Why Data Citation Is a Computational Problem

Why Data Citation Is a Computational Problem

Why Data Citation is a Computational Problem Susan B. Davidson University of Pennsylvania Work partially supported by NSF IIS 1302212, NSF ACI 1547360 NIH 3-U01-EB-020954-02S1 Outline ¤ The power of abstraction ¤ And how it has helped with two of my favorite problems in bioinformatics ¤ New problem: data citation ¤ Bigger picture: Data Science 2 The power of abstraction ¤ The “right” abstraction is key to developing solutions to many practical problems. ¤ Data Integration ¤ Provenance ¤ …. ¤ Data Citation ¤ Developing the right abstraction requires close collaboration between end-users, systems builders, and theoreticians. 3 3 9 t 42 41 40 39 h 38 37 36 34 33 32 31 30 29 S t t t t t t t 4 t t y e r e e e e e 0 e e a e e e e e e e r t e e r e r r r t r h w r t r t t t t t t t s S S S S S S S s S S t t e h h h d d r r Advanced h s t h t t r e t t n p 1 7 Mabel Pew Care 0 8 3 e 6 4 2 x 3 3 3 3 Pavilion 3 4 t 3 Myrin 3 3 1 Pavilion E s l l 4 t Wright/Saunders i 2 k n S Building Cupp l y d t r Pavilion u t e h e S e 3810 c e t t r r S t e S e Presbyterian I t Scheie Medical Medical Center I d Eye Medical r Science of the Office Bldg 3 Research Institute University of 4 Lab Pennsylvania Health System Heart Andrew Parking Institute 30th Street Station JFK Boulevard Mutch Bldg Garage ue Aven elton Pow DatabasesFilbert Street meets bioinformatics Medical 3737 3711 3701 3665 3535 3501 3401 3100 Arts J Bldg J 3615 Market Street Market Street 3750 3700 3624 3550 3508 3500 3440 3600 University City Science Center Ludlow Street 4124 Ludlow Ralston IRS House Axis 3335 Chestnut Garage 4039 The St. Leonard's Chestnut 34 Complex K Chestnut Hub International Sheraton Dom“Genomicsus is the next moon landing.” K House Hub New University 4111-25 3939 Chestnut Ralston City House Chestnut Street Chestnut Street y Sansom a Greenfield English Place W Evo 4026-40 0 Center Nichols Gittis Hall HUP 1 4212 s College Cira Center West ' 9 (1992) Newman Chestnut y House US Post Office Offices 3 House New South Chestnut Center a 4258 r Kings Tanenbaum Silverman r College Hall 4101 u Court Hall Hall House 4059 M ICA Christian e Golkin Hall Horizon v House Cira Center Assoc. e t The Left Bank Highline South Sansom Street S Hill Field Garage McNeil Square 3808 Franklin Early Garage American 125 S. 31st Street L Walnut 40 Annex ( Translational Research ) Singh 3201 L 2 4015 Module 6 6 4 0 8 4 4 3 3 3 2 1 3 2 Walnut 4109 Retail Pottruck Hill Nanotechnology Walnut 3 The Radian F Center Garage 3 Inn at Penn College FMC Tower Fresh F F 119 S. 38th L.R.S.M 3025 9 3901 F Garage 30 Perelman Franklin 3401 House Walnut 32 3101 Grocer 3 3815 Walnut AFSCME S F F Walnut S F 3809 Bookstore Center for Building Walnut F Walnut Political ( WXPN ) Science and Economics 0 8 4 2 Walnut Street 6 Walnut Street 0 0 0 0 0 1 1 1 1 1 4 4 4 4 4 President's Grad e F S F Philadelphia Du Bois College House Grad School Jaffe Fisher Jones Way Lower Walnut Street r House Annenberg Addams Research Free of Education Dietrich History Bennett a 4126-38 Cinema School Hall Van Pelt Wing Library Fox-Fels 3808-10 Graduate of Art Hall u Walnut Annenberg Moore David Library Library School Class of 1923 q Hall Center Rittenhouse Rotunda Levine Ice Rink S Solomon Labs 206 Jon M. Labs Annenberg Meyerson Hall Skirkanich 3216 s Hillel at Huntsman Psychology PPC Lerner Hall Chancellor k Shops Stiteler F Hall Ctr r Steinhardt Hall Rodin Hall a at 40th Hall Perry Colonial 212 Street College World F The M M Penn Towne Building ARCH 7 M Hamilton House F House 3615 Sweeten Hecht F 3 Morgan . Caster Locust Ctr F 3609 F 5 t Village F 3619 Alumni Bldg Palestra Tennis Building House 3611 3 Blanche P. Levy Park S Kelly House Center Writers Robbins Fisher Locust Street Locust Walk House House Fine Arts Smith Walk Shoemaker Library Green 4032 250 S Dunning-Cohen Ace Adams Levy St Mary's Harnwell F F 36th Hayden Hall Champions Oral Health Class of Vagelos Field Church College Duhring Dunning Field Sadie Tanner Mossell Alexander Civic 1920 McNeil Steinberg Hall Labs Hutchinson House Commons Steinberg College Hall Wing Coaches’ University of Pennsylvania House Building Dietrich Hall IAST Ctr