DOCSLIB.ORG

Seizure 6-Like (SEZ6L) Gene and Risk for Lung Cancer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Seizure 6-Like (SEZ6L) Gene and Risk for Lung Cancer Research Article Seizure 6-Like (SEZ6L) Gene and Risk for Lung Cancer Ivan P. Gorlov,1 Peter Meyer,2,3,4 Triantafillos Liloglou,6 Jonathan Myles,7 Melanie Barbara Boettger,2,3 Adrian Cassidy,6 Luc Girard,9 John D. Minna,9 Reiner Fischer,8 Stephen Duffy,7 Margaret R. Spitz,1 Karl Haeussinger,2 Stefan Kammerer,5 Charles Cantor,5 Rainer Dierkesmann,8 John K. Field,6 and Christopher I. Amos1 1Department of Epidemiology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas; 2Department for Respiratory Medicine, Asklepios Specialist Hospitals, Munich-Gauting, Germany; 3Genefinder Technologies Ltd.; 4Institute of Molecular Medicine, Munich, Germany; 5Sequenom, Inc., San Diego, California; 6Roy Castle Lung Cancer Research Programme, University of Liverpool Cancer Research Centre, Liverpool, United Kingdom; 7Cancer Research UK Centre for Epidemiology, Mathematics and Statistics Wolfson Institute of Preventive Medicine, London, United Kingdom; 8Department for Respiratory Medicine, Schillerho¨he Specialist Hospital, Stuttgart-Gerlingen, Germany;and 9Hamon Center for Therapeutic Oncology Research, Simmons Cancer Center, University of Texas Southwestern Medical Center, Dallas, Texas Abstract small cell lung cancer (SCLC; n = 22) cell lines by using Affymetrix HG-U133A and HG-U133B GeneChips. We found DNA pooling in combination with high-throughput sequenc- that the average expression level of SEZ6L in NSCLC cell lines ing was done as a part of the Sequenom-Genefinder project. In was almost two times higher and in SCLC cell lines more than the pilot study, we tested 83,715 single nucleotide poly- six times higher when compared with normal lung epithelial morphisms (SNP), located primarily in gene-based regions, cell lines. Using the National Center for Biotechnology to identify polymorphic susceptibility variants for lung cancer. Information Gene Expression Omnibus database, we found a For this pilot study, 369 male cases and 287 controls of both f2-fold elevated and statistically significant (P = 0.004) level sexes (white Europeans of Southern German origin) were of SEZ6L expression in tumor samples compared with normal analyzed. The study identified a candidate region in 22q12.2 lung tissues. In conclusion, the results of these studies that contained numerous SNPs showing significant case- representing 906 cases compared with 811 controls indicate control differences and that coincides with a region that was aroleoftheSEZ6L Met430Ile polymorphic variant in shown previously to be frequently deleted in lung cancer cell increasing lung cancer risk. lines. The candidate region overlies the seizure 6-like (SEZ6L) [Cancer Res 2007;67(17):8406–11] gene. The pilot study identified a polymorphic Met430Ile substitution in the SEZ6L gene (SNP rs663048) as the top Introduction candidate for a variant modulating risk of lung cancer. Two Although up to 90% of lung cancers are attributable to smoking, replication studies were conducted to assess the association of only a small fraction of smokers develop lung cancer over their SNP rs663048with lung cancer risk. The M. D. Anderson lifetimes (1), suggesting that genetic variation may contribute to Cancer Center study included 289 cases and 291 controls lung cancer susceptibility (2). Results of segregation analyses matched for gender, age, and smoking status. The Liverpool suggest that rare autosomal dominant polymorphisms may explain Lung Project (a United Kingdom study) included 248cases and susceptibility to early-onset lung cancer;however, only a minority 233 controls. Both replication studies showed an association of lung cancer cases can be explained by the presence of such of the rs663048with lung cancer risk. The homozygotes for the variants (3–6). There is also a rapidly expanding body of literature variant allele had more than a 3-fold risk compared with the on the association of common, low-penetrance genes with lung wild-type homozygotes [combined odds ratio (OR), 3.32; 95% cancer risk (5–8). According to the latest update of Cancer Genetics confidence interval (95% CI), 1.81–7.21]. Heterozygotes also Web database,10 more than forty genes may be involved in had a significantly elevated risk of lung cancer from the susceptibility to, and progress of lung cancer. combined replication studies with an OR of 1.15 (95% CI, 1.04– Identification of genetic