Medical and Veterinary Entomology (2003) 17, 363–369

Molecular identification of some forensically important blowflies of southern Africa and Australia

M.L.HARVEY,M.W.MANSELL* ,M.H.VILLETy andI.R.DADOUR Centre for Forensic Science, University of Western Australia, Australia, *Department of Zoology and Entomology, University of Pretoria, South Africa, and yDepartment of Zoology and Entomology, Rhodes University, South Africa

Abstract. One major aspect of research in forensic entomology is the investigation of molecular techniques for the accurate identification of . Studies to date have addressed the corpse fauna of many geographical regions, but generally neglected the southern African calliphorid species. In this study, forensically significant calliphorids from South Africa, Swaziland, Botswana and Zimbabwe and Australia were sequenced over an 1167 base pair region of the COI gene. Phylogenetic analysis was performed to examine the ability of the region to resolve species identities and taxonomic relationships between species. Analyses by neigh- bour-joining, maximum parsimony and maximum likelihood methods all showed the potential of this region to provide the necessary species-level identifications for application to post-mortem interval (PMI) estimation; however, higher level taxonomic relationships did vary according to method of analysis. Intraspecific variation was also considered in relation to determining suitable maximum levels of variation to be expected during analysis. Individuals of some species in the study represented populations from both South Africa and the east coast of Australia, yet maximum intraspecific variation over this gene region was calculated at 0.8%,with minimum interspecific variation at 3%, indicating distinct ranges of variation to be expected at intra- and interspecific levels. This region therefore appears to provide southern African forensic entomologists with a new technique for providing accurate identification for application to estimation of PMI. Key words. Calliphora, , Hydrotaea, Lucilia, , Blowflies, Cytochrome oxidase I gene, forensic entomology, mitochondrial DNA, Australia, Botswana, South Africa, Swaziland, Zambia, Zimbabwe.

Introduction have addressed this issue by using DNA sequences to iden- tify insects, most choosing to use mitochondrial DNA Forensic entomology has been an important investigative (mtDNA) as the basis for sequencing (Sperling et al., 1994; tool for many years, particularly through its use in court Malgorn & Coquoz, 1999; Wallman & Donnellan, 2001; trials in providing an estimation of post-mortem interval Wells & Sperling, 2001; Harvey et al., 2003). These studies (PMI) in homicide cases. This application of entomology to have revealed the potential for the use of mtDNA in pro- investigations demands great accuracy in PMI estimations, viding more accurate identifications for the estimation of resulting in significant research addressing this issue. PMI. The correct identification of specimens is a critical pre- The majority of literature in the field of forensic entom- requisite in the estimation of PMI using insects, but this ology has addressed the corpse fauna of the United States, may be difficult using the traditional morphology-based Europe, Britain and Australia, but generally neglected approach (Prins, 1982; Wallman, 2001). Several studies Africa. In southern Africa, forensic entomology is being increasingly incorporated into death investigations (M. Mansell, pers. obs.). To date, southern African research Correspondence: M. L. Harvey, Centre for Forensic Science, has focused largely on the succession of insects on corpses University of Western, Australia, Stirling Highway, Nedlands WA (Louw & van der Linde, 1993), and a few studies have 6907, Australia. E-mail: [email protected] considered the succession on carcasses that may be

