Supplementary Data

SUPPLEMENTARY DATA

Bioinformatic analysis of ChIP-seq data

Define the panel of genes associated with energy storage and expenditure We searched the genes list from NCBI Gene, Gene Ontology and UniProt database with the terms “obesity”, “energy homeostasis”, "energy metabolism", “energy storage”, and “energy expenditure” by two independent investigators, and through which we identified 742 genes from all these databases (supplementary Table 8). We then selected the genes associated either with energy storage or expenditure by searching the literatures from PubMed and Google Scholar with the term “gene name" and "obesity" or "energy metabolism" or "energy homeostasis" and "adipose tissue" or "adipocyte”. For a particular gene, if its deficiency protected mice from obesity or overexpression exacerbated obesity, we then categorized it into the panel of energy storage. On the contrary, if its deficiency or overexpression generated opposite phenotype, we classified it into the panel of energy expenditure. We next searched them in the BioGPS database to check their expression in the adipose tissue or adipocyte. If the transcriptional activity index is lower than 50, the gene was considered without expression in adipose tissue. Those genes were also excluded in which they are only expressed in the central nervous system to involve in energy metabolism. The above screenings allowed us to characterize 216 genes associated with energy storage (supplementary Table 9) and 159 genes associated with energy expenditure (supplementary Table 10).

Characterization of differential methylated genes. We first compared the signal of chip-seq data in the promoter region to check the DNA methylation state of two panels. Promoter region of those differential methylated genes was defined as 5kb upstream TSS sites. We failed to detect a significant difference for most of the genes between HF and ND fed mice. To enhance the discrimination, a cut-off value (defined >1.5-fold) was then set up for data analysis. We calculated MBD2 ChIP-seq enrichment levels over energy storage and energy expenditure gene loci with normalization to the Fragments Per Kilobase Of Exon Per Million Fragments Mapped (FPKM) value. For a particular differential methylated gene, at least a two-fold difference between ND and HF samples was characterized. We divided TSS region of those genes into 100 bins and normalized MBD2 ChIP-seq signal with the FPKM value.

Isolation of mature adipocytes Isolation of adipocytes was performed as described previously (1-3). Briefly, male mice were sacrificed by CO2 inhalation, and the epididymal adipose tissue depots were washed in cold Dulbecco’s PBS supplemented with 0.5% BSA, followed by digestion with 1 mg/mL type II collagenase in the presence of 5 mmol/L CaCl2. Tissue homogenates were incubated at 37°C for 30 min with shaking. After centrifugation, the floating oil were removed ,buoyant adipocytes were collected, filtered and collected as the adipocyte fraction.

References:

1. Aune UL, Ruiz L, Kajimura S: Isolation and differentiation of stromal vascular cells to beige/brite cells. J Vis Exp, 2013

2. Orr JS, Puglisi MJ, Ellacott KL, Lumeng CN, Wasserman DH, Hasty AH: Toll-like receptor 4 deficiency promotes the alternative activation of adipose tissue macrophages. Diabetes 61:2718-2727, 2012

3. H X, GT B, Q Y, G T, D Y, CJ C, J S, A N, JS R, LA T, H C: Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. Journal of Clinical Investigation, 2003

4. Zhong J, Yu Q, Yang P, Rao X, He L, Fang J, Tu Y, Zhang Z, Lai Q, Zhang S, Kuczma M, Kraj P, Xu JF, Gong F, Zhou J, Wen L, Eizirik DL, Du J, Wang W, Wang CY: MBD2 regulates TH17 differentiation and experimental autoimmune encephalomyelitis by controlling the homeostasis of T- bet/Hlx axis. J Autoimmun 53:95-104, 2014

Supplementary Figure S1. Results for the Area Above Curve (AAC) of Insulin tolerance tests.

Supplementary Figure S2. Metabolic index measured in CLAMS metabolic cages. A: Metabolic data for mean oxygen consumption (VO2) and carbon dioxide production (VCO2) of HFD-induced mice at each time point（Left, Middle）; The average VO2 and VCO2 of mice under HFD (Right). B: Metabolic data for mean oxygen consumption (VO2) and carbon dioxide production (VCO2) of mice under normal diet at each time point （Left, Middle）; The average VO2 and VCO2 of mice under normal diet (Right).

Supplementary Figure S3. Real Time PCR results for genes associated with energy metabolism in the liver and skeletal muscle after 16wk of HFD or ND induction (n=8 per group).

Supplementary Figure S4. HFD induced Mbd2-/- mice show higher expression of genes relevant to lipolysis and -oxidative. Western blot results for analysis of p-HSL, ATGL (lipolysis) and CPT1 (- oxidation) in the liver (A) and skeletal muscle (B). The expression of p-HSL and CPT1 was higher in HFD-induced Mbd2-/- mice as compared with WT controls.

Supplementary Figure S5. The total 5-mC levels of genomic DNA isolated from mature adipocyte of HFD- and ND-induced mice. Mature adipocytes were isolated from epididymal adipose tissues after 16wk of HFD or ND induction as described, and the 5-mC levels were measured using a MethylFlash Methylated DNA Quantification kit.

Supplementary Figure S6. Bisulfite DNA sequencing analysis of the selected Raptor and Ucp1 promoter region. A: Results for a selected peak region located within the Raptor promoter from MBD2 ChIP-seq analysis. B: Results for a selected peak region located within the Ucp1 promoter from MBD2 ChIP-seq analysis. Genomic DNA was isolated from epididymal adipose tissues, and was then subjected to bisulfite DNA sequencing as described. C: Results for the same Raptor promoter region using mature adipocytes genomic DNA isolated from epididymal adipose tissues. D: Results for the same Ucp1 promoter region using mature adipocyte genomic DNA isolated from epididymal adipose tissues. Unfilled cycles represent unmethylated cytosines, while filled cycles represent methylated cytosines. A total of 20 clones were analyzed for each sample.