factors modulating lung cancer risk 1.59). The effect remained significant after adjusting for age, requires a combination of effective genotyping technologies with gender, and pack-years of tobacco smoke. We also compared an appropriate and efficient study design. Sequenom (San Diego, expression of SEZ6L in normal human bronchial epithelial CA) has developed a DNA analysis platform, capable of high- cells (n = 7), non–small cell lung cancer (NSCLC; n = 52), and throughput genotyping with pooled DNA allele frequency analysis. Using this approach, Sequenom implemented a Genetics Discovery platform with dense genome-wide single nucleotide polymorphism (SNP) markers (7, 8). A hypothesis-free approach using allele Note: Supplementary data for this article are available at Cancer Research Online frequency estimates of many thousands (for lung cancer, 83,715 (http://cancerres.aacrjournals.org/) and at Cancer Genetics Web database: http:// SNPs) of SNPs was used as a first step (pilot study) in identifying www.cancerindex.org/geneweb/X1501.htm. potentially relevant genetic variants. Significant SNPs identified in I.P. Gorlov, P. Meyer, R. Dierkesmann, J.K. Field, and C.I. Amos contributed equally to this work. this first step were then individually genotyped and validated in Requests for reprints: Christopher I. Amos, Department of Epidemiology, The replication studies using independent samples. The efficiency of University of Texas M. D. Anderson Cancer Center, Box 189, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: 713-563-49-51;Fax: 49-8106-23273;E-mail: camos@ this strategy has been shown by the rediscovery of genes shown mail.mdanderson.org or Peter Meyer, Genefinder Technologies Ltd., Sperberstrasse 2, 81827 Munich, Germany. Phone: 49-171-2838333;Fax: 49-8106-23273;E-mail: Peter. [email protected]. I2007 American Association for Cancer Research. doi:10.1158/0008-5472.CAN-06-4784 10 http://www.cancerindex.org/geneweb/index.htm Cancer Res 2007; 67: (17). September 1, 2007 8406 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on October 1, 2021. © 2007 American Association for Cancer Research. SEZ6L and Lung Cancer previously to be involved in several common diseases (8–10). The smoke. Smoking status was defined as in the U.S. study. In total, 248 lung purpose of the current study was to implement this strategy to cancer cases and 233 controls were included in this analysis. Table 1 identify genetic variation modulating lung cancer risk. provides a description of cases and controls used in the LLP study. SNP markers and genotyping. Genomic DNA was extracted from blood peripheral leukocytes by using the Qiagen DNA blood mini kit (Qiagen) according to the manufacturer’s instruction. DNA pools were formed by Materials and Methods combining equimolar amounts of individual samples as described Sequenom-Genefinder pilot study (Southern Germany). Lung cancer elsewhere (13). For the pilot study, one pool of 369 cases and one pool of cases for the pilot study were recruited from the Departments for 287 controls, respectively, were constructed. For assays carried out on Respiratory Medicine and Thoracic Surgery, Schillerho¨he Specialist Hospital sample pools, 25 ng of a 5-ng/L pool were used for PCRs. All PCR and (Stuttgart-Gerlingen, Germany) and the Department for Respiratory MassEXTEND reactions were conducted using standard conditions. Relative Medicine, Asklepios Specialist Hospitals (Munich-Gauting, Germany). allele frequency estimates were derived from calculations based on the area Controls were sampled from patients with nonmalignant disease at the under the peak of mass spectrometry measurements from four analyte same hospitals. The final sample consisted of 369 male cases and 287 aliquots (14). Tests of association between disease status and each SNP were controls of both genders, all with a positive history of tobacco smoke carried out as previously discussed (15). When three or more replicate exposure. A total of 83,715 SNPs, mostly in gene-based regions, were used measurements of a SNP were available, the corresponding variance in the analysis. Epidemiologic data were collected by personal interview. component was estimated from the data. Otherwise, the following historical Table 1 provides a description of cases and controls used in the pilot study. laboratory averages were used to calculate sources of variability: pool À À The M. D. Anderson Cancer Center replication study (United formation, 5.0 Â 10 5;PCR/mass extension, 1.7 Â 10 4;and chip À States). Cases and controls for the M. D. Anderson Cancer Center (MDACC) measurement, 1.0 Â 10 4. The same procedure was used for individual study were recruited from an ongoing lung cancer case-control study genotyping except 2.5 ng DNA was used and only one mass spectrometry enrolling patients with newly diagnosed, untreated lung cancer at The measurement was taken. The following gene-specific primers were used to University of Texas MDACC (Houston, TX). The study has been described in genotype rs663048: the forward PCR primer was 5¶-TGGGCTATGAGCTC- detail previously (11). Control subjects were recruited from the largest CAGGG-3¶;the reverse PCR primer was 5
