Mitosis-specific MRN complex promotes a mitotic signaling cascade to regulate spindle dynamics and segregation

Ran Xua,1, Yixi Xua,1, Wei Huoa, Zhicong Lva, Jingsong Yuanb,c, Shaokai Ninga, Qingsong Wanga, Mei Houa, Ge Gao (高歌)a, Jianguo Jia, Junjie Chend, Rong Guoa,2, and Dongyi Xua,2

aState Key Laboratory of and Plant Research, School of Life Sciences, Peking University, Beijing 100871, China; bDepartment of Radiation Oncology, Columbia University Medical Center, New York, NY 10032; cCenter for Radiological Research, Columbia University Medical Center, New York, NY 10032; and dDepartment of Experimental Radiation Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030

Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved September 11, 2018 (received for review April 18, 2018) The MRE11––NBS1 (MRN) complex is well known for partici- nases, including PLK1 (18, 19). PLK1 interacts with KIF2A spe- pating in DNA damage response pathways in all phases of cell cycle. cifically during mitosis, in a manner dependent on its kinase Here, we show that MRN constitutes a mitosis-specific complex, activity. PLK1 is also capable of directly phosphorylating KIF2A named mMRN, with a protein, MMAP. MMAP directly interacts with and enhancing its depolymerase activity (18). Here, we show that MRE11 and is required for optimal stability of the MRN complex MRN forms a mitosis-specific complex, named mMRN, with a during mitosis. MMAP colocalizes with MRN in mitotic spindles, protein, MMAP. The mMRN complex is required for PLK1 to and MMAP-deficient cells display abnormal spindle dynamics and interact with and activate its downstream substrate, KIF2A, chromosome segregation similar to MRN-deficient cells. Mechanisti- leading to spindle turnover and chromosome segregation. Our cally, both MMAP and MRE11 are hyperphosphorylated by the mi- data suggest that mMRN plays a crucial role in the PLK1–KIF2A totic kinase, PLK1; and the phosphorylation is required for assembly signaling cascade to regulate mitotic spindle dynamics. of the mMRN complex. The assembled mMRN complex enables PLK1 to interact with and activate the depolymerase, Results KIF2A, leading to spindle turnover and chromosome segregation. MMAP/C2orf44 Is One Component of the MRN Complex. We transiently Our study identifies a mitosis-specific version of the MRN complex expressedFLAG-taggedMRE11,RAD50,andNBS1inHEK293 – that acts in the PLK1 KIF2A signaling cascade to regulate spindle cells and immunoprecipitated the complexes with an anti-FLAG dynamics and chromosome distribution. antibody (Fig. 1A). Mass spectrometry identified a protein, C2orf44, in the immunoprecipitates of all of the components of the MRN C2ORF44 | MMAP | MRN | KIF2A | mMRN complex but not with the control (Fig. 1 A and B). Immunoblotting further validated this finding (Fig. 1C and SI Appendix,Fig.S1A). – – he MRE11 RAD50 NBS1 (MRN) complex plays multiple We renamed this protein as mitosis-specific MRN-associated Troles in the DNA damage response. This complex can act as a protein (MMAP). Immunoblotting (Fig. 1D) of the reciprocal sensor, a signal transducer, as well as a nuclease complex that functions in DNA double-strand break (DSB) repair by homolo- Significance gous recombination. The complex can promote activation of the ATM-dependent signaling pathway, catalyze DNA resection to – – initiate homologous recombinational repair and microhomology- The Mre11 Rad50 Nbs1 (MRN) complex is well known for par- mediated end joining, and, in some organisms, is also required ticipating in DNA damage response pathways and mediating the for the nonhomologous end-joining pathway (1, 2). Hypomorphic ATM-dependent phosphorylation signaling cascade. Hypomorphic mutations in human MRN complex have been identified in rare mutations in the human MRN complex have been identified in – autosomal recessive genetic diseases, ataxia-telangiectasia–like dis- autosomal recessive genetic diseases, ataxia-telangiectasia like order, and Nijmegen breakage syndrome (3–5). These disorders are disorder, and Nijmegen breakage syndrome. Here, we show that characterized by genome instability, hypersensitivity to ionizing ra- MRN forms a mitosis-specific complex with a protein, MMAP, diation (IR), immunodeficiency, and cancer predisposition (6, 7). which mediates a mitotic signaling cascade between PLK1 and Proper spindle assembly and subsequent spindle dynamics are KIF2A. We demonstrate that the assembly of this complex is crucial critical for accurate chromosome separation and genomic integrity for normal spindle dynamics during mitosis. Thus, our study de- scribes a signaling cascade in which PLK1-dependent phosphory- (8). Spindle assembly is mediated by two major pathways, in- – – – cluding search-and-capture of kinetochores by lation promotes the assembly of the MRN MMAP PLK1 KIF2A (MTs), and self-assembly of these MTs into a bipolar structure (9). complex, leading to mitotic spindle turnover and chromosome The latter process is dependent on the RCC1-mediated RanGTP alignment. gradient (10, 11). It was reported that the MRN complex contrib- Author contributions: R.G. and D.X. designed research; R.X., Y.X., W.H., Z.L., and S.N. utes to Ran-dependent mitotic spindle assembly by recruiting or performed research; J.Y. and J.C. contributed new reagents/analytic tools; R.X., Y.X., stabilizing RCC1 to associate with (12). W.H., Q.W., M.H., G.G., J.J., R.G., and D.X. analyzed data; and R.X., Y.X., R.G., and D.X. Conversely, spindle dynamics is driven by active polymeriza- wrote the paper. tion and depolymerization of MTs and can generate the pulling The authors declare no conflict of interest. force for chromosome congression and segregation (9). Proper This article is a PNAS Direct Submission. spatial and temporal regulation of spindle dynamics is critical for Published under the PNAS license. normal chromosome separation and governed by multiple fac- 1R.X. and Y.X. contributed equally to this work. tors, including MT nucleators, MT depolymerase, and MT- 2To whom correspondence may be addressed. Email: [email protected] or xudongyi@ associated . MT depolymerase, KIF2A, is localized to pku.edu.cn. spindle MTs and spindle poles, and plays a crucial role in spindle This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.

dynamics and chromosome separation (13–17). The activity of 1073/pnas.1806665115/-/DCSupplemental. CELL BIOLOGY KIF2A is regulated through its phosphorylation by multiple ki- Published online October 8, 2018.

www.pnas.org/cgi/doi/10.1073/pnas.1806665115 PNAS | vol. 115 | no. 43 | E10079–E10088 Downloaded by guest on September 27, 2021 A Flag-IP C Flag-IP ItInput Flag IP Mock NBS1 Mock NBS1 RAD50 RAD50 MRE11 MRE11 MMAP Mock Markers MMAPs MRE11 RAD50 Markers Mock (kDa) NBS1 MMAP (kDa) 200 Flag-RAD50 200 RAD50 Flag-NBS1 116 NBS1 116 Flag-MRE11 97 MRE11 97 C2orf44 /MMAP 66 66 MMAPs Fig. 1. MMAP is one component of the MRN com- 45 45 plex. (A) Silver-stained SDS/PAGE gels showing the D IP polypeptides that were immunopurified from ex- 31 31 AP tracts of HEK293 cells expressing FLAG-tagged put M M G G Ig 21 M MRE11, RAD50, NBS1, MMAP, or MMAPs using the In 21 14 MMAP FLAG antibody. MMAPs is the short isoform of MMAP. 14 MRE11 As a control, a mock IP (Mock) was performed using untransfected HEK293 cells. (B) The proteins that were B RAD50 identified in the indicated immunoprecipitates using Flag-IP Idenfied NBS1 mass spectrometry. The numbers of peptides are aver- proteins Mock MRE11 RAD50 NBS1 MMAP MMAPs aged over two experiments. (C) Immunoblot showing MRE11 0 69. 5 52 34 5 0 the immunoprecipitation of FLAG-tagged MRE11, RAD50 0 163 168.5 23.5 15 2 Flag IP NBS1 0 18 56.5 76.5 2 0 RAD50, and NBS1. (D) Immunoblot showing the MMAP MMAP 0 5.5 4.5 1 77 57 F immunoprecipitation. For each immunoprecipitation, 8 KIF2A 0 0 0 0 43 0 extract of 1 × 10 HEK293 cells was used. (E) Schematic Mock MMAP MMAPs PLK1000090 MRE11 representation of the human MMAP isoforms. The MMAP (NP_079479.1) and MMAPs (NP_001135791.1) NBS1 isoforms were identified by searching the National RAD50 Center for Biotechnology Information NR database. CC, E 1 432 552 583 616 676 721 MMAP WD40 CC SH3 KIF2A coiled-coil motif; SH3, SH3 domain; WD40, WD40 repeat Pi PLK1 domain. A phosphorylated cluster was marked by a 1 622 MMAPs WD40 CC Flag-MMAP brown box. (F) Immunoblot showing the immunopre- Flag-MMAPs cipitation of FLAG-tagged MMAP and MMAPs.

