Why Data Citation Is a Computational Problem

Total Page:16

File Type:pdf, Size:1020Kb

Why Data Citation Is a Computational Problem Why Data Citation is a Computational Problem Susan B. Davidson University of Pennsylvania Work partially supported by NSF IIS 1302212, NSF ACI 1547360 NIH 3-U01-EB-020954-02S1 Outline ¤ The power of abstraction ¤ And how it has helped with two of my favorite problems in bioinformatics ¤ New problem: data citation ¤ Bigger picture: Data Science 2 The power of abstraction ¤ The “right” abstraction is key to developing solutions to many practical problems. ¤ Data Integration ¤ Provenance ¤ …. ¤ Data Citation ¤ Developing the right abstraction requires close collaboration between end-users, systems builders, and theoreticians. 3 3 9 t 42 41 40 39 h 38 37 36 34 33 32 31 30 29 S t t t t t t t 4 t t y e r e e e e e 0 e e a e e e e e e e r t e e r e r r r t r h w r t r t t t t t t t s S S S S S S S s S S t t e h h h d d r r Advanced h s t h t t r e t t n p 1 7 Mabel Pew Care 0 8 3 e 6 4 2 x 3 3 3 3 Pavilion 3 4 t 3 Myrin 3 3 1 Pavilion E s l l 4 t Wright/Saunders i 2 k n S Building Cupp l y d t r Pavilion u t e h e S e 3810 c e t t r r S t e S e Presbyterian I t Scheie Medical Medical Center I d Eye Medical r Science of the Office Bldg 3 Research Institute University of 4 Lab Pennsylvania Health System Heart Andrew Parking Institute 30th Street Station JFK Boulevard Mutch Bldg Garage ue Aven elton Pow DatabasesFilbert Street meets bioinformatics Medical 3737 3711 3701 3665 3535 3501 3401 3100 Arts J Bldg J 3615 Market Street Market Street 3750 3700 3624 3550 3508 3500 3440 3600 University City Science Center Ludlow Street 4124 Ludlow Ralston IRS House Axis 3335 Chestnut Garage 4039 The St. Leonard's Chestnut 34 Complex K Chestnut Hub International Sheraton Dom“Genomicsus is the next moon landing.” K House Hub New University 4111-25 3939 Chestnut Ralston City House Chestnut Street Chestnut Street y Sansom a Greenfield English Place W Evo 4026-40 0 Center Nichols Gittis Hall HUP 1 4212 s College Cira Center West ' 9 (1992) Newman Chestnut y House US Post Office Offices 3 House New South Chestnut Center a 4258 r Kings Tanenbaum Silverman r College Hall 4101 u Court Hall Hall House 4059 M ICA Christian e Golkin Hall Horizon v House Cira Center Assoc. e t The Left Bank Highline South Sansom Street S Hill Field Garage McNeil Square 3808 Franklin Early Garage American 125 S. 31st Street L Walnut 40 Annex ( Translational Research ) Singh 3201 L 2 4015 Module 6 6 4 0 8 4 4 3 3 3 2 1 3 2 Walnut 4109 Retail Pottruck Hill Nanotechnology Walnut 3 The Radian F Center Garage 3 Inn at Penn College FMC Tower Fresh F F 119 S. 38th L.R.S.M 3025 9 3901 F Garage 30 Perelman Franklin 3401 House Walnut 32 3101 Grocer 3 3815 Walnut AFSCME S F F Walnut S F 3809 Bookstore Center for Building Walnut F Walnut Political ( WXPN ) Science and Economics 0 8 4 2 Walnut Street 6 Walnut Street 0 0 0 0 0 1 1 1 1 1 4 4 4 4 4 President's Grad e F S F Philadelphia Du Bois College House Grad School Jaffe Fisher Jones Way Lower Walnut Street r House Annenberg Addams Research Free of Education Dietrich History Bennett a 4126-38 Cinema School Hall Van Pelt Wing Library Fox-Fels 3808-10 Graduate of Art Hall u Walnut Annenberg Moore David Library Library School Class of 1923 q Hall Center Rittenhouse Rotunda Levine Ice Rink S Solomon Labs 206 Jon M. Labs Annenberg Meyerson Hall Skirkanich 3216 s Hillel at Huntsman Psychology PPC Lerner Hall Chancellor k Shops Stiteler F Hall Ctr r Steinhardt Hall Rodin Hall a at 40th Hall Perry Colonial 212 Street College World F The M M Penn Towne Building ARCH 7 M Hamilton House F House 3615 Sweeten Hecht F 3 Morgan . Caster Locust Ctr F 3609 F 5 t Village F 3619 Alumni Bldg Palestra