Two Distinct Domains in Drosophila Melanogaster Telomeres

Two Distinct Domains in Drosophila melanogaster Telomeres

Harald Biessmann,* Sudha Prasad,† Valery F. Semeshin,‡ Eugenia N. Andreyeva,‡ Quang Nguyen,§ Marika F. Walter* and James M. Mason†,1 *Developmental Biology Center, University of California, Irvine, California 92697, †Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina 27709, ‡Laboratory of Molecular Cytogenetics, Institute of Cytology and Genetics, Russian Academy of Sciences, Novosibirsk 630090, Russia and §Department of Biological Chemistry, University of California, Irvine, California 92697 Manuscript received July 27, 2005 Accepted for publication August 16, 2005

ABSTRACT Telomeres are generally considered heterochromatic. On the basis of DNA composition, the telomeric region of Drosophila melanogaster contains two distinct subdomains: a subtelomeric region of repetitive DNA, termed TAS, and a terminal array of retrotransposons, which perform the elongation function instead of telomerase. We have identiﬁed several P-element insertions into this retrotransposon array and compared expression levels of transgenes with similar integrations into TAS and euchromatic regions. In contrast to insertions in TAS, which are silenced, reporter genes in the terminal HeT-A, TAHRE,orTART retroelements did not exhibit repressed expression in comparison with the same transgene construct in euchromatin. These data, in combination with cytological studies, provide evidence that the subtelomeric TAS region exhibits features resembling heterochromatin, while the terminal retrotransposon array exhibits euchromatic characteristics.

NA sequences at the ends of eukaryotic chromo- tandem repeats of 457 bp (Walter et al. 1995; Mason D somes are the products of a telomere elongation et al. 2003b). While the TAS array on other chromo- process. In most eukaryotes, these sequences are simple somes may be of similar size (Abad et al. 2004a), X TAS repeating units that are synthesized by telomerase, but is more complex with a 1.8-kb and a 0.9-kb repeat, which in Drosophila melanogaster they are tandem head-to-tail are related to each other (Karpen and Spradling 1992). arrays of three non-long terminal repeat retrotranspo- Drosophila telomeric regions are able to repress gene sons, HeT-A, TAHRE,andTART (Mason and Biessmann activity, resulting in partial silencing and variegated 1995; Pardue and DeBaryshe 2003; Abad et al. 2004b). expression of reporter genes (Karpen and Spradling Despite these differences, a common feature of eukary- 1992), referred to as telomeric position effect (TPE). otic chromosomes is a region of complex repeats located These repressed transgenes have inserted into or adja- adjacent to the terminal sequences. These complex cent to TAS (Levis et al. 1993; Cryderman et al. 1999; repeats are referred to as subtelomeric regions, or Golubovsky et al. 2001), suggesting that TAS regions of telomere-associated sequences (TAS), and differ in se- Drosophila telomeres are heterochromatic. quence, structure, and length among species and among No integrations into the terminal retrotransposon telomeres within an individual (Pryde et al. 1997). The array have been reported. There are several possible ex- repetitive nature and the high density of transposable planations for the absence of these integration events. elements in these subtelomeric regions (Mefford and First, the chromatin structure of the retrotransposon Trask 2002) are reminiscent of heterochromatin. In array may not allow integration of P elements, or if D. melanogaster, TAS consist of several kilobases of com- integrations do occur, they may be unstable. Second, plex repeats, which exhibit similarities between the dif- integration events may occur in the HeT-A/TART/ ferent chromosome ends. Sequences of the 2L and TAHRE array but are not detectable, because expression X TAS regions have been described in detail (Karpen of the reporter gene is completely repressed due to the and Spradling 1992; Walter et al. 1995), and in situ heterochromatic nature of the terminal array. Third, hybridizations to polytene chromosomes showed that integrations may occur, but expression is not repressed; 2L TAS share homology with 3L TAS, while X TAS share thus, insertion events are not distinguishable from homology with 2R and 3R TAS. The 2L TAS appear to integrations into euchromatic sites. To address this ques- be 15 kb in length and composed of relatively simple tion, we took advantage of the P-element mobilization screen performed by the Berkeley Drosophila Genome Project (BDGP) Gene Disruption Project to generate 1Corresponding author: Laboratory of Molecular Genetics, National ellen Institute of Environmental Health Sciences, 111 Alexander Dr., Research insertions at every Drosophila gene (B et al. 2004). Triangle Park, NC 27709-2233. E-mail: [email protected] This screen generated .30,000 independent P-element

Genetics 171: 1767–1777 (December 2005) 1768 H. Biessmann et al. integrations using constructs SuPor-P and EPgy2. After expression of the transgene can be observed without further performing inverse PCR, the BDGP sequenced the 59- crosses. and 39-flanking regions to determine the genomic Flanking sequences were obtained from R. Levis and batch blasted (BlastN) (Altschul et al. 1997) against sequences location of each integration. We reasoned that among from HeT-A (GenBank U06920), TART-A (U02279), TART-B1 the large number of P-element integrations there might (U14101), TART-B2 (U14102), TART-C (U02279), 2LTAS be some that had inserted into the HeT-A/TAHRE/ (U35404), and 1.8-kb X-TAS (L03284). To identify potential TART array, unless this terminal region is refractory to telomeric insertions when both 39- and 59-flanking regions integration. Indeed, by screening genomic sequences of the P-element integration had been determined, we