Load more

Recommended publications
  • Novel Driver Strength Index Highlights Important Cancer Genes in TCGA Pancanatlas Patients
    medRxiv preprint doi: https://doi.org/10.1101/2021.08.01.21261447; this version posted August 5, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Novel Driver Strength Index highlights important cancer genes in TCGA PanCanAtlas patients Aleksey V. Belikov*, Danila V. Otnyukov, Alexey D. Vyatkin and Sergey V. Leonov Laboratory of Innovative Medicine, School of Biological and Medical Physics, Moscow Institute of Physics and Technology, 141701 Dolgoprudny, Moscow Region, Russia *Corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2021.08.01.21261447; this version posted August 5, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Abstract Elucidating crucial driver genes is paramount for understanding the cancer origins and mechanisms of progression, as well as selecting targets for molecular therapy. Cancer genes are usually ranked by the frequency of mutation, which, however, does not necessarily reflect their driver strength. Here we hypothesize that driver strength is higher for genes that are preferentially mutated in patients with few driver mutations overall, because these few mutations should be strong enough to initiate cancer.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • HHS Public Access Author Manuscript
    HHS Public Access Author manuscript Author Manuscript Author ManuscriptJAMA Psychiatry Author Manuscript. Author Author Manuscript manuscript; available in PMC 2015 August 03. Published in final edited form as: JAMA Psychiatry. 2014 June ; 71(6): 657–664. doi:10.1001/jamapsychiatry.2014.176. Identification of Pathways for Bipolar Disorder A Meta-analysis John I. Nurnberger Jr, MD, PhD, Daniel L. Koller, PhD, Jeesun Jung, PhD, Howard J. Edenberg, PhD, Tatiana Foroud, PhD, Ilaria Guella, PhD, Marquis P. Vawter, PhD, and John R. Kelsoe, MD for the Psychiatric Genomics Consortium Bipolar Group Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis (Nurnberger, Koller, Edenberg, Foroud); Institute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, Indianapolis (Nurnberger, Foroud); Laboratory of Neurogenetics, National Institute on Alcohol Abuse and Alcoholism Intramural Research Program, Bethesda, Maryland (Jung); Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis (Edenberg); Functional Genomics Laboratory, Department of Psychiatry and Human Behavior, School of Medicine, University of California, Irvine (Guella, Vawter); Department of Psychiatry, School of Medicine, Corresponding Author: John I. Nurnberger Jr, MD, PhD, Institute of Psychiatric Research, Department of Psychiatry, Indiana University School of Medicine, 791 Union Dr, Indianapolis, IN 46202 ([email protected]). Author Contributions: Drs Koller and Vawter had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study concept and design: Nurnberger, Koller, Edenberg, Vawter. Acquisition, analysis, or interpretation of data: All authors. Drafting of the manuscript: Nurnberger, Koller, Jung, Vawter.
    [Show full text]
  • Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis
    Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis Ugo Ala1., Rosario Michael Piro1., Elena Grassi1, Christian Damasco1, Lorenzo Silengo1, Martin Oti2, Paolo Provero1*, Ferdinando Di Cunto1* 1 Molecular Biotechnology Center, Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy, 2 Department of Human Genetics and Centre for Molecular and Biomolecular Informatics, University Medical Centre Nijmegen, Nijmegen, The Netherlands Abstract Background: Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings: We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion: Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. Citation: Ala U, Piro RM, Grassi E, Damasco C, Silengo L, et al.