Supplementary Figure S7. Results for bioinformatic analysis of the potential transcription factor binding sites within the Raptor promoter enriched from the ChIP-seq data. The Raptor promoter region enriched from ChIP-seq data was subjected to Transfac and PROMO analysis to predict potential transcription factor binding sites. A potential Cebpα binding site was identified, which contains the - 3881 CpG site.

Supplementary Figure S8. Results for bioinformatic analysis of the potential transcription factor binding sites within the Ucp1 promoter enriched from the ChIP-seq data. Similar as above, the Ucp1 promoter region enriched from ChIP-seq data was subjected to Transfac and PROMO analysis to predict potential transcription factor binding sites. A potential ATF6 binding site was identified, which contains the -3302 CpG site.

Supplementary Figure S9. HFD is more potent to induce the expression of genes relevant to energy storage. A: Relative fold enrichment of peak regions in the promoter of genes relevant to energy storage and energy expenditure. Dok1 (tyrosine kinases-1), Fasn (Fatty acid synthase), Trem2 (Triggering receptor expressed on myeloid cells 2), Thbs1 (Thrombospondin 1), Agpat4 (1-acylglycerol-3-phosphate O-acyltransferase 4) and Mir103-2 are relevant to energy storage, while Leptin, Gpr12 (G protein- coupled receptor 12), Ppargc1a (peroxisome proliferator-activated receptor-gamma coactivator 1 alpha), Parp1 (Poly(ADP-ribose)polymerase-1), FATP-1 (fatty acid transport protein-1) and Vegf-a ( vascular endothelial growth factor A) are associated with energy expenditure. B: Real Time PCR results in the epididymal adipose tissues for analysis of the above selected genes. The results confirmed the ChIP-seq data as evidenced by the higher expression of energy storage genes after HFD induction (n=8 per group).

Supplementary Table 1. Primer sequences for real-time PCR.

Gene Sequence(5’-3’)

UCP1 CACGGGGACCTACAATGCTT

GATTAGGGGTCGTCCCTTTCC

PGC1-α CGGAAATCATATCCAACCAG

TGAGAACCGCTAGCAAGTTTG

PPAR-α GCGTACGGCAATGGCTTTAT

GAACGGCTTCCTCAGGTTCTT

Leptin TTCACACACGCAGTCGGTATC

GGCTGGTGAGGACCTGTTG

MCP-1 CTCAGCCAGATGCAGTTAACGCCC

GGTGCTGAAGACCTTAGGGCAGAT

TNF-α CGTCGTAGCAAACCACCAAG

GAGATAGCAAATCGGCTGACG

F4/80 CTCTTCTGGGGCTTCAGTGG

GCAGACTGAGTTAGGACCACA

Dok1 AAGACCGAGGCTTCTGAACG

ATAGCGACGCAACAGAGTGT

Trem2 CTGGAACCGTCACCATCACTC

CGAAACTCGATGACTCCTCGG

Fasn AAGCGGTCTGGAAAGCTGAA

CCTCTGAACCACTCACACCC

Thbs1 GCTGCCAATCATAACCAGCG

TTCGTTAAAGGCCGAGTGCT

Agpat4 AATGCAAAGAACTGCCCGGA

TTGATGGGCCAGATGACCAG

Scd1 AATATCCTGGTTTCCCTGGGTG

AGGAACTCAGAAGCCCAAAGCTC

Srebf1 AACTTTTCCTTAACGTGGGCCT

TGTCCAGTTCGCACATCTCG

Ucp-2 CCTCCCCTGTTGATGTGGTC GGAAGGCATGAACCCCTTGT Ucp-3 CTGCACCGCCAGATGAGTTT

ATCATGGCTTGAAATCGGACC mmu-mir-103-2 MI0000588 from Guangzhou Ribobio, China

Supplementary Table 2. Primer sequences for bisulfate DNA PCR (NCBI mm9) and

Gene Peaks Region Primer Sequence Size

Ucp1 chr8:85,811,116- ATTTAGTGAAAGATATATTGGGAGT 222 85,811,337 CACCTCTCTTCACCAATCTTAC chr11:119,183,582- 119,183,914 Raptor TTTTGAGTTAGAATTTTATGAAG 333 CATACCCAACACACACACTA

Supplementary Table 3. Primer sequences for ChIP PCR.

Gene Sequence(5’-3’) Size

UCP1 CATTGGACATAACTTAGTGAAA 127bp

TGAGATGATTTGGCAGTGTG

Raptor TGTGTGTGGTGTGTGTTTATG 145bp

CCAAAGTCTCCTCCAATAGC

Supplementary Table 4. Primer for constructing plasmid of luciferase reporter assay.

UCP1_Me_F1 CTGGCCCCACTTACTAAAGAGTT UCP1_Me_R1 GCCAGGCAAGCTGAAACTCC UCP1_Me_R2 GTGACGGCACTATAAATTGGCAT UCP1_Me_F2 CATGCCAATTTATAGTGCCGTC UCP1_KpnI_F GGGGTACCCTGGCCCCACTTACTAAAGAG UCP1_NcoI_R CATGCCATGGTGGCTTGGAGGGCAGAG

Raptor_F1 AAGGATGGCTCTAAACTTCTGAACC Raptor_R2 TCTCTCCAAAGTCTCCTCCAATAGC Raptor_F2 AGCTCAGCTATTGGAGGAGACTTT Raptor_R1 CCCCGAGTCCCATAAGAGGC Raptor_ Sma I _F TCCCCCGGGAAGGATGGCTCTAAACTTCTGAACC Raptor_HindIII_R CCAAGCTTGGGGAGGAGGGGGAGGG

Supplementary Table 5. Genes associated with energy storage characterized by MBD2 ChIP-seq analysis.