# 2003 The Royal Entomological Society 363 364 M. L. Harvey et al. applied to human corpse succession (Meskin, 1986; Braack & more distantly related muscid was chosen. The Calliphor- De Vos, 1987; Ellison, 1990). Despite increased interest in inae, although commonly found on corpses in Australia, are forensic entomology, DNA-based identification still only represented by Calliphora croceipalpis Jaennicke and remains a curiosity rather than an application in southern C. vicina Robineau-Desvoidy in southern Africa and were Africa. This is largely a result of the small amount of genetic not included in this analysis. The potential of the COI data collected on the forensically significant species. A encoding region for use in identification of for PMI robust typing method requires a large body of data to estimation based on insects is discussed. ensure that characters used to distinguish species are repre- sented among all populations of a species, and consequently to consider the intraspecific variation that may be observed Materials and methods across the distribution of a species. The usefulness of such information becomes evident as several African insects Samples associated with carcasses have now been identified from South America (Lawrence, 1986). Adult flies were used in this study as adult morphological mtDNA is recognized as being useful for evolutionary characters allowed more rapid and accurate identification to study because of its relatively higher mutation rate than species level than larval characters. Specimens were identified nuclear DNA (Hoy, 1994), and also the presence of both using keys and characters in Zumpt (1965). Origins of speci- conserved and variable segments. Evolutionary studies of mens are shown in Table 1. Flies were trapped in Botswana, forensically important Calliphoridae using phylogenetic South Africa, Swaziland, Zambia and Zimbabwe, and techniques allow visualization of relationships between Australian specimens were taken from laboratory colonies species, based on levels of similarity in sequence data. or trapped using liver-baited traps. Specimens were preserved Such relationships are useful to elucidate, as they often in 70% ethanol and refrigerated. reflect the morphological and behavioural discrepancies observed in the field and provide a greater understanding for entomologists of potential pitfalls in data. This may be DNA extraction in the discovery of species complexes, or simply in the phylogenetic confirmation of the genetic separation of two Extraction was performed using a Chelex 100 (Bio-Rad, highly similar species over which species status may be Australia) technique modified from Hunt (1997). An inci- questioned. sion was made under the left wing of each specimen, and The potential of the cytochrome oxidase I (COI) encod- flight muscles removed and macerated. In a few specimens ing region of mtDNA has been shown to be useful for flight muscles had degraded and, consequently, a single identification in many studies (e.g. Sperling et al., 1994; wing of the was used for extraction. The remainder of Malgorn & Coquoz, 1999). Various segments of this region the specimen was then stored in ethanol and refrigerated, as have been sequenced in different studies, ranging from 278 a voucher specimen. The muscle or wing was then frozen using base pairs to the entire COI gene. This study considered the liquid nitrogen and ground to a fine powder using micropestles use of a 1167-bp region of the COI gene for identification of in 1.5-mL Eppendorf tubes. One hundred microlitres of a 5% forensically important calliphorids in southern Africa. The solution of Chelex was added to the ground material, vortexed region encompassed the 278-bp segment used by Harvey and incubated for 15 min on a 95C heatblock. Following et al. (2003) and the 639 sites used by Wallman & Donnellan incubation, the sample was vortexed for 5 s, and centrifuged (2001) to provide successful distinction with the Australian for 3 min at maximum speed. The supernatant was removed corpse fauna. andstoredat20C. Flies from Botswana, South Africa, Swaziland, Zambia and Zimbabwe were sequenced and phylogenetic analyses used to construct evolutionary relationships between them. PCR conditions and purification of PCR products Species sequenced were Chrysomya albiceps (Wiedemann), C. megacephala (Fabricius), C. putoria (Wiedemann), The primers used amplified a region of approximately C. marginalis (Wiedemann), C. inclinata Walker and Lucilia 1270 bp. Primers were C1-J-1718 (50-30 GGAGGATTTG- sericata (Meigen). Forensically significant Australian GAAATTGATTAGTTCC) and TL2-N-3014 (50-30 TCCA- species from the subfamilies Chrysomyinae and Luciliinae ATGCACTAATCTGCCATATTA) (Simon et al., 1994). were included in order to test intraspecific variation for The PCR reaction mix consisted of: 1 PCR buffer species also found in southern Africa. Specimens of (Biotools, South Africa), 200 mM dNTPs (Biotools), 1.5 mM C. rufifacies (Macquart), C. varipes (Macquart) and MgCl2,25pM each primer and 3 mL template DNA, and L. cuprina (Wiedemann) were also included, along with water added to a total volume of 50 mL. A Perkin Elmer the muscid Hydrotaea rostrata (Robineau-Desvoidy). GeneAmp PCR System 2400 thermocycler was used. The Hydrotaea rostrata was included primarily for its forensic programme began with a 90-s 94C denaturation period, relevance, but also as an outgroup. Although a sarcophagid followed by 36 cycles of: 94C for 22 s, 48C for 30 s and species may have formed a more suitable outgroup, there 72C for 80 s. A final extension period of 60 s at 72C was were no sequences available of sufficient length and thus a used, followed by storage at 4C. Electrophoresis of PCR