−/− immunoprecipitation with antiendogenous MMAP antibodies function of MMAP in DSB repair, we generated MMAP revealed that the MRN complex is present in the MMAP- HCT116 cells (SI Appendix,Fig.S4A and B) and found that these associated complexes, demonstrating that MMAP is a compo- cells displayed normal sensitivity to IR or camptothecin (CPT) (SI nent of the MRN complex. In contrast, CtIP, which interacts Appendix,Fig.S4C), both of which can induce DSBs. These results with MRN complex to initiate DNA resection, is not present in suggest that, unlike the MRN complex, MMAP and its associated the MMAP-associated complexes (SI Appendix, Fig. S1B), im- MMAP–MRN complex are dispensable for DSB repair. plicating that the MMAP-associated MRN complex may not be required for homologous recombinational repair. MMAP–MRN Is a Mitosis-Specific Complex. In addition to the MRN MMAP is expressed only in vertebrates (SI Appendix,Fig.S2). complex, KIF2A and PLK1 were found to coimmunoprecipitate There are two MMAP isoforms in the database with FLAG–MMAP by both mass spectrometry and immuno- (Fig. 1E). The long isoform (MMAP) contains an N-terminal blotting analyses (Fig. 1 B and F). The interactions between WD40 repeat domain, a central coiled-coil motif, and a C-terminal MMAP and these two proteins are likely mediated by the C- SH3 domain; the short isoform (MMAPs) lacks the SH3 domain- terminal region of MMAP because only the long isoform of containing C terminus. Mass spectrometry (Fig. 1 A and B) and MMAP, but not the short version lacking the C terminus, immunoblotting (Fig. 1F) showed that the long isoform, but not coimmunoprecipitated with KIF2A and PLK1 (Fig. 1 B and F). the short isoform, pulled down the MRN complex, demonstrat- Immunoblots of the reciprocal immunoprecipitation showed that ing that the C-terminal region is required for its interaction MMAP, MRE11, and KIF2A similarly coimmunoprecipitated with MRN. with FLAG-tagged PLK1 (Fig. 2A). These results suggest that Next, we determined the subunit of the MRN complex that PLK1 and KIF2A associate with the MMAP–MRN complex. interacted with MMAP. We found that deletion of the MRE11- KIF2A and PLK1 have been reported to interact specifically in binding regions in RAD50 or NBS1 resulted in the loss of their mitosis (18). We examined their interaction with MMAP–MRN interactions with MMAP in the coimmunoprecipitation (co-IP) complex in different cell phases. In asynchronous cells, the assay (SI Appendix,Fig.S3A–D), implying that these two proteins protein level of PLK1 is very low and the immunoprecipitation of may associate with MMAP through MRE11. Consistent with this endogenous PLK1 did not contain other detectable proteins notion, deletion of 50 aa at the C terminus of MRE11 completely examined under these conditions (Fig. 2B), although overex- disrupted its association with MMAP, but not with RAD50 and pressed FLAG-tagged PLK1 was copurified with MMAP, NBS1 (SI Appendix,Fig.S3E and F). Moreover, a C-terminal re- MRE11, and KIF2A from asynchronous cells (Fig. 2A). In mi- gion of MRE11 (amino acids 593–708) is sufficient and necessary totic cells, PLK1 was highly expressed and robustly coimmuno- for its interaction with MMAP (SI Appendix,Fig.S3E and G). precipitated with MMAP–MRN and KIF2A (Fig. 2B). These These results suggest that the MRN complex interacts with MMAP results are also consistent with previous independent finding that through the C-terminal region of MRE11. MMAP and KIF2A were identified in the immunoprecipitate of MRN plays a critical role in maintaining genomic stability, par- PLK1 from Taxol-arrested cells by mass spectrometry (20), ticularly in DSB response and repair (2). One common feature of demonstrating that PLK1 is associated with KIF2A and the cells from patients with hypomorphic mutations in MRE11, RAD50, MMAP–MRN complex especially in mitotic cells possibly due to or NBS1 is their hypersensitivity to IR. To examine the potential its elevated protein level.

E10080 | www.pnas.org/cgi/doi/10.1073/pnas.1806665115 Xu et al. Downloaded by guest on September 27, 2021 A Flag-IP B Input PLK1 IP C Input MRE11 IP AS M AS M AS M AS M 1 ck K K o o H-MMAP PL M MMAP KIF2A MRE11 MRE11 H-MMAP MMAP KIF2A PLK1 PLK1 MMAP KIF2A Flag-PLK1 Cyclin B MRE11 Cyclin B E AS M MMAP-/- MMAP-/- D Input MMAP IP WT 12WT 12 Mitotic cells WT F MMAP-/-_1 AS M AS M MRE11 1.5 MMAP-/-_2 KIF2A RAD50 1.0 tensity n PLK1 NBS1 n Fig. 2. MRN–MMAP forms a mitosis-specific com- MRE11 ** MMAP 0.5 plex, mMRN, which associates with PLK1 and KIF2A. H-MMAP KIF2A Relative I (A) Immunoblot showing the immunoprecipitation MMAP 0.0 of FLAG-tagged PLK1 using HEK293 cells. (B–D)Im- Cyclin B PLK1 munoblot showing the immunoprecipitations of PLK1 NBS1 Actin Actin Actin KIF2A MRE11 RAD50 PLK1 (B), MRE11 (C), and MMAP (D) in asynchronous MI(%): 2.8 7.8 8.3 85.8 87.1 87.5 (AS) or mitotic (M) HeLa cells. For each immunopre- × 7 G 0 min 5 min 10 min 15 min 20 min25 min 30 min 35 min40 min 45 min 50 min cipitation, an extract of 3 10 cells was used. H- MMAP indicates the shifted MMAP band. (E and F) Immunoblotting (E) and quantification (F) show that GFP-

MMAP

+ the levels of the MRN proteins are reduced in the MMAP-null mitotic HCT116 cells. β-Actin was used as a loading control. The mitotic index (MI) was de- E11 P-H2B R R F F termined using phosphorylated-H3(S10) and is in- R M dicated at the bottom of the blots. A cross-reactive polypeptide is indicated with asterisks. Data were GFP GFP H (rabbit) Tubulin DAPI Merged (mouse) KIF2A DAPI Merged I MRE11 NBS1 DAPI Merged quantified from at least three independent experi- ments for each protein. The data represent the mean GFP WT values, and the error bars represent SD. (G) Time- lapse imaging of living HeLa cells expressing RFP– -/- – – GFP-MRE11 NBS1 H2B and GFP MMAP or GFP MRE11. The yellow ar- rows indicate the localization of GFP–MMAP and GFP–MRE11 at spindle poles. (Scale bars, 5 μm.) (H) GFP-MRE11 Immunofluorescence showing the spindle localiza- +BI2536 J MRE11 Tubulin DAPI Merged tion of the GFP–MMAP and GFP–MRE11 fusion pro- WT tein in HeLa cells. Two different anti-GFP antibodies GFP-MMAP were used. (Scale bars, 5 μm.) (I and J) Immunofluo- NBS1-/- rescence showing the localization of endogenous GFP-MMAP MRE11 and NBS1 (I) and Tubulin (J) in metaphase +BI2536 HeLa cells. (Scale bars, 5 μm.)