Gene symbol Gene ID Abca1 11303 Abcb11 27413 Abcg1 11307 Abhd6 66082 Acot11 329910 Acp5 11433 Acvr1c 269275 Acvr2b 11481 Adam12 11489 Adam17 11491 Adam23 23792 Aebp1 11568 Ager 11596 Agpat4 68262 Agt 11606 Agtr1a 11607 Akt1 11651 Alox5ap 11690 Angptl2 26360 Angptl3 30924 Arntl 11865 Atf3 11910 Atg7 74244 Bcat1 12035 Ccnd3 12445 Ccr2 12772 Ccrn4l 12457 Cd36 12491 Cd38 12494 Cd47 16423 Ceacam2 26367 Cebpa 12606 Cebpb 12608 Cerk 223753 Clic5 224796 Cmklr1 14747 Cnot3 232791 Cnr1 12801 Creb1 12912 Crtc3 70461 Cry1 12952 Cry2 12953 Ctsk 13038

Cx3cr1 13051 Cxcl14 57266 Cxcl5 20311 Cyp2e1 13106 Ddit3 13198 Dgat1 13350 Dgat2 67800 Dok1 13448 E2f1 13555 Egln1 112405 Egr1 13653 Enpp2 18606 Ephx2 13850 F2rl1 14063 Fabp4 11770 Fabp5 16592 Fads2 56473 Fas 14102 Flcn 216805 Fto 26383 Fyn 14360 G0s2 14373 Ghr 14600 Gprc5b 64297 Grn 14824 Hif1a 15251 Hmox1 15368 Hnf4a 15378 Htr2a 15558 Ifng 15978 Igf2bp2 319765 Ikbkb 16150 Ikbke 56489 Il17a 16171 Il1a 16175 Il1b 16176 Il1rn 16181 Irf5 27056 Irf7 54123 Itgax 16411 Jun 16476 Kcna3 16491 Keap1 50868 Khk 16548 Kl 16591 Lcat 16816 Lgals3 16854

Lgr4 107515 Lipc 15450 Lox 16948 Lpin1 14245 Lrrc8c 100604 Ltb4r1 16995 Ly86 17084 Maf1 68877 Map3k14 53859 Mapk8 26419 Mapk9 26420 Mark3 17169 Mark4 232944 Mchr1 207911 Mfge8 17304 Mgat1 17308 Mir103-2 723825 Mir335 723930 Mir34a 723848 Mlxipl 58805 Mogat2 233549 Mstn 17700 Mtor 56717 Nampt 59027 Nck1 17973 Nfkb1 18033 Nlrp3 216799 Nnmt 18113 Nod1 107607 Npy2r 18167 Nr1d2 353187 Nr1h4 20186 Nr1i2 18171 Nr2c2 22026 Nr3c2 110784 Nupr1 56312 Ogg1 18294 Oip5 70645 Pank1 75735 Paqr3 231474 Pask 269224 Pdcd4 18569 Pemt 18618 Pgf 18654 Pid1 98496 Pik3cg 30955 Pik3r1 18708

Pla2g1b 18778 Pla2g4c 232889 Plcd1 18799 Plin1 103968 Plin2 11520 Pnpla2 66853 Pnrc2 52830 Prcp 72461 Prkab1 19079 Prkar2a 19087 Prkcb 18751 Prkcd 18753 Pten 19211 Ptgs2 19225 Ptpn1 19246 Ptpn11 19247 Ralbp1 19765 Rasd1 19416 Rb1 19645 Rbp4 19662 Ren1 19701 Retn 57264 Rorc 19885 Rptor 74370 Scd1 20249 Sel1l 20338 Serpine1 18787 Sertad2 58172 Skp2 27401 Smad3 17127 Sort1 20661 Sp1 20683 Srebf1 20787 Ssfa2 70599 Stat3 20848 Stat4 20849 Stk39 53416 Tas1r3 83771 Tbk1 56480 Tbx21 57765 Tgfb1 21803 Thbs1 21825 Thrsp 21835 Timp3 21859 Tlr2 24088 Tnc 21923 Tnf 21926

Tnfrsf14 230979 Tnfrsf1a 21937 Tnfrsf9 21942 Tnfsf12 21944 Tnfsf13b 24099 Tph1 21990 Traf3 22031 Traf6 22034 Trem2 83433 Trim72 434246 Trp53 22059 Trpm5 56843 Trpv4 63873 Txnip 56338 Vegfb 22340 Wisp1 22402 Xbp1 22433 Zfp423 94187

Supplementary Table 6. Genes associated with energy expenditure characterized by MBD2 ChIP- seq analysis.