re- quired that both identified the same region in the telomeric flanking the P-element insertions for similarity to HeT-A retrotransposon and showed the 8-bp duplication generated and TART, several such integrations were identified. by the P element. In cases when only one of the flanking Extant strains were then subjected to molecular genetic regions was known, sequence identity to HeT-A, TART,orTAS analyses, and the phenotypic expression levels of the had to be at least 80% over a substantial part of the flank. In reporter genes were determined. addition to insertions identified in this manner, a SuPor-P element in 3R TAS, 316-1 (Roseman et al. 1995), was provided The experiments described in this article were per- by P. Geyer. SuPor-P (KG04716 at position 21A5–B1, KG00040 formed for several reasons: (a) to investigate the mor- at 60E1, and KG03807 at 60D15–16) and EPgy2 (EY00630 at phological characteristics of the terminal array and the 59D8, KG00487 at 62A6–7, and KG02201 at 62A11–12) in- TAS subterminal region in polytene chromosomes, (b) sertions into distal euchromatin were obtained from the to determine if P elements can integrate into the ter- Bloomington Stock Center (http://flystocks.bio.indiana.edu) and used as controls in gene expression studies. minal array of the Drosophila telomere, and (c) to in- Genetic isolation of P insertion chromosomes: Drosophila vestigate gene expression at the integration site. The stocks were maintained and crosses were performed at 25° on results show that the terminal array is not refractory to cornmeal, molasses medium with dry yeast added to the P-element insertions. Further, expression of transgenes surface. Genetic markers and special chromosomes are de- ly ase onsortium in the terminal transposon array is not reduced when scribed by FlyBase (F B C 2003). To identify the chromosome carrying the insertion, males carrying the the insertion is far from TAS. Thus, in contrast to TAS, transgene were crossed to yw67c23; Sco/SM1 or yw67c23; Sb/TM6, the terminal arrays do not appear to mediate hetero- 67c23 Ubx females. F1 males were then crossed to yw females, and chromatic gene silencing. However, the silencing effect segregation of the reporter genes was noted. Simultaneous of TAS spreads into the retrotransposon array and can backcrosses of F1 males to balancer females allowed new stocks 67c23 be detected over short distances. We, therefore, suggest to be formed with yw on the X chromosome and the marked element on an autosome. Insertions on the X and that there are two distinct chromatin domains within fourth chromosomes were not considered further. the Drosophila telomere, one consisting of the terminal In a similar fashion, su(Hw)8 was crossed into KG lines to retrotransposon array, which is transcriptionally active, render the SU(HW) binding sites nonfunctional as insulators. and the other containing TAS, which appear by genetic When the SuPor-P element was carried on chromosome 2, 67c23 67c23 assays to be heterochromatic. The chromosome cap may yw , homozygous transgene females were crossed to yw ; Sb/TM6 males, and F1 transgene/1; Sb/1 females crossed be a third telomeric domain that does not contain a spe- 2 8 8 iessmann ason with y sc v; su(Hw) /TM6 males. F2 transgene/1; su(Hw) /Sb cific DNA sequence (B and M 1988), but sons were then crossed with yw67c23; Sb/TM6 females. Transgene/ requires specific capping proteins (Fanti et al. 1998; 1; su(Hw)8/TM6 progeny from this cross were mated together Biessmann et al. 2005; Cenci et al. 2005). in single pairs, and transgene homozygotes were selected by monitoring segregation in subsequent generations. When the SuPor-P element was on chromosome 3, yw67c23, homozygous transgene males were crossed to y2 sc v; su(Hw)8/ 1 67c23 MATERIALS AND METHODS TM6 females, and Ubx F1 females crossed to yw ; Sb/TM6, 1 1 1 Ubx males. Ten F2 sc w v Ubx males were mated singly to P-element inserts and Blast screening: Two P-element yw67c23; Sb/TM6 females and stocks produced by brother-sister constructs were used in the mobilization screen by the BDGP. matings, as above. The resulting stocks were then tested for the SuPor-P (Roseman et al. 1995) carries mini-white gene with its presence of su(Hw) by crossing males to y2 sc v; su(Hw)8/TM6 eye enhancer element flanked on both sides by SU(HW) females and examining y2 sc v; Ubx1 sons for expression of sc. binding sites that protect it from most telomeric position In situ hybridizations, genomic DNA libraries, and effects. SuPor-P also carries a yellow gene with the body and Southern blotting: These were done as described previously wing, but not the bristle, enhancers. P-element mobilization (Golubovsky et al. 2001). The P-element vectors EPgy2 or gave rise to the KG lines (Bellen et al. 2004). To observe the Casper were used to generate digoxigenin-labeled hybridiza- eye color in flies carrying this element, the transgene was tion probes for in situ hybridization. crossed into yw67c23; su(Hw)8 background. This mutant allele of Polymerase chain reaction amplifications: Polymerase su(Hw) was caused by the insertion of 0.7 kb of jockey into the chain reactions (PCR) to amplify ,1-kb fragments were done first intron, resulting in greatly reduced levels of mRNA in 50-ml reactions containing 1 mg of genomic DNA with 2.5 (Parkhurst et al. 1988) and protein (Harrison et al. 1993). units Taq polymerase (Shuzo, Otsu, Japan) at an annealing While Harrison et al. (1993) describe this mutation as a weak temperature of 5–10° below the melting temperature of the suppressor of y2, we find it to be a strong suppressor. To obtain primers, with 2-min. synthesis at 72°. Longer DNA fragments the EY lines, the EPgy2 element was mobilized. This P element were amplified using the Herculase PCR system from Stra- carries an unprotected mini-white gene without an enhancer tagene (La Jolla, CA) or the Phusion polymerase (Finnzymes, and the same yellow gene with body/wing enhancers (Bellen Espoo, Finland), allowing longer times for extension. Ampli- et al. 2004). In flies carrying this element the eye color from the fied DNA products were tested on agarose gels and sequenced Domains in Drosophila Telomeres 1769 after purification through Zymoclean columns (Zymo Research, Orange, CA) or after cloning into pGem-T-easy (Promega, Madison, WI). Inverse PCR was done to confirm the flanking sequences provided by the BDGP and in some cases to obtain larger DNA fragments from the flanking regions. Briefly, 5 mg of genomic DNA was digested to completion with either four-cutter restriction enzymes (MboI, HhaI, HpaII) or six-cutter enzymes (ClaI, SstI, SalI) (New England Biolabs, Beverly, MA). Enzymes were inactivated by heating for 20 min at 65°, and 1–2 mg of the Figure 1.—TAS on the telomere of the left arm of chromo- digested DNA was circularized by ligation overnight at 4° in some 2. (Left) The 2L tip region of a polytene chromosome is 400-ml reaction volumes with 2 ml of T4 DNA polymerase (New shown. (Middle) An image of fluorescent in situ hybridization England Biolabs). DNA was precipitated, dissolved in 10 ml TE, with a 6-kb digoxigenin-labeled DNA probe containing 2L and subjected to PCR with primers from either the 39 or the 59 TAS to the tip of second chromosome of an Oregon-R/Tel end of the P elements, using either Taq polymerase (for short hybrid. (Right) The merged image. Scale bar, 10 mm. fragments) or Phusion polymerase (for long fragments) allowing extension times at 72° between 2 and 15 min, depending on the expected fragment sizes. The following primers according to standard procedures. A 6-kb tandem array of 2L (synthesized by Genosys Biotechnologies, The Woodlands, TAS DNA (Walter et al. 1995) in pBluescript was labeled with TX) were used: digoxigenin (Roche, Indianapolis).

39Plarb-F: 59 CATACGTTAAGTGGATGTCTCTTGC 39 (Tm 67.2) 39P-ry-1: 59 CCTTAGCATGTCCGTGGGGTTTGAAT 39 (Tm RESULTS 73.3) 39P-ry-4: 59 CAATCATATCGCTGTCTCACTCA 39 (Tm 64.0) Morphology of the 2L telomere in polytene chro- 59Plarb-R: 59 GGCTATCGACGGGACCACC 39 (Tm 68.9) mosomes: EM was used to obtain detailed cytological 59Plac-1: 59 CACCCAAGGCTCTGCTCCCACAAT 39 (Tm 74.7) information about the 2L telomere of salivary gland 59Plac-4: 59 GTGACTGTGCGTTAGGTCCTGTTCATTG 39 chromosomes. This telomere has been studied exten- (Tm 67.5) sively by molecular techniques. Junctions of the oli- 2R TAS-dist (TAS 2R/3R/X): 59 CTCTGTTTTTGGTGTAAAA GCATTGC 39 (Tm 67.1) go(A) tails of HeT-A to the distal end of TAS, as well as 2L SAT-R1 (TAS 2L/3L): 59 CATCTCGTTCATCCGCCACC 39 the proximal junction of TAS to single-copy regions, (Tm 70.0) have been deﬁned (Walter et al. 1995). We took 39 roo-F: 59 GCGATTCTCATGTCACCTATTTAAACCG 39 (Tm advantage of the very long retrotransposon arrays at 70.1) the chromosome ends of the Tel strain (Siriaco et al. allTART-R: 59 ATTCTTGGGGAGGGAGTTGAT 39 (Tm 67.1) TART-R2: 59 GACAGCGCCGAAAGGCACTG 39 (Tm 63.5) 2002). TAS were localized at the tip of 2LinaTel/ TART-R1: 59 GCCAGCGTCTATTAGGCGTTG 39 (Tm72.5) Oregon-R hybrid by in situ hybridization (Figure 1), in TART-roo-F: 59 TCGCAAAGGAATCTATCTATAAACAACGC bands 21B1 and 21B2. All material distal to this band 39 (Tm 69.3) must consist of the terminal retrotransposon array TART-roo-R: 59 GTGGGCGGAAATGAGTGAGATGG 39 (Tm (Walter et al. 1995). 72.5) Subsection 21A, which contains the terminal retrotransposon array, is very short in Oregon-R (Figure 2A). DNA sequencing and sequence analysis: Sequences were It appears as loose reticulate material, and we could not determined in an ABI 3700 sequencer using the Prism Ready Reaction DyeDeoxy terminators v.3.1 from Applied Biosystems detect any bands in this region, although four single (Foster City, CA). bands are indicated on the cytological map (Lindsley Determination of gene expression: Expression of the white and Zimm 1992). Two single and distinct bands are reporter gene was determined in both hemizygous and situated proximal of this reticulate material, which we homozygous males and females. Homozygotes were taken classify as 21B1 and 21B2. These two bands are easily directly from stock. Hemizygotes were produced by crossing males from the insertion stock to yw67c23 females that were identiﬁed in a Tel 2L chromosome (Figure 2B). In this devoid of suppressors of TPE. When SuPor-P lines were tested, strain, however, the 21B1 band appears slightly decon- the tester females also carried su(Hw)8, and homozygous densed. Consistent with the extended retrotransposon su(Hw)8 progeny were examined. To determine expression of array in Tel, the 21A region is considerably longer than the white reporter gene, individuals were collected within a few that in Oregon-R (Figure 2C) and as in Oregon-R has no hours of eclosion and aged 3 days. Expression of the yellow reporter gene was determined in males hemizygous for the banding pattern. This enlarged subsection consists of transgene. Photographs were taken using a Nikon SMZ-U two morphologically distinguished parts: a light proxi- stereomicroscope with the diaphragm half open. mal zone and denser distal zone, which sometimes has a Electron microscopy of polytene chromosomes: Oregon-R granular appearance (Figure 2B). In some cases, the and Tel individuals, as well as their hybrids, were used. distal zone appears to have a banded structure. How- Chromosomes were prepared for electron microscopy (EM) observations as described (Semeshin et al. 1989, 2001). Larval ever, it is impossible to count these structures in serial salivary glands were dissected in Ephrussi and Beadle solution sections because of their varying number and irregular (Ephrussi and Beadle 1936) and squashed in 45% acetic acid shape. In any case, both of the zones in 21A are 1770 H. Biessmann et al.