Unlike PLK1, the protein levels of MMAP, MRE11, and Interestingly, the MRE11 level decreased by more than 50% in −/− KIF2A were not significantly changed in mitotic cells compared MMAP cells compared with wild-type cells upon mitotic arrest with asynchronous cells, although another MMAP species with (Fig. 2 E and F). Protein levels of RAD50 (30% decrease) and retarded gel mobility was seen (Fig. 2 C and D and SI Appendix, NBS1 (20% decrease) were also modestly reduced in mitotic −/− Fig. S5A). The interactions among them were very weak in MMAP cells, but to a lesser extent than that of MRE11, which asynchronous cells (Fig. 2 C and D and SI Appendix, Fig. S5A) is consistent with the hypothesis that MMAP interacts with the and only detectable when bait proteins were overexpressed (Fig. MRN complex through MRE11. Conversely, MRE11 depletion 1 C and F) or the exposure time of immunoblotting is prolonged also strongly reduced MMAP protein levels in mitotic cells, but (Fig. 1D). Interestingly, the interactions are dramatically in- not in asynchronous cells (SI Appendix, Fig. S5 C and D). These creased in mitotic cells compared with asynchronous cells (Fig. 2 results are consistent with our immunoprecipitation experiments, C and D and SI Appendix, Fig. S5A), suggesting that MMAP and which demonstrated that MMAP and MRN form a stability- MRN specifically form a complex and interact with PLK1 and interdependent complex in mitosis. KIF2A in mitosis. We define this mitosis-specific MMAP–MRN In contrast, KIF2A and PLK1 did not show significant de- complex as the mMRN complex. crease, in either asynchronous or mitotic cells when MMAP was absent (Fig. 2 E and F and SI Appendix, Fig. S5B). These results The Protein Stability of MMAP and MRE11 Are Interdependent in imply that PLK1 and KIF2A may interact with the mMRN Mitotic Cells. The proper folding of one protein often requires complex relatively loosely in mitotic cells. interactions with its partners. Thus, the depletion of one subunit in a multisubunit complex usually leads to instability of the other The mMRN Complex Colocalizes with KIF2A on the Spindle. KIF2A components. This feature of stability interdependence has often and PLK1 localize to spindle MTs and the spindle pole during been used to verify whether proteins are components of the same mitosis (18). We examined whether the mMRN complex had a complex in vivo. An analysis of the protein levels showed that all similar localization during mitosis. Time-lapse imaging of living

proteins examined were stable when MMAP was disrupted in cells expressing GFP–MMAP or GFP–MRE11 showed that CELL BIOLOGY asynchronous HCT116 cells (Fig. 2E and SI Appendix, Fig. S5B). GFP–MMAP and GFP–MRE11 localized to spindles and

Xu et al. PNAS | vol. 115 | no. 43 | E10081 Downloaded by guest on September 27, 2021 −/− concentrated on spindle poles during mitosis (Fig. 2G). Although the amount of PLK1 at the spindle poles in MMAP cells or living-cell imaging obviously showed spindle localization of MRE11-depleted cells was reduced compared with that in con- GFP–MMAP and MRE11, the high background of these pro- trol cells (Fig. 3 H–J). These data suggest that the mMRN teins in cytosol and/or chromosome interfered with the visuali- complex facilitates the recruitment of PLK1 to spindle poles. zation of these proteins on spindles. To overcome this limitation, we performed indirect immunofluorescence with detergent- PLK1 Kinase Activity Is Required for the mMRN Complex Assembly based preextraction and ribonuclease treatment as described and Its Association with KIF2A. PLK1 has been shown to interact previously (21). These treatments not only strongly reduced both with KIF2A in a kinase activity-dependent manner (18). We signals of GFP–MMAP and GFP–MRE11 from the cytosol, but therefore investigated whether the formation of the PLK1– also the GFP–MRE11 signal on the chromosome (Fig. 2H). As a mMRN–KIF2A complex similarly depends on PLK1 kinase ac- result, immunofluorescence with two different anti-GFP anti- tivity. As reported, preincubating mitotic cells with BI2536, a bodies clearly showed that both GFP–MMAP and GFP– PLK1 kinase inhibitor, strongly reduced the levels of KIF2A in MRE11, but not GFP alone, colocalized with KIF2A on spin- the FLAG–PLK1 immunoprecipitates (Fig. 4A). Moreover, the dles (Fig. 2H). Moreover, we examined the localization of same inhibitor reduced the levels of MRE11 and KIF2A in endogenous MRE11 and NBS1 with immunofluorescence using the FLAG–MMAP immunoprecipitates (Fig. 4B), as well as the the same method of preextraction. MRE11 and NBS1 colo- level of MMAP in the MRE11 immunoprecipitates (Fig. 4C). calized on spindles in the wild-type HeLa cells (Fig. 2 I and J). In These data suggest that PLK1 kinase activity is essential for the addition, compared with MRE11, NBS1 was more concentrated mMRN complex assembly and its association with KIF2A. In at spindle poles, possibly reflecting dynamic assembly of the contrast, the PLK1 inhibitor had no significant effect on MMAP mMRN complex on spindle. Additionally, both proteins dis- – −/− and MRE11 levels in the FLAG PLK1 immunoprecipitates (Fig. appeared from spindle in NBS1 cells, indicating that these 4A) or on PLK1 levels in the FLAG–MMAP immunoprecipi- signals of NBS1 and MRE11 in wild-type cells were not due to tates (Fig. 4B), suggesting that the interactions of PLK1 with I J antibody cross-reaction (Fig. 2 and ). These data are consistent MMAP and MRE11 are independent of PLK1 kinase activity. with our biochemical data showing that MMAP and MRN as- Then we examined whether PLK1 kinase activity is also re- sociate during mitosis. quired for the spindle localization of these proteins. Consistent Additionally, we examined the distribution of LIG4, RAD51, with a previous report (18), KIF2A was observed on mitotic and XRCC4 during mitosis. Unlike MRE11, these proteins did spindles in both untreated and BI2536-treated cells (Fig. 2H), SI Appendix A B not localize to spindle ( , Fig. S6 and ), suggesting suggesting that the spindle localization of KIF2A is independent that not all DNA damage response proteins localize to spindle. of PLK1 activity. Because its interaction with mMRN complex depends on PLK1 kinase activity, our data imply that KIF2A mMRN Complex Is Required for the PLK1–KIF2A Interaction. To ex- localization to the spindle does not require its interaction with amine the direct interactions, we performed MBP pull-down as- mMRN complex. Interestingly, MMAP and MRE11 localized to says in vitro. FLAG-tagged MMAP, but not MRE11, was pulled the mitotic spindle in untreated cells but not in BI2536-treated down by MBP–KIF2A (Fig. 3A and SI Appendix,Fig.S7A and B), cells (Fig. 2H), suggesting that the spindle localization of these suggesting that KIF2A directly interacts with MMAP, but not MRE11. Additionally, MBP–MRE11, but not MBP, was able to two proteins depends on PLK1 kinase activity. Furthermore, pull down MMAP (Fig. 3B and SI Appendix,Fig.S7A), suggesting because the assembly of the mMRN complex and its interaction that MRE11 also has a direct interaction with MMAP. with KIF2A depend on PLK1 activity, we concluded that PLK1- The MBP pull-down assays implicate that MMAP may act as a mediated phosphorylation may recruit the mMRN complex to bridge that mediates the interaction between the MRN complex KIF2A, leading to their spindle localization. and KIF2A. Consistently, the level of KIF2A protein in −/− PLK1 Phosphorylates MMAP to Promote Its Interaction with KIF2A MRE11 immunoprecipitates from MMAP cells was strongly and MRE11. The findings that PLK1 kinase activity is required reduced compared with wild-type cells (Fig. 3C). In contrast, the −/− KIF2A level in the MMAP immunoprecipitates from NBS1 for the formation of the mMRN complex and its interaction with cells was comparable with that from wild-type cells (SI Appendix, KIF2A raised the possibility that PLK1 may directly phosphor- Fig. S9), consistent with the interaction of KIF2A with MMAP ylate MMAP, MRN, and KIF2A, leading to increased interac- being direct and independent on the MRN complex. tions between these proteins. To investigate this possibility, we We also analyzed the association between PLK1 and the other first examined whether any of these proteins become hyper- proteins in MMAP- and MRN-knockout cells using co-IP assays. phosphorylated during mitosis. We noticed that both MMAP The level of KIF2A was reduced in PLK1 immunoprecipitates and GFP-tagged MMAP from mitotic-cell extracts displayed −/− −/− from both MMAP and NBS1 cells compared with wild-type slower mobility on SDS/PAGE gels than their counterparts from B–D D cells (Fig. 3 D and E and SI Appendix, Fig. S8 A and B). These asynchronous cell extracts (Figs. 2 and 4 ), suggesting that results suggest that the mMRN complex bridges PLK1 and MMAP is posttranslationally modified during mitosis. Importantly, KIF2A. this mobility shift was suppressed in phosphatase-treated lysates, Interestingly, the level of MRN in the PLK1 immunoprecipi- but not in lysates treated simultaneously with both a phosphatase −/− tates from MMAP cells was indistinguishable from that of the and a phosphatase inhibitor (Fig. 4E), demonstrating that this control cells (Fig. 3D), suggesting that the interaction between shifted band represents a hyperphosphorylated form of MMAP. To PLK1 and MRN is direct and is not mediated by MMAP. Sim- determine whether MMAP was phosphorylated by PLK1, we ilarly, the level of MMAP in PLK1 immunoprecipitates from treated the mitotic cells with the PLK1 inhibitor BI2536 and found −/− NBS1 cells was comparable with that from the wild-type cells that the mobility shift of MMAP was abolished (Fig. 4F), indicating (Fig. 3E), indicating that the interaction between PLK1 and that the mitotic hyperphosphorylation of MMAP depends on MMAP is also direct and is not mediated by MRN. Together, PLK1 kinase activity in vivo. To examine whether PLK1 directly these data suggest a model wherein MMAP and MRN have in- phosphorylates MMAP, we expressed and purified recombinant dependent binding sites for PLK1 (Fig. 3F). MMAP and PLK1 from HEK293 cells (SI Appendix,Fig.S7A and We further examined the interdependence of the recruitment C), and performed an in vitro kinase assay. Consistent with the in of these proteins to spindle. MRE11 lost its spindle localization vivo data, the gel mobility of the recombinant MMAP was highly when MMAP was absent (Fig. 3G), demonstrating that the re- shifted in the presence of PLK1 and ATP (Fig. 4G); as in the in vivo cruitment of MRN to spindles depends on MMAP. Moreover, experiment (Fig. 4F), this mobility shift was inhibited by BI2536