    [Show full text]
  • DNA Methylation of Developmental Genes in Pediatric Medulloblastomas Identified by Denaturation Analysis of Methylation Differences
    DNA methylation of developmental genes in pediatric medulloblastomas identified by denaturation analysis of methylation differences Scott J. Diedea,b, Jamie Guenthoerc, Linda N. Gengc, Sarah E. Mahoneyc, Michael Marottad,e, James M. Olsona,b, Hisashi Tanakad,e, and Stephen J. Tapscotta,c,1 Divisions of aClinical Research and cHuman Biology, Fred Hutchinson Cancer Research Center, Seattle, WA 98109; bDepartment of Pediatrics, University of Washington School of Medicine, Seattle, WA 98195; dDepartment of Molecular Genetics, Cleveland Clinic, Cleveland, OH 44195; and eLerner Research Institute, Cleveland Clinic, Cleveland, OH 44195 Edited by Mark T. Groudine, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved November 6, 2009 (received for review July 8, 2009) DNA methylation might have a significant role in preventing normal Results differentiation in pediatric cancers. We used a genomewide method An Assay to Detect Palindrome Formation Enriches for CpG Methylation. for detecting regions of CpG methylation on the basis of the in- Earlier work from our laboratory focused on identifying regions of creased melting temperature of methylated DNA, termed denatu- the genome susceptible to DNA palindrome formation, a rate- ration analysis of methylation differences (DAMD). Using the DAMD limiting step in gene amplification. We previously described a fi fi assay, we nd common regions of cancer-speci c methylation method to obtain a genomewide analysis of palindrome formation changes in primary medulloblastomas in critical developmental reg- (GAPF) on the basis of the efficient intrastrand base pairing in ulatory pathways, including Sonic hedgehog (Shh), Wingless (Wnt), large palindromic sequences (3). Palindromic sequences can rap- retinoic acid receptor (RAR), and bone morphogenetic protein idly anneal intramolecularly to form “snap-back” DNA under (BMP).
    [Show full text]
  • Comprehensive Biological Information Analysis of PTEN Gene in Pan-Cancer
    Comprehensive biological information analysis of PTEN gene in pan-cancer Hang Zhang Shanghai Medical University: Fudan University https://orcid.org/0000-0002-5853-7754 Wenhan Zhou Shanghai Medical University: Fudan University Xiaoyi Yang Shanghai Jiao Tong University School of Medicine Shuzhan Wen Shanghai Medical University: Fudan University Baicheng Zhao Shanghai Medical University: Fudan University Jiale Feng Shanghai Medical University: Fudan University Shuying Chen ( [email protected] ) https://orcid.org/0000-0002-9215-9777 Primary research Keywords: PTEN, correlated genes, TCGA, GEPIA, UALCAN, GTEx, expression, cancer Posted Date: April 12th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-388887/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Background PTEN is a multifunctional tumor suppressor gene mutating at high frequency in a variety of cancers. However, its expression in pan-cancer, correlated genes, survival prognosis, and regulatory pathways are not completely described. Here, we aimed to conduct a comprehensive analysis from the above perspectives in order to provide reference for clinical application. Methods we studied the expression levels in cancers by using data from TCGA and GTEx database. Obtain expression box plot from UALCAN database. Perform mutation analysis on the cBioportal website. Obtain correlation genes on the GEPIA website. Construct protein network and perform KEGG and GO enrichment analysis on the STRING database. Perform prognostic analysis on the Kaplan-Meier Plotter website. We also performed transcription factor prediction on the PROMO database and performed RNA-RNA association and RNA-protein interaction on the RNAup Web server and RPISEq.
