DOCSLIB.ORG

Molecular Identification of Some Forensically Important Blowflies of Southern Africa and Australia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Identification of Some Forensically Important Blowflies of Southern Africa and Australia Medical and Veterinary Entomology (2003) 17, 363–369 Molecular identification of some forensically important blowflies of southern Africa and Australia M.L.HARVEY,M.W.MANSELL* ,M.H.VILLETy andI.R.DADOUR Centre for Forensic Science, University of Western Australia, Australia, *Department of Zoology and Entomology, University of Pretoria, South Africa, and yDepartment of Zoology and Entomology, Rhodes University, South Africa Abstract. One major aspect of research in forensic entomology is the investigation of molecular techniques for the accurate identification of insects. Studies to date have addressed the corpse fauna of many geographical regions, but generally neglected the southern African calliphorid species. In this study, forensically significant calliphorids from South Africa, Swaziland, Botswana and Zimbabwe and Australia were sequenced over an 1167 base pair region of the COI gene. Phylogenetic analysis was performed to examine the ability of the region to resolve species identities and taxonomic relationships between species. Analyses by neigh- bour-joining, maximum parsimony and maximum likelihood methods all showed the potential of this region to provide the necessary species-level identifications for application to post-mortem interval (PMI) estimation; however, higher level taxonomic relationships did vary according to method of analysis. Intraspecific variation was also considered in relation to determining suitable maximum levels of variation to be expected during analysis. Individuals of some species in the study represented populations from both South Africa and the east coast of Australia, yet maximum intraspecific variation over this gene region was calculated at 0.8%,with minimum interspecific variation at 3%, indicating distinct ranges of variation to be expected at intra- and interspecific levels. This region therefore appears to provide southern African forensic entomologists with a new technique for providing accurate identification for application to estimation of PMI. Key words. Calliphora, Chrysomya, Hydrotaea, Lucilia, Calliphoridae, Blowflies, Cytochrome oxidase I gene, forensic entomology, mitochondrial DNA, Australia, Botswana, South Africa, Swaziland, Zambia, Zimbabwe. Introduction have addressed this issue by using DNA sequences to iden- tify insects, most choosing to use mitochondrial DNA Forensic entomology has been an important investigative (mtDNA) as the basis for sequencing (Sperling et al., 1994; tool for many years, particularly through its use in court Malgorn & Coquoz, 1999; Wallman & Donnellan, 2001; trials in providing an estimation of post-mortem interval Wells & Sperling, 2001; Harvey et al., 2003). These studies (PMI) in homicide cases. This application of entomology to have revealed the potential for the use of mtDNA in pro- investigations demands great accuracy in PMI estimations, viding more accurate identifications for the estimation of resulting in significant research addressing this issue. PMI. The correct identification of specimens is a critical pre- The majority of literature in the field of forensic entom- requisite in the estimation of PMI using insects, but this ology has addressed the corpse fauna of the United States, may be difficult using the traditional morphology-based Europe, Britain and Australia, but generally neglected approach (Prins, 1982; Wallman, 2001). Several studies Africa. In southern Africa, forensic entomology is being increasingly incorporated into death investigations (M. Mansell, pers. obs.). To date, southern African research Correspondence: M. L. Harvey, Centre for Forensic Science, has focused largely on the succession of insects on corpses University of Western, Australia, Stirling Highway, Nedlands WA (Louw & van der Linde, 1993), and a few studies have 6907, Australia. E-mail: [email protected] considered the succession on animal carcasses that may be # 2003 The Royal Entomological Society 363 364 M. L. Harvey et al. applied to human corpse succession (Meskin, 1986; Braack & more distantly related muscid was chosen. The Calliphor- De Vos, 1987; Ellison, 1990). Despite increased interest in inae, although commonly found on corpses in Australia, are forensic entomology, DNA-based identification still only represented by Calliphora croceipalpis Jaennicke and remains a curiosity rather than an application in southern C. vicina Robineau-Desvoidy in southern Africa and were Africa. This is largely a result of the small amount of genetic not included in this analysis. The potential of the COI data collected on the forensically significant species. A encoding region for use in identification of flies for PMI robust typing method requires a large body of data to estimation based on insects is