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369 COI of southern African and Australian Calliphoridae 365

Table 1. Individuals included in study with locality and accession Sequencing number. Sequencing reactions were performed using the ABI Species Locality Accession no. PRISM Big Dye Terminator 3.0 Sequencing Kit (Perkin KwaZulu-Natal, AB112830 Elmer) under recommended cycling conditions, but with South Africa the annealing temperature lowered to 48C. The external Pretoria, South Africa AB112848 primers were C1-J-1718 and TL2-N-3014, and the internals Kitwe, Zambia AB112861 0 0 Kitwe, Zambia AB112856 were C1-J-2183 (5 -3 CAACATTTATTTTGATTTTTTGG) 0 0 Brisbane, Australia AB112841 and C1-N-2329 (5 -3 ACTGTAAATATATGATGAGCTCA) Perth, Australia AB112846 (Simon et al., 1994). Sequences were compiled using the Perth, Australia AB112847 ABI 3100 and ABI 377 systems. Analysis was performed Chrysomya inclinata KwaZulu-Natal, AB112857 using Sequence Navigator software (v1.01, Applied Biosys- South Africa tems), Chromas v1.43 (http://trishul.sci.gu.edu.au/conor/ Chrysomya putoria Kitwe, Zambia AB112831 chromas.html) and DAPSA (University of Cape Town). Kitwe, Zambia AB112860 Phylogenetic analysis was performed using MEGA 2.0 Snake Island, Botswana AB112835 (Kumar et al., 2001) and PAUP*4.0 (Swofford, 2002) soft- Snake Island, Botswana AB112855 ware packages. Sequences were submitted to GenBank (see Chrysomya marginalis Pretoria, South Africa AB112832 Pretoria, South Africa AB112838 Table 1 for accession numbers). KwaZulu-Natal, AB112837 South Africa KwaZulu-Natal, AB112834 South Africa Analysis Karoo, South Africa AB112866 Karoo, South Africa AB112862 Both neighbour-joining and maximum parsimony tech- Chrysomya albiceps Pretoria, South Africa AB112839 niques were used for analysis to compare the results of both Pretoria, South Africa AB112840 distance and discrete methods. Sequences were tested KwaZulu-Natal, AB112842 for purifying selection using the Z-test option in MEGA. South Africa Neighbour-joining analysis was performed using the KwaZulu-Natal, AB112836 Tamura-Nei model of substitution and bootstrapping South Africa (n ¼ 500) conducted using MEGA. A heuristic maximum par- Manzini, Swaziland AB112865 Manzini, Swaziland AB112851 simony search was conducted and bootstrapped (50 repli- Manzini, Swaziland AB112854 cates). The maximum likelihood analysis was performed Deka, Zimbabwe AB112858 using the HKY85 model of substitution with starting trees Deka, Zimbabwe AB112849 derived from parsimony, and the transition/transversion Chrysomya rufifacies Perth, Australia AB112828 ratio and gamma shape parameter estimated. Parsimony Perth, Australia AB112845 and likelihood analyses were conducted in PAUP*. Hydro- Chrysomya varipes Perth, Australia AB112869 taea rostrata was the outgroup in all analyses. Perth, Australia AB112867 Perth, Australia AB112868 Lucilia cuprina Perth, Australia AB112852 Perth, Australia AB112853 Results Perth, Australia AB112863 Lucilia sericata Graaf-Reinet, AB112850 Calliphorid sequences from 41 flies were successfully South Africa sequenced and aligned with that of one muscid individual. Graaf-Reinet, AB112843 The sequences corresponded to positions 1776–2942 of South Africa Drosophila yakuba (GenBank accession number NC_001322). Pretoria, South Africa AB112859 No insertions or deletions were identified within the aligned Pretoria, South Africa AB112864 sequences. Of 1167 bp analysed, 287 of these positions Harare, Zimbabwe AB112844 Perth, Australia AB112833 were variant and, of these, 211 were parsimony-informative Hydrotaea rostrata Perth, Australia AB112829 characters. (Muscidae) The nucleotide composition showed much higher fre- quencies of adenine (A) and thymine (T) at 40% and 30% of total nucleotide composition as compared with 15% cytosine (C) and 15% guanine (G). The sequences were products was performed using 1.5% agarose gels with ethi- also tested for purifying selection using a Z-test, comparing dium bromide staining. Products were purified using the the relative abundance of synonymous and non-synonymous High Pure PCR Product Purification Kit (Roche), with substitutions, indicating that in general purifying selection elution in 50 mL of water as opposed to the elution buffer appears to have acted on the sequences with synonymous supplied by the manufacturer. changes far exceeding non-synonymous substitutions.

