e 92 Escherichia coi 825 NC OO8563 e 92 ategory-B Escherichiafergusonii 826 CU9281.58 e 92 Escherichia hermannii 827 HQ407266 e 92 Escherichia sp. 11 43 828 ACIDO1 OOOO33 e 92 Escherichia sp. 4 1 40B 829 ACDMO2OOOOS6 e 92 Escherichia sp. B4 830 EU722735 e 92 Escherichia vulneris 831 NR 041927 e 92 Ewingelia americana 877 JN175329 e 92 Haemophilus genomosp. P2 oral clone MB3 C24 971 DQ003621 e 92 Haemophilus genomosp. P3 oral clone MB3 C38 972 DQ003635 e 92 Haemophilus sp. oral clone JM053 986 AY349380 e 92 Hafnia alvei 989 DQ412565 e 92 Klebsiella Oxytoca O24 AY29.2871 e 92 Klebsiella pneumoniae O2S CPOOO647 e 92 Klebsiella sp. AS10 026 HQ616362 e 92 Klebsiella sp. Co9935 027 DQ068764 e 92 Klebsiella sp. enrichment culture clone SRC DSD25 O36 HM195210 e 92 Klebsiella sp. OBRC7 028 HQ616353 e 92 Klebsiella sp. SP BA O29 FJ999767 e 92 Klebsiella sp. SRC DSD1 O33 GUT 97254 e 92 Klebsiella sp. SRC DSD11 O3O GUT 97.263 e 92 Klebsiella sp. SRC DSD12 O31 GU797264 e 92 Klebsiella sp. SRC DSD15 O32 GUT97267 e 92 Klebsiella sp. SRC DSD2 O34 GUT 97253 e 92 Klebsiella sp. SRC DSD6 O35 GUT 97258 e 92 Kiebsiella varicola O37 CPOO1891 e 92 Kluyvera as Corbata O38 NR 028677 e 92 Kluyvera cryocrescens O39 NR 028803 e 92 Leminorella grimontii 159 AJ233421 e 92 Leminorelia richardi 160 HFSS8368 e 92 Pantoea agglomerans 409 AY335552 e 92 Pantoea ananatis 410 CPOO1875 e 92 Pantoea brenneri 411 EU21673S e 92 Panioea citrea 412 EF6880O8 e 92 Pantoea conspictia 413 EU216737 e 92 Pantoea septica 414 EU216734 e 92 Pastetirella dagmatis 434 ACZRO1 OOOOO3 e 92 US 2016/0040215 A1 Feb. 11, 2016 73
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Pasteureia mitocida 435 NC 002663 e 92 Plesiomonas Shigelioides 469 X60418 e 92 Raouitella ornithinolytica 617 B364958 e 92 Raouitella planticola 618 F129443 e 92 Raouitella terrigena 619 R 037085 e 92 Salmonella bongori 683 R 041699 e 92 Category-B Saimoneia enterica 672 C O11149 e 92 Category-B Saimoneia enterica 673 C O11205 e 92 Category-B Saimoneia enterica 674 Q344532 e 92 Category-B Saimoneia enterica 675 BEHO2OOOOO4 e 92 Category-B Saimoneia enterica 676 BAKO2OOOOO1 e 92 Category-B Saimoneia enterica 677 011080 e 92 Category-B Saimoneia enterica 678 18094 e 92 Category-B Saimoneia enterica 679 011094 e 92 Category-B Saimoneia enterica 68O O14613 e 92 Category-B Saimoneia enterica 682 FHO2OOOOO1 e 92 Category-B Saimoneia enterica 684 EMO1(OOOOO1 e 92 Category-B Saimoneia enterica 685 AMO2OOOOO1 e 92 Category-B Salmonella typhimurium 681 344533 e 92 Category-B Salmonella typhimurium 686 701.76 e 92 Category-B Serratia fonticola 718 O25339 e 92 N Serraia liquefaciens 719 042062 e 92 N Serraia marcescens 720 826157 e 92 N Serratia odorifera 721 BYO1 OOOOO1 e 92 N Serraia proteanachtians 722 UNO1 OOOO15 e 92 N Shigella boydii 724 AA KAO1OOOOO7 e 92 Category-B Shigella dysenteriae 725 C OO7606 e 92 Category-B Shigella flexneri 726 EOOS674 e 92 Category-B Shigella sonnei 727 C OO7384 e 92 Category-B Tattimelia ptyseos 916 R O25342 e 92 N Trabulsiella guamensis 925 YST3830 e 92 N Yersinia aidovae 2019 871363 e 92 OP Yersinia aleksiciae 2020 627597 e 92 OP Yersinia bercovieri 2021 F366377 e 92 OP Yersinia enterocolitica 2022 FR729477 e 92 Category-B Yersinia fiederiksenii 2023 F366379 e 92 OP Yersinia intermedia 2O24 F36638O e 92 OP Yersinia kristensenii 2025 CCAO1 OOOO78 e 92 OP Yersinia moiareii 2026 R 027546 e 92 OP Yersinia pestis 2027 EO13632 e 92 Category-A Yersinia pseudotuberculosis 2028 C OO9708 e 92 OP Yersinia rohdei 2029 CCDO1 OOOO71 e 92 OP Yokenelia