discussed. ensure that characters used to distinguish species are repre- sented among all populations of a species, and consequently to consider the intraspecific variation that may be observed Materials and methods across the distribution of a species. The usefulness of such information becomes evident as several African insects Samples associated with carcasses have now been identified from South America (Lawrence, 1986). Adult flies were used in this study as adult morphological mtDNA is recognized as being useful for evolutionary characters allowed more rapid and accurate identification to study because of its relatively higher mutation rate than species level than larval characters. Specimens were identified nuclear DNA (Hoy, 1994), and also the presence of both using keys and characters in Zumpt (1965). Origins of speci- conserved and variable segments. Evolutionary studies of mens are shown in Table 1. Flies were trapped in Botswana, forensically important Calliphoridae using phylogenetic South Africa, Swaziland, Zambia and Zimbabwe, and techniques allow visualization of relationships between Australian specimens were taken from laboratory colonies species, based on levels of similarity in sequence data. or trapped using liver-baited traps. Specimens were preserved Such relationships are useful to elucidate, as they often in 70% ethanol and refrigerated. reflect the morphological and behavioural discrepancies observed in the field and provide a greater understanding for entomologists of potential pitfalls in data. This may be DNA extraction in the discovery of species complexes, or simply in the phylogenetic confirmation of the genetic separation of two Extraction was performed using a Chelex 100 (Bio-Rad, highly similar species over which species status may be Australia) technique modified from Hunt (1997). An inci- questioned. sion was made under the left wing of each specimen, and The potential of the cytochrome oxidase I (COI) encod- flight muscles removed and macerated. In a few specimens ing region of mtDNA has been shown to be useful for flight muscles had degraded and, consequently, a single identification in many studies (e.g. Sperling et al., 1994; wing of the fly was used for extraction. The remainder of Malgorn & Coquoz, 1999). Various segments of this region the specimen was then stored in ethanol and refrigerated, as have been sequenced in different studies, ranging from 278 a voucher specimen. The muscle or wing was then frozen using base pairs to the entire COI gene. This study considered the liquid nitrogen and ground to a fine powder using micropestles use of a 1167-bp region of the COI gene for identification of in 1.5-mL Eppendorf tubes. One hundred microlitres of a 5% forensically important calliphorids in southern Africa. The solution of Chelex was added to the ground material, vortexed region encompassed the 278-bp segment used by Harvey and incubated for 15 min on a 95C heatblock. Following et al. (2003) and the 639 sites used by Wallman & Donnellan incubation, the sample was vortexed for 5 s, and centrifuged (2001) to provide successful distinction with the Australian for 3 min at maximum speed. The supernatant was removed corpse fauna. andstoredatÀ20C. Flies from Botswana, South Africa, Swaziland, Zambia and Zimbabwe were sequenced and phylogenetic analyses used to construct evolutionary relationships between them. PCR conditions and purification of PCR products Species sequenced were Chrysomya albiceps (Wiedemann), C. megacephala (Fabricius), C. putoria (Wiedemann), The primers used amplified a region of approximately C. marginalis (Wiedemann), C. inclinata Walker and Lucilia 1270 bp. Primers were C1-J-1718 (50-30 GGAGGATTTG- sericata (Meigen). Forensically significant Australian GAAATTGATTAGTTCC) and TL2-N-3014 (50-30 TCCA- species from the subfamilies Chrysomyinae and Luciliinae ATGCACTAATCTGCCATATTA) (Simon et al., 1994). were included in order to test intraspecific variation for The PCR reaction mix consisted of: 1 Â PCR buffer species also found in southern Africa. Specimens of (Biotools, South Africa), 200 mM dNTPs (Biotools), 1.5 mM C. rufifacies (Macquart), C. varipes (Macquart) and MgCl2,25pM each primer and 3 mL template DNA, and L. cuprina (Wiedemann) were also included, along with water added to a total volume of 50 mL. A Perkin Elmer the muscid Hydrotaea rostrata (Robineau-Desvoidy). GeneAmp PCR System 2400 thermocycler was used. The Hydrotaea rostrata was included primarily for its forensic programme began with a 90-s 94C denaturation period, relevance, but also as an outgroup. Although a sarcophagid followed by 36 cycles of: 94C for 22 s, 48C for 30 s and species may have formed a more suitable outgroup, there 72C for 80 s. A final extension period of 60 s at 72C was were no sequences available
Load more

Recommended publications
  • A Global Study of Forensically Significant Calliphorids: Implications for Identification