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369 366 M. L. Harvey et al.

Pairwise divergence between species was calculated and is Intraspecific variation was relatively low. Maximum expressed as percentages in Table 2. Variation was calcu- values observed between individuals of each species are lated based on an average computed from all individuals of displayed in Table 3. The highest level was observed in the species. Hydrotaea rostrata, a muscid included as an C. varipes at 0.8%, in individuals collected from one loca- outgroup, displayed 12.83–15.7% variation from all calli- tion and presumably members of a single population. phorid species. The lowest interspecific variation was Chrysomya putoria individuals from Botswana and Zambia between the two sister species pairings of L. sericata and displayed 0.6% variation. Despite representatives from mul- L. cuprina at 3%, and C. rufifacies and C. albiceps at 3.5%. tiple countries in the C. megacephala, C. albiceps and At a higher level, the subfamilies Chrysomyinae and Luci- L. sericata samples, very little intraspecific variation was liinae displayed greater than 8% variation across all species. observed. The tree resulting from neighbour-joining analysis is Chrysomya marginalis showed a small separation between shown in Fig. 1. Maximum parsimony analysis returned 20 the Pretoria (urban) and other specimens. Similar division possible trees, all reflecting identical topologies. The con- was shown between C. megacephala from Brisbane (east sensus tree was computed, and the bootstrapped version coast), and the Perth (west coast) and African individuals. resulted in the same tree as gained using neighbour-joining. Maximum likelihood analysis also returned a similar tree (data not shown). Likelihood analysis was performed using Discussion the HKY85 model in PAUP*, using unequal base frequencies. The gamma distribution shape-parameter and transition/ The high adenine and thymine frequencies observed in the transversion ratio were estimated from the data as 0.11567 sequences are often characteristic of mtDNA, includ- and 2.42, respectively. ing the Diptera (Lewis et al., 1995; Bernasconi et al., 2000). The trees produced using both the distance and the dis- Considering that the sequences are protein coding, purify- crete methods of analysis yielded very similar topologies. ing selection to minimize non-synonymous changes within The subfamily status was well supported, with the Lucilii- the sequence is not surprising. The outgroup was quite nae displaying 100% support in all analyses, and the species distant from the calliphorids, as expected because the of the Chrysomyinae also grouping together, but with lower Muscidae and Calliphoridae are representative families support. In almost all analyses, individuals of each species from different superfamilies. received bootstrap support of 100%, indicating the strong In searching for a possible diagnostic tool for use in basis for species distinction. The major discrepancy between forensic investigations, the method selected needs to be the results came in the grouping of C. varipes with the robust. In molecular-based identification, a specimen may closely related C. rufifacies and C. albiceps under likelihood, be identified by similarity and difference in the sequence yet with the other Chrysomya species under neighbour- when compared with other individuals. Such a method will joining and maximum parsimony. However, when the likeli- be a useful identification tool only if a reference sample hood trees were bootstrapped, C. varipes reverted to grouping from the same species is present in the sequence database, with the other Chrysomya species. necessitating thorough knowledge of all species likely to be Chrysomya rufifacies and C. albiceps formed a single attracted to decomposing organic matter in a region (Wells grouping with strong support, but separated into two dis- & Sperling, 2001). In the absence of an appropriate refer- tinct species groups. The morphologically similar C. putoria ence sample, the individual will simply group with the most and C. inclinata also formed a separate grouping, and closely matched reference sample. It is consequently useful C. varipes was a comparatively isolated group within the to have indications of levels of interspecific and intraspecific Chrysomyinae. Lucilia sericata and L. cuprina also sepa- variation to be expected in making an identification based rated to form species groupings with full bootstrap support. on sequence data, so that pairwise distances may be used as

Table 2. Pairwise divergence between species expressed as a percentage of 1167 base pairs.