Gene symbol Gene ID Abhd5 67469 Acacb 100705 Acadl 11363 Adipoq 11450 Adipor1 72674 Adipor2 68465 Adrb1 11554 Adrb2 11555 Adrb3 11556 Akr1b7 11997 Alkbh7 66400 Ankrd26 232339 Anxa1 16952 Apoa1 11806 Apoc1 11812 Apoe 11816 Aqp7 11832 Arf6 11845 Arrdc3 105171 Bdnf 12064 Bmp7 12162 Brd2 14312 Ccdc80 67896 Cd40 21939 Ceacam1 26365 Cidea 12683 Cideb 12684 Clock 12753 Cxcl1 14825 Cxcr4 12767 Dio2 13371 Dlk1 13386 Epo 13856 Esr1 13982 Ffar2 233079 Fgf21 56636 Foxc2 14234 Foxo1 56458 Fstl3 83554 Gcg 14526 Gcgr 14527 Gh 14599 Gip 14607

Gpr12 14738 Gpr39 71111 Igfbp2 16008 Il10 16153 Il18 16173 Il22 50929 Il6 16193 Irf4 16364 Irs2 384783 Jak2 16452 Jazf1 231986 Kdm3a 104263 Lcn2 16819 Ldlr 16835 Lep 16846 Lepr 16847 Lipe 16890 Lrp6 16974 Med1 19014 Metrnl 210029 Mir27a 387220 Mir33 723897 Mkl1 223701 Mrap2 244958 Nfe2l2 18024 Nmu 56183 Nos3 18127 Npr3 18162 Nr0b2 23957 Osmr 18414 Otop1 21906 Parp1 11545 Pde3b 18576 Ppara 19013 Ppard 19015 Pparg 19016 Ppargc1a 19017 Prrx1 18933 Rgs5 19737 Rock1 19877 Serpina12 68054 Sfrp5 54612 Sh2b1 20399 Sirt1 93759 Slc2a4 20528 Stat5a 20850 Stat5b 20851

Tbc1d1 57915 Thrb 21834 Tmbim6 110213 Tnfaip3 21929 Tnfsf10 22035 Tpcn1 252972 Tpcn2 233979 Trib3 228775 Trpm8 171382 Trpv1 193034 Tsc1 64930 Tsc2 22084 Ube2l6 56791 Ucn3 83428 Ucp1 22227 Ucp2 22228 Ucp3 22229 Vav3 57257 Vegfa 22339 Wdtc1 230796 Xdh 22436 Hipk2 15258 Nrip1 268903 Bmp4 12159 Prdm16 70673 Cnr2 12802 Crhr2 12922 Fam132a 67389 Gdf15 23886 Gstk1 76263 Gtf2h1 14884 Hdac4 208727 Lpl 16956 Mmp19 58223 Ncoa1 17977 Neil1 72774 Nos2 18126 Nr1h3 22259 Ntrk2 18212 Oma1 67013 Park7 57320 Pias1 56469 Pon3 269823 Prkaa1 105787 Prkaca 18747 Ptafr 19204 Rapgef3 223864

Sesn3 75747 Sfrp1 20377 Sirt2 64383 Sirt3 64384 Sirt6 50721 stk11 20869 Ppargc1b 170826 Adcy3 104111 Cidec 14311 Mfn2 170731 Opa1 74143 Nenf 66208 Atxn2 20239 Pik3ca 18706 Plscr3 70310

Supplementary Table 7. Clinical characteristics for subjects included in the present study.

Lean (BMI<25) Obese (BMI≥30) P Value n 23 24 Age, y 40.08±2.32 42.63±2.82 0.486 BMI, Kg/m2 21.63±0.49 34.74±1.68 <0.001 Waist circumference, cm 70±2.21 95±2.47 <0.001 Hip circumference, cm 83.21±2.52 102±3.85 <0.001 Systolic BP, mm Hg 1235.84 1308.76 <0.05 TG, mmol/L 1.100.44 1.430.43 <0.05 TC, mmol/L 4.260.41 4.510.62 0.268 LDL-c, mmol/L 2.540.52 2.850.71 0.088 HDL-c, mmol/L 1.140.29 0.970.33 0.348 Fasting Glucose, mmol/L 5.33±0.42 6.12±0.39 0.068

Supplementary Table 8. List for genes involved in energy metabolism.

Gene symbol Gene ID Abca1 11303 Abcb11 27413 Abcg1 11307 Abhd5 67469 Abhd6 66082 Acacb 100705 Acadl 11363 Ace2 70008 Acot11 329910 Acp5 11433 Acsm3 20216 Acvr1c 269275 Acvr2b 11481 Ad 104253 Adam12 11489 Adam17 11491 Adam23 23792 Adamts13 279028 Adcy3 104111 Adcy5 224129 Adipoq 11450 Adipor1 72674 Adipor2 68465 Adora2a 11540 Adrb1 11554 Adrb2 11555 Adrb3 11556 Aebp1 11568 Agap2 216439 Ager 11596 Agrp 11604 Agt 11606 Agtr1a 11607 Agtr1b 11608 Agtr2 11609 Akr1b7 11997 Akt1 11651 Alkbh7 66400 Alms1 236266 Alox12 11684 Alox5ap 11690 AMPD2 109674 AMPD3 11717 Amy1 11722 Angptl2 26360

Angptl3 30924 Angptl4 57875 Angptl6 70726 Ankrd26 232339 Anxa1 16952 Aoc3 11754 Apba1 319924 Apln 30878 Apoa1 11806 Apobr 171504 Apoc1 11812 Apoe 11816 Aqp7 11832 Ar 11835 Arf6 11845 Arid5b 71371 Arntl 11865 Arrdc3 105171 Ascl1 17172 Atf3 11910 Atg7 74244 Atp10a 11982 Atp5g3 228033 Atrn 11990 Atxn2 20239 Avpr1a 54140 Azgp1 12007 Bbs12 241950 Bbs2 67378 Bbs4 102774 Bcat1 12035 Bdkrb1 12061 Bdnf 12064 Becn2 226720 Bhlhe40 20893 Bmp7 12162 Bmp8a 12163 Bmp8b 12164 Brd2 14312 Bsbob 493119 Bsbob2 493120 Bsbob3 493121 Bsbob4 100035800 Bsbob5 100034953 C3 12266 C5ar2 319430 Ca3 12350 Calm1 12313