E10082 | www.pnas.org/cgi/doi/10.1073/pnas.1806665115 Xu et al. Downloaded by guest on September 27, 2021 Input MBP-Pull down A Input MBP-Pull down B (40%) MBP MBP-KIF2A MBP: -- + + ------+ + + - + - + - Flag-MMAP MBP-MRE11: +++ + + + -+-+ - + Flag-MRE11 Flag-MMAP: PLK1+ATP: - + - + - + WB: Flag-MRE11 (light exposure) α-Flag Flag-MMAP Flag-MMAP-Pi WB: Flag-MMAP α-Flag (long exposure) Flag-MMAP-Pi MBP-KIF2A Flag-MMAP Coomassie Blue Staining MBP-MRE11-Pi MBP-MRE11 Fig. 3. mMRN complex is required for the PLK1– Coomassie KIF2A interaction. (A) In vitro MBP pull-down assays Blue Staining MBP showed that KIF2A directly interacted with MMAP, MBP but not MRE11. MBP–KIF2A was expressed and purified in E. coli.Flag–MMAP and MRE11 were expressed and C Input MRE11 IP D Input PLK1 IP E Input PLK1 IP F .,)$ purified from HEK293 cells. (B) In vitro MBP pull-down -/- -/- -/- -/- /- - -/- assays showed that MMAP directly interacted with AP AP T T AP AP BS1 BS1 M M W W T T N N T T T T M M MRE11 and their interaction was enhanced by PLK1 and M M M M W W 00$3 W W M M ATP. MBP–MRE11 was expressed and purified in E. coli. MRE11 KIF2A KIF2A 3/. Flag–MMAP and PLK1 were expressed and purified KIF2A MMAP – MRE11 051 from HEK293 cells. Pi, phosphorylated Flag MMAP and Cyclin B PLK1 MBP–MRE11. (C) Immunoblot showing that MMAP is MMAP required for the interaction between MRE11 and KIF2A. Cyclin B PLK1 MRE11 was immunoprecipitated from extracts of 3 × 107 wild-type or MMAP−/− HCT116 cells arrested in mi- Cyclin B tosis. (D and E) Immunoblot showing that the mMRN MRE11 Tubulin DAPI Merged PLK1 Tubulin DAPI Merged complex is required for the interaction between G H PLK1 and KIF2A. PLK1 was immunoprecipitated from − − − − WT WT extracts of 3 × 107 MMAP / (D), NBS1 / (E), and cor- responding wild-type mitotic cells. (F) Schematic repre- sentation of the assembly of the PLK1–mMRN–KIF2A P P - - complex. (G) Immunofluorescence showing that MMAP is required for the spindle localization of MRE11. For MMA MMAP +

+ WT WT complementation experiments, HeLa cells were trans- -/- -/- fected with the wild type or MMAP-6A mutant expressing plasmid for 48 h before fixation. (H and I)

6A MMAP 6A

MMAP Immunofluorescence (H) and quantification (I) showing that the absence of MMAP affected the localization of PLK1 to the spindle pole. As a sample on the top, a line I 120 J P<0.0001 across both spindle poles was set. The intensities of

100 P<0.0001 PLK1 in every pixel on the line were measured. The WT point with highest intensity was defined as spindle pole. 80 MMAP-/- The middle point of the line between two spindle poles MMAP-/-+WT 60 intensity -/- was defined as midzone. The density of the PLK1 signals MMAP +6A 1 intensity 1 1 40 from the pole to the midzone was determined in more PLK − − PLK than 30 wild-type or MMAP / mitotic HCT116 cells. The 20 data represent the mean values for each position, and 0 -10 0 10 20 30 40 50 60 the error bars represent the SEs. (J) A graph showing -10 0 10 20 30 40 50 60 Pole to midzone (pixel) that MRE11 depletion affected the localization of Pole to midzone (pixel) PLK1 to the spindle pole.

(Fig. 4G). Thus, both the in vitro and in vivo data demonstrate that replaces the negatively charged phospho group with a neutral MMAP is hyperphosphorylated by PLK1 during mitosis. residue, which is expected to disrupt phosphorylation-mediated To identify the PLK1-dependent phosphorylation sites in MMAP protein–protein interactions. In contrast, aspartate introduces a that mediate its interactions with the other proteins, we searched negatively charged residue that mimics the negative charge of the the phosphoproteomics database (https://www.phosphosite.org/), phosphate group and may retain the phosphorylation-dependent which identified multiple phosphorylation sites throughout MMAP. interactions. Compared with wild-type MMAP, the MMAP-6A Notably, the long isoform-specific C-terminal region, which is re- mutant coimmunoprecipitated with a substantially lower amount quired for the association with MRN, KIF2A, and PLK1 (Fig. 1F), of MRE11 and a comparable amount of KIF2A (Fig. 4I), contains six phosphorylation sites (S680, S686, S688, S690, S695, whereas the phosphomimic version of MMAP (6D) coimmuno- and S696; Fig. 4H). These sites form a phosphorylation cluster at precipitated with comparable amounts of MRE11 and KIF2A in the flank of the SH3 motif. Phosphorylation at three sites (S686 or the same assay (Fig. 4I). These results demonstrate that PLK1- S688, S688 or S690, and S695 or S696) has been shown to depend mediated phosphorylation of the C terminus of MMAP is spe- on PLK1 kinase activity in vivo (20). Using purified MMAP and cifically required for its interaction with MRE11, but not KIF2A; PLK1, we performed in vitro kinase assays followed by mass spec- moreover, the interaction between MMAP and KIF2A may be trometry and found that two sites (S686 and S695) in this cluster mediated by other phosphorylation sites in MMAP by PLK1. were phosphorylated. Thus, all of these results are in agreement Consistently, the interaction of MMAP-6D with KIF2A was that this cluster is phosphorylated by PLK1. impaired by PLK1 inhibitor (Fig. 4J). To determine the importance of this MMAP phosphorylation Moreover, the wild type, but not MMAP-6A mutant, was able to cluster in cells, we generated two phosphomutant versions of recruit MRE11 and PLK1 to spindle (Fig. 3 G–I), although the

MMAP, 6A and 6D, in which all six phosphorylation sites were spindle localization of MMAP-6A mutant is normal (SI Appendix, CELL BIOLOGY replaced with alanine and aspartic acid, respectively. Alanine Fig. S10), demonstrating that PLK1-mediated phosphorylation of

Xu et al. PNAS | vol. 115 | no. 43 | E10083 Downloaded by guest on September 27, 2021 A Input Flag-IP B Input Flag-IP Input MRE11-IP - + - + BI2536 C - + - + BI2536 - + - + BI2536 KIF2A MRE11 MRE11 KIF2A MMAP MMAP PLK1 P-MRE11 MRE11 Flag-MMAP Flag-PLK1

D E Mitoc cells F CON GFP-MMAP Mitoc cells AS M AS M CIP - + + GFP-MMAP PPi --+ - + BI2536 * * * * H-MMAP H-MMAP H-MMAP MMAP MMAP MMAP Cyclin B β-Acn β-Acn β-Acn

GFlag-MMAP + + + + K Flag-MRE11 + + + + Flag-PLK1 + + + - Flag-PLK1 ATP -- + + - + + + BI2536 -- - + ATP --+ + BI2536 ---+ WB: MMAP Flag-MMAP MMAP(endogenous) WB: MRE11 Flag-MRE11

WB: Flag Flag-MMAP Flag-PLK1 WB: Flag Flag-MRE11 Flag-PLK1

L MRE11 H Pi MMAP binding MMAP WD40 CC SH3 Phosphoesterasep DBD GAR DBD 680 698 NBS1 RAD50