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by South East Academic Libraries System (SEALS) A global study of forensically significant calliphorids: Implications for identification M.L. Harveya, S. Gaudieria, M.H. Villet and I.R. Dadoura Abstract A proliferation of molecular studies of the forensically significant Calliphoridae in the last decade has seen molecule-based identification of immature and damaged specimens become a routine complement to traditional morphological identification as a preliminary to the accurate estimation of post-mortem intervals (PMI), which depends on the use of species-specific developmental data. Published molecular studies have tended to focus on generating data for geographically localised communities of species of importance, which has limited the consideration of intraspecific variation in species of global distribution. This study used phylogenetic analysis to assess the species status of 27 forensically important calliphorid species based on 1167 base pairs of the COI gene of 119 specimens from 22 countries, and confirmed the utility of the COI gene in identifying most species. The species Lucilia cuprina, Chrysomya megacephala, Ch. saffranea, Ch. albifrontalis and Calliphora stygia were unable to be monophyletically resolved based on these data. Identification of phylogenetically young species will require a faster-evolving molecular marker, but most species could be unambiguously characterised by sampling relatively few conspecific individuals if they were from distant localities. Intraspecific geographical variation was observed within Ch. rufifacies and L. cuprina, and is discussed with reference to unrecognised species. 1. Introduction The advent of DNA-based identification techniques for use in forensic entomology in 1994 [1] saw the beginning of a proliferation of molecular studies into the forensically important Calliphoridae.
    [Show full text]
  • Medicinal Plants Used by ‘Root Doctors’, Local Traditional Healers in Bié Province, Angola
    Journal Pre-proof Medicinal plants used by ‘root doctors’, local traditional healers in Bié province, Angola B. Novotna, Z. Polesny, M.F. Pinto-Basto, P. Van Damme, P. Pudil, J. Mazancova, M.C. Duarte PII: S0378-8741(19)31151-1 DOI: https://doi.org/10.1016/j.jep.2020.112662 Reference: JEP 112662 To appear in: Journal of Ethnopharmacology Received Date: 23 March 2019 Revised Date: 6 February 2020 Accepted Date: 6 February 2020 Please cite this article as: Novotna, B., Polesny, Z., Pinto-Basto, M.F., Van Damme, P., Pudil, P., Mazancova, J., Duarte, M.C., Medicinal plants used by ‘root doctors’, local traditional healers in Bié province, Angola, Journal of Ethnopharmacology (2020), doi: https://doi.org/10.1016/j.jep.2020.112662. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V. provided by Universidade de Lisboa: Repositório.UL View metadata, citation and similar papers at core.ac.uk CORE brought to you by Medicinal plants used by ‘root doctors’, local traditional healers in Bié province, Angola B.
    [Show full text]
  • Forensic Entomology Research and Application in Southern Africa Page 2 of 8
    Forensic entomology research and application in AUTHORS: southern Africa: A scoping review Danisile Tembe1 Samson Mukaratirwa1* The use of forensic entomology is well established in the northern hemisphere, but is still emerging in AFFILIATIONS: 1School of Life Sciences, College of the southern hemisphere, where most of the current research is not explicitly undertaken in the context of Agriculture, Engineering and Science, forensics. In this review, we provide an update on the current status of forensic entomology research and University of KwaZulu-Natal, Durban, South Africa its application in relation to estimation of post-mortem interval in various criminal investigations ranging *Current: One Health Center for from murder cases, cases of human neglect and the poaching of wildlife in southern Africa, among Zoonoses and Tropical and Veterinary other issues. A literature search was conducted using Google Scholar, PubMed, Scopus and EBSCOhost Medicine, Ross University School of Veterinary Medicine, Basseterre, databases. The studies reviewed were focused on arthropod diversity during different stages of carcass West Indies decomposition, effect of seasons on the abundance and diversity of carrion feeding arthropod species during carcass decomposition, and diurnal and nocturnal oviposition of forensically important insect CORRESPONDENCE TO: Danisile Tembe species during carcass decomposition. It was further observed that arthropod species that established on a decomposing carcass are potentially useful in the estimation of post-mortem interval and determining EMAIL: clues in cases of criminal investigations. The review confirmed the paucity of research in forensic [email protected] entomology, and its application in southern Africa. Future studies on the research and application of DATES: forensic entomology in various criminal investigation scenarios – such as murder cases, human neglect, Received: 21 Feb.