Tennis Building House 3611 3 Blanche P. Levy Park S Kelly House Center Writers Robbins Fisher Locust Street Locust Walk House House Fine Arts Smith Walk Shoemaker Library Green 4032 250 S Dunning-Cohen Ace Adams Levy St Mary's Harnwell F F 36th Hayden Hall Champions Oral Health Class of Vagelos Field Church College Duhring Dunning Field Sadie Tanner Mossell Alexander Civic 1920 McNeil Steinberg Hall Labs Hutchinson House Commons Steinberg College Hall Wing Coaches’ University of Pennsylvania House Building Dietrich Hall IAST Ctr Gymnasium Partnership School Schattner Class of 1925 Conference Lauder- Center House Center Fischer Parent Infant Cohen Center F Steinhardt Perelman Quad Ringe Lehman Brothers Quad Hall 1958 N Spruce Berkshire 3907 235 S. 39th Plaza Wynn Commons Wing Weightman Squash Crt N Harrison Mack Plaza Wood Apts College Irvine Hall Evans Garage Chemistry Apts House Wistar Auditorium Spruce Building Spruce 38 Houston Hall 1973 Paley 3905 Institute Wing Cret Penn Park House Spruce Van Pelt Mayer Vance Hall Williams Hall Wing Bridge College House Residence Hall Multi-Purpose Hall Stadium Spruce Street Franklin Field e r S F F S F F F Rosenthal a Penn Kane S Building Stouffer u Transplant F Hospital Park College q House of the House S 301 3920 University of Pennsylvania Hamlin Tennis Center O Delancey s Health System O k F r 3918 The Quadrangle a Surrey Matthew J. Ryan School of Rhoads M Veterinary Veterinary Pavilion . Hall Hospital Weave t Medicine of the UofP Bridge S Old Quad Museum of y Pine Street Hamilton Walk Archaeology and a Anthropology South Green w s Johnson Stemmler e s Leidy e John Morgan Building Hall u r Labs n p Hill Pavilion Goddard Richards Building University University e x 4200 Pine Museum Museum v E Labs Building l Academic Garage A il Children's Hospital Wing n k r 4219 l e Levin Building of Philadelphia io y Osage Avenue t u iv Claire M. n h R P Fagin Hall Clinical e c ll P Anatomy Research v S i E n k Kaskey Chemistry Building a 6 l Webster Manor Cyclotron s Child New Patient o -7 y Park t C u Stellar- S Guidance Pavilion University I h Carolyn Chance Center c Lynch e City Laboratories r Station Hollenback S Labs Wood Pediatric v Center ic Ambulatory Care e O Center ve Blockley D ri Hall s r D le iv Hollenback n BRB 2 r e Perelman Center For Annex a C + Advanced Medicine i d ir Children's ar The c Seashore Roberts e u Consortium l House nu rd e E Proton ve G a Curie A v a Jordan Medical re le Garage s mo u t Education Center lti Veterans o rd Buerger S Ba Administration B a e Smilow Rhodes Q e v Center For r Center for South Street Medical Center ri Philadelphia le Advanced v Field u Abramson u ic Translational Center For o Pediatric e Research C Health Care Sciences Pediatric B Research r Care D e r e U Medical t i u n v n Q n Examiners e e C e i Building Stewart v v ic Field A e v i ll r C i s k i VA l t y e y Nursing Vagelos venu W e u r A A Home e v Field h este s ri c h v C t D S e S s n e Colket ce u rv Research n e e ic Center ci e S R D h r lt iv ea UPHS e H Medical Parking Garage R Mondschein Field UofP / CHOP Medical Parking Garage 51 ve s Dri Field S River S Module 7 Meiklejohn Stadium e u n e v A d n T a T l d o o W 4 272 179 192 Pennovation Center y 212 a w s University of Pennsylvania s e r p Facilities and Real Estate Services : Office of the University Architect x E © Trustees of the University of Pennsylvania l l i h t t k Revised: 02/24/16 Pennovation Works l r e y o 3401 Grays Ferry Avenue e r u N t h Feet 150 300 450 600 227 S c S Grays Ferry Avenue h t 6 Meters 50 100 150 200 4 7 - 3 I 197 42 41 40 39 38 37 36 34 33 32 31 30 29 Example 1: Data Integration Entrez Sequence Image Data Id Date & Time Image >gi|2580555|gb|AF000985.1|HSAF000985 Homo