683 704 SDVFRDSFSHSPGAVSSLK GVDFESSEDDDDDPFMNTSSLR

I WT 6A 6D J Flag-IP M

MRE11 - BI2536 WT

+ 688AA -IP P IP KIF2A - KIF2A MMAP Flag

Flag Flag-MMAP_6D Flag-MMAP Flag-I Flag-MRE11 Input KIF2A Input MRE11 Input MMAP

Fig. 4. PLK1-dependent phosphorylation of MMAP and MRE11 governs the assembly of the PLK1–mMRN–KIF2A complex. (A and B) Immunoblotting shows that the assembly of the PLK1–mMRN–KIF2A complex is dependent on PLK1 kinase activity. Extracts from asynchronous HEK293 cells expressing FLAG-tagged PLK1 (A) and MMAP (B) were used for the immunoprecipitations. BI2536 was added to the medium at a final concentration of 1 μM 1.5 h before harvesting. The shifted MRE11 band is indicated as p-MRE11. (C) Immunoprecipitations were performed using extracts of nocodazole-arrested HeLa cells treated with or without 1 μM BI2536. (D) Immunoblot showing the shift of the MMAP band in the mitotic cells. HeLa cells were transfected with or without GFP–MMAP. Mitotic cells were arrested with nocodazole. AS, asynchronous cells; M, mitotic cells. The asterisk marks a cross-reactive polypeptide. β-Actin was included as a loading control. (E) Immunoblot showing that MMAP was phosphorylated in mitotic HeLa cells. Extracts of nocodazole-arrested mitotic cells were treated with phosphatase(CIP)in the presence or absence of phosphatase inhibitors (PPi). (F) Immunoblot showing that MMAP phosphorylation was dependent on PLK1 kinase activity. Nocodazole-arrested mitotic HeLa cells were treated with or without 1 μM BI2536 1.5 h before harvest. (G) PLK1 directly phosphorylates MMAP in vitro. Purified FLAG–MMAP and FLAG–PLK1 were incubated with or without ATP and BI2536. The products were examined by immunoblotting with anti-MMAP (Top)oranti- FLAG (Bottom) antibodies. Endogenous MMAP was copurified with FLAG–MMAP, implying that MMAP may form a homooligomer. (H) Schematic representation of the C-terminal phosphorylation cluster of MMAP. The phosphorylation sites are marked by red letters. (I) Immunoblot showing the FLAG pull-down assay using the MMAP variants. In the 6A and 6D mutants, the six sites of the C-terminal phosphorylation cluster are replaced with alanine and aspartic acid, respectively. (J) Immunoblot showing the IP of FLAG–MMAP-6D with or without PLK1 inhibitor. (K) PLK1 directly phosphorylates MRE11 in vitro. Purified FLAG–MRE11 and FLAG– PLK1 was incubated with or without ATP and BI2536. The products were examined by immunoblotting with anti-MRE11 or anti-FLAG antibodies. (L)Schematic representation of the C-terminal phosphorylation sites in MRE11. The phosphorylation sites are marked by red letters. (M) Immunoblot showing the FLAG pull- down assay using the MRE11 variants.

the C terminus of MMAP and subsequent interaction with immunoprecipitates (Fig. 4A). Interestingly, the amount of the MRE11 are required for the normal localization of MRN and shifted form of MRE11 was strongly reduced when the cells were PLK1 to spindle. treated with the PLK1 kinase inhibitor BI2536 (Fig. 4A), indi- cating that this form represents hyperphosphorylated MRE11. PLK1 Phosphorylates MRE11 to Promote Its Interaction with MMAP. Consistent with this notion, an in vitro kinase assay revealed that We investigated whether other proteins are phosphorylated by recombinant MRE11 incubated with PLK1 and ATP displayed PLK1 to facilitate the interactions among PLK1, MMAP, MRN, slower mobility via SDS/PAGE (Fig. 4K and SI Appendix,Fig.S7 and KIF2A. We noticed that a small fraction of MRE11 exhibited B and C). Thus, both the in vitro and in vivo data suggest that slower gel mobility (p-MRE11), which is enriched in FLAG–PLK1 MRE11 is hyperphosphorylated by PLK1.

E10084 | www.pnas.org/cgi/doi/10.1073/pnas.1806665115 Xu et al. Downloaded by guest on September 27, 2021 Phosphoproteomics database (https://www.phosphosite.org/) defects that resemble KIF2A-depleted cells. First, as with −/− searches revealed that MRE11 contains multiple phosphory- KIF2A-deficient cells, MMAP cells display increased levels of lation sites. Two of these, S688 and S689, are located in the MTs at the spindle in mitotic cells (Fig. 5 A and B), but not in MMAP-binding region (Fig. 4L) and have been reported to interphase cells (SI Appendix, Fig. S11 A and B). The difference undergo PLK1-mediated phosphorylation in vivo (20). In became more significant after cold treatment (SI Appendix, Fig. −/− agreement with previous findings, we identified one of them in S12 A and B) as reported (15). MMAP cells also display a recombinant MRE11 that was phosphorylated by PLK1 in vitro larger distance between poles than wild-type cells (SI Appendix, using mass spectrometry (Fig. 4K and SI Appendix,Fig.S7B Fig. S12 A and C), indicating that both MMAP and KIF2A are −/− and C). To examine whether these phosphorylation sites are essential for facilitating MT turnover. Second, MMAP cells or important for MRE11 function in vivo, we replaced both sites MMAP-knockdown cells resemble KIF2A-deficient cells in with alanine and found that the mutant protein (688AA) dis- exhibiting a higher frequency of unaligned chromosomes at played a dramatically reduced association with MMAP in co-IP metaphase than do wild-type cells (SI Appendix, Fig. S12 A, D, assays (Fig. 4M). These results demonstrate that PLK1-mediated and E), indicating that these two proteins are also essential for phosphorylation of MRE11 at S688 and S689 is essential for the proper chromosome alignment in metaphase. Third, MMAP- association of MRE11 with MMAP. deficient cells resemble KIF2A-depleted cells in exhibiting a Moreover, MBP–MRE11 pulled down more MMAP after the prolonged metaphase and a higher mitotic index (SI Appendix, incubation with PLK1 and ATP in vitro (Fig. 3B), consistent with Fig. S13 A–D), suggesting that both MMAP and KIF2A are re- PLK1-mediated phosphorylation of MMAP and MRE11 en- quired for efficient chromosome congression to the metaphase hancing their interaction. plate and for the timely onset of anaphase. Finally, a fluores- cence loss in photobleaching (FLIP) experiment showed that the MMAP Is Required for Normal Spindle Dynamics and Chromosome rate of MT turnover on metaphase spindles was slower in the Alignment. KIF2A is a MT depolymerase that is required for MMAP-depleted cells than that in the control cells (Fig. 5C). proper spindle dynamics. KIF2A-depleted cells display increased Additionally, MMAP-deficient cells showed higher frequency of levels of MTs at the spindles, a higher frequency of unaligned mitotic catastrophe (SI Appendix, Fig. S13E), which might lead chromosomes, and delayed metaphase (15, 18). We investigated to slower proliferation, while apoptosis rate is normal in the −/− whether the mMRN complex has mitotic functions similar to MMAP cells (SI Appendix, Fig. S13 F and G). Together, these −/− those of KIF2A. Indeed, MMAP cells exhibit several mitotic data demonstrate that MMAP-deficient cells have similar defects

A α-Tubulin KIF2A DAPI Merged B P<0.0001 P<0.0001 WT

MMAP-/-_1 Relave Intensity 2 1 1 -/-_ 2 - - - - - MMAP -

2 / WT -/- -/ -/- - WT MMAP MMAP MMAP MMAP KIF2A Tubulin

C D P<0.0001 ns ns P<0.0001 P<0.0001

P<0.0001 Relave Intensity Remained on Spindle S S GFP-α-Tubulin Relave Intensity 6D 6D 6A 6A WT WT Vec 0 20 40 60 80 100 120 140 160 Vec MMAP-/-+ MMAP-/-+ HCT116 Times(s) HCT116 KIF2A Tubulin

Fig. 5. MMAP is required for spindle dynamics regulation. (A and B) Immunofluorescence (A) showing that MMAP is required for the normal function of the spindle. (Scale bar, 5 μm.) The relative intensity of α-tubulin and KIF2A on the metaphase spindle (n ≥ 30 cells for each sample) was quantified and plotted in B. The error bars show the SD. (C) A FLIP assay showing that MMAP promotes MT turnover. HeLa cells stably expressing GFP–α-tubulin were transfected with lenti-shRNA viruses. GFP fluorescence intensity was acquired every 0.76 s while a photobleaching laser was focused to a diffraction-limited spot in the cy- toplasm away from the spindle. Sixteen half-spindles from 16 metaphase cells were quantified, and fluorescence signals for each half-spindle were nor- malized to their intensity at 0 s. The means and SEs are shown in the plots. P value is from two-tailed t test. (D) A graph showing the intensity of the MTs and − − KIF2A on the spindle in the complementation assay. MMAP / HCT116 cells were transfected with wild-type MMAP, the MMAP short isoform (S), or the 6A or 6D MMAP mutants 48 h before immunofluorescence. Vec, empty vector. Thirty metaphase cells were quantified in each sample. The data represent the mean CELL BIOLOGY values, and the error bars represent SD. The typical images are shown in SI Appendix, Fig. S14.