    [Show full text]
  • Faculdade De Medicina Veterinária
    UNIVERSIDADE DE LISBOA Faculdade de Medicina Veterinária SEASONAL INFLUENCE IN THE SUCCESSION OF ENTOMOLOGICAL FAUNA ON CARRIONS OF CANIS FAMILIARIS IN LISBON, PORTUGAL CARLA SUSANA LOPES LOUÇÃO CONSTITUIÇÃO DO JÚRI: ORIENTADORA: Doutora Isabel Maria Soares Pereira Doutor José Augusto Farraia e Silva da Fonseca de Sampaio Meireles Doutora Isabel Maria Soares Pereira da CO-ORIENTADORA: Fonseca de Sampaio Doutora Maria Teresa Ferreira Ramos Nabais de Oliveira Rebelo Doutora Anabela de Sousa Santos da Silva Moreira 2017 LISBOA UNIVERSIDADE DE LISBOA Faculdade de Medicina Veterinária SEASONAL INFLUENCE IN THE SUCCESSION OF ENTOMOLOGICAL FAUNA ON CARRIONS OF CANIS FAMILIARIS IN LISBON, PORTUGAL CARLA SUSANA LOPES LOUÇÃO Dissertação de Mestrado Integrado em Medicina Veterinária CONSTITUIÇÃO DO JÚRI: ORIENTADORA: Doutora Isabel Maria Soares Pereira Doutor José Augusto Farraia e Silva da Fonseca de Sampaio Meireles Doutora Isabel Maria Soares Pereira da CO-ORIENTADORA: Fonseca de Sampaio Doutora Maria Teresa Ferreira Ramos Nabais de Oliveira Rebelo Doutora Anabela de Sousa Santos da Silva Moreira 2017 LISBOA Agradecimentos Gostaria de agradecer em primeiro lugar às minhas orientadoras, Profª Doutora Isabel Fonseca e Profª Doutora Teresa Rebelo por terem aceite orientar-me e por todos os conselhos e conhecimentos teóricos e práticos que me foram transmitindo ao longo de todo o projecto, sempre com uma contagiante boa disposição, entusiasmo e dinamismo. Agradeço ainda toda a disponibilidade e ajuda preciosa na identificação das “moscas difíceis”, bem como as revisões criteriosas de todo este documento. Os meus agradecimentos estendem-se ainda à Profª Doutora Graça Pires, ao Mestre Marcos Santos e ao Sr. Carlos Saraiva. Acima de tudo agradeço à minha mãe, por me ter proporcionado todas as condições e possibilidades de tirar o curso que sempre quis, e por estar presente em toda esta longa etapa.
    [Show full text]
  • Durham E-Theses
    Durham E-Theses Studies on the morphology and taxonomy of the immature stages of calliphoridae, with analysis of phylogenetic relationships within the family, and between it and other groups in the cyclorrhapha (diptera) Erzinclioglu, Y. Z. How to cite: Erzinclioglu, Y. Z. (1984) Studies on the morphology and taxonomy of the immature stages of calliphoridae, with analysis of phylogenetic relationships within the family, and between it and other groups in the cyclorrhapha (diptera), Durham theses, Durham University. Available at Durham E-Theses Online: http://etheses.dur.ac.uk/7812/ Use policy The full-text may be used and/or reproduced, and given to third parties in any format or medium, without prior permission or charge, for personal research or study, educational, or not-for-prot purposes provided that: • a full bibliographic reference is made to the original source • a link is made to the metadata record in Durham E-Theses • the full-text is not changed in any way The full-text must not be sold in any format or medium without the formal permission of the copyright holders. Please consult the full Durham E-Theses policy for further details. Academic Support Oce, Durham University, University Oce, Old Elvet, Durham DH1 3HP e-mail: [email protected] Tel: +44 0191 334 6107 http://etheses.dur.ac.uk 2 studies on the Morphology and Taxonomy of the Immature Stages of Calliphoridae, with Analysis of Phylogenetic Relationships within the Family, and between it and other Groups in the Cyclorrhapha (Diptera) Y.Z. ERZINCLIOGLU, B.Sc. The copyright of this thesis rests with the author.