sapiens dead box, Y isoform (DBY) ? mRNA, alternative transcript 1, complete cds spdfld13a 9/8/95 12:02:03 CCAGTGTAAGAGTTCCGCTATTCGGTCTCACACCTACAGTGGACTACCCGATTTTTCGCTTCTCTTCAGG GATGAGTCATGTGGTGGTGAAAAATGACCCTGAACTGGACCAGCAGCTTGCTAATCTGGACCTGAACTCT GAAAAACAGAGTGGAGGAGCAAGTACAGCGAGCAAAGGGCGCTATATACCTCCTCACTTAAGGAACAAAG AAGCATCTAAAGGATTCCATGATAAAGACAGTTCAGGTTGGAGTTGCAGCAAAGATAAGGATGCATATAG spdfld22a 9/8/95 12:02:04 CAGTTTTGGGTCTCGAGATTCTAGAGGAAAGCCTGGTTATTTCAGTGAACGTGGAAGTGGATCAAGGGGA ... spdfld22a 9/8/95 12:02:06 Relational Databases Name P Value Len HT97683 0 2182 Integrating Query: Q62167 3.1e-234 440 P16381 4.2e-230 440 What genes are involved in P24346 4.2e-214 440 P066346 2.6e-127 423 bipolar schizophrenia? Entrez Medline Object-Oriented Databases Genome Sequence of the Nematode C. elegans: A Platform for Investigating Biology. 3 SCIENCE Volume 282 (5396): 2012 - 2018 8 Issue of 11 Dec 1998 The C.
Recommended publications
  • Remembrances and Thank Yous by Alan Cotler, W'72
    Remembrances and Thank Yous By Alan Cotler, W’72, WG’74 When I told Mrs. Spitzer, my English teacher at Flushing High in Queens, I was going to Penn her eyes welled up and she said nothing. She just smiled. There were 1,100 kids in my graduating class. I was the only one going to an Ivy. And if I had not been recruited to play basketball I may have gone to Queens College. I was a student with academic friends and an athlete with jock friends. My idols were Bill Bradley and Mickey Mantle. My teams were the Yanks, the New York football Giants, the Rangers and the Knicks, and, 47 years later, they are still my teams. My older cousin Jill was the first in my immediate and extended family to go to college (Queens). I had received virtually no guidance about college and how life was about to change for me in Philadelphia. I was on my own. I wanted to get to campus a week before everyone. I wanted the best bed in 318 Magee in the Lower Quad. Steve Bilsky, one of Penn’s starting guards at the time who later was Penn’s AD for 25 years and who helped recruit me, had that room the year before, and said it was THE best room in the Quad --- a large room on the 3rd floor, looked out on the entire quad, you could see who was coming and going from every direction, and it had lots of light. It was the control tower of the Lower Quad.
    [Show full text]
  • The Twenty Greatest Music Concerts I've Ever Seen
    THE TWENTY GREATEST MUSIC CONCERTS I'VE EVER SEEN Whew, I'm done. Let me remind everyone how this worked. I would go through my Ipod in that weird Ipod alphabetical order and when I would come upon an artist that I have seen live, I would replay that concert in my head. (BTW, since this segment started I no longer even have an ipod. All my music is on my laptop and phone now.) The number you see at the end of the concert description is the number of times I have seen that artist live. If it was multiple times, I would do my best to describe the one concert that I considered to be their best. If no number appears, it means I only saw that artist once. Mind you, I have seen many artists live that I do not have a song by on my Ipod. That artist is not represented here. So although the final number of concerts I have seen came to 828 concerts (wow, 828!), the number is actually higher. And there are "bar" bands and artists (like LeCompt and Sam Butera, for example) where I have seen them perform hundreds of sets, but I counted those as "one," although I have seen Lecompt in "concert" also. Any show you see with the four stars (****) means they came damn close to being one of the Top Twenty, but they fell just short. So here's the Twenty. Enjoy and thanks so much for all of your input. And don't sue me if I have a date wrong here and there.