Gymnasium Partnership School Schattner Class of 1925 Conference Lauder- Center House Center Fischer Parent Infant Cohen Center F Steinhardt Perelman Quad Ringe Lehman Brothers Quad Hall 1958 N Spruce Berkshire 3907 235 S. 39th Plaza Wynn Commons Wing Weightman Squash Crt N Harrison Mack Plaza Wood Apts College Irvine Hall Evans Garage Chemistry Apts House Wistar Auditorium Spruce Building Spruce 38 Houston Hall 1973 Paley 3905 Institute Wing Cret Penn Park House Spruce Van Pelt Mayer Vance Hall Williams Hall Wing Bridge College House Residence Hall Multi-Purpose Hall Stadium Spruce Street Franklin Field e r S F F S F F F Rosenthal a Penn Kane S Building Stouffer u Transplant F Hospital Park College q House of the House S 301 3920 University of Pennsylvania Hamlin Tennis Center O Delancey s Health System O k F r 3918 The Quadrangle a Surrey Matthew J. Ryan School of Rhoads M Veterinary Veterinary Pavilion . Hall Hospital Weave t Medicine of the UofP Bridge S Old Quad Museum of y Pine Street Hamilton Walk Archaeology and a Anthropology South Green w s Johnson Stemmler e s Leidy e John Morgan Building Hall u r Labs n p Hill Pavilion Goddard Richards Building University University e x 4200 Pine Museum Museum v E Labs Building l Academic Garage A il Children's Hospital Wing n k r 4219 l e Levin Building of Philadelphia io y Osage Avenue t u iv Claire M. n h R P Fagin Hall Clinical e c ll P Anatomy Research v S i E n k Kaskey Chemistry Building a 6 l Webster Manor Cyclotron s Child New Patient o -7 y Park t C u Stellar- S Guidance Pavilion University I h Carolyn Chance Center c Lynch e City Laboratories r Station Hollenback S Labs Wood Pediatric v Center ic Ambulatory Care e O Center ve Blockley D ri Hall s r D le iv Hollenback n BRB 2 r e Perelman Center For Annex a C + Advanced Medicine i d ir Children's ar The c Seashore Roberts e u Consortium l House nu rd e E Proton ve G a Curie A v a Jordan Medical re le Garage s mo u t Education Center lti Veterans o rd Buerger S Ba Administration B a e Smilow Rhodes Q e v Center For r Center for South Street Medical Center ri Philadelphia le Advanced v Field u Abramson u ic Translational Center For o Pediatric e Research C Health Care Sciences Pediatric B Research r Care D e r e U Medical t i u n v n Q n Examiners e e C e i Building Stewart v v ic Field A e v i ll r C i s k i VA l t y e y Nursing Vagelos venu W e u r A A Home e v Field h este s ri c h v C t D S e S s n e Colket ce u rv Research n e e ic Center ci e S R D h r lt iv ea UPHS e H Medical Parking Garage R Mondschein Field UofP / CHOP Medical Parking Garage 51 ve s Dri Field S River S Module 7 Meiklejohn Stadium e u n e v A d n T a T l d o o W 4 272 179 192 Pennovation Center y 212 a w s University of Pennsylvania s e r p Facilities and Real Estate Services : Office of the University Architect x E © Trustees of the University of Pennsylvania l l i h t t k Revised: 02/24/16 Pennovation Works l r e y o 3401 Grays Ferry Avenue e r u N t h Feet 150 300 450 600 227 S c S Grays Ferry Avenue h t 6 Meters 50 100 150 200 4 7 - 3 I 197 42 41 40 39 38 37 36 34 33 32 31 30 29 Example 1: Data Integration Entrez Sequence Image Data Id Date & Time Image >gi|2580555|gb|AF000985.1|HSAF000985 Homo sapiens dead box, Y isoform (DBY) ? mRNA, alternative transcript 1, complete cds spdfld13a 9/8/95 12:02:03 CCAGTGTAAGAGTTCCGCTATTCGGTCTCACACCTACAGTGGACTACCCGATTTTTCGCTTCTCTTCAGG GATGAGTCATGTGGTGGTGAAAAATGACCCTGAACTGGACCAGCAGCTTGCTAATCTGGACCTGAACTCT GAAAAACAGAGTGGAGGAGCAAGTACAGCGAGCAAAGGGCGCTATATACCTCCTCACTTAAGGAACAAAG AAGCATCTAAAGGATTCCATGATAAAGACAGTTCAGGTTGGAGTTGCAGCAAAGATAAGGATGCATATAG spdfld22a 9/8/95 12:02:04 CAGTTTTGGGTCTCGAGATTCTAGAGGAAAGCCTGGTTATTTCAGTGAACGTGGAAGTGGATCAAGGGGA ... spdfld22a 9/8/95 12:02:06 Relational Databases Name P Value Len HT97683 0 2182 Integrating Query: Q62167 3.1e-234 440 P16381 4.2e-230 440 What genes are involved in P24346 4.2e-214 440 P066346 2.6e-127 423 bipolar schizophrenia? Entrez Medline Object-Oriented Databases Genome Sequence of the Nematode C. elegans: A Platform for Investigating Biology. 3 SCIENCE Volume 282 (5396): 2012 - 2018 8 Issue of 11 Dec 1998 The C.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    62 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us