Xu et al. PNAS | vol. 115 | no. 43 | E10085 Downloaded by guest on September 27, 2021 as those described previously in KIF2A-depleted cells (15), phomimic version (6D) of MMAP retained the ability to rescue suggesting that these two proteins may act in the same pathway this defect (Fig. 5D and SI Appendix,Fig.S14). These data suggest to promote spindle dynamics. Because the level and spindle lo- that PLK1-mediated phosphorylation at the C-terminal region and −/− calization of KIF2A in MMAP cells were indistinguishable the subsequent interaction with MRE11 are important for the from those in wild-type cells (Fig. 5 A and B), we conclude that function of MMAP in mitotic spindle dynamics. MMAP may affect the activity of KIF2A. −/− To verify that the defective mitosis observed in MMAP cells MRN Regulates Spindle Dynamics Together with MMAP. We next is due to the inactivation of MMAP and not to off-target effects of asked whether the MRN complex has a similar function as CRISPR, we performed a complementation experiment by reex- MMAP in regulating spindle dynamics. Depletion of MRE11 by pressing MMAP in these cells. Reintroducing the long form of two different siRNA oligos resulted in similar phenotypes as ob- MMAP, but not the short form, rescued the MT-stacking phe- served in the MMAP-null cells, including significantly increased −/− notype of the MMAP cells (Fig. 5D and SI Appendix,Fig.S14), levels of MTs (Fig. 6 A and B and SI Appendix,Fig.S15A and B), a suggesting that the SH3 domain-containing C-terminal region of larger pole-to-pole distance (SI Appendix,Fig.S15A and C), and an MMAP is required to suppress excessive MT assembly. Notably, elevated frequency of unaligned chromosomes (SI Appendix,Fig. the phosphorylation-deficient mutant (6A) was largely defective in S15 A and D). These results suggest that both MRN and MMAP −/− rescuing the stacked MTs in MMAP cells, whereas the phos- are required for normal spindle dynamics. Complementation

A B P<0.0001 α-Tubulin KIF2A DAPI Merged P<0.0001

siCON

siMRE11_1 Relave Intensity 2 siMRE11_2 siCON siCON siMRE11-1 siMRE11-2 siMRE11-1 siMRE11- KIF2A Tubulin

C ns D ns P<0.0001 ns E P<0.0001 P<0.0001 P<0.0001 Intensity Intensity Relave Relave Intensity Relave 2 -2 -1 - -1 1h 12h 1h 12h - /- -/ WT -/- - -/- WT

CON Mirin CON Mirin NBS1 NBS1 NBS1 NBS1 WT WT Vec Vec KIF2A Tubulin siCON

siCON KIF2A Tubulin 688AA 688AA siMRE11 siMRE11 KIF2A Tubulin

F ns G P<0.0001 Interphase Mitosis P<0.0001 Active .,)$ Inacve Inactive 3 .,)$ .,)$ 3 3 00$3 00$3 00$3 3/. 3 3 Relave Intensity 3 3/. 3/. 3/. 051 051 3 051 shCON shCON shCON shCON shMMAP shMMAP shMMAP shMMAP HeLa NBS1-/- HeLa NBS1-/- KIF2A Tubulin

Fig. 6. MRN complex is in the same pathway with MMAP for spindle dynamics regulation. (A and B) Immunofluorescence (A) showing that MRE11 is required for the normal function of the spindle. (Scale bar, 5 μm.) The relative intensity of α-tubulin and KIF2A on the metaphase spindle was quantified and plotted in B.The errorbarsshowSD.(C) A graph showing the intensity of the MTs and KIF2A in the complementation assay. MRE11-depleted HeLa cells were transfected with wild- type MRE11 or the 688AA mutant 48 h before immunofluorescence. More than 30 metaphase cells were quantified in each sample. The data represent the mean values, and the error bars represent SD. The typical images are shown in SI Appendix,Fig.S16A.(D) A graph showing the relative intensity of the MTs and KIF2A on the spindle in metaphase HeLa cells treated with or without mirin (25 μM) at the indicated times. More than 30 metaphase cells were quantified in each sample. ns, P > 0.05. The data represent the mean values, and the error bars represent the SEs. The typical images are shown in SI Appendix,Fig.S16C.(E) A graph showing the − − relative intensity of the MTs and KIF2A on the spindle in the wild-type and NBS1 / metaphase HeLa cells. More than 30 metaphase cells were quantified in each sample. The data represent the mean values, and the error bars represent SD. The typical images are shown in SI Appendix,Fig.S16D.(F) A graph showing the relative intensity of the MTs and KIF2A in wild-type or NBS1−/− metaphase HeLa cells transfected with control or MMAP lenti-shRNA viruses. ns, P > 0.05. The typical images are shown in SI Appendix,Fig.S16E.(G) A model showing the function of mMRN complex in mitotic signaling cascade. P, phosphorylation.