    [Show full text]
  • Faculty Bulletins University Publications
    La Salle University La Salle University Digital Commons Faculty Bulletins University Publications 2-20-1974 Faculty Bulletin: February 20, 1974 La Salle University Follow this and additional works at: http://digitalcommons.lasalle.edu/faculty_bulletins Recommended Citation La Salle University, "Faculty Bulletin: February 20, 1974" (1974). Faculty Bulletins. 169. http://digitalcommons.lasalle.edu/faculty_bulletins/169 This Book is brought to you for free and open access by the University Publications at La Salle University Digital Commons. It has been accepted for inclusion in Faculty Bulletins by an authorized administrator of La Salle University Digital Commons. For more information, please contact [email protected]. CALENDAR OF EVENTS (Through April 24, 1974) College Union Special: Steve Merriman-Pianist, Music Room, 12:30 P . M . ---- ---------- February 20 TKE: Blood Donor Recruitment, College Union Lobby, 9:30 A.M. - 3:30 P.M.---------- February 20 Poetry Workshop: College Union 301, 7 - 10:30 P . M . ------------------ February 20 Alpha Sigma Lambda: Settlement Music School Madrigals, Theater, 8:00 P . M . -------------------- February 20 USA: Masque Workshop, Olney 100, 8:30 P . M . ------------------- -------February 20 Men's Basketball: vs. Villanova, 8:00 P.M., Palestra ---------------- February 20 Women's Swimming: vs. Bryn Mawr College, 4:00 P.M., LSC Kirk: Po o l --- February 20 TKE: Blood Donor Recruitment, College Union Lobby, 9:30 A.M. - 3:30 P . M . ------------- February 21 New Cinema Film: "Lolita", Theater, 12:30 & 6:00 P.M. -------------- February 21 Poetry Workshop: College Union 301, 7 - 10:30 P.M. --- -------------- February 21 USA: Masque Workshop, Olney 100 , 8:30 P . M . ------------------------ February 21 Women's Basketball: vs.
    [Show full text]
  • Faculty Bulletin: December 12, 1973 La Salle University
    La Salle University La Salle University Digital Commons Faculty Bulletins University Publications 12-12-1973 Faculty Bulletin: December 12, 1973 La Salle University Follow this and additional works at: http://digitalcommons.lasalle.edu/faculty_bulletins Recommended Citation La Salle University, "Faculty Bulletin: December 12, 1973" (1973). Faculty Bulletins. 50. http://digitalcommons.lasalle.edu/faculty_bulletins/50 This Book is brought to you for free and open access by the University Publications at La Salle University Digital Commons. It has been accepted for inclusion in Faculty Bulletins by an authorized administrator of La Salle University Digital Commons. For more information, please contact [email protected]. CALENDAR OF EVENTS (Through February 20, 1973) N.B. - Student Activites for February are not included as they are still tentative. Evening Division: Fall Semester Final Exams-------------- ------------December 12 Evening Division: Fall Semester Final Exams -------------------------- December 13 Day Division: End of Fall Semester Classes, 4:30 P.M. --------------- December 13 Day Division: Fall Semester Final Exams---- ------------------------- December 14 Men’s Basketball: vs. Holy Cross, A w a y ------- ----------------------- December 15 Day & Evening Division: Fall Semester Final Exams -------------------- December 17 Day & Evening Division: Fall Semester Final Ex a m s ---------------------December 18 Day & Evening Division: Fall Semester Final Exams -------------------- December 19 Hen's Basketball: vs. Univ. of Pennsylvania, 8:45 P.M., Palestra ---- December 19 Day & Evening Division: Fall Semester Final Exams; Final Date for Hail Registration---------- December 20 Evening Division: Christmas Recess Begins, 10 15 P.M. --------------- December 20 Day Division: Fall Semester Final Exams; Christmas Recess Begins 4:30 P.M.; Residence Hall close, 6:00 P.M.
