Molecular Identification of Some Forensically Important Blowflies of Southern Africa and Australia

View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by South East Academic Libraries System (SEALS) Molecular identification of some forensically important blowflies of southern Africa and Australia M. L. Harvey, M. W. Mansell, M. H. Villet and I. R. Dadour Centre for Forensic Science, University of Western Australia, Australia Department of Zoology and Entomology, University of Pretoria, South Africa Department of Zoology and Entomology, Rhodes University, South Africa Abstract One major aspect of research in forensic entomology is the investigation of molecular techniques for the accurate identification of insects. Studies to date have addressed the corpse fauna of many geographical regions, but generally neglected the southern African calliphorid species. In this study, forensically significant calliphorids from South Africa, Swaziland, Botswana and Zimbabwe and Australia were sequenced over an 1167 base pair region of the COI gene. Phylogenetic analysis was performed to examine the ability of the region to resolve species identities and taxonomic relationships between species. Analyses by neighbour-joining, maximum parsimony and maximum likelihood methods all showed the potential of this region to provide the necessary species-level identifications for application to post-mortem interval (PMI) estimation; however, higher level taxonomic relationships did vary according to method of analysis. Intraspecific variation was also considered in relation to determining suitable maximum levels of variation to be expected during analysis. Individuals of some species in the study represented populations from both South Africa and the east coast of Australia, yet maximum intraspecific variation over this gene region was calculated at 0.8%, with minimum interspecific variation at 3%, indicating distinct ranges of variation to be expected at intra- and interspecific levels. This region therefore appears to provide southern African forensic entomologists with a new technique for providing accurate identification for application to estimation of PMI. Introduction Forensic entomology has been an important investigative tool for many years, particularly through its use in court trials in providing an estimation of post-mortem interval (PMI) in homicide cases. This application of entomology to investigations demands great accuracy in PMI estimations, resulting in significant research addressing this issue. The correct identification of specimens is a critical prerequisite in the estimation of PMI using insects, but this may be difficult using the traditional morphology-based approach (Prins, 1982; Wallman, 2001). Several studies have addressed this issue by using DNA sequences to identify insects, most choosing to use mitochondrial DNA (mtDNA) as the basis for sequencing (Sperling et al., 1994; Malgorn & Coquoz, 1999; Wallman & Donnellan, 2001; Wells & Sperling, 2001; Harvey et al., 2003). These studies have revealed the potential for the use of mtDNA in providing more accurate identifications for the estimation of PMI. The majority of literature in the field of forensic entomology has addressed the corpse fauna of the United States, Europe, Britain and Australia, but generally neglected Africa. In southern Africa, forensic entomology is being increasingly incorporated into death investigations (M. Mansell, pers. obs.). To date, southern African research has focused largely on the succession of insects on corpses (Louw & van der Linde, 1993), and a few studies have considered the succession on animal carcasses that may be applied to human corpse succession (Meskin, 1986; Braack & De Vos, 1987; Ellison, 1990). Despite increased interest in forensic entomology, DNA-based identification still remains a curiosity rather than an application in southern Africa. This is largely a result of the small amount of genetic data collected on the forensically significant species. A robust typing method requires a large body of data to ensure that characters used to distinguish species are represented among all populations of a species, and consequently to consider the intraspecific variation that may be observed across the distribution of a species. The usefulness of such information becomes evident as several African insects associated with carcasses have now been identified from South America (Lawrence, 1986). mtDNA is recognized as being useful for evolutionary study because of its relatively higher mutation rate than nuclear DNA (Hoy, 1994), and also the presence of both conserved and variable segments. Evolutionary studies of forensically important Calliphoridae using phylogenetic techniques allow visualization of relationships between species, based on levels of similarity