regensburgei 2O3O B273.739 e 92 Conchiformibius kuhniae 669 R 041821 e 94 Morococcus cerebrosus 267 JN175352 e 94 Neisseria baciliiformis 328 FAYO1OOOOS8 e 94 Neisseria cinerea 329 DYO1000037 e 94 Neisseria flavescens 331 CQVO1000025 e 94 Neisseria gonorrhoeae 333 POO2440 e 94 P Neisseria iacianica 334 EQ01000095 e 94 Neisseria macacae 335 FQE01000146 e 94 Neisseria meningitidis 336 OO3112 e 94 P Neisseria inticosa 337 CDXO1OOO110 e 94 Neisseria pharyngis 338 239281 e 94 Neisseria polysaccharea 339 DBEO1OOO137 e 94 Neisseria Sicca 340 CKOO2OOOO16 e 94 Neisseria sp. KEM232 341 GQ203291 e 94 Neisseria sp. oral clone AP132 344 AYOO5O27 e 94 Neisseria sp. oral strain B33KA 346 AYOOSO28 e 94 Neisseria sp. oral taxon 014 347 ADEAO1 OOOO39 e 94 Neisseria sp. TM10 1 343 DQ279352 e 94 Neisseria subflava 348 ACEOO1OOOO67 e 94 Okadaella gastrococci is 365 HQ6994.65 e 98 Streptococci is agaiactiae 785 AAJOO1OOO130 e 98 Streptococci is alactolyticits 786 NR 041 781 e 98 Streptococcusatistralis 788 AEQRO1000024 e 98 Streptococcus bovis 789 AEELO1OOOO3O e 98 Streptococci is Canis 790 A4132O3 e 98 Streptococci is constellatus 791 AY277942 e 98 Streptococci is cristatus 792 AEVCO1OOOO28 e 98 Streptococci is dysgalaciae 794 APO10935 e 98 Streptococci is equi 795 CPOO1129 e 98 Streptococci is equinus 796 AEVBO1OOOO43 e 98 Streptococci is gallolyticits 797 FR824O43 e 98 US 2016/0040215 A1 Feb. 11, 2016 74
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession C 8. d e Former Status Streptococci is genomosp. C1 798 AY278629 e 98 Streptococci is genomosp. C2 799 AY2.7863O e 98 Streptococci is genomosp. C3 800 AY2.78631 e 98 Streptococci is genomosp. C4 8O1 AY2.78632 e 98 Streptococci is genomosp. C5 8O2 AY278633 e 98 Streptococci is genomosp. C6 803 AY2.78634 e 98 Streptococci is genomosp. C7 804 AY278635 e 98 Streptococci is genomosp. C8 805 AY278609 e 98 Streptococci isgordonii 806 NC OO9785 e 98 Streptococci is infantarius 807 BJKO2OOOO17 e 98 Streptococci is infantis 808 FNNO1OOOO24 e 98 Streptococci is intermedius 809 R 028736 e 98 Streptococci is lutetiensis 810 R 037.096 e 98 Streptococci is massiliensis 811 Y769.997 e 98 Streptococci is mitis 813 M15742O e 98 Streptococci is oligofermenians 815 YO99095 e 98 Streptococci is oralis 816 DMVO1 OOOOO1 e 98 Streptococci is parasanguinis 817 EKMO1 OOOO12 e 98 Streptococci is pasteuriants 818 PO12O54 e 98 Streptococci is peroris 819 EVFO1 OOOO16 e 98 Streptococci is pneumoniae 820 E0O8537 e 98 Streptococci is porcinus 821 EF121439 e 98 Streptococci is pseudopneumoniae 822 FJ827123 e 98 Streptococci is pseudoporcinus 823 AENSO1 OOOOO3 e 98 Streptococci is pyogenes 824 AEOO6496 e 98 Streptococci is ratti 825 XS8304 e 98 Streptococci is sanguinis 827 NR 074974 e 98 Streptococci is Sinensis 828 AF43.2857 e 98 Streptococcus sp. 2 1 36FAA 831 ACOIO1 OOOO28 e 98 Streptococcus sp. 2285 97 830 AJ131.96S e 98 Streptococcus sp. ACS2 834 HQ616360 e 98 Streptococcus sp. AS20 835 HQ616366 e 98 Streptococcus sp. BS35a 836 HQ616369 e 98 Streptococcus sp. C150 837 ACRIO1OOOO45 e 98 Streptococcus sp. CM6 838 HQ616372 e 98 Streptococcus sp. ICM10 840 HQ616389 e 98 Streptococcus sp. ICM12 841 HQ616390 e 98 Streptococcus sp. ICM2 842 HQ616386 e 98 Streptococcus sp. ICM4 844 HQ616387 e 98 Streptococcus sp. ICM45 843 HQ616394 e 98 Streptococcus sp. M143 845 ACRKO1 OOOO2S e 98 Streptococcus sp. M334 846 ACRLO1 OOOOS2 e 98 Streptococcus sp. oral clone ASB02 849 AY923121 e 98 Streptococcus sp. oral clone ASCA03 850 DQ272504 e 98 Streptococcus sp. oral clone ASCA04 851 