E10086 | www.pnas.org/cgi/doi/10.1073/pnas.1806665115 Xu et al. Downloaded by guest on September 27, 2021 experiments showed that, whereas wild-type MRE11 rescued the of the major pathways for spindle assembly in mammalian cells MT-stacking phenotype of the MRE11-depleted cells, the MRE11 (10, 11). This function is dependent on the nuclease activity of phosphorylation mutant (688AA) was largely deficient in rescuing MRE11 as it was inhibited by mirin (12). Here, we discovered a this defect (Fig. 6C and SI Appendix,Fig.S16A). These results distinct function of the MRN complex together with its partner, suggest that the PLK1-mediated phosphorylation of MRE11 at MMAP, in spindle dynamics. First, it plays a role in spindle dy- S688 and S689 and the subsequent interactions between hyper- namics, but not spindle assembly, through regulating KIF2A ac- phosphorylated MRE11 and MMAP are necessary for its function tivity. Second, it acts on spindle around the pole, but not around in regulating spindle dynamics. Additionally, both wild-type MRE11 kinetochores and chromosome. Third, most importantly, it is not and 688AA mutant rescued the CHK2 phosphorylation of the dependent on MRE11 nuclease activity. Together, these data MRE11-depleted cells after DNA damage (SI Appendix,Fig.S16B), suggest that MRN may act at different phases of spindle dynamics: suggesting that the PLK1-mediated phosphorylation of MRE11 at spindle assembly (12) and turnover (this study). S688 and S689 is dispensable for its function in the ATM activation. Increasing evidence shows that some DNA damage response To determine whether the nuclease activity of MRE11 is re- proteins also play a role in mitotic process (12, 22, 23). An in- quired to facilitate spindle dynamics, we treated the cells with triguing question is why the regulation of spindle shares these mirin, an inhibitor of MRE11 nuclease activity, before fixing the proteins with DNA damage response. One possibility is that cells cells for immunofluorescence studies. The MT signals in the cells can coordinate these two processes during mitosis in this way. after a 1- or 12-h mirin treatment were comparable to those of MRN plays a key role in the ATM-dependent phosphorylation the untreated cells (Fig. 6D and SI Appendix, Fig. S16C), sug- signaling cascade in DNA damage response pathway. Here, we gesting that MRE11 nuclease activity is largely dispensable for showed that it also plays a role in a PLK1-dependent phos- the regulation of spindle dynamics. phorylation signaling cascade between PLK1–KIF2A during To examine whether the other components of the MRN mitosis. Integrating the signals of these two pathways through the complex play a role in regulating spindle dynamics, we generated MRN complex, cells might regulate its mitotic progression based −/− NBS1 HeLa cells by CRISPR-mediated gene targeting (SI on the status of genome integrity. Consistent with this assump- Appendix, Fig. S8 A and B). We found that these cells displayed tion, the presence of a Chk1 and BRCA1-dependent mitotic exit an elevated level of MTs (∼1.4-fold) compared with wild-type DNA damage checkpoint in mammalian cells has been reported cells (Fig. 6E and SI Appendix, Fig. S16D). These results suggest (24). It remains to be tested in the future whether the mMRN that the entire MRN complex participates in regulating spindle complex is a player of this kind of checkpoint. dynamics. We performed epistasis analysis to determine whether the Materials and Methods MRN complex and MMAP work in the same pathway to pro- Cell Culture and Transfection. HeLa cells were cultured in DMEM containing mote MT depolymerization. Depletion of MMAP using a spe- 10% FBS (Invitrogen). HCT116 cells were cultured in RPMI 1640 medium with cific shRNA led to an increased level of MTs (∼1.6-fold) in the 10% FBS (Invitrogen). HEK293 suspension cells were cultured in Freestyle wild-type background compared with control cells treated with a medium (Invitrogen) supplemented with 1% Gibco FBS and 1% glutamine in an incubator with shaking at 130 rpm. nontargeted shRNA (Fig. 6F and SI Appendix, Fig. S16E). This For synchronization, the cells were cultured in medium with 2.5 mM increase is comparable to that observed in MMAP-knockout thymidine for 16 h and released into fresh medium for 8 h. The cells were then cells, providing further evidence that MMAP is required for treated with a second dose of 2.5 mM thymidine for 16 h and released into spindle dynamics. MMAP depletion in the NBS1-null cells fresh medium. After 8 h, 100 ng/mL nocodazole was added for 12 h to allow resulted in an increased level (∼1.6-fold) of MTs that was in- the cells to accumulate at M phase. distinguishable from that seen in MMAP-depleted wild-type cells HEK293 and 293T cells were transfected with polyethylenimine (PEI). HeLa (∼1.6-fold; Fig. 6F and SI Appendix, Fig. S16E). These results and HCT116 cells were transfected with Fugene HD (Promega). The siRNAs suggest that MRN and MMAP work in the same pathway to targeting MRE11, 5′-GAUGCCAUUGAGGAAUAAG-3′ (#1) and 5′-GCUAAU- regulate spindle dynamics turnover, consistent with our bio- GACUCUGAUGAUA-3′ (#2), were transfected using RNAi MAX (Invitrogen). chemical data showing that MRN and MMAP form the mMRN To produce the MMAP shRNA (CCGGCACAGTGGAGAGGTCAAGTTTCTCGA- GAAACTTGACCTCTCCACTGTGTTTTTTG), the lentiviral plasmids were cotrans- complex to link PLK1 and KIF2A during mitosis. fected into 293T cells using PEI. After 4 d, the supernatants containing the packaged lentivirus were harvested and stored at −80 °C until further use. Discussion Proper spindle dynamics provide an essential driving force for Immunoprecipitation and Protein Purification. The immunoprecipitation of chromosome congression and segregation during mitosis. In this the complex was performed as described previously (25). study, we describe a mitosis-specific complex, mMRN, which re- To purify the recombinant FLAG–MMAP, FLAG–MRE11, and FLAG– cruits PLK1 to KIF2A and regulates spindle dynamics (Fig. 6G). PLK1 proteins, 100 μg of pDEST26–FLAG–cDNA plasmids were transfected Specifically, mMRN acts in the mitotic signaling cascade between into 100 mL of HEK293 suspension cells using PEI. The cells were harvested PLK1 and KIF2A (Fig. 6G). In interphase cells, PLK1 protein after 4 d and lysed in 3.5 mL of lysis buffer (20 mM Tris·HCl, pH 7.5, 500 mM expression is kept low, as are the levels of the mMRN complex; NaCl, 10% glycerol, 0.5% Nonidet P-40, 10 mM NaF, 1 mM Na3VO4,1mM G PMSF, 1 mM DTT, 1 μg/mL aprotinin, and 1 μg/mL leupeptin). The lysate was thus, KIF2A remains inactive (Fig. 6 ). When cells enter mitosis, supplemented with 2 mL of 20 mM Tris·HCl buffer (pH 7.5) and ultra- PLK1 becomes highly expressed and activated, which binds and centrifuged at 440,000 × g for 15 min. The supernatant was filtered with a phosphorylates the C termini of MMAP and MRE11. This 0.45-μm membrane (GE Healthcare) and incubated with 50 μL of anti-FLAG phosphorylation increases the protein–protein interactions between M2 agarose beads (Sigma) at 4 °C for 3–4 h. The beads were washed three MMAP, MRN, and KIF2A, leading to mMRN complex assembly times with wash buffer (50 mM Tris·HCl, pH 7.5, 500 mM NaCl, 10% glycerol, μ and its interaction with KIF2A (PLK1-dependent phosphorylation 0.5% Nonidet P-40, 10 mM NaF, 1 mM Na3VO4, 1 mM PMSF, 1 mM DTT, 1 g/mL of MMAP at other unknown sites may enhance its interaction with aprotinin, and 1 μg/mL leupeptin). The recombinant proteins were eluted KIF2A). The assembled PLK1–mMRN–KIF2A complex enables with 150 μL of elution buffer (25 mM Tris·HCl, pH 7.5, 100 mM NaCl, and μ × PLK1 to phosphorylate KIF2A, which activates the MT depoly- 10% glycerol) containing 400 g/mL 3 FLAG peptide. merase activity of KIF2A (18) and induces mitotic spindle dynamics MBP Pull-Down Assay. For in vitro MBP pulldown assay, MBP-tagged MRE11 or and chromosome movement. KIF2A were expressed in Escherichia coli. Cells were harvested and resus- Notably,MRNhasalsobeenreportedtofunctioninspindle pended in lysis buffer (20 mM Tris·HCl, pH 7.0, 300 mM NaCl, 1% Triton X- assembly during mitosis (12). It achieved its function by 100, PMSF and DTT). After sonication, the extract was centrifuged at 35,000 × g recruiting or stabilizing RCC1 chromosome association and for 30 min at 4 °C. The supernatant was collected and incubated with am- CELL BIOLOGY subsequent establishment of a RanGTP gradient, which is one ylose resins for 2 h at 4 °C. After washing the beads three times with

Xu et al. PNAS | vol. 115 | no. 43 | E10087 Downloaded by guest on September 27, 2021 washing buffer (20 mM Tris·HCl, 500 mM NaCl, 0.1% Triton X-100, 1 mM Immunofluorescence and Imaging. For staining MRE11, NBS1, and GFP-fused DTT), we washed the beads once with low-salt wash buffer (20 mM Tris·HCl, MRE11 or MMAP, a modified immunofluorescence was performed as de- 100 mM NaCl, 0.1% Triton X-100, 1 mM DTT) and balanced the beads with scribed previously (21). Briefly, HeLa or HCT116 cells were cultured on poly-lysine–