in sequence data. Such relationships are useful to elucidate, as they often reflect the morphological and behavioural discrepancies observed in the field and provide a greater understanding for entomologists of potential pitfalls in data. This may be in the discovery of species complexes, or simply in the phylogenetic confirmation of the genetic separation of two highly similar species over which species status may be questioned. The potential of the cytochrome oxidase I (COI) encoding region of mtDNA has been shown to be useful for identification in many studies (e.g. Sperling et al., 1994; Malgorn & Coquoz, 1999). Various segments of this region have been sequenced in different studies, ranging from 278 base pairs to the entire COI gene. This study considered the use of a 1167-bp region of the COI gene for identification of forensically important calliphorids in southern Africa. The region encompassed the 278-bp segment used by Harvey et al. (2003) and the 639 sites used by Wallman & Donnellan (2001) to provide successful distinction with the Australian corpse fauna. Flies from Botswana, South Africa, Swaziland, Zambia and Zimbabwe were sequenced and phylogenetic analyses used to construct evolutionary relationships between them. Species sequenced were Chrysomya albiceps (Wiedemann), C. megacephala (Fabricius), C. putoria (Wiedemann), C. marginalis (Wiedemann), C. inclinata Walker and Lucilia sericata (Meigen). Forensically significant Australian species from the subfamilies Chrysomyinae and Luciliinae were included in order to test intraspecific variation for species also found in southern Africa. Specimens of C. rufifacies (Macquart), C. varipes (Macquart) and L. cuprina (Wiedemann) were also included, along with the muscid Hydrotaea rostrata (Robineau-Desvoidy). Hydrotaea rostrata was included primarily for its forensic relevance, but also as an outgroup. Although a sarcophagid species may have formed a more suitable outgroup, there were no sequences available of sufficient length and thus a more distantly related muscid was chosen. The Calliphorinae, although commonly found on corpses in Australia, are only represented by Calliphora croceipalpis Jaennicke and C. vicina Robineau-Desvoidy in southern Africa and were not included in this analysis. The potential of the COI encoding region for use in identification of flies for PMI estimation based on insects is discussed. Materials and methods Samples Adult flies were used in this study as adult morphological characters allowed more rapid and accurate identification to species level than larval characters. Specimens were identified using keys and characters in Zumpt (1965). Origins of specimens are shown in Table 1. Flies were trapped in Botswana, South Africa, Swaziland, Zambia and Zimbabwe, and Australian specimens were taken from laboratory colonies or trapped using liver- baited traps. Specimens were preserved in 70% ethanol and refrigerated. DNA extraction Extraction was performed using a Chelex 100 (Bio-Rad, Australia) technique modified from Hunt (1997). An incision was made under the left wing of each specimen, and flight muscles removed and macerated. In a few specimens flight muscles had degraded and, consequently, a single wing of the fly was used for extraction. The remainder of the specimen was then stored in ethanol and refrigerated, as a voucher specimen. The muscle or wing was then frozen using liquid nitrogen and ground to a fine powder using micropestles in 1.5-mL Eppendorf tubes. One hundred microlitres of a 5% solution of Chelex was added to the ground material, vortexed and incubated for 15 min on a 95°C heatblock. Following incubation, the sample was vortexed for 5 s, and centrifuged for 3 min at maximum speed. The supernatant was removed and stored at −20°C. PCR conditions and purification of PCR products The primers used amplified a region of approximately 1270 bp. Primers were C1-J-1718 (5'-3' GGAGGATTTGGAAATTGATTAGTTCC) and TL2-N-3014 (5'-3' TCCAATGCACTAATCTGCCATATTA) (Simon et al., 1994). The PCR reaction mix consisted of: 1 × PCR buffer (Biotools, South Africa), 200 µM dNTPs (Biotools), 1.5 mM MgCl2, 25 pM each primer and 3 µL template DNA, and water added to a total volume of 50 µL. A Perkin Elmer GeneAmp PCR System 2400 thermocycler was used. The programme began with a 90-s 94°C denaturation period, followed by 36 cycles of: 94°C for 22 s, 48°C for 30 s and 72°C for 80 s. A final extension period of 60 s at 72°C was used, followed by storage at 4°C. Electrophoresis of PCR products was performed using 1.5% agarose gels with ethidium bromide staining. Products were purified using the High Pure PCR Product Purification Kit (Roche), with elution in 50 µL of water as opposed to the elution buffer supplied by the manufacturer. Sequencing Sequencing reactions were

Load more