    [Show full text]
  • Key for Identification of European and Mediterranean Blowflies (Diptera, Calliphoridae) of Forensic Importance Adult Flies
    Key for identification of European and Mediterranean blowflies (Diptera, Calliphoridae) of forensic importance Adult flies Krzysztof Szpila Nicolaus Copernicus University Institute of Ecology and Environmental Protection Department of Animal Ecology Key for identification of E&M blowflies, adults The list of European and Mediterranean blowflies of forensic importance Calliphora loewi Enderlein, 1903 Calliphora subalpina (Ringdahl, 1931) Calliphora vicina Robineau-Desvoidy, 1830 Calliphora vomitoria (Linnaeus, 1758) Cynomya mortuorum (Linnaeus, 1761) Chrysomya albiceps (Wiedemann, 1819) Chrysomya marginalis (Wiedemann, 1830) Chrysomya megacephala (Fabricius, 1794) Phormia regina (Meigen, 1826) Protophormia terraenovae (Robineau-Desvoidy, 1830) Lucilia ampullacea Villeneuve, 1922 Lucilia caesar (Linnaeus, 1758) Lucilia illustris (Meigen, 1826) Lucilia sericata (Meigen, 1826) Lucilia silvarum (Meigen, 1826) 2 Key for identification of E&M blowflies, adults Key 1. – stem-vein (Fig. 4) bare above . 2 – stem-vein haired above (Fig. 4) . 3 (Chrysomyinae) 2. – thorax non-metallic, dark (Figs 90-94); lower calypter with hairs above (Figs 7, 15) . 7 (Calliphorinae) – thorax bright green metallic (Figs 100-104); lower calypter bare above (Figs 8, 13, 14) . .11 (Luciliinae) 3. – genal dilation (Fig. 2) whitish or yellowish (Figs 10-11). 4 (Chrysomya spp.) – genal dilation (Fig. 2) dark (Fig. 12) . 6 4. – anterior wing margin darkened (Fig. 9), male genitalia on figs 52-55 . Chrysomya marginalis – anterior wing margin transparent (Fig. 1) . 5 5. – anterior thoracic spiracle yellow (Fig. 10), male genitalia on figs 48-51 . Chrysomya albiceps – anterior thoracic spiracle brown (Fig. 11), male genitalia on figs 56-59 . Chrysomya megacephala 6. – upper and lower calypters bright (Fig. 13), basicosta yellow (Fig. 21) . Phormia regina – upper and lower calypters dark brown (Fig.
    [Show full text]
  • A History of Southern African Research Relevant to Forensic Entomology
    Review Article South African Journal of Science 102, January/February 2006 59 A history of southern African research relevant to forensic entomology K.A. Williams* and M.H. Villet diamonds. Much of the exports was skins and hides, ostrich feathers, and wool and mohair.16 By 1929, wool was the most Entomological forensic evidence has been used in southern Africa important South African export after gold.17 As the South African for decades but explicitly forensic research began in southern wool industry expanded, the threat of sheep strike or myiasis in Africa only 26 years ago. Although applicable local research has sheep increased, which engendered the first local research that accumulated since 1921, it is scattered in a diverse literature or would contribute to forensic entomology. unpublished. Some overseas research has also touched on local In 1921, R.W.Thornton, principal of the Grootfontein School of species. This review uses a historical approach to synthesize the Agriculture, established a committee to investigate sheep southern African literature and to illustrate the cross-disciplinary, strike.18 The work began in September 1922, when Owen Wahl, a opportunistic nature of forensic entomology. Distinct phases of Grootfontein entomologist, returned from Australia and the research focused on agriculture (1921–1950), medicine (1952– United States, where he had gathered information on sheep 1965), ecology (1968–1990) and forensics (1980–2005), but system- strike. Many Australian fly control techniques were not feasible atics spanned the entire period and tended to be ad hoc. Few scien- in South Africa and it was realized that much needed to be tists were involved, situated at geographically distant locations and learned about South African blowflies.