intercalary heterochromatin regions are densely packed; the 22A1–2 band is a typical region of intercalary heterochromatin (Zhimulev and Belyaeva 2003). Euchromatic bands are intermediate between these extremes. Regions 21C and D show several euchromatic bands. Our EM data can thus distinguish differently compacted chromatin morphologies in the telomere region: the distalmost retrotransposon array appears to be similar to interband regions, while TAS resembles banded material. Molecular analysis of integrations into the retrotransposon array: Comparing the flanking regions of 20,000 independent P-element integrations provided by the BDGP with HeT-A and TART-A,-B,-C sequences by BLASTN, we identified 6 integrations in HeT-A, 1 in TAHRE, and 24 in TART (Figure 3). The integration sites in HeT-A and TART were nonrandomly distributed and showed a strong bias for the last 1.5 kb of the TART 39-UTR. The factors influencing insertion site prefer- ence are not well understood, but correlate well with physical properties of chromatin rather than with nucleotide sequence, except for an increased GC content (Liao et al. 2000). A hotspot was observed 656 bp upstream of the oligo(A) tail of TART-B1, with 12 in- Figure 2.—Electron microscopy of 2L telomeres. Telo- dependent EPgy2 integrations, all with the 39 end of P meres of the 2L chromosome in Oregon-R (A), Tel (B), facing toward the oligo(A) tail. No SuPor-P insertions and an Oregon-R/Tel hybrid (C) are shown. Identities of were observed at this site. As our effort to identify these the cytological bands are indicated. In B, the two zones of subsection 21A1–4 are indicated with brackets labeled with one insertions began some time after the start of the BDGP or two asterisks. The bracket labeled TAS in C indicates the mobilization screen, only 13 of the 31 lines were avail- position of TAS DNA according to in situ hybridization data able to us. We characterized only three of the seven shown in Figure 1. Scale bar, 1 mm. insertions into the TART hotspot; thus, nine insertions in the retrotransposon array were analyzed (Table 1). We first mapped the insertion sites to chromosome by obviously decompacted. Chromosome regions with segregation analysis and determined the cytological decondensed bands are characteristic of active euchro- positions by in situ hybridization to polytene chromo- matic regions, for example, the middle and proximal somes. Seven insertions were located in the retrotrans- part of the 21B subsection (Figure 2). By contrast, poson array (Table 1), indicating that the terminal array

Figure 3.—Integration sites of P elements into telomeric retrotransposons HeT-A, TAHRE, and TART. Schematic of HeT-A, TAHRE, and TART elements with the position of P-element insertions iden- tiﬁed. Boldface type identiﬁes the insertions that were characterized. Domains in Drosophila Telomeres 1771

TABLE 1 P-element insertions into telomere regions

Insertiona Flanking sequence Integration site Distance to TAS Variegation KG01591 HeT-A, ORF 3R telomere 5 kb No KG10047 HeT-A, 396 bp from A-tail 2R telomere 396 bp Yes EY08176 TAHRE, GAG-ORF 2R telomere .12 kb No EY00453 TART-B1, 656 bp from A-tail 3L telomere .23 kb No EY00802b TART-B1, 656 bp from A-tail 3L telomere .19 kb No EY01387b TART-B1, 656 bp from A-tail 3L telomere .25 kb No EY09966b TART-C, 614 bp from A-tail 4 telomere .14 kb Yes EY09589 TART,59 and 39 repeat 2R at 46/47 NDc Yes EY10037 TART,59 and 39 repeat; stalker 2L base NDc Yes KG01031 X-TAS 2R telomere 0 Yes KG01528 X-TAS 2R telomere 0 ?d EY03383 X-TAS 2R telomere 0 Yes 316-1 X-TAS 3R telomere 0 Yes EY10337 X-TAS related 2L base NDc Yes EY09260 2L-TAS related 2L base NDc Yes a SuPor-P insertions are labeled ‘‘KG,’’ except for 316-1 (Roseman et al. 1995). EPgy2 insertions are labeled ‘‘EY.’’ b EY00453, EY00802, and EY01387 have all inserted into the same site of a TART element. c Not done. d yw67c23; su(Hw)8/su(Hw)8 flies carrying this element died. is not refractory to P-element integrations. Two others, accession no. X68130). The HeT-A element sequences with flanking regions similar to TART, were not located continue to its oligo(A)5-tail, which is attached to 3R at a telomere and were not considered further. TAS. The HeT-A/TAS junction is located within the 173- Because the oligo(A) tails of the telomeric retrotrans- bp repeat unit that is also in the 1.8-kb repeat of the posons always face proximally (Biessmann et al. 1993), X TAS (Karpen and Spradling 1992). the sequences flanking the P element can be used to l libraries were established from three integrations in determine its orientation. With this information, PCR the hotspot in the 39-UTR of TART-B1 656 bp upstream amplifications were attempted with extension times of of the oligo(A) tail (Figure 3) and screened with a yellow up to 15 min to amplify the DNA between the P element gene probe to clone the DNA proximal to the inser- and TAS using one primer specific for the region of the tions. Thus, 14 kb of flanking region was obtained from P element facing the centromere and another primer EY00453, 10 kb from EY00802, and 8 kb from EY01387. located in the 2L/3Lorthe2R/3R/X TAS regions Although all three P elements were located at the 3Ltelo- facing the chromosome end. This strategy was success- mere, their environments were very different (Figure 4). ful with KG01591 and KG10047, but failed with the In all three integrations, sequences immediately flank- other lines. For the latter insertion lines, libraries in ing the 39 end of P were identical and continued to the l phage were established and screened. oligo(A) tail of a TART-B1 element. However, past this The