Capn10 23830 Cartpt 27220 Casp1 12362 Casp14 12365 Cav1 12389 Cbl 12402 Ccar2 219158 Ccdc80 67896 Cck 12424 Ccl2 20296 Ccl7 20306 Ccnd3 12445 Ccr2 12772 Cd14 12475 Cd180 17079 CD36 12491 Cd38 12494 Cd40 21939 Cd40lg 21947 Cd47 16423 Cd5l 11801 Cd69 12515 Cd80 12519 Cd86 12524 Cdh15 12555 Cdkn2a 12578 Ceacam1 26365 Ceacam2 26367 Cebpa 12606 Cebpb 12608 Cep19 66994 Cerk 223753 Ces3a 382053 Cfd 11537 Chga 12652 Chrm3 12671 Cidea 12683 Cideb 12684 Cidec 14311 Clec10a 17312 Clic5 224796 Clmp 71566 Clock 12753 Clps 109791 Cmklr1 14747 Cnot3 232791 Cnr1 12801 Cnr2 12802

Cntf 12803 Cntn2 21367 Cntnap2 66797 Cort 12854 Cox4i1 12857 Cpe 12876 Creb1 12912 Crem 12916 Crhr1 12921 Crhr2 12922 CRTC3 70461 Cry1 12952 Cry2 12953 Ctf1 13019 Ctgf 14219 Ctla4 12477 Ctnnb1 12387 Ctsb 13030 Ctsd 13033 Ctse 13034 Ctsk 13038 Cux1 13047 Cx3cr1 13051 Cxcl1 14825 Cxcl12 20315 Cxcl14 57266 Cxcl5 20311 Cxcr3 12766 Cxcr4 12767 Cybb 13058 Cyp19a1 13075 Cyp2e1 13106 Dapk2 13143 Ddit3 13198 Dgat1 13350 Dgat2 67800 Dhrs7b 216820 Dio2 13371 Diobq 100035832 Dlk1 13386 Dll1 13388 Dnajc1 13418 Dnmt1 13433 Dnmt3a 13435 Dob1 109375 Dob2 112008 Dob3 112015 Dob4 112019

Dob7 112016 Dob9 112020 Dok1 13448 Dpp4 13482 Drd2 13489 Dusp2 13537 E2f1 13555 Edn1 13614 Efnb1 13641 Egln1 112405 Egr1 13653 Ei24 13663 Eif2ak2 19106 Eif4ebp1 13685 Eif4ebp2 13688 Elovl3 12686 Enpp1 18605 Enpp2 18606 Epas1 13819 Ephx2 13850 Epm2aip1 77781 Epo 13856 Ern1 78943 Esr1 13982 Esr2 13983 Esrra 26379 F2rl1 14063 F3 14066 Fabp1 14080 Fabp3 14077 Fabp4 11770 Fabp5 16592 Fads2 56473 Fam132a 67389 Fas 14102 Fbp1 14121 Fcgr2b 14130 Fcor 100503924 Ffar1 233081 Ffar2 233079 Ffar4 107221 Fgf21 56636 Flcn 216805 Flt1 14254 Fob1 109394 Fob2 109399 Fob3 109398 Fob3a 100035759

Fob3b1 100034858 Fob4 109395 Foxc2 14234 Foxo1 56458 Foxo3 56484 Foxo6 329934 Fstl1 14314 Fstl3 83554 Fto 26383 Furin 18550 Fxn 14297 Fyn 14360 G0s2 14373 Gabbr1 54393 Gal 14419 Gata4 14463 Gcg 14526 Gcgr 14527 Gck 103988 Gdf15 23886 Gh 14599 Ghr 14600 GHRL 58991 Ghsr 208188 Gip 14607 Gipr 381853 Gjd2 14617 Gk 14933 Glp1r 14652 Glp2r 93896 Gm2a 14667 Gnas 14683 Gnat3 242851 Gpam 14732 Gper1 76854 Gpr1 241070 Gpr119 236781 Gpr12 14738 Gpr21 338346 Gpr39 71111 Gprc5b 64297 Grk5 14773 Grm6 108072 Grn 14824 Gsk3b 56637 Gstk1 76263 Gtf2h1 14884 Gucy2c 14917

Gys1 14936 Gys2 232493 Hamp 84506 Hcar1 243270 Hcar2 80885 Hcrt 15171 Hcrtr2 387285 Hdac4 208727 Hgf 15234 Hif1a 15251 Hmox1 15368 Hnf4a 15378 Hoxa10 15395 Hsd11b1 15483 Hspa5 14828 Htr2a 15558 Iapp 15874 Ifitm1 68713 Ifng 15978 Igf1 16000 Igf1r 16001 Igf2 16002 Igf2bp2 319765 Igfbp2 16008 Ikbkb 16150 Ikbke 56489 Il10 16153 Il15 16168 Il15ra 16169 Il17a 16171 Il18 16173 Il1a 16175 Il1b 16176 Il1r1 16177 Il1rn 16181 Il21 60505 Il22 50929 Il25 140806 Il33 77125 Il6 16193 Inppl1 16332 Ins1 16333 Ins2 16334 Insr 16337 Irf4 16364 Irf5 27056 Irf7 54123 Irs1 16367