    [Show full text]
  • University of Cape Town
    DNA Barcoding of Forensically Important Flies in the Western Cape By TENIELLE MONIQUE COOKE CKXTEN001 SUBMITTED TO THE UNIVERSITY OF CAPE TOWN In partial fulfilment of the requirements for the degree MPhil (Biomedical Forensic Science) Faculty of Health Sciences UNVERSITY OF CAPE TOWN February 2016 Supervisor: Dr. Marise Heyns Co-Supervisor: Ms Laura Heathfield University of Cape Town i The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgement of the source. The thesis is to be used for private study or non- commercial research purposes only. Published by the University of Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University of Cape Town . ii ACKNOWLEDGMENTS I would like to thank my supervisor Dr. Marise Heyns for all the support and guidance throughout my Masters studies. I would also like to acknowledge my co-supervisor Miss Laura Heathfield whose constant guidance kept me striving for excellence I would like to thank my colleagues, your constant support and friendship was much appreciated I would like to thank my parents Romal and Pauline Cooke for enduring this far with me I would like to acknowledge the support I received from my sisters Kesha and Angelique, my cousins Bronwyn and Teagan Reddy and a special thank you to Rosemary Reddy for opening her heart and doors for me I hereby acknowledge the financial assistance of the National Research Foundation (NRF) towards this research. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF Lastly, I would like to acknowledge God, without whom none of this would be possible.
    [Show full text]
  • Are Pit Latrines in Urban Areas of Sub-Saharan Africa
    Nakagiri et al. BMC Public Health (2016) 16:120 DOI 10.1186/s12889-016-2772-z RESEARCH ARTICLE Open Access Are pit latrines in urban areas of Sub- Saharan Africa performing? A review of usage, filling, insects and odour nuisances Anne Nakagiri1*, Charles B. Niwagaba1, Philip M. Nyenje1, Robinah N. Kulabako1, John B. Tumuhairwe2 and Frank Kansiime3 Abstract Background: A pit latrine is the most basic form of improved sanitation which is currently used by a number of people around the globe. In spite of the wide spread use, known successes and advantages associated with pit latrines, they have received little attention in form of research and development. This review focuses on the usage and performance (filling, smell and insect nuisance) of pit latrines in urban areas of sub-Saharan Africa (SSA) and proposes approaches for their improvements and sustainability. Methods: Current pit latrine usage within urban SSA was calculated from Joint Monitoring Programme (JMP) water and sanitation country-files. We conducted a literature search and review of documents on pit latrine usage, filling, smell and insect nuisances in urban areas of SSA. Findings of the review are presented and discussed in this paper. Results and Discussion: Pit latrines are in use by more than half the urban population in SSA and especially among low income earners. An additional 36 million people in urban areas of SSA have adopted the pit latrine since 2007. However, their performance is unsatisfactory. Available literature shows that contributions have been made to address shortfalls related to pit latrine use in terms of science and technological innovations.
    [Show full text]
  • (Diptera, Calliphoridae) of Forensic Importance Third Instars
    Key for identification of European and Mediterranean blowflies (Diptera, Calliphoridae) of forensic importance Third instars Krzysztof Szpila Nicolaus Copernicus University Institute of Ecology and Environmental Protection Department of Animal Ecology Key for identification of E&M blowflies, third instars 2 Key for identification of E&M blowflies, third instars 3 Key for identification of E&M blowflies, third instars Key 1. – abdominal segments of the larva with numerous fleshy protuberances (Fig. 1A) . Chrysomya albiceps – abdominal segments of the larva without such protuberances . 2 2. – oral sclerite at least partly sclerotised (Figs 1BD, 2AFJ, 3A, 4A, 5FK) . 3 – oral sclerite totally unsclerotised (Figs 1C, 3FJ, 4EHK) . 10 3. – sclerotised part of the oral sclerite short, almost circular (Figs 1D, 3A, 4A, 5FK) . 4 – oral sclerite well sclerotised along the whole length (Figs 1B, 2AFJ) . 6 4. – spines small, with single tips, arranged in short rows (check on the thoracic segments) (Fig. 4C); posterior spiracles wide apart and with complete peritreme (Fig. 4D) . Lucilia ampullacea – spines large, robust, arranged separately (check on the thoracic segments) (Figs 3CD, 5IJ); posterior spiracles close to each other and with incomplete peritreme (Figs 3E, 5G) . 5 5. – all spines with single, blunt tips (check on the thoracic segments) (Figs 5IJ) . .Chrysomya marginalis – at least some spines with serrated tips (check on the thoracic segments) (Figs 3CD) . Chrysomya megacephala 6. – spines large, arranged separately (check on the thoracic segments) (Figs 2CD) . .. Calliphora vomitoria – spines small, arranged in short rows (check on the thoracic segments) . 7 7. – posterior spiracles relatively close together (SDF≈1.0) (Figs 1E, 2I) .