AY923116 e 98 Streptococcus sp. oral clone ASCA09 852 AY923119 e 98 Streptococcus sp. oral clone ASCB04 853 AY923.123 e 98 Streptococcus sp. oral clone ASCB06 854 AY923124 e 98 Streptococcus sp. oral clone ASCC04 855 AY923127 e 98 Streptococcus sp. oral clone ASCC05 856 AY923128 e 98 Streptococcus sp. oral clone ASCC12 857 DQ272507 e 98 Streptococcus sp. oral clone ASCD01 858 AY923129 e 98 Streptococcus sp. oral clone ASCD09 859 AY923.130 e 98 Streptococcus sp. oral clone ASCD10 860 DQ272509 e 98 Streptococcus sp. oral clone ASCE03 861 AY923.134 e 98 Streptococcus sp. oral clone ASCE04 862 AY95.3253 e 98 Streptococcus sp. oral clone ASCE05 863 DQ272510 e 98 Streptococcus sp. oral clone ASCE06 864 AY923135 e 98 Streptococcuss one ASCEO9 865 AY923136 e 98 Streptococcuss one ASCE10 866 AY923.137 e 98 Streptococcus sp. oral clone ASCE12 867 AY923138 e 98 Streptococcus sp. oral clone ASCF05 868 AY923140 e 98 Streptococcus sp. oral clone ASCF07 869 AY95.3255 e 98 Streptococcuss O8. one ASCFO9 870 AY923.142 e 98 Streptococcuss O8. one ASCG04 871 AY923.145 e 98 Streptococcuss O8. one BWOO9 872 AYOOSO42 e 98 Streptococcuss O8. one CHO16 873 AYOOSO44 e 98 Streptococcuss O8. one GKOS1 874 AY3494.13 e 98 Streptococcus sp. oral clone GMO06 875 AY349414 e 98 Streptococcus sp. oral clone P2PA 41 P2 876 AY2O7051 e 98 Streptococcus sp. oral clone P4-PA 30 P4 877 AY2O7064 e 98 Streptococci is sp. oral taxon 071 878 AEEPO1 OOOO19 e 98 Streptococcuss oral taxon G59 879 GU432132 e 98 Streptococcuss oral taxon G62 880 GU432.146 e 98 US 2016/0040215 A1 Feb. 11, 2016 75
TABLE 1-continued SEQ ID Public DB Spore Pathogen OTU Number Accession Clade Former Status Streptococci is sp. oral taxon G63 1881 GU4321SO clade 98 N N Streptococci is stiis 1882 FM2S2O32 clade 98 N N Streptococcus thermophilus 1883 CPOOO419 clade 98 N N Streptococci is salivarius 1826 AGBVO1OOOOO1 clade 98 N N Streptococci is liberis 1884 HQ391900 clade 98 N N Streptococci is tirina is 1885 DQ303194 clade 98 N N Streptococcus vestibularis 1886 AEKOO1000008 clade 98 N N Streptococcus viridans 1887 AFO76036 clade 98 N N Synergistetes bacterium oral clone 035 D05 1908 GU227.192 clade 98 N N
0395 List of Operational Taxonomic Units (OTU) with TABLE 3 taxonomic assignments made to Genus, Species, and Phylo genetic Clade. Clade membership of bacterial OTUs is based DPA doses in Table 2 when normalized to 4 x 105 SCFU per dose on 16S sequence data. Clades are defined based on the topol SCFU3O DPASEq/30 Fraction of ogy of a phylogenetic tree that is constructed from full-length Preparation capsules capsules Preparation 1 Dose 16S sequences using maximum likelihood methods familiar Preparation 1 4.0 x 105 6.8 x 107 1.O to individuals with ordinary skill in the art of phylogenetics. Preparation 2 4.0 x 105 1.8 x 107 O.26 Clades are constructed to ensure that all OTUs in a given Preparation 3 4.0 x 105 S.6 x 105 O.OO82 clade are: (i) within a specified number of bootstrap Sup ported nodes from one another, and (ii) within 5% genetic similarity. OTUs that are within the same clade can be distin TABLE 4 guished as genetically and phylogenetically distinct from Interpretation of Results from USP <62> OTUs in a different clade based on 16S-V4 sequence data, Table 2. Interpretation of Results while OTUs falling within the same clade are closely related. Results for Each Quantity of Product Probable Number OTUs falling within the same clade are evolutionarily closely 0.1 g or 0.01 g or 0.001 g or of Bacteria perg related and may or may not be distinguishable