transgene in KG10047 was mapped by chromo- A-tail, the composition of the retrotransposon array some segregation and in situ hybridization to the 2R diverges. In EY00453, the A-tail is attached to a TART-B1 telomere. Primers 39Plarb-F and 2R TAS-dist amplified element at nucleotide position 5521 in its RT-ORF. After a 0.4-kb fragment from genomic DNA, which was se- the 39-UTR of this TART element are two HeT-A 39-UTRs, quenced from both ends, showing the P-element/HeT-A the first of which contains the last 358 bp of the ORF. junction and HeT-A sequences matching the 59-flanking In EY00802, a second 550-bp-long TART 39-UTR sequences determined by the BDGP. HeT-A sequences follows the oligo(A) tail of the TART-B1 that harbors continue to an oligo(A)17 tail, followed by a 48-bp the insertion. The oligo(A) tail of this second TART sequence identical to 2R TAS (Figure 4). The distance element is attached to a 3-kb HeT-A fragment truncated between the P element and TAS is only 359 bp. in its ORF. The nucleotide position of the junction The transgene in KG01591 was mapped to the tip of between the TART and the ORF of HeT-A is identical to 3R. The same primer set as above amplified a 5-kb DNA that in EY00453. This HeT-A element terminates in a fragment from genomic KG01591 DNA. We also cloned double oligo(A) tail attached to the 59-UTR of a HeT-A the region between the P element and TAS in l phage element, which terminates in its ORF with the BamHI and determined its sequence. The SuPor-P element was site used for cloning. integrated into the GAG-ORF at a site equivalent to The oligo(A) tail of the TART-B1 element that nucleotide 1340 of the HeT-A element 9D4 (GenBank harbors the EY01387 insertion is followed by three short 1772 H. Biessmann et al.

Figure 4.—Structure of retrotransposon arrays on the proximal side of P-element insertions. The HeT-A, TAHRE, and TART elements located adjacent to the P elements in several SuPor-P and EPgy2 lines were determined by restriction mapping and sequencing fragments isolated from l libraries. These maps show the structure of otherwise undisturbed retrotransposon arrays at the indicated telomeres. Restriction sites used for mapping and subclon- ing: EcoRI (R), BamHI (B), Xba, and XhoI.

(30- to 500-bp) TART 39-UTRs. Proximal to this arrange- or, in the case of EY01387, 39 roo-F, failed to produce any ment is the 59-UTR of another TART-B1 element, which fragments. continues into the GAG-ORF. Surprisingly, sequences at The integration in strain EY08176 was in the GAG the proximal XbaI site that was used for cloning ORF of TAHRE with the 59 end of P facing proximally. originated from a roo/B104 retrotransposon. The distal Sequencing of the 39- and 59-flanking regions obtained and proximal junctions were amplified using primers by inverse PCR showed that the TAHRE element that TART-roo-F, TART-roo-R, and a primer from the roo harbors the insertion is full length. The presence of a inverted repeats. Sequencing showed the precise con- characteristic TAHRE RT ORF was confirmed by PCR tinuation of TART GAG sequences at the proximal side and sequencing. Proximal to this element and two very of the roo insertion and a 5-bp duplication characteristic short 39-UTRs of 20 and 9 bp lies the 59-UTR of a HeT-A of the roo transposable element. Moreover, PCR with element, which extends into the ORF at the end of the TART-roo-F and TART-roo-R primers amplified a 9-kb cloned fragment. fragment from genomic EY01387 DNA, which proved Identification of P-element insertions into TAS: We by partial sequencing to be a full-length roo element. screened P-element flanks obtained from the BDGP Finally, using a primer from the proximal side of roo and with the 2L TAS repeat and the 1.8-kb repeat of X TAS, one in the TART RT (allTART-R), we amplified a which together represent almost all of the known TAS fragment from genomic EY01387 DNA, whose pre- sequences. One insertion flanked by 2L TAS and 109 dicted identity was confirmed by sequencing. There insertions in the 1.8-kb repeat of X TAS were identified, are about 80 copies of roo in the genome, spread out but only six stocks were available for our analyses (Table 1). over all the chromosome arms (Scherer et al. 1982). Sequences related to TAS, however, also occur in loca- Due to the limits of fragment size clonable into l tions other than the telomeres. After genetic isolation of phage, we were unable to isolate the entire stretch of P insertion chromosomes, the flanking sequences were DNA between P and TAS in any of these three EY strains. obtained by inverse PCR and sequenced. The EY10337 Long-range PCR amplifications from genomic DNA and EY09260 elements had inserted into TAS-related with one primer that recognizes 3L TAS (2L SAT-R1) sequences near the centromere of chromosome 2 and and the other primer from 39 P(39 P-ry-4 or 39 Plarb-F) were excluded from further analysis. In situ hybridizations Domains in Drosophila Telomeres 1773 located the insertions of KG01031, KG01528, and EY03383 at telomere 2R. Their flanking regions, as isolated by inverse PCR, had similarity to the 173-bp repeats within the 1.8-kb repeat sequence defined by X TAS. A stock of one other insertion of the SuPor-P element into the 3R TAS, 316-1, was also included in our studies (Roseman et al. 1995). Expression of reporter genes at telomeric sites: Expression of reporter genes inserted into the terminal retrotransposon array was compared to gene expression when the same P-element construct was integrated into TAS or euchromatin. To examine the expression of the reporter genes, null mutations y1 and w67c23 were used at the normal genomic locations