    [Show full text]
  • La Salle Basketball 1960-61 La Salle University
    La Salle University La Salle University Digital Commons La Salle Basketball Media Guides University Publications 1960 La Salle Basketball 1960-61 La Salle University Follow this and additional works at: http://digitalcommons.lasalle.edu/basketball_media_guides Recommended Citation La Salle University, "La Salle Basketball 1960-61" (1960). La Salle Basketball Media Guides. 4. http://digitalcommons.lasalle.edu/basketball_media_guides/4 This Article is brought to you for free and open access by the University Publications at La Salle University Digital Commons. It has been accepted for inclusion in La Salle Basketball Media Guides by an authorized administrator of La Salle University Digital Commons. For more information, please contact [email protected]. LA JhU£ 1960-61 1960-61 LA SALLE COLLEGE BASKETBALL BROCHURE Prepared for members o2 the press, radio, and television corps by La Salle College's News Bureau, with the co-operation of the college's Department of Athletics. For further information call, write, or wire: Ralph W. Howard Director, News Bureau La Salle College Philadelphia 41, Penna. OFFICE PHONE: Victor 8-8300, Ext. 301 HOME PHONE: BAldwin 9-3874 CONTENTS Section I - The 1960-61 Season Varsity Schedule 3 Season at a Glance 4 James J. Henry, Athletic Director 5 Donald W. Moore, Head Coach 6 Prospects for the Season 7-9 Varsity Roster 10 Varsity Sketches 11-13 1960-61 Opponents 14-19 Freshman Schedule 20 Freshman Roster 21 Freshman Sketches 22-23 Section II - The Records 1959-60 Team Record 25 1959-60 Varsity Statistics 25-26 1959-60 Freshman Statistics 26-27 All-Time Records With 1960-61 Opponents 27 Game-by Game Records With 1960-61 Opponents 28-31 All-Time Won-Lost Records by Opponents 32-35 All-Time Team & Individual Records 35-41 Complete Modern Records 42 Sports Assistants: Frank Bilovsky, ' bl Bob Lyons, '60 Cover Photo by Mike Maicher Art by Arthur Dorn Digitized by the Internet Archive in 2012 with funding from LYRASIS Members and Sloan Foundation http://archive.org/details/lasallebasket60unse SECTION I - THE 1960-61 SEASON 3.
    [Show full text]
  • November 24, 2009, Vol. 56 No. 13
    UNIVERSITY OF PENNSYLVANIA Tuesday November 24, 2009 Volume 56 Number 13 www.upenn.edu/almanac Penn Medicine: $45 Million Penn GSE and 15 APEC Member Economies: NIH-Supported Trial to Study International Study in Science and Math Teacher Preparation Testosterone Therapy in Older Men The University of Pennsylvania Graduate School of Education-International is teaming up with Penn Medicine will lead a new national $45 15 other members of the Asia-Pacific Economic Cooperation to conduct an international study on million clinical trial to test whether testoster- secondary-school teacher preparation, “Identifying Unique and Promising Practices in Math and one therapy can favorably affect certain condi- Science Teacher Education in APEC Economies.” tions affecting older men. Low serum testoster- Led by scholars from around the globe, this four-year research project will illustrate how teach- one may contribute to a number of problems af- er education and preparation influence student outcomes, fill critical gaps in education research and fecting older men, including decreased ability assess how American teachers can learn from international counterparts. to walk, loss of muscle mass and strength, de- This study will compare teacher education in the US, Australia, Chile, Japan, New Zealand, creased vitality, decreased sexual function, im- Peru, Russia, South Korea, Singapore, Thailand and Vietnam. paired cognition, cardiovascular disease and ane- “We know that teacher preparation here puts a great deal of emphasis on methodology and psy- mia. While testosterone normally decreases with chology and not so much on subject matter. The opposite is true in the East,” Dr. Andrew Porter, age, in some men, low levels of testosterone may Penn GSE dean, said.