Irs2 384783 Irx3 16373 Itgad 381924 Itgam 16409 Itgax 16411 Itpr2 16439 Jak2 16452 Jak3 16453 Jazf1 231986 Jun 16476 Kcna3 16491 Kdm3a 104263 Kdr 16542 Keap1 50868 Khk 16548 Kl 16591 Klrk1 27007 Kras 16653 Lcat 16816 Lcn2 16819 Ldlr 16835 Lep 16846 Lepr 16847 Leprot 230514 Letmd1 68614 Lgals3 16854 Lgi3 213469 Lipc 15450 Lipe 16890 Lnpep 240028 Lox 16948 Lpar1 14745 Lpin1 14245 Lpin2 64898 Lpl 16956 Lrp6 16974 Lrrc8c 100604 Lta 16992 Ltb4r1 16995 Ltf 17002 Ly86 17084 Lyrm1 73919 Maf1 68877 Magel2 27385 Map3k11 26403 Map3k14 53859 Map3k8 26410 Map4k4 26921

Mapk1 26413 Mapk3 26417 Mapk8 26419 Mapk9 26420 Mark4 232944 Mc3r 17201 mc4r 17202 Mchr1 207911 Mdk 17242 Med1 19014 Met 17295 Metrnl 210029 Mex3c 240396 Mfge8 17304 Mfn2 170731 Mgat1 17308 Mgat2 217664 Mif 17319 Mir125a 387235 Mir27a 387220 Mir29c 387224 Mir33 723897 Mir335 723930 Mir34a 723848 Mir378a 723889 Mir504 100124476 Mir7-1 723902 Mkks 59030 Mkl1 223701 Mlxipl 58805 Mlycd 56690 Mme 17380 Mmp10 17384 Mmp14 17387 Mmp19 58223 Mmp9 17395 Mogat2 233549 Moo3 100034896 Moo4 100035774 Mors1 114752 Mors2 114751 Mors3 114753 Mors4 114754 Mrap2 244958 Mst1r 19882 Mstn 17700 Mt1 17748 Mt2 17750

Mtch2 56428 mt-Nd6 17722 Mtor 56717 Myc 17869 Myd88 17874 Mzb1 69816 Nampt 59027 Ncf1 17969 Nck1 17973 Ncoa1 17977 Neil1 72774 Nenf 66208 NEWENTRY 192344 Nfe2l2 18024 Nfkb1 18033 Nhlh2 18072 Nkx1-1 672284 Nlrp3 216799 Nmu 56183 Nnat 18111 Nnmt 18113 Noct 12457 Nod1 107607 Nod2 257632 NOR-1 18124 Nos1 18125 Nos2 18126 Nos3 18127 Nov 18133 Nox1 237038 Nox4 50490 Npc1 18145 Npr1 18160 Npr3 18162 Npy 109648 Npy1r 18166 Npy2r 18167 Npy4r 19065 Npy5r 18168 Nr0b2 23957 Nr1d2 353187 Nr1h3 22259 Nr1h4 20186 Nr1i2 18171 Nr2c2 22026 Nr3c2 110784 Nr4a3 18124 Nrip1 268903

Ntrk2 18212 Nuak2 74137 Nucb2 53322 Nupr1 56312 Ogg1 18294 Ogt 108155 Oip5 70645 Oma1 67013 Opa1 74143 Oprk1 18387 Osmr 18414 Otc 18416 Otop1 21906 Oxsr1 108737 Oxtr 18430 P2rx2 231602 Pank1 75735 Paqr3 231474 Park7 57320 Parp1 11545 Pask 269224 Pcsk1 18548 Pcyt2 68671 Pdcd4 18569 Pde3b 18576 Pdx1 18609 Peg3 18616 Pemt 18618 Pfkfb2 18640 Pfkp 56421 Pgf 18654 Phb 18673 Phb2 12034 Pias1 56469 Pid1 98496 Pik3ca 18706 Pik3cb 74769 Pik3cg 30955 Pik3r1 18708 Pin1 23988 Pitrm1 69617 Pla2g1b 18778 Pla2g4c 232889 Plagl2 54711 Plcd1 18799 Plin1 103968 Plin2 11520 Plscr3 70310

Pmch 110312 Pnliprp1 18946 Pnoc 18155 Pnpla2 66853 Pnpla3 116939 Pnrc2 52830 Pomc 18976 Pon3 269823 Ppara 19013 Ppard 19015 Pparg 19016 Ppargc1a 19017 Ppargc1b 170826 Prcp 72461 Prkaa1 105787 Prkaa2 108079 Prkab1 19079 Prkaca 18747 Prkar2a 19087 Prkcb 18751 Prkcd 18753 Prkcq 18761 Prkcz 18762 Prkg1 19091 Prl 19109 Prlhr 226278 Prox1 19130 Prrx1 18933 Ptafr 19204 Pten 19211 Ptgds 19215 Ptgs2 19225 Ptpn1 19246 Ptpn11 19247 Ptprt 19281 Ptx3 19288 Pycard 66824 Pyy 217212 Rai1 19377 Ralbp1 19765 Raly 19383 Rapgef3 223864 Rarres2 71660 Rasd1 19416 Rb1 19645 Rbp4 19662 Ren1 19701 Retn 57264

Retnlb 57263 Retnlg 245195 Rfx6 320995 Rgcc 66214 Rgs5 19737 Rock1 19877 Rock2 19878 Rora 19883 Rorc 19885 Rpgrip1l 244585 Rps6kb1 72508 Rsc1a1 69994 Saa 111345 Saa1 20208 Saa3 20210 Scarb1 20778 Scd1 20249 Scg3 20255 Scn3b 235281 Sdc 20249 Sdc3 20970 Sel1l 20338 Selplg 20345 Sema3e 20349 Sepp1 20363 Serpina12 68054 Serpine1 18787 Serpinf1 20317 Sertad2 58172 Sesn3 75747 Sfrp1 20377 Sfrp4 20379 Sfrp5 54612 Sftpd 20390 SGIP1 73094 Sgms2 74442 Sh2b1 20399 Shc1 20416 Siae 22619 Sim1 20464 Sirt1 93759 Sirt2 64383 Sirt3 64384 Sirt4 75387 Sirt6 50721 Ski 20481 Skp2 27401 Slc12a1 20495