    [Show full text]
  • Transcriptomic Causal Networks Identified Patterns of Differential Gene Regulation in Human Brain from Schizophrenia Cases Versus Controls
    Transcriptomic Causal Networks identified patterns of differential gene regulation in human brain from Schizophrenia cases versus controls Akram Yazdani1, Raul Mendez-Giraldez2, Michael R Kosorok3, Panos Roussos1,4,5 1Department of Genetics and Genomic Science, Icahn School of Medicine at Mount Sinai, New York, NY, USA 2Lineberger Comprehensive Cancer Center, School of Medicine, University of North Carolina at Chapel Hill, NC, USA 3Department of Biostatistics, University of North Carolina at Chapel Hill, NC, USA 4Department of Psychiatry and Friedman Brain Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA 5Mental Illness Research Education and Clinical Center (MIRECC), James J. Peters VA Medical Center, Bronx, New York, 10468, USA Abstract Common and complex traits are the consequence of the interaction and regulation of multiple genes simultaneously, which work in a coordinated way. However, the vast majority of studies focus on the differential expression of one individual gene at a time. Here, we aim to provide insight into the underlying relationships of the genes expressed in the human brain in cases with schizophrenia (SCZ) and controls. We introduced a novel approach to identify differential gene regulatory patterns and identify a set of essential genes in the brain tissue. Our method integrates genetic, transcriptomic, and Hi-C data and generates a transcriptomic-causal network. Employing this approach for analysis of RNA-seq data from CommonMind Consortium, we identified differential regulatory patterns for SCZ cases and control groups to unveil the mechanisms that control the transcription of the genes in the human brain. Our analysis identified modules with a high number of SCZ-associated genes as well as assessing the relationship of the hubs with their down-stream genes in both, cases and controls.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name golgi brefeldin A resistant guanine nucleotide exchange factor 1 Gene Symbol GBF1 Organism Human Gene Summary This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. Gene Aliases ARF1GEF, FLJ21263, FLJ21500, KIAA0248, MGC134877, MGC134878 RefSeq Accession No. NG_008147.1, NC_000010.10, NT_030059.13 UniGene ID Hs.290243 Ensembl Gene ID ENSG00000107862 Entrez Gene ID 8729 Assay Information Unique Assay ID qHsaCID0008440 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000369983 Amplicon Context Sequence ATGTATTCCTTCGACCTTTTCTGGAAGTGATTCGCTCTGAAGATACCACTGGCCC TATCACTGGACTGGCACTCACCTCTGTCAACAAGTTCCTGTCCTATGCACTCATA GATCCCACCCATGAGGGCACAGCAGAGGGCATGGAGAACATGGCAGATGCT Amplicon Length (bp) 131 Chromosome Location 10:104103829-104111062 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 94 R2 0.9988 cDNA Cq 20.43 cDNA Tm (Celsius) 84.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 36.2 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay
    [Show full text]
  • Associations Between Human Disease Genes and Overlapping Gene Groups and Multiple Amino Acid Runs
    Associations between human disease genes and overlapping gene groups and multiple amino acid runs Samuel Karlin*†, Chingfer Chen*, Andrew J. Gentles*, and Michael Cleary‡ Departments of *Mathematics and ‡Pathology, Stanford University, Stanford, CA 94305 Contributed by Samuel Karlin, October 30, 2002 Overlapping gene groups (OGGs) arise when exons of one gene are Chr 22. Such rearrangements may be mediated by recombination contained within the introns of another. Typically, the two over- events based on region-specific low copy repeats. The DGS lapping genes are encoded on opposite DNA strands. OGGs are region of 22q11.2 is particularly rich with segmental duplications, often associated with specific disease phenotypes. In this report, which can induce deletions, translocations, and genomic insta- we identify genes with OGG architecture and genes encoding bility (4). There are several anomalous sequence features asso- multiple long amino acid runs and examine their relations to ciated with OGGs, including Alu sequences intersecting exons, diseases. OGGs appear to be susceptible to genomic rearrange- pseudogenes occupying introns, and single-exon (intronless) ments as happens commonly with the loci of the DiGeorge syn- genes that often result from a processed multiexon gene. drome on human chromosome 22. We also examine the degree of At least 28 genes in Chr 21 are related to diseases, as conservation of OGGs between human and mouse. Our analyses characterized in the GeneCards database (5), as are 64 genes in suggest that (i) a high proportion of genes in OGG regions are Chr 22. Specific disorders that have been mapped to genes on disease-associated, (ii) genomic rearrangements are likely to occur Chr 21 and that involve OGG structures include: amyotrophic within OGGs, possibly as a consequence of anomalous sequence lateral sclerosis (ALS, Lou Gehrig’s disease), linked to the features prevalent in these regions, and (iii) multiple amino acid GRIK1 ionotrophic kainate 1 glutamate receptor gene at 21q22 runs are also frequently associated with pathologies.