from one 0.1 mL 0.01 mL O.OO1 mL. or mL of Product another using 16S-V4 sequence data. Members of the same ------more than 10 clade, due to their evolutionary relatedness, play similar func -- -- less than 10 and tional roles in a microbial ecology Such as that found in the more than 10° -- less than 10° and human gut. Compositions substituting one species with more than 10 another from the same clade are likely to have conserved less than 10 ecological function and therefore are useful in the present invention. All OTUs are denoted as to their putative capacity to form spores and whether they are a Pathogen or Pathobiont TABLE 5 (see Definitions for description of “Pathobiont'). NIAID Pri Clostridium paraputrificum ority Pathogens are denoted as Category-A, Category-B or Clostridium disporicum Category-C, and Opportunistic Pathogens are denoted as Clostridium glycolicum Clostridium bartlettii OP. OTUs that are not pathogenic or for which their ability Clostridium butyricum Ruminococcus bromii to exist as a pathogen is unknown are denoted as N. The Lachnospiraceae bacterium 2 158FAA SEQ ID Number denotes the identifier of the OTU in the Eubacterium hadrum Sequence Listing File and Public DB Accession denotes the Turicibacter Sanguinis Lachnospiraceae bacterium oral taxon F15 identifier of the OTU in a public sequence repository. ostridium perfringens ostridium bifermentans TABLE 2 O buria sp. 11 SE37 ridium quinii inococcus lactaris Spore quantitation for ethanol treated spore preparations ridium botulinum using spore CFU (SCFU) assay and DPA assay ridium tyrobutyricum ia hansenii ridium kluyveri SCFU3O DPASEq/30 Ratio ridium sp. JC122 Preparation capsules capsules SCFUDPA ridium hylemonae ridium cellatum Preparation 1 4.0 x 105 6.8 x 107 5.9 x 10-3 ridium straminisolvens Preparation 2 2.1 x 107 9.2 x 108 O.O23 ridium orbiscindens buria cecicola Preparation 3 6.9 x 109 9.6 x 109 0.72 ubacteriumSOeS tenue ostridium sp. 7. 2 43FAA US 2016/0040215 A1 Feb. 11, 2016 76
TABLE 5-continued TABLE 6-continued Lachnospiraceae bacterium 4 137FAA ostridium sp. JC122 Eubacterium rectale achnospiraceae bacterium 3 1 57FAA Clostridium viride Clostridium aldenense Ruminococcus sp K. 1 Ruminococcus torques Clostridium Symbiosum Clostridium sp. 72 43FAA Ruminococcus torques Clostridium cellatum Clostridium algidicarnis Eubacterium sp. WAL. 14571 Eubacterium tenue Lachnospiraceae bacterium 5 1 57FAA ostridium clostridioforme ostridium sp. YIT 12070 TABLE 6 autia sp M25 Clostridium paraputrificum An aerostipes caccae Clostridium bartlettii billians Lachnospiraceae bacterium 2 1 58FAA Clostridiumostricium sp.asparagiforme US Clostridium disporicum Coprobacillus sp. D7 Ruminococcus bromii C HGF2 Eubacterium hadrum ostricium sp H Clostridium citroniae Clostridium butyricum Clostridium difficileWr Roseburia sp. 11 SE37 Oscillibacter Valericigenes Clostridium perfringens Clostridium algidicarnis
TABLE 7
GAM+ Sweet B -- Sweet OTU BBA FOSimulin M2GSC FOS, Inulin GAM Total
Bialitia producia 1 1 Cliostridium bartieiti 4 1 5 Cliostridium boiteae 2 5 1 8 Clostridium boilini in 5 5 Clostridium butyricum 37 43 8 1 33 122 Cliostridium ceiatum 4 1 5 Clostridium clostridioforme 1 1 2 Clostridium disporicum 26 26 22 33 50 157 Clostridium glycolicum 4 9 14 27 Clostridium mayombei 2 2 4 Clostridium parapattrifictim 8 8 33 16 6 71 Cliostridium sordei 14 14 Clostridium sp. 7 2 43FAA 1 Clostridium symbiosum 3 3 Cliostridium tertium 1 1 (blank) 2 31 33
Totals 92 92 92 92 92 460