Slc15a1 56643 Slc16a1 20501 Slc22a12 20521 Slc27a6 225579 Slc2a4 20528 Slc30a8 239436 Slc35d3 76157 Slc36a1 215335 Slc38a2 67760 Slc6a20a 102680 Slc6a4 15567 Sln 66402 Smad3 17127 Snca 20617 Sncaip 67847 Sntb2 20650 Socs3 12702 Sorcs1 58178 Sort1 20661 Sost 74499 Sox6 20679 Sp1 20683 Spa17 20686 Spi1 20375 Spon2 100689 Spp1 20750 Spx 319552 Sqle 20775 Srebf1 20787 srl 106393 Srpr 67398 Ssfa2 70599 Sstr4 20608 Stat3 20848 Stat4 20849 Stat5a 20850 Stat5b 20851 Steap4 117167 stk11 20869 Stk39 53416 Sts 20905 Tabw2 100035794 Tas1r3 83771 Tbc1d1 57915 Tbk1 56480 Tbx21 57765 Tcf7l2 21416 Tfap2b 21419

Tgfb1 21803 Thbs1 21825 Thrb 21834 Thrsp 21835 Timp1 21857 Timp3 21859 Tlr2 24088 Tlr4 21898 Tmbim6 110213 Tmem120a 215210 Tmem120b 330189 Tnc 21923 Tnf 21926 Tnfaip3 21929 Tnfrsf14 230979 Tnfrsf1a 21937 Tnfrsf9 21942 Tnfsf10 22035 Tnfsf12 21944 Tnfsf13b 24099 Tnfsf9 21950 Tp53inp2 68728 Tpcn1 252972 Tpcn2 233979 Tph1 21990 Traf3 22031 Traf6 22034 Trem2 83433 Trib3 228775 Trim30a 20128 Trim72 434246 Trp53 22059 Trp53inp2 68728 Trpm5 56843 Trpm8 171382 Trpv1 193034 Trpv4 63873 Trpv6 64177 Tsc1 64930 Tsc2 22084 Tsp1 108314 Ttr 22139 Tub 22141 Txnip 56338 Ubb 22187 UBC 22190 Ube2l6 56791 Ucn3 83428

Ucp1 22227 Ucp2 22228 Ucp3 22229 Vav3 57257 Vegfa 22339 Vegfb 22340 Wdtc1 230796 Wisp1 22402 Xbp1 22433 Xdh 22436 Zfp36 22695 Zfp423 94187

Supplementary Table 9. List for genes involved in energy storage (the gene panel of energy storage) in adipose tissue.

Symbol Gene ID Abca1 11303 Abcb11 27413 Abcg1 11307 Abhd6 66082 Acot11 329910 Acp5 11433 Acvr1c 269275 Acvr2b 11481 Adam12 11489 Adam17 11491 Adam23 23792 Aebp1 11568 Ager 11596 Agpat4 68262 Agt 11606 Agtr1a 11607 Agtr2 11609 Akt1 11651 Alox5ap 11690 Angptl2 26360 Angptl3 30924 Arntl 11865 Atf3 11910 Atg7 74244 Bcat1 12035 Ccl2 20296 Ccnd3 12445 Ccr2 12772 Ccrn4l 12457 Cd36 12491 Cd38 12494 Cd47 16423 Ceacam2 26367 Cebpa 12606 Cebpb 12608 Cerk 223753 Clic5 224796 Cmklr1 14747 Cnot3 232791 Cnr1 12801 Creb1 12912 Crtc3 70461 Cry1 12952

Cry2 12953 Ctsk 13038 Cx3cr1 13051 Cxcl12 20315 Cxcl14 57266 Cxcl5 20311 Cxcr3 12766 Cyp2e1 13106 Ddit3 13198 Dgat1 13350 Dgat2 67800 Dok1 13448 E2f1 13555 Egln1 112405 Egr1 13653 Elovl3 12686 Enpp2 18606 Ephx2 13850 F2rl1 14063 Fabp4 11770 Fabp5 16592 Fads2 56473 Fas 14102 Flcn 216805 Fto 26383 Fyn 14360 G0s2 14373 Ghr 14600 Gpr21 338346 Gprc5b 64297 Grn 14824 Hcar1 243270 Hif1a 15251 Hmox1 15368 Hnf4a 15378 Htr2a 15558 Ifng 15978 Igf2bp2 319765 Ikbkb 16150 Ikbke 56489 Il17a 16171 Il1a 16175 Il1b 16176 Il1rn 16181 Inppl1 16332 Irf5 27056 Irf7 54123

Itgax 16411 Jun 16476 Kcna3 16491 Keap1 50868 Khk 16548 Kl 16591 Lcat 16816 Lgals3 16854 Lgr4 107515 Lipc 15450 Lox 16948 Lpin1 14245 Lrrc8c 100604 Ltb4r1 16995 Ly86 17084 Maf1 68877 Map3k14 53859 Mapk8 26419 Mapk9 26420 Mark3 17169 Mark4 232944 Mchr1 207911 Mfge8 17304 Mgat1 17308 Mir103-2 723825 Mir335 723930 Mir34a 723848 Mlxipl 58805 Mogat2 233549 Mstn 17700 Mtor 56717 Myd88 17874 Nampt 59027 Nck1 17973 Nfkb1 18033 Nlrp3 216799 Nnmt 18113 Nod1 107607 Npy2r 18167 Nr1d2 353187 Nr1h4 20186 Nr1i2 18171 Nr2c2 22026 Nr3c2 110784 Nupr1 56312 Ogg1 18294 Oip5 70645