    [Show full text]
  • Mbb Media Guide 11-12 Layout 1
    QUICK FACTS School: La Salle University Location: Philadelphia, PA Earl Total Enrollment: 7,331 (4,673 undergraduates) Pettis Founded: 1863 President: Brother Michael J. McGinniss, F.S.C., Ph.D. Web Site: www.lasalle.edu Athletic Web Site: www.goexplorers.com Athletic Phone: 215-951-1425 Nickname: Explorers Colors: Blue (540) and Gold (7406) Home Court/Capacity: Tom Gola Arena (3,400) Athletic Director: Dr. Thomas Brennan Senior Associate Athletic Director: John Lyons Associate Athletic Director: Kale Beers Assistant Athletic Director: Mary Ellen Wydan Assistant Athletic Director: Chris Kane Basketball Information Head Coach (alma mater/year): Dr. John Giannini (North Central College ’84) Record at School (years): 98-115/8th Overall Record (years): 395-264/22nd Assistants (alma mater/years at La Salle): Horace Owens (Rhode Island ’83/8th) Harris Adler (Univ. of the Sciences ’98/8th) Will Bailey (UAB ‘98/2nd) Director of Operations: Sean Neal (La Salle ’07/4th) Video Coordinator: Terrence Stewart (Rowan ’96/3rd) Basketball Office Phone: 215-951-1518 Best Time to Reach Coach: Contact SID 2010-11 Record (Conference Record/Finish): 15-18 (6-10/T-10th) All-Time NCAA Tournament Record: 11-10 (11 appearances) All-Time NIT Record: 9-10 (11 appearances) Letterwinners Returning/Lost: 6/5 Starters Returning/Lost: 2/3 Media Information WHY WE ARE THE EXPLORERS La Salle University’s nickname – the Explorers – Assistant AD/Communications: Kevin Bonner was announced by the Collegian in March 1932 as Office Phone: 215-951-1513 the winning entry to a student contest. However, in the fall of 1931, a Baltimore sportswriter cover- Cell Phone: 484-880-3382 ing the La Salle/St.
    [Show full text]
  • February 12, 1969
    from the associated press ^^ To Parents of Tunnel Staff i News Roundup: From the State, Dean Sends Warnin g Letters By ALLAN YODER The letter to the parents of Tunnel staff dent whose conduct is prejudicial to the good upon notification that foinuil charges ai«- Nation & World members included a copy of the letter Mur- name of the University may be dismissed." bemg placed against them by the University Collegian Stajj Writer phy sent to the staff members themselves "We hope we don' t have lo go .is far a*, Murphy also said in his letter to staff Parents of Water Tunnel staff mem- last Friday. In that letter. Murphy listed ex- taking legal action." Thomp.ion said "We cerpts from the first issue of the paper, members. "I strongly encourage you to re- would leally like to come to some type of The World bers received letters yesterday from the which abounded with four-letter words. frain from publishing and distributing on agreement with the Administration." he this campus material like that which ap- added. Hanoi Press Hints Impatience for War ' s End University Administration warning that peared in your first issue." The 14-page firs t issue of the Tunnel wa> PARIS — Members of the U.S. delegation of the Viet- ght be taken A spokesman tor the Water Tunnel said disciplinary action mi In his second letter to parents of minor banned by Charles L. Lewis, vice president nam talks are studying a batch of articles in the official at last night's Students for a Democratic Hanoi press hinting at public impatience in North Vietnam against their sons and daughters.
    [Show full text]
  • Activities 2010
    Activities 2010 Activities - 2010 Table of contents General Information .........................................................................................................................4 Unit Description ....................................................................................................................4 General Objectives .............................................................................................................5 Main Achievements ............................................................................................................7 Integrative/multidisciplinary activities ..............................................................................8 Outreach activities ........................................................................................................... 10 Outreach/Science and Society ..................................................................................... 11 Networking Actions .......................................................................................................... 13 Training Activities ............................................................................................................... 14 Organization of International Events ............................................................................. 15 Internal Services and Resources .................................................................................... 16 External Services and Resources ...................................................................................
    [Show full text]
  • Visitor's Guide University City
    U01 addamsniversity gallery City univ. of pennsylvania 200 south 36th street upenn.edu/gsfa 215.898.8374 Philadelphia 02 arthur ross gallery univ. of pennsylvania 220 south 34th street upenn.edu/arg 215.898.2083 design arts gallery drexel university 33rd & market streets drexel.edu 215.895.2548 Visitor’sellen powell tiburino museum of contemporary art 3819 hamilton street 215.739.6753Guide esther m. klein gallery univ. city science center 3600 market street kleinartgallery.org 215.387.2262 fox gallery univ. of pennsylvania 249 south 36th street upenn.edu/gsfa 215.898.8374 institute of contemporary art 118 south 36th street icaphila.org 215.898.5199 kroiz gallery univ. of pennsylvania 220 south 34th street cafés & restaurants museums & galleries hotels & b&bs shopping, neighborhood info, & more UCD Dear Visitor: Welcome to University City! University City District Each year, thousands of visitors enjoy the rich cultural opportunities, wonderful array of ethnic restaurants, and unique shopping that University City has to offer – a 2.2 sq. mile district on the west side of downtown Philadelphia (see map on page 27). Founded in 1997, University City District, a private nonprofit organization, builds effective partnerships to maintain a clean and safe environment and to promote, plan and advocate for University City’s diverse, urban community. We are the region’s leading community for technology, research, higher education and health care integrated with historic and desirable www.UCityphila.org residential neighborhoods, vibrant commercial corridors, cultural attractions, and strong transportation connections. We welcome visitors from near and far and hope this guide assists in making each visit an enjoyable, memorable, and inspirational experience.