TABLE 6-continued TABLE 8 C ostri ium glycolicum Results of the prophylaxis mouse model and dosing Clostridium hylemonae information for the germinable, and Sporulatable fractions Clostridium orbiscindens Ruminococcus lactaris Average Clostridium symbiosum Weight on Average Lachnospiraceae bacterium oral taxon F15 Day 3 Clinical B au ia hansenii # Deaths Relative to Score Turicibacter sanguinis Test Article Dose by Day 6 Day -1 on Day 3 Clostridium straminisolvens Clostridium botulinum Vehicle NA 10 0.72 NA Lachnospiraceae bacterium 4 1 37FAA Naive NA O 1.03 O Roseburia cecicola Donor B fecal 0.2 mL of 10% 1 O.91 O.11 Ruminococcus Sp K. 1 Suspension Suspension Clostridium bifermentans Donor A 8.99 * 107 Spore O 1.02 O Eubacterium rectale Spore Prep Equivalents dose Clostridium quinii germinable Clostridium viride Donor A 7.46 * 107 Spore O O.99 O Clostridium kluyveri Spore Prep Equivalents dose Clostridium tyrobutyricum Sporulatable Oscillibacter sp G2 US 2016/0040215 A1 Feb. 11, 2016 77
TABLE 9 16s rDNA identification of colony picks from plating a 20% fecal suspension or ethanol treated preparation to selective media (number of colony picks matching each species in parentheses). ethanol treated feces 20% Suspension of feces (# of colonies) (# of colonies) Raffinose Ruminococcus albus (5) Bifidobacterium adolescentis (3) Bifidobacterium Clostridium sp. D5 (7) Bifidobacterium longum (6) Agar Lachnospiraceae bacterium Streptococcus bovis (1) 3 1 57 FAA CT1 (1) Escherichia coli (4) Clostridium boiteae (3) Robinsoniella peoriensis (1) Ruminococcus lactaris (1) Eubacterium fissicatena (1) Eubacterium contorium Eubacterium xylanophilum (1) Clostridium clostridiiformes (1) Enterococcosel no colonies observed Streptococcois bovis (4) Agar Streptococci is pasteuriants (1) Mitis Saivarius Bacillus subtilis (1) Streptococcus vestibularis (3) Agar Bacilius Sonorensis (1) Streptococcus bovis (4) Streptococci is Saivarius (1)
TABLE 10 16s rDNA identification of colony picks from plating a 20% fecal suspension or ethanol treated preparation to selective media (number of colony picks matching each Species in parentheses ethanol treated feces 20% Suspension of feces (# of colonies) (# of colonies) Raffinose Ruminococcus sp. 5 1 39BFAA (12) Bifidobacterium adolescentis (3) Bifidobacterium Agar Dorea longicatena (3) Bifidobacterium longum (10) Eubacterium contortum (4) Enterococci is faecium (1) Clostridium sp. D5 (5) Clostridium sp. 7 2 43FAA (1) Bryantella formatexigens (1) Clostridium orbiscindens (1) Enterococcosel Agar no colonies observed Enterococcus faecium (5) Mitis Saivarius Agar Bacilius sp. BT1B CT2 (2) Streptococcus vestibularis (1) Bacilius sp. B27 (2008) (1) Enterococci is faecium (4) Bacilius Sonorensis (1) Streptococci is Saivarius (1)
TABLE 11 TABLE 12
Colony counts in Log CFU/mL determined from a 20% Colony counts in Log CFU/mL determined from a 20% fecal Suspension and ethanol treated spore composition fecal Suspension and ethanol treated spore composition. Table 11 depicts the estimated concentration of a 20% fecal suspension Table 12 depicts the estimated concentration of a 20% fecal suspension and the ethanol treated spore composition Colonies were counted and the ethanol treated spore composition Colonies were counted from from plating a 20% feces suspension (Sample1) or ethanol treated plating a 20% feces suspension (Sample2) or ethanol treated Suspension to selective media and used to back-calculate the Suspension to selective media and used to back-calculate the concentration of presumptive cells in each sample (Log CFU/mL). concentration of presumptive cells in each sample (Log CFU/mL). Log CFU/mL of Log CFU/mL of Log CFU/mL of Log CFU/mL of 20% Ethanol-treated Log 20% Ethanol-treated Log Selective Media Suspension spore composition Reduction Selective Media Suspension spore composition Reduction Mitis Saivarius 5.25 1.90 (8) 3.34 Mitis Saivarius 4.92 1 (1) 3.92 Enterococcosel 5.14 1 Limit of Detection 4.14 Enterococcosel 4.75 1 Limit of Detection 3.75 (O) (O) BIFIDO 7.22 4.6O 2.62 Raffinose 6.65 2.70 3.95 Raffinose 6.36 3.18 3.19 Bifidobacterium Bifidobacterium US 2016/0040215 A1 Feb. 11, 2016 78
TABLE 13 TABLE 16-continued Results of Plating Ethanol-treated fecal suspensions on 16S rRNA identified spore forming species from picked colony plates BBE and MacConkey II lactose agar Treatment Species No. isolates MacConkey II Lactose Donor BBE Agar Results Result 70 deg 1 h Clostridium paraputrificum 3 70 deg 1 h Clostridium sp. D5 1 Donor A Sample 1 No Colonies Observed No Colonies Observe 70 deg 1 h Clostridium symbiosum 1 Donor A Sample 2 No Colonies Observed No Colonies Observe 80 deg 1 h Clostridium bartlettii 6 Donor B Sample 1 No Colonies Observed No Colonies Observe 80 deg 1 h Clostridium butyricum 1 Donor B Sample 2 No Co onies Observed No Co onies Observe 80 deg 1 h Clostridium paraputrificum 5 RNR R . N ones N ones 80 deg 1 h Coprobacillus sp. D7 1 OO 3 S8. It otolonies upserved No Colonies upserve 80 deg 1 h Eubacterium sp. WAL 14571 1 Donor B Sample 5 No Colonies Observed No Colonies Observe Donor C Sample No Colonies Observed No Colonies Observe 80 deg 1 h Ruminococcus bromii 1 Donor C Sample No Colonies Observed No Colonies Observe 90 deg 1 h Clostridium butyricum 1 Donor C Sample No Colonies Observed No Colonies Observe 90 deg 10 min Ruminococcus bromii 1 Donor C Sample No Colonies Observed No Colonies Observe 90 deg 10 min Anaerotruncus colihominis 2 90 deg 10 min Clostridium bartlettii 1 Donor C Sample No Colonies Observed No Colonies Observe 100 deg 10 mi Rumi b 1 Donor C Sample No Colonies Observed No Colonies Observe eg LU mln uillilocOCCuS Oll Donor C Sample No Colonies Observed No Colonies Observe Donor D Sample 1 No Colonies Observed No Colonies Observe Donor D Sample 2 No Colonies Observed No Colonies Observe Donor E. Sample No Colonies Observed No Colonies Observe TABLE 17 Donor E. Sample 2 No Colonies Observed No Colonies Observe Donor F Sample No Colonies Observed No Colonies Observe Spore-forming species identified l ethanol treated or Donor F Sample 2 No Colonies Observed No Colonies Observe heat treated samples and not identified in untreated samples
*Note: The limit of detection for these results is 10 colony forming units per mL of sample. isolatedSOI8CC. f Oil isolatedSOI80CO f isolatedSO.80 f Ol Species untreated EtOH-treated heat-treated Acetivibrio ethanolgigners X Anaerofustis Stercorihominis X TABLE 1.4 Bacilius anthracis X Bacilius horii X Results from Sabouraud Dextrose agar plating of fecal Bacilius licheniformis X - Suspensions before and after treatment with 50%. Ethanol Bacilius neaisonii X Bacilius pumilus X CFU/mL CFU/mL Bacillus sp. BT1B CT2 X Donor Pre-Ethanol Inactivation Post-Ethanol Inactivation Bacilius thuringiensis X A. 2.00 x 10 cfu/mL No Colonies Detected Bacteroides galacturonicus X B 1.80 x 10 cfu/mL No Colonies Detected E.tically in C 2.00 x 10 cfu/mL 2.00 x 10 cfu/mL OStirl l es) hill D 2.00 x 10 cfu/mL No Colonies Detected Bacteroides pectinop ii.2iS X (phylogenetically in *Note: The limit of detection for this experiment was 