kinase buffer (20 mM Hepes, pH 7.8, 10 mM MgCl2, 15 mM KCl, 1 mM EGTA, coated coverslips at least 24 h before the experiments. The cells were washed 10 mM DTT). The protein-bound beads were incubated with the purified with PBS and then preextracted 10 min at 4 °C with CSK buffer (20 mM Hepes, – – FLAG MMAP with or without FLAG PLK1 and ATP for 30 min at 30 °C and pH 7.4, 100 mM NaCl, 300 mM sucrose, and 3 mM MgCl2) contacting 0.5% Triton then for 2.5 h at 4 °C (for MBP–MRE11), or with the purified FLAG– X-100. After preextraction, the cells were washed three times with PBST (PBS MRE11 and FLAG–MMAP for 2.5 h at 4 °C (for MBP–KIF2A). After washing containing 0.1% Tween 20) and fixed with 3% paraformaldehyde (PFA) for with low-salt wash buffer (20 mM Tris·HCl, pH 7.0, 100 mM NaCl, 0.1% Triton 10 min at room temperature. Then cells were washed three times with PBST and X-100, 1 mM DTT), the proteins were eluted with sample buffer (63 mM incubated for 10 min with CSK buffer containing 1% RNase A. For staining Tris·HCl, pH 6.8, 10% glycerol, 2% SDS, 0.0025% bromophenol blue) and α-tubulin, HeLa or HCT116 cells were directly fixed with 3% PFA for 10 min at analyzed with SDS/PAGE and Western blotting. room temperature and then were extracted with CSK buffer containing 0.5% To detect the interaction of MBP–MRE11 and its truncated mutant with Triton X-100. After washing four to five times with PBST, the cells were blocked MMAP, 30 μg of pDEST26–MBP–MRE11 and its truncated plasmids were with 5% BSA (Sigma) in PBS for 15 min. The primary antibodies were diluted in transfected into 30 mL of HEK293 suspension cells using PEI. The cells were PBS containing 1% BSA and incubated with the cells for 90 min. After washing, harvested after 4 d and lysed in 3 mL of lysis buffer (25 mM Tris·HCl, pH 7.5, secondary antibodies diluted in PBS containing 1% BSA were added to the cells 150 mM NaCl, 0.5% Nonidet P-40, 5 mM MgCl2, 0.25 M sucrose, 10 mM NaF, for 30 min. The cells were washed three times and mounted with ProLong Gold μ μ 1mMNa3VO4, 1 mM PMSF, 1 mM DTT, 1 g/mL aprotinin, and 1 g/mL antifade reagent with DAPI (Invitrogen). The images were acquired by the API leupeptin). After being ultracentrifuged at 440,000 × g for 15 min at 4 °C, DeltaVision microscope (GE Healthcare) with a 100×/1.4 oil objective. Images the supernatant was incubated with amylose resins at 4 °C for 4 h. The beads were acquired on the N-SIM imaging system (Nikon) equipped with a 100×/ · were washed four times with wash buffer (25 mM Tris HCl, pH 7.5, 150 mM 1.49 N.A. oil-immersion objective (Nikon). Images stacks with 0.12-μm interval NaCl, 5 mM MgCl2, 10% glycerol, 0.1% Nonidet P-40, 1 mM PMSF, 1 mM were acquired and computationally reconstructed to generate superresolution μ DTT) and eluted with 50 L of PBS containing 20 mg/mL maltose. optical serial sections with twofold extended resolution in both xy and z di- rections/in all axes. The reconstructed images were further processed for Generation of MMAP-Knockout Cells. MMAP-deficient HCT116 cells were maximum-intensity projections and/or 3D-rendering with NIS-Elements AR generated using CRISPR. Briefly, two guide sequences, ACACAGCCCTG- 4.20.00 (Nikon). The antibodies are listed in SI Appendix,TableS1. GGGAAGGAT and GACCCAGGATGGCCTGAGGC, targeting two different sites Immunofluorescence intensity and pole-to-pole distance were quantified us- of the human MMAP gene were inserted into the pX330 vector (26). The guide ing ImageJ. The proteins that were quantified in different samples were stained in sequence-containing pX330 plasmids were transfected into HCT116 cells. Sin- parallel, and the images were acquired using the same exposure time. In each – gle colonies were picked after 8 10 d of incubation. The genomic fragments experiment, the control group was standardized to 1 by dividing by the mean of the MMAP gene were amplified by PCR using the following primers: value, and the other groups were all divided by the mean value of the control. CTTGCCTGGACCGATGGGAATCAAG and GGGAAAATGGAGACATCCTGAGCAG; Live-cell imaging was performed with an UltraView VoX spinning-disk and CCAGGTAAAGGCAGACATCAACAC and CTGGTAAAGCATACGGAGTCATGTC. confocal microscope (PerkinElmer) with 60×/1.4 N.A. oil objective lens. The products were digested with BseLI. Colonies containing the expected PCR Cells were tracked every 5 min at 37 °C with 5% CO . fragments were then sequenced and examined by Western blotting. 2 NBS1-knockout HeLa cell lines were generated using the CRISPR/Cas9 Statistics. Statistics were performed by two-tailed t test or one-way ANOVA test. genome-editing system with two CRISPR guide sequences: NBS1_gR1: The data were normally distributed, and the variance between groups being ACTGGCGTTGAGTACGTTGT and NBS1_gR2: GTATGGTACCTTTGTTAATG. statistically compared was similar. All experiments were performed at least twice. Cell Survival Assay. Cell survival curves for HCT116 cells treated with IR and ACKNOWLEDGMENTS. We thank Weidong Wang, Yixian Zheng, and Chuanmao CPT were generated as described (27). An appropriate number of cells was Zhang for their advice and revisions to the manuscript. We thank the mass plated in six-well plates, cultured for 24 h, and exposed to the appropriate spectrometry facility of the National Center for Protein Sciences at Peking dose of X-ray irradiation. For the CPT treatments, the cells were cultured for University for assistance with the identification of the proteins and phosphoryla- 24 h, and then the indicated dose of CPT was added to the medium. After an tion sites, and the Core Facility of Life Sciences, Peking University, for assistance additional 9–14 d of incubation, the colonies were stained with methylene with imaging. This work was supported in part by the National Natural Science blue and counted. Foundation of China (Grants 31870807, 81672773, and 31661143040).

1. Williams GJ, Lees-Miller SP, Tainer JA (2010) Mre11-Rad50-Nbs1 conformations and 15. Jang CY, et al. (2008) DDA3 recruits microtubule depolymerase Kif2a to spindle poles and the control of sensing, signaling, and effector responses at DNA double-strand controls spindle dynamics and mitotic chromosome movement. J Cell Biol 181:255–267. breaks. DNA Repair (Amst) 9:1299–1306. 16. Zhu C, et al. (2005) Functional analysis of human microtubule-based motor proteins, 2. Stracker TH, Petrini JH (2011) The MRE11 complex: Starting from the ends. Nat Rev the kinesins and dyneins, in mitosis/cytokinesis using RNA interference. Mol Biol Cell Mol Cell Biol 12:90–103. 16:3187–3199. 3. Varon R, et al. (1998) , a novel DNA double-strand break repair protein, is 17. Manning AL, et al. (2007) The kinesin-13 proteins Kif2a, Kif2b, and Kif2c/MCAK have mutated in Nijmegen breakage syndrome. Cell 93:467–476. distinct roles during mitosis in human cells. Mol Biol Cell 18:2970–2979. 4. Stewart GS, et al. (1999) The DNA double-strand break repair gene hMRE11 is mu- 18. Jang CY, Coppinger JA, Seki A, Yates JR, 3rd, Fang G (2009) Plk1 and Aurora A regulate tated in individuals with an ataxia-telangiectasia-like disorder. Cell 99:577–587. the depolymerase activity and the cellular localization of Kif2a. JCellSci122:1334–1341. 5. Waltes R, et al. (2009) Human RAD50 deficiency in a Nijmegen breakage syndrome- 19. Uehara R, et al. (2013) Aurora B and Kif2A control microtubule length for assembly of like disorder. Am J Hum Genet 84:605–616. a functional central spindle during anaphase. J Cell Biol 202:623–636. 6. Dzikiewicz-Krawczyk A (2008) The importance of making ends meet: Mutations in 20. Kettenbach AN, et al. (2011) Quantitative phosphoproteomics identifies substrates and altered expression of proteins of the MRN complex and cancer. Mutat Res and functional modules of Aurora and Polo-like kinase activities in mitotic cells. Sci 659:262–273. Signal 4:rs5. 7. Wang Z, et al. (2004) Three classes of genes mutated in colorectal cancers with chro- 21. Britton S, Coates J, Jackson SP (2013) A new method for high-resolution imaging of Ku mosomal instability. Cancer Res 64:2998–3001. foci to decipher mechanisms of DNA double-strand break repair. JCellBiol202:579–595. 8. Compton DA (2000) Spindle assembly in animal cells. Annu Rev Biochem 69:95–114. 22. Yang C, et al. (2011) Aurora-B mediated ATM serine 1403 phosphorylation is required 9. Gadde S, Heald R (2004) Mechanisms and molecules of the mitotic spindle. Curr Biol for mitotic ATM activation and the spindle checkpoint. Mol Cell 44:597–608. 14:R797–R805. 23. Joukov V, et al. (2006) The BRCA1/BARD1 heterodimer modulates ran-dependent 10. Li HY, Wirtz D, Zheng Y (2003) A mechanism of coupling RCC1 mobility to RanGTP mitotic spindle assembly. Cell 127:539–552. production on the chromatin in vivo. J Cell Biol 160:635–644. 24. Huang X, Tran T, Zhang L, Hatcher R, Zhang P (2005) DNA damage-induced mitotic 11. Wilde A, Zheng Y (1999) Stimulation of microtubule aster formation and spindle catastrophe is mediated by the Chk1-dependent mitotic exit DNA damage check- assembly by the small GTPase Ran. Science 284:1359–1362. point. Proc Natl Acad Sci USA 102:1065–1070. 12. Rozier L, et al. (2013) The MRN-CtIP pathway is required for metaphase chromosome 25. Xing M, et al. (2015) Interactome analysis identifies a new paralogue of XRCC4 in non- alignment. Mol Cell 49:1097–1107. homologous end joining DNA repair pathway. Nat Commun 6:6233. 13. Desai A, Verma S, Mitchison TJ, Walczak CE (1999) Kin I kinesins are microtubule- 26. Cong L, et al. (2013) Multiplex genome engineering using CRISPR/Cas systems. Science destabilizing enzymes. Cell 96:69–78. 339:819–823. 14. Ganem NJ, Compton DA (2004) The KinI kinesin Kif2a is required for bipolar spindle 27. Katsube T, et al. (2011) Differences in sensitivity to DNA-damaging agents between assembly through a functional relationship with MCAK. J Cell Biol 166:473–478. XRCC4- and Artemis-deficient human cells. J Radiat Res (Tokyo) 52:415–424.

E10088 | www.pnas.org/cgi/doi/10.1073/pnas.1806665115 Xu et al. Downloaded by guest on September 27, 2021