    [Show full text]
  • Courtmen Open Dec. 2 at Palestra Ugly Man Title Obtained Either in the Pie Constitutes an Award for the Mr
    - ' '"'-?"'3^: * Tiffs Go To Sun Bowl Dec 30 •h^ First Team To Attept A Bid mm Around eleven o'clock Friday morning November 17, NOVA, PA. DECEMBER 6, 1961 Villanova accepted its first bid to a post-season bowl game since 1949. The Wildcats were the first team to accept a Bowl bid. Officials of the Sun Bowl later announced that Law Forum Hosts TrialExpert, Wichita University had also accepted an invitation to com- " ^ramotic Presentation of pete with the Main Liners on Satuixiay, December 30 in El Berman, Kingsley's Paso, Texas. In Talk "For Defense There have been only two pre- Wichita. Wichita has captured George West Monetary recovery for the vious meetings between the the Missouri Valley Conference by l^etective Storv' Beains Run Taniaht plaintiff was briefly touched teams. The Wildcats topped the title behind the quarterbacking The upon. The jury must be condi- Shockers in 1957, 24-6 and lost of Alex Zyskowski, sixth in the second meeting of the Belle tioned to accent a large Maaque^s production of year 21-6. Ted Villanova Law Forum was ad- amount the following nation in total offense. His fav- Sidney Kingsley's "Detective Five members of VUlanova's starting basketball team appear with Jack Kraft, head basketball in damages. He made it quite Dean, Eagle fullback, led the pros- dressed by one of the most cap- orite target is another pro coach. From left are Coach Kraft, White, Jim McMonagle, Jones, clear that Story" opens a five night run in HuMe Wally Joe Wainh, and able of the important fact Wichita team in 1958 to this vic- pect Ron Turner, a 6-2, 215 trial lawyers, Emil Zola the Vasey Hall George Left^lch.
    [Show full text]
  • PAS WEEKLY Pennalexander.Philasd.Org | Mr
    Penn Alexander School Week of September 11 PAS WEEKLY pennalexander.philasd.org | Mr. Farrell, Principal | 215-400-7760 Upcoming Events: Back to School Nights (Sept. 12th & 13th) Back to School Night (Grades 1-5) All parents/families are asked to join your Wed., Sept. 12th 6PM child’s classroom teacher at Back to School Night on the following date: Back to School Night (Middle School) Grades 1-5, Wed., Sept. 12th 6PM Thur., Sept. 13th 6PM Grade 6-Thur., Sept. 13th 6-7PM Home & School Association (HSA) Meeting Grades 7& 8-Thur., Sept. 13th 7-8PM Mon., Sept. 17th 8:45AM & 6PM Enter building through front entrance. Yom Kippur, School Closed Wednesday, September 19th Box Tops Collection International Peace Day Last year, PAS earned over $1,000 Friday, September 21st in Box Tops. Start Pretzel Friday ($1) & collecting now, and send Dress Down Day ($1) them to school. Friday, September 21st Interim Reports (Grades 4-8) Monday, October 1st e-Pony launches September 11th Winter Coat Drive Begins Monday, October 1st Beginning September 11th, all families who create a PAS MySchool Anywhere account will automatically receive an email the first day of High School Info Night the week with a link to access our weekly Pony materials. (8th Grade Families) Tuesday, October 2nd, 6-7PM Your family can choose NOT to receive our paper Pony materials each week, by OPTING-OUT using Noon Dismissal the the link below. PAS will continue to send home Friday, October 5th paper copies of forms/slips that need to be returned. Fall Festival Thursday, October 11th https://tinyurl.com/PonyOptOut !1 Penn Alexander School Week of September 11 Please join us! Interested in volunteering at PAS? Check out the MySchool Anywhere Application and click on “Sign-Ups” to volunteer.
    [Show full text]