2.00 x 10 cfu/mL. Clostridiales) Bialitia welerae X X Brachyspira pilosicoli X Brevibacilius parabrevis X TABLE 1.5 Cliostridium aidenense X Clostridium beijerinckii X Mortality and weight change in mice challenged with C. difficile Cliostridium carnis X with or without ethanol treated, Spore product treatment Cliostridium ceiatum X Clostridium favososportin X mortality % weight change Clostridium hyiemonae X Testarticle (n = 10) on Day 3 Clostridium irregulare X Clostridium methylpentosum X vehicle (negative 20% -10.5% Clostridium sp. D5 X X control) Clostridium sp. L2-50 X Donor feces (positive O -0.1% Clostridium sp. MT4 E X control) Clostridium sp. NML 04A032 X EtOH-treated feces 1X O 2.3% Clostridium sp. SS2/1 X EtOH-treated feces 0.1X O 2.4% Clostridium sp. YIT 12069 X EtOH-treated feces O -3% Cliostridium Stercorarium X O.O1x Clostridium xvianolyticum X heat-treated feces O O.1% Coprococcus sp. ART55/1 X Deferribacteres sp. oral clone X JVOO6 Desulfitobacterium frappieri X TABLE 16 Eubacterium caiianderi X Eubacterium Siraeum X 16S rRNA identified Spore forming Species from picked colony plates Exigliobacterium acetylictim X Gemmiger formicilis X Treatment Species No. isolates Lachnospira multipara X Lachnospira pectinoschiza X 70 deg 1 h Clostridium cellatum 4 Roseburia faecalis X 70 deg 1 h Clostridium clostridioform 1 Ruminococcus aibus X 70 deg 1 h Clostridium hylemonae 1 US 2016/0040215 A1 Feb. 11, 2016 79
TABLE 18 TABLE 19-continued Donor A, 45 species in 374 EtOH-resistant colonies sequenced Donor B, 26 species in 195 EtOH-resistant colonies sequenced OTU OTU Anaerostipes sp 3 2 56FAA Bacillus anthracis Gemmiger formicilis Bacillus cereus Lachnospira pectinoschiza Bacillus thuringiensis Raiminococcus albus autia producta Raiminococcus gnavuts autia sp M25 ostridiales Sp SSC 2 Raiminococcus obel in ostridium aldenense Ruminococcus sp 5 139BFAA ostridium bartlettii Raiminococci is sp K. 1 ostridium bolteae ostridium cellatum ostridium disporicum ostridium ghonii TABLE 20 ostridium hathewayi ostridium lactatifermentans Donor C, 39 species in 416 EtOH-resistant ostridium mayombei colonies sequenced ostridium orbiscindens OTU ostridium paraputrificum ostridium perfringens Bacteroides galactatronicus ostridium Sordellii Bacteroidespectinophilus ostridium stercorarium Bialitia producta ostridium straminisolvens Blautia sp M25 ostridium tertium Bialitia welerae Coprobacillus sp. D7 Clostridiales sp SS3 4 Coprococcus catus Clostridiales sp SSC 2 Deferribacteres sp. oral clone JV006 Cliostridium bartietti Dorea formicigenerans Cliostridium citroniae Eubacterium rectale Clostridium disporicum Eubacterium Siraeum Cliostridium indois Eubacterium sp. WAL 14571 Cliostridium orbiscindens Eubacterium ventriosum Clost ridium paraputrifictim Flexistipes sinusarabici Cliostridium Sordei Fulvimonas sp. NML 060897 Clostridium sp. NML 04A032 Lachnospiraceae bacterium 2 1 58FAA Clostridium sp. SS2 1 Lachnospiraceae bacterium 3 1 57FAA Clostridium Straminisolvens Lachnospiraceae bacterium A4 Cliostridium viride Clostridium xvianolytictim Lachnospiraceae bacterium oral taxon F15 Coprobacilius sp D7 Moorella thermoacetica Dorea longicatena Roseburia faecalis Eubacterium reciaie Roseburia hominis Etibacterium ventriostin Ruminococcus albus Hydrogenoanaerobacterium saccharovo rans Ruminococcus bromii Lachnospira multipara Ruminococcus gnavus Lachnospira pectinoschiza Ruminococcus sp 5 1 39BFAA Lachnospiraceae bacterium A4 Ruminococcus torques Oscillibacter sp G2 Pseudofiavonifactor capiliosits