    [Show full text]
  • Two New Records of Flies Causing Myiasis from Saudi Arabia with a Survey of Flies Parasitizing Goats and Sheep in Jazan Region
    Tropical Biomedicine 37(2): 499–512 (2020) Two new records of flies causing myiasis from Saudi Arabia with a survey of flies parasitizing goats and sheep in Jazan Region Alahmed, A.M.1, Nasser, M.G.2*, Sallam, M.F.3, Dawah, H.4, Kheir, S.1 and AlAshaal, S.A.2 1Department of Plant Protection, College of Food and Agriculture Science, King Saud University, P.O. Box 2460m Riyadh 11454, Saudi Arabia 2Department of Entomology, Faculty of Science, Ain Shams University, Abbasia Square, Cairo 11566, Egypt 3Department of Biology, University of Nevada, Reno, USA 4Centre for Environmental Research and Studies (CERS), Jazan University, P.O. Box, 2095 *Corresponding author e-mail: [email protected] Received 4 October 2018; received in revised form 26 July 2019; accepted 1 August 2019 Abstract. Despite the medical, veterinary and forensic relevance of myiasis-causing flies, knowledge of their diversity in Saudi Arabia is limited especially in the southern region. Therefore, a survey of myiasis-causing flies in the Jazan region was carried out using Red Top Fly Catcher traps baited with either decomposing beef liver or a lure composed primarily from fishmeal during the period April 2013-March 2014. Twelve known species were identified and recorded in this study, seven species of them belonging to Calliphoridae (Chrysomya, Lucilia, and Hemipyrella) and five species belonging to Sarcophagidae (Sarcophaga). Two of these species were recorded for the first time for Saudi Arabia, namely Hemipyrella pulchra (Wiedemann, 1830) and Sarcophaga (Liosarcophaga) exuberans Pandellé, 1896. Images of the species recorded are also provided for the first time.
    [Show full text]
  • (Diptera) of Saudi Arabia with New Records and Updated List of Species
    J. Entomol. Res. Soc., 21(1): 65-93, 2019 Research Article Print ISSN:1302-0250 Online ISSN:2651-3579 An Overview of the Calliphoridae (Diptera) of Saudi Arabia with New Records and Updated List of Species Hassan Ali DAWAH1* Mohammed A. ABDULLAH2 Syed KAMRAN AHMAD3 Centre for Environmental Research and Studies, Jazan University, P.O. Box 2095, Jazan, KINGDOM OF SAUDI ARABIA. e-mails: *[email protected], [email protected], [email protected] ORCID ID: 10000-0001-5642-7247, 20000-0002-3323-3623, 30000-0002-6211-2345 ABSTRACT Despite the species richness of the blow fly (Calliphoridae: Diptera) fauna (1600 species), the relevant environmental, medical, agricultural, and forensic knowledge of these species found in Saudi Arabia is limited. As part of a study on the biodiversity of Diptera of south-western Saudi Arabia a survey of the Diptera fauna of Jazan, Asir and Najran was performed between 2010-2016 at 17 sites, mainly using Malaise traps, sweep nets and baited traps. Eighteen species of Calliphoridae were identified and recorded in this study, seven of which were recorded for the first time. This makes the total number of Calliphoridae species in Saudi Arabia (including 26 species previously recorded and excluding two species which were synonymized namely: Rhyncomya zumptii Peris 1952; Chrysoma regalis Robineau-Desvoidy 1830) to be 44. A list of all species of Calliphoridae recorded from Saudi Arabia is provided. Images of five species are presented. Biological information on each species (where known) and geographical distribution are included. In addition to the results of the identifications all available literature about Calliphoridae of Saudi Arabia is summarized and analysed.
    [Show full text]