H. C. C. C. C. C. C. C. L. rostrata rufifacies albiceps inclinata putoria megacephala marginalis varipes sericata H. rostrata C. rufifacies 13.5 C. albiceps 12.8 3.5 C. inclinata 15.7 8.8 8.1 C. putoria 14.8 7.7 7 3.6 C. megacephala 14.9 7.3 6.6 5.1 4.9 C. marginalis 14.6 7.5 7.8 5.7 4.4 5.4 C. varipes 14.5 8.3 7.3 6.9 6.8 6.8 6.6 L. sericata 14 10.7 10.1 9.4 9.1 8.3 8.2 9.7 L. cuprina 13.9 10.1 9.5 9.4 9.5 8.5 8.7 9.9 3

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369 COI of southern African and Australian Calliphoridae 367

Ch.albiceps (Pretoria, RSA) Ch.albiceps (Natal, RSA) 65 Ch.albiceps (Manzini, Swaziland) Ch.albiceps (Manzini, Swaziland) 46 Ch.albiceps (Natal, RSA) Ch.albiceps (Deka, Zimbabwe) 100 Ch.albiceps (Manzini, Swaziland) 49 100 Ch.albiceps (Pretoria, RSA) Ch.albiceps (Deka, Zimbabwe) Ch.rufifacies (Perth, Australia) 100 Ch.rufifacies (Perth, Australia) 41 Ch.varipes (Perth, Australia) 64 100 Ch.varipes (Perth, Australia) Ch.varipes (Perth, Australia) Ch.megacephala (Natal, RSA) Ch.megacephala (Perth, Australia) 93 Ch.megacephala (Perth, Australia) Ch.megacephala (Natal, RSA) 72 100 Ch.megacephala (Kitwe, Zambia) Ch.megacephala (Pretoria, RSA) Ch.megacephala (Brisbane, Australia) 63 Ch.putoria (SnakeIs, Botswana) 100 Ch.putoria (SnakeIs, Botswana) 84 89 Ch.putoria (Kitwe, Zambia) 91 Ch.putoria (Kitwe, Zambia) Ch.inclinata (Natal, RSA) 79 Ch.marginalis (Pretoria, RSA) Ch.marginalis (Natal, RSA) 100 Ch.marginalis (Natal, RSA) Ch.marginalis (Karoo, RSA) 88 Ch.marginalis (Karoo, RSA) Ch.marginalis (Pretoria, RSA) L.cuprina (Perth, Australia) 100 L.cuprina (Perth, Australia) L.cuprina (Perth, Australia) 100 L.sericata (Graaf-Reinet, RSA) L.sericata (Perth, Australia) 100 L.sericata (Pretoria, RSA) L.sericata (Pretoria, RSA) 69 L.sericata (Graaf-Reinet, RSA) L.sericata (Harare, Zimababwe) H.rostrata (Perth, Australia)

0.02

Fig. 1. Neighbour-joining tree with branch lengths and bootstrap support for calliphorid species of forensic importance.

a confirmation of validity to support both the morpholo- Table 3. Maximum intraspecific variation for each species gical and the molecular-based analyses conducted. Defined expressed as a percentage of 1167 base pairs (species represented levels of intra- and interspecific variation that can be by a single individual omitted). expected in identifications will provide such a confirmation. Species % variation within species Morphologically, calliphorids are generally simple to C. rufifacies 0.1 identify to subfamily level, and the molecular data here C. albiceps 0.2 support the separation of the Chrysomyinae and Luciliinae. C. putoria 0.6 Chyrsomya rufifacies and C. albiceps, and L. cuprina and C. megacephala 0.3 L. sericata, are recognized as being difficult to distinguish C. marginalis 0.3 morphologically (Stevens & Wall, 1996; Wells & Sperling, C. varipes 0.8 1999), and over this 1167-bp region displayed 3.5% and 3% L. sericata 0.1 variation, respectively. The maximum intraspecific vari- L. cuprina 0 ation was 0.8%, showing a distinct separation between