of these genes. Insertions of the SuPor-P and EPgy2 elements produced different phenotypes and will be considered separately. Individ- uals in the KG lines, carrying the SuPor-P element, exhibited relatively high levels of white and yellow expression (Figure 5). As noted previously (Golubovsky et al. 2001), males consistently show darker eye color than females of the same genotype. We, therefore, present only females in the discussion of SuPor-P expression. The w gene in the SuPor-P element is adjacent to an eye-specific enhancer and surrounded by SU(HW) binding sites, which act as insulators. Integrants with SuPor-P thus show a strong red eye-color phenotype in a wild-type background, independent of the integration site. The su(Hw)8 mutation, therefore, was introduced into the SuPor-P lines to observe the effects of the surrounding sequence on w gene expression. Females hemizygous for the transgene and homozygous for su(Hw)8 were obtained by crossing KG males to y2 sc w; su(Hw)8 females. The transgene inserted into 2R and 3R TAS shows a strongly repressed and variegated eye-color phenotype, especially when homozygous (Figure 5). KG10047 also shows weak w gene expression and strong variegation, suggesting some spreading of silencing from TAS into HeT-A. All three of the insertions into Figure 5.—Phenotypes of marker genes associated with in- or close to TAS exhibit more repression and variegation sertions. The left column of images shows expression of re- in transgene homozygotes than in hemizygotes. porter genes in TAS. The two middle columns show KG01591 females, however, show very little suppression expression of these genes when they are in the terminal retro- or variegation of the transgene and resemble females transposon array. The right column shows the expression of with a euchromatic insertion. Weak repression is ob- euchromatic controls. The eyes express the white gene; the abdomens express yellow. served in hemizygous females, but this is not seen in males or homozygous females. Thus, the w reporter genes in three SuPor-P integrations in TAS, or in HeT-A insertions into TART, all at least 19 kb distal from 3L very close to TAS, are strongly repressed and variegate, TAS, exhibit essentially the same eye-color phenotype as while a similar w reporter gene in HeT-A farther from euchromatic EPgy2 elements, while EY03383, which is in TAS is only weakly repressed. 2R TAS, shows very little or no w expression. Unlike the The EPgy2 insertion lines show orange to pale eye other EPgy2 insertions into the terminal array, EY08176 color, depending on the location of the insertion. Given exhibits an eye color that is slightly lighter than males the relatively light eye colors and the greater w expres- with euchromatic insertions (Figure 5). The reason for sion in males, we discuss expression in males here. The this difference is not known. Variegation of the w mini-white gene in EPgy2 lacks the eye-specific enhancer. reporter gene is not seen for any of these insertion Thus, integrations into euchromatin exhibit a light lines. Expression of w in EY03383 is virtually indistin- orange eye color in hemizygotes and a darker orange guishable from a null. Thus, expression of the w re- eye color in homozygotes (Figure 5). Three EPgy2 porter in the EPgy2 transgene resembles that in SuPor-P, 1774 H. Biessmann et al. because both reporters are strongly repressed when in pressors of TPE (Shanower et al. 2005). We, therefore, TAS, but only weakly, or not visibly, repressed when in asked what effect the gppXXV mutation has on expression the terminal array. of the EPgy2 insertions in the terminal array. As with the Both the EPgy2 and the SuPor-P constructs have a yellow 2L deficiencies, we found that gppXXV did not change the gene that is not surrounded by SU(HW) binding sites. level of expression of the inserts in the terminal array. Expression of this y reporter, which is reflected in abdomen pigmentation, especially in the last two male tergites, is independent of the nature of the P-element construct, DISCUSSION but reflects the nature of chromatin surrounding the transgene. Males carrying a marked P element in TAS Noncoding repetitive sequences make up a large show considerable repression and variegation of the y portion of eukaryotic genomes. Large blocks of repetitive reporter (Figure 5). Most males with an insertion in the DNA are mostly packaged into heterochromatin around retrotransposon array exhibited no discernable repres- centromeres, but their organization and structure has sion of y and resembled control males with a euchro- been difficult to analyze. By contrast, the smaller regions matic insertion. The y gene in KG10047 males, however, of heterochromatin at the telomeres provide an oppor- exhibited minor variegation, possibly due to close vicin- tunity to study their DNA and protein composition. Our ity to TAS. Thus, y expression in the abdomens of these EM data provide the first clear evidence that two distinct flies reflects w expression in their eyes. chromatin subdomains exist within a telomeric region: It is possible that at least some of the KG lines, and the terminal retrotransposon array is diffuse and mor- possibly others, were discarded because they exhibited phologically resembles interband regions or puffs, while variegation (Bellen et al. 2004). This might have pre- the subterminal TAS region resembles regular bands. vented us from identifying variegating elements in the Our results show that the terminal retrotransposon array terminal retrotransposon array. Only a small subset of at Drosophila telomeres is not refractory to the integra- the insertions