Pank1 75735 Paqr3 231474 Pask 269224 Pdcd4 18569 Pemt 18618 Pgf 18654 Pid1 98496 Pik3cg 30955 Pik3r1 18708 Pla2g1b 18778 Pla2g4c 232889 Plcd1 18799 Plin1 103968 Plin2 11520 Pnpla2 66853 Pnrc2 52830 Prcp 72461 Prkab1 19079 Prkar2a 19087 Prkcb 18751 Prkcd 18753 Pten 19211 Ptgs2 19225 Ptpn1 19246 Ptpn11 19247 Ralbp1 19765 Rasd1 19416 Rb1 19645 Rbp4 19662 Ren1 19701 Retn 57264 Rgcc 66214 Rorc 19885 Rptor 74370 Scd1 20249 Sel1l 20338 Serpine1 18787 Sertad2 58172 Skp2 27401 Smad3 17127 Socs3 12702 Sort1 20661 Sp1 20683 Srebf1 20787 Ssfa2 70599 Stat3 20848 Stat4 20849 Stk39 53416

Tas1r3 83771 Tbk1 56480 Tbx21 57765 Tfap2b 21419 Tgfb1 21803 Thbs1 21825 Thrsp 21835 Timp1 21857 Timp3 21859 Tlr2 24088 Tlr4 21898 Tnc 21923 Tnf 21926 Tnfrsf14 230979 Tnfrsf1a 21937 Tnfrsf9 21942 Tnfsf12 21944 Tnfsf13b 24099 Tnfsf9 21950 Tph1 21990 Traf3 22031 Traf6 22034 Trem2 83433 Trim72 434246 Trp53 22059 Trpm5 56843 Trpv4 63873 Txnip 56338 Vegfb 22340 Wisp1 22402 Xbp1 22433 Zfp423 94187

Supplementary Table 10. List of genes involved in energy expenditure (the gene panel of energy expenditure) in adipose tissue.

Symbol GeneID Abhd5 67469 Acacb 100705 Acadl 11363 Ace2 70008 Adipoq 11450 Adipor1 72674 Adipor2 68465 Adrb1 11554 Adrb2 11555 Adrb3 11556 Akr1b7 11997 Alkbh7 66400 Ankrd26 232339 Anxa1 16952 Apln 30878 Apoa1 11806 Apoc1 11812 Apoe 11816 Aqp7 11832 Ar 11835 Arf6 11845 Arrdc3 105171 Bdnf 12064 Bmp7 12162 Brd2 14312 Ccdc80 67896 Cd40 21939 Ceacam1 26365 Cep19 66994 Cidea 12683 Cideb 12684 Clock 12753 Cntf 12803 Cxcl1 14825 Cxcr4 12767 Dio2 13371 Dlk1 13386 Epo 13856 Esr1 13982 Ffar2 233079 Fgf21 56636 Foxc2 14234 Foxo1 56458

Fstl3 83554 Gcg 14526 Gcgr 14527 Gh 14599 Gip 14607 Gpr12 14738 Gpr39 71111 Igfbp2 16008 Il10 16153 Il18 16173 Il22 50929 Il6 16193 Irf4 16364 Irs2 384783 Jak2 16452 Jazf1 231986 Kdm3a 104263 Lcn2 16819 Ldlr 16835 Lep 16846 Lepr 16847 Lipe 16890 Lrp6 16974 Med1 19014 Metrnl 210029 Mir27a 387220 Mir33 723897 Mkl1 223701 Mrap2 244958 Mt2 17750 Nfe2l2 18024 Nmu 56183 Nos3 18127 Npr3 18162 Nr0b2 23957 Osmr 18414 Otop1 21906 Parp1 11545 Pde3b 18576 Ppara 19013 Ppard 19015 Pparg 19016 Ppargc1a 19017 Prrx1 18933 Rgs5 19737 Rock1 19877 Serpina12 68054

Sfrp5 54612 Sh2b1 20399 Sirt1 93759 Slc2a4 20528 Stat5a 20850 Stat5b 20851 Tbc1d1 57915 Thrb 21834 Tmbim6 110213 Tnfaip3 21929 Tnfsf10 22035 Tpcn1 252972 Tpcn2 233979 Trib3 228775 Trpm8 171382 Trpv1 193034 Tsc1 64930 Tsc2 22084 Ube2l6 56791 Ucn3 83428 Ucp1 22227 Ucp2 22228 Ucp3 22229 Vav3 57257 Vegfa 22339 Wdtc1 230796 Xdh 22436 Zfp36 22695 Hipk2 15258 Nrip1 268903 Bmp4 12159 Prdm16 70673 Cnr2 12802 Crhr2 12922 Fam132a 67389 Gdf15 23886 Gstk1 76263 Gtf2h1 14884 Hdac4 208727 Il15 16168 Lpl 16956 Mmp19 58223 Ncoa1 17977 Neil1 72774 Nos2 18126 Nox4 50490 Nr1h3 22259

Ntrk2 18212 Oma1 67013 Park7 57320 Pias1 56469 Pon3 269823 Prkaa1 105787 Prkaca 18747 Ptafr 19204 Rapgef3 223864 Rock2 19878 Sesn3 75747 Sfrp1 20377 Sfrp4 20379 Sirt2 64383 Sirt3 64384 Sirt6 50721 stk11 20869 Ppargc1b 170826 Adcy3 104111 Cidec 14311 Mfn2 170731 Opa1 74143 Nenf 66208 Sts 20905 Atxn2 20239 Ffar4 107221 Pik3ca 18706 Plscr3 70310