    [Show full text]
  • Pharmacogenomics of Ventricular Conduction in Multi-Ethnic Populations Amanda Seyerle Dissertation Committee
    Pharmacogenomics of Ventricular Conduction in Multi-Ethnic Populations Amanda Seyerle Dissertation Committee: Christy Avery (chair) Kari North Eric Whitsel Til Stürmer Craig Lee 1 TABLE OF CONTENTS Page LIST OF TABLES ...................................................................................................................................... v LIST OF FIGURES ..................................................................................................................................... vi LIST OF ABBREVIATIONS ..................................................................................................................... vii LIST OF GENE NAMES ............................................................................................................................ ix 1. Overview .............................................................................................................................................. 1 2. Specific Aims ....................................................................................................................................... 3 3. Background and Significance ............................................................................................................ 4 A. Ventricular Conduction ......................................................................................................................... 4 A.1. Electrical Conduction of the Heart ................................................................................................ 4 A.1.1. Sodium Channels..................................................................................................................
    [Show full text]
  • Downloaded from Ensembl
    UCSF UC San Francisco Electronic Theses and Dissertations Title Detecting genetic similarity between complex human traits by exploring their common molecular mechanism Permalink https://escholarship.org/uc/item/1k40s443 Author Gu, Jialiang Publication Date 2019 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California by Submitted in partial satisfaction of the requirements for degree of in in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN FRANCISCO AND UNIVERSITY OF CALIFORNIA, BERKELEY Approved: ______________________________________________________________________________ Chair ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ ______________________________________________________________________________ Committee Members ii Acknowledgement This project would not have been possible without Prof. Dr. Hao Li, Dr. Jiashun Zheng and Dr. Chris Fuller at the University of California, San Francisco (UCSF) and Caribou Bioscience. The Li lab grew into a multi-facet research group consist of both experimentalists and computational biologists covering three research areas including cellular/molecular mechanism of ageing, genetic determinants of complex human traits and structure, function, evolution of gene regulatory network. Labs like these are the pillar of global success and reputation
    [Show full text]
  • Gwas Meta-Analysis of Intelligence 1
    bioRxiv preprint doi: https://doi.org/10.1101/184853; this version posted September 6, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GWAS META-ANALYSIS OF INTELLIGENCE 1 GWAS meta-analysis (N=279,930) identifies new genes and functional links to intelligence Jeanne E Savage1#, Philip R Jansen1,2#, Sven Stringer1, Kyoko Watanabe1, Julien Bryois3, Christiaan A de Leeuw1, Mats Nagel1, Swapnil Awasthi4, Peter B Barr5, Jonathan R I Coleman6,7, Katrina L Grasby8, Anke R Hammerschlag1, Jakob Kaminski4,9, Robert Karlsson3, Eva Krapohl6, Max Lam10, Marianne Nygaard11,12, Chandra A Reynolds13, Joey W Trampush14, Hannah Young15, Delilah Zabaneh6, Sara Hägg3, Narelle K Hansell16, Ida K Karlsson3, Sten Linnarsson17, Grant W Montgomery8,18, Ana B Muñoz-Manchado17, Erin B Quinlan6, Gunter Schumann6, Nathan Skene17, Bradley T Webb19,20,21, Tonya White2, Dan E Arking22, Deborah K Attix23,24, Dimitrios Avramopoulos22,25, Robert M Bilder26, Panos Bitsios27, Katherine E Burdick28,29,30, Tyrone D Cannon31, Ornit Chiba-Falek32, Andrea Christoforou23, Elizabeth T Cirulli33, Eliza Congdon26, Aiden Corvin34, Gail Davies35, 36, Ian J Deary35,36, Pamela DeRosse37, Dwight Dickinson38, Srdjan Djurovic39,40, Gary Donohoe41, Emily Drabant Conley42, Johan G Eriksson43,44, Thomas Espeseth45,46, Nelson A Freimer26, Stella Giakoumaki47, Ina Giegling48, Michael Gill34, David
    [Show full text]