analyzed by the GDGP, however, appear to tion of P elements, but reporter genes inserted into these have been subject to this treatment; there is no mention two domains of the Drosophila telomere are affected that the collections as a whole were culled of variegating differently. Except for the P-element integrations de- elements (Bellen et al. 2004). In any case, we asked what scribed here, the insertion of a full-length roo element proportion of the insertions we examined exhibited into the otherwise stereotypical HeT-A/TAHRE/TART variegation (Table 1). Of the four KG elements, two var- array is the only documented insertion of a transposon iegated, one did not, and one could not be tested be- into the telomeric retrotransposon region and demon- cause yw67c23; su(Hw)/su(Hw) flies carrying this insertion strates that transposable elements are capable of insert- did not survive. In addition, five of the nine EPgy2 in- ing into the telomeric array. sertions exhibited variegation. As expected, all three of Configuration of otherwise undisturbed retrotrans- the inserts in or within 1 kb of TAS variegate. Thus, we poson arrays at telomeres: Analyzing the structure and see no evidence of a bias against variegating insertions. composition of the telomeric retrotransposon array can white expression in many of the insertion lines, provide information about the dynamic events of new especially those carrying the EPgy2 element, is less than transpositions and terminal erosion that shape the that seen in wild type. We, therefore, asked to what organization of chromosome ends in Drosophila. HeT-A, extent expression of the EPgy2 element might be in- TAHRE, and TART sequences are predominantly found creased by the presence of a dominant suppressor of at telomeres, but tandem arrays of relatively short HeT-A telomeric silencing. As most suppressors of TPE are segments also occur in autosomal centromeric hetero- deficiencies of 2LTAS(Golubovsky et al. 2001; chromatin and in interstitial regions of the heterochro- Mason et al. 2004), we examined the effects of three matic Y chromosome (Young et al. 1983; Traverse such deficiencies in different genetic backgrounds, and Pardue 1989; Agudo et al. 1999). Thus, isolation of Df(2L)net62, l(2)gl26,andSu(TS)M1.Noneofthese HeT-A sequences from genomic DNA libraries does affected w expression in any of the EPgy2 elements in not ensure that the cloned fragments originated from the terminal array. This is as expected, as the EPgy2 a telomere (Biessmann et al. 1993). By walking from element in the terminal array expresses to the same TAS into the terminal retrotransposon array, two nor- extent as in euchromatin (Figure 5). The extreme mal telomeres have been analyzed, defining the junc- repression of w seen in EY03383 (Figure 5) shows only tion between the proximalmost HeT-A element and slight suppression in the presence of these TAS defi- the subtelomeric TAS (Karpen and Spradling 1992; ciencies, but the moderate repression of y in EY03383 Walter et al. 1995). Directional cloning of chromo- is strongly suppressed to give an abdomen with very some ends (Biessmann et al. 1993) demonstrated that little variegation. Thus, this element in TAS behaves the oligo(A) tails of HeT-A elements face toward the similarly to other TAS insertions. centromere. Mutations in gpp, a gene that encodes the histone H3 Results presented here confirm and extend these lysine 79 methytransferase, also act as dominant sup- observations. The telomeric retrotransposon arrays are Domains in Drosophila Telomeres 1775 highly polymorphic. HeT-A, TAHRE,andTART elements according to the insertion locations, but telomeric are intermingled, and the elements are often truncated insertions into TAS exhibit very modest, if any, un- at the 59 end, although full-length elements were also derrepresentation in polytene chromosomes. found. Our results are consistent with recent analyses of Gene silencing at telomeres: Transcriptional silenc- BACs that span the TAS regions and extend into the ing is a sensitive criterion for defining heterochromatin. terminal arrays (Abad et al. 2004a) and support the idea TAS is likely to be directly involved in silencing telome- of a dynamic Drosophila telomere. The abundance of ric transgenes, suggesting a heterochromatic character 59-truncated retroelements is striking. While these in- (Levis et al. 1993; Cryderman et al. 1999; Golubovsky complete elements will not produce full-length tran- et al. 2001; Karpen and Spradling 1992). Indeed, a 6-kb scripts of the element, they may provide additional 2L TAS array exhibited array-length-dependent and promoters for transcription of proximally located ele- orientation-dependent repression of a w reporter gene ments (Danilevskaya et al. 1997). (Kurenova et al. 1998), and a single 1.2-kb region The nature of Drosophila telomeres: Heterochro- derived from the 1.8-kb X TAS repeat induced pairing- matin in Drosophila is distinct from euchromatin by sensitive repression of a reporter gene (Boivin et al. several criteria, including cytological staining, timing 2003). Telomeric silencing is different from silencing of replication, a propensity for ectopic pairing, under- that occurs in closely linked copies of mini-white genes replication in polytene chromosomes, and ability to (Dorer and Henikoff 1994), because TPE on the repress gene activity (Weiler and Wakimoto 1995; major autosomes does not respond to mutations in Zhimulev 1998; Grewal and Elgin 2002). Most het- Su(var)205, the gene that encodes HP1 (Wallrath and erochromatin is found around the centromeres, but Elgin 1995; Cryderman et al. 1999). smaller regions are present