Roseburia hominis Roseburia intestinalis TABLE 19 Raiminococcus albus Raiminococci is lactaris Donor B, 26 species in 195 EtOH-resistant Raiminococcus obel in colonies sequenced Ruminococcus sp 5 139BFAA OTU Raiminococci is sp K. 1 Raiminococci is torques Bacilius horii Syntrophococci is sticromtitans Bialitia welerae Chlamydiales bacterium NS11 Clostridiales sp SSC 2 Cliostridium bartietti TABLE 21 Cliostridium ceiatum Clostridium disporicum Donor D, 12 species in 118 EtOH-resistant Clostridium ghonii colonies sequenced Cliostridium oroticum OTU Clostridium paraputrific in Clostridium perfingens Bialitia initi Cliostridium Sordei Bialitia welerae Clostridium sp. L2 50 Brachyspira pilosicoli Clostridium sp. MT4 E Clost ridium paraputrifictim Cliostridium Straminisolvens Collinseila aerofaciens Coprococcus sp. ART55 1 Coprobacilius sp D7 Eubacterium caiianderi Desulfitobacterium fiappieri Eubacterium reciaie Eubacterium reciaie Etibacterium riminantium Mooreia thermoacetica US 2016/0040215 A1 Feb. 11, 2016 80
TABLE 21-continued TABLE 23-continued
Donor D, 12 species in 118 EtOH-resistant Donor F, 54 OTUs in 768 EtOH-resistant colonies colonies sequenced sequenced OTU OTU
Raiminococcus gnavus Clostridium symbiosum Raiminococci is obel in Cliostridium tertium Raiminococci is sp K. 1 Coprobacilius sp. 29 1 Coprobacilius sp D7 Etibacterium contorium TABLE 22 Etibacterium desmoians Etibacterium ramitius Donor E, 11 species in 118 EtOH-resistant colonies Exigliobacterium acetylictim sequenced Faecalibacterium prailsnitzii OTU Lachnospiraceae bacterium 2 158FAA Lachnospiraceae bacterium 3 157FAA Bialitia litti Lachnospiraceae bacterium 5 157FAA Bialitia welerae Lachnospiraceae bacterium 6 163FAA Brachyspira pilosicoli Lachnospiraceae bacterium oral taxon F15 Clostridium paraputrific in Marvinbryantia formatexigens Coprobacilius sp D7 Mycoplasma amphoriforme Destifitobacterium frappieri Oscillibacter sp G2 Eubacterium reciaie Pseudofiavonifactor capiliosits Moorelia thermoacetica Raiminococcus gnavus Raiminococcus gnavuts Raiminococci is obel in Raiminococcits hansenii Raiminococci is sp K. 1 Raiminococcus obel in Ruminococcus sp 5 139BFAA Ruminococcus sp ID8 Thiricibacter sanguinis TABLE 23 Donor F, 54 OTUs in 768 EtOH-resistant colonies sequenced OTU TABLE 24 AnaerofitStis Stercorihominis Anaerostipes sp 3 2 56FAA Organisms crown from ethanol treated spore population Bacilius neaisonii on various media (See Example 7 for full media names and Bacilius sp BT1B CT2 references). Bialitia producta Butyrivibrio crossotus total number unique % unique Cliostridiaies bacterium SY8519 Media reads OTUS OTUS Clostridiales sp. 1747 Cliostridium aidenense M2GSC 93 33 O3S Cliostridium bartietti M-BHI 66 26 O.39 Cliostridium boiteae Sweet B 74 23 O.31 Clostridium butyricum GAM fructose 44 18 O41 Cliostridium citroniae M2 mannitol 39 17 0.44 Clostridium clostridioforme M2 soluble starch 62 16 O.26 Clostridium disporicum M2 lactate 43 14 O.33 Clostridium favososportin GAMFOS, Inulin 52 14 0.27 Clostridium glycolicum EYA 29 13 O45 Clostridium hathewayi Mucin 19 12 O.63 Cliostridium indois M2 lactose 32 12 O.38 Clostridium lepium BHIS az1/ge2 35 12 O.34 Clostridium mayombei BHIS CInMaz1/ge2 24 11 O46 Cliostridium nexile GAM mannitol 41 11 0.27 Cliostridium orbiscindens Cliostridium Sordei BBA 29 10 O.34 Clostridium sp. 7. 2 43FAA Sulfite-polymyxin milk 48 9 O.19 Clostridium sp. D5 Noack-Blaut Etibacterium 12 4 O.33 Clostridium sp. M62 1 agar Clostridium sp. NML 04A032 742 total analyzed Clostridium spiroforme