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369 368 M. L. Harvey et al. individuals of different populations of a species, and a appear clearly defined. Population-level studies will perhaps separate species altogether. This supports the finding of allow identification of the geographical provenance of flies Wells & Sperling (2001) of interspecific divergence of in investigations, as well as any possible subspecies that may 3%, and intraspecific divergence of 1% in a number of complicate identification. Further studies will also need to forensically significant calliphorid species. Thus calculation consider other forensically significant species in southern of pairwise differences between individuals should provide a Africa, such as Calliphora croceipalpis Jaennicke and useful indication of the validity of a grouping in an analysis. Chrysomya chloropyga (Weidemann). COI sequence data The phylogenetic analyses by all three methods produced appear to provide a strong basis for species identification, similar results, all supporting the subfamily separation and and will prove an invaluable contribution to forensic ento- distinct clustering of individuals with conspecific individ- mology as an investigative tool in southern Africa. uals. The strong bootstrap support through all techniques indicates the robust nature of the region for use in providing distinction between species. Acknowledgements The change in the position of C. varipes within the trees, according to technique, involves grouping with either the This study was funded by the Rotary Foundation of Rotary C. rufifacies/C. albiceps group, or the other Chrysomya spe- International in the form of an Ambassadorial Scholarship cies. Neighbour-joining and maximum parsimony phylogen- to M.L.H. Thanks are extended to Professor Clarke Scholtz ies concur on the latter positioning of the species, perhaps and Jenny Edrich at the University of Pretoria in South indicating this grouping to be the most probable. The Africa for supervision, facilities and technical assistance; change in the position of the species under likelihood analy- Nicola Lunt from the Department of Zoology and sis, when bootstrapped on separate occasions, indicates Entomology at Rhodes University, South Africa, for the instability of the likelihood phylogeny. Therefore, technical assistance; and Silvana Gaudieri from the Centre although likelihood analysis supports the general topology, for Forensic Science at the University of Western Australia and supports the 100% bootstrap support for all species for help in analyses. clusters, the phylogeny has been excluded. It is likely that the discrepancy under this method is a product of taxon sampling, and that species necessary to place C. varipes in a phylogeny with some stability using this technique have References been excluded. The Chrysomya species sequenced were chosen for their forensic significance in particular regions Bernasconi, M.V., Valsangiacomo, C., Piffaretti, J.-C. & Ward, P.I. and, consequently, species of importance in constructing a (2000) Phylogenetic relationships among Muscoidea (Diptera: phylogeny may have been overlooked. A stable position for Calyptratae) based on mitochondrial DNA sequences. Insect Molecular Biology, 9, 67–74. C. varipes might otherwise be found by extending the region Braack, L.E.O. & De Vos, V. (1987) Seasonal abundance of sequenced to gain more data or by sequencing another gene. carrion-frequenting blow-flies (Diptera: Calliphoridae) in the The low intraspecific variation across several countries Kruger National Park. Onderstepoort Journal of Veterinary and two continents for some of the species indicates the Research, 54, 591–597. value of the mtDNA region for interspecific distinction, Ellison, G.T.H. (1990) The effect of scavenger mutilation on insect and the need for a region of greater variability for popula- succession at impala carcasses in southern Africa. Journal of tion-level studies. It would be advantageous to have the Zoology, 220, 679–688. ability to identify the geographical origin of a fly, particu- Harvey, M.L., Dadour, I.R. & Gaudieri, S. (2003) Mitochondrial larly in locating the place of death when a body has been DNA cytochrome oxidase I gene: potential for distinction shifted, based on changes in the insect DNA from flies from between immature stages of some forensically important fly species (Diptera) in western Australia. Forensic Science Inter- both the place of killing and place of disposal. Chrysomya national, 131, 134–139. megacephala and L. sericata were both sequenced from Hoy, M.A. (1994) Insect Molecular Genetics. Academic Press, Australia and Africa and showed little variation between California. populations. Ironically, the largest amount of intraspecific Hunt, G.J. (1997) Insect DNA extraction protocol. Fingerprinting variation was observed in C. varipes individuals from the Methods Based on Arbitrarily Primed PCR (ed. by M. R. Micheli same population. A new region of DNA is clearly required and R. Bova), pp. 21–24. Springer-Verlag, Berlin. for population-level study, perhaps the hyper-variable con- Kumar, S., Tamura, K., Jakobsen, I.B. & Nei, M. (2001) MEGA2: trol region already proven useful by Lessinger & Azeredo- Molecular Evolutionary Genetics Analysis software. Bioinfor- Espin (2000) in the myiasis-causing flies. matics, 17, 1244–1245. From a southern African perspective, this study provides Laurence, B.R. (1986) Old World blowflies in the New World. Parasitology Today, 2, 77–79. a strong foundation for molecular-based identification of Lessinger, A.C. & Azeredo-Espin, A.M.L. (2000) Evolution and forensically important flies. Although comparison with structural organization of mitochondrial DNA control region of Australian individuals has shown the necessity of further myiasis-causing flies. Medical and Veterinary Entomology, 14, work to study intraspecific variation, the data have shown 71–80. the robust nature of this mtDNA region to provide species Lewis, D.L., Farr, C.L. & Kaguni, L.S. (1995) Drosophila identifications. Levels of inter- and intraspecific divergences melanogaster mitochondrial DNA: completion of the nucleotide

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369 COI of southern African and Australian Calliphoridae 369

sequence and evolutionary comparisons. Insect Molecular (Diptera: Calliphoridae). Proceedings of the Royal Society of Biology, 4, 263–278. London Series B, 263, 1335–1341. Louw, S.V.D.M. & van der Linde, T.C. (1993) Insects frequenting Swofford, D.L. (2002) Paup*. Phylogenetic Analysis Using Parsi- decomposing corpses in central South Africa. African Entom- mony (*and Other Methods), Version 4. Sinauer Associates, ology, 1, 265–269. Sunderland, MA. Malgorn, Y. & Coquoz, R. (1999) DNA typing for identification of Wallman, J.F. (2001) Third-instar larvae of common carrion- some species of Calliphoridae: an interest in forensic entom- breeding blowflies of the genus Calliphora (Diptera: Calliphor- ology. Forensic Science International, 102, 111–119. idae) in South Australia. Invertebrate , 15, 37–51. Meskin, I. (1986) Factors affecting the coexistence of blowflies Wallman, J.F. & Donnellan, S.C. (2001) The utility of mitochon- (Diptera: Calliphoridae) on the Transvall Highveld, South drial DNA sequences for the identification of forensically Africa. South African Journal of Science, 82, 244–250. important blowflies (Diptera: Calliphoridae) in southeastern Prins, A.J. (1982) Morphological and biological notes on six South Australia. Forensic Science International, 120, 60–67. African blow-flies (Diptera, Calliphoridae) and their immature Wells, J.D. & Sperling, F.A.H. (1999) Molecular phylogeny of stages. Annals of the South African Museum, 90, 201–217. Chrysomya albiceps and C. rufifacies (Diptera: Calliphoridae). Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. & Flook, P. Journal of Medical Entomology, 36, 222–226. (1994) Evolution, weighting, and phylogenetic utility of mito- Wells, J.D. & Sperling, F.A.H. (2001) DNA-based identification of chondrial gene-sequences and a compilation of conserved forensically important Chrysomyinae (Diptera: Calliphoridae). polymerase chain-reaction primers. Annals of the Entomological Forensic Science International, 120, 110–115. Society of America, 87, 651–701. Zumpt, F. (1965) Myiasis in Man and in the Old World. Sperling, F.A.H. & Anderson, G.S. & Hickey, D.A. (1994) A Butterworths, London. DNA-based approach to the identification of insect species used for postmortem interval estimation. Journal of Forensic Sciences, 39, 418–427. Stevens, J. & Wall, R. (1996) Species, sub-species and hybrid populations of the blowflies Lucilia cuprina and Lucilia sericata Accepted 4 July 2003

# 2003 The Royal Entomological Society, Medical and Veterinary Entomology, 17, 363–369