at the telomeres and scat- P-element insertions allowed us to detect telomeric tered around the genome as intercalary heterochro- subdomains by their different ability to silence inte- matin (Zhimulev and Belyaeva 2003). It has been grated transgenes. In agreement with the previous inferred that telomeres exist in a heterochromatic studies, we find that reporter genes surrounded by configuration. While this may be true in part, most TAS are repressed. The same P-element constructs in- studies lack the resolution to distinguish between sub- serted into the terminal retrotransposon array, however, domains within the telomeric region. For instance, generally resemble euchromatic insertions in their level earlier observations showed that some but not all telo- of reporter gene expression, except when they are lo- meres are replicated late; however, they are not among cated close to TAS. These observations support our the last sequences to be replicated during S phase model for TPE, which proposes that variegated expres- (Berendes and Meyer 1968; Zhimulev and Belyaeva sion of reporter genes at telomeres is the result of 2003). competition between the repressive effects of TAS and Ectopic pairing is a feature often associated with the stimulating effects of the HeT-A promoters (Mason heterochromatin. Telomere-telomere interactions have et al. 2000). This interaction between HeT-A and TAS been well documented and shown to vary widely might constitute a mechanism by which TAS regulate between strains and over time (Berendes and Meyer telomere elongation by controlling HeT-A promoter 1968). While the nature of these ectopic contacts is not activity (Mason et al. 2003a). known, threads connecting the telomeres, at least in The HP1 protein has been reported to play a role in some cases, hybridize with HeT-A (Rubin 1978; Young telomere capping, elongation, and HeT-A transcription et al. 1983; Traverseand Pardue 1989) and TAS probes (Savitsky et al. 2002; Perrini et al. 2004). The mech- (Karpen and Spradling 1992). The observation that anism by which HP1 might act to promote HeT-A tran- telomere interactions are dramatically increased in the scription and elongation is unclear, as it is not possible Tel strain, which has extremely long telomeric retro- to estimate the number of transcripts per genomic transposon arrays, suggests that these interactions are HeT-A copy number, because both increase in the mediated by the retrotransposons or proteins associated presence of a mutation in Su(var)205. Further, muta- with them. These interactions are resolved in diploid tions in Su(var)205 do not affect TPE (Wallrath and brain cells in mitosis, arguing against covalent DNA- Elgin 1995; Cryderman et al. 1999), and HP1 does not DNA bonds (Siriaco et al. 2002). bind to the long terminal retrotransposon arrays carried Direct comparison of copy number of TAS and HeT-A by Tel mutants, except at the cap region (Siriaco et al. sequences in diploid vs. polytene tissues to determine 2002). possible underreplication is not possible, because these The relative position of heterochromatic telomeric sequences are also found in other genomic locations. domains in Drosophila appears to be reversed from that Therefore, P-element insertions into the subtelomeric in telomeres of other eukaryotes. In yeast, the terminal- TAS and the pericentric heterochromatin have been used most telomeric repeats are heterochromatic by virtue of as tags to address this question (Karpen and Spradling their nonnucleosomal chromatin packaging and their 1992; Zhang and Spradling 1995; Wallrath et al. gene silencing ability even in nontelomeric locations 1996). These measurements reflect vast differences (Tham and Zakian 2002), while insertions of reporters 1776 H. Biessmann et al. into the subtelomeric Y9 elements are generally sub- of the Y chromosome of Drosophila melanogaster contains a tan- jected to very little, if any, repression (Pryde and Louis dem array of telomeric HeT-A- and TART-related sequences. Nu- cleic Acids Res. 27: 3318–3324. 1999). This difference between Drosophila and yeast Altschul, S. F., T. L. Madden,A.A.Schaffer,J.Zhang,Z.Zhang may reflect the fundamental difference in how the et al., 1997 Gapped BLAST and PSI-BLAST: a new generation of terminal DNA structures are generated. In yeast and protein database search programs. Nucleic Acids Res. 25: 3389– 3402. most other eukaryotes, simple repeats are added by Bellen, H. J., R. W. Levis,G.Liao,Y.He,J.W.Carlson et al., telomerase onto the chromosome end, where they bind 2004 The BDGP gene disruption project: single transposon in- a number of proteins and assume a heterochromatin- sertions associated with 40% of Drosophila genes. Genetics 167: right 761–781. like state called the telosome (W et al. 1992). In Berendes, H. D., and G. F. Meyer, 1968 A specific chromosome el- contrast, the terminal retrotransposon arrays in Dro- ement, the telomere of Drosophila polytene chromosomes. Chro- sophila are themselves the source of RNA transcripts mosoma 25: 184–197. Biessmann, H., B. Kasravi,K.Jakes,T.Bui,K.Ikenaga et al., that are essential components in telomere elongation by 1993 The genomic organization of HeT-A retroposons in Dro- serving as mRNA for the synthesis of proteins necessary sophila melanogaster. Chromosoma 102: 297–305. for transposition and as templates for reverse transcrip- Biessmann, H., and J. M. Mason, 1988 Progressive loss of DNA sequences from terminal chromosome deficiencies in Drosophila tion. The fact that HeT-A and TART elements are actively melanogaster. EMBO J. 7: 1081–1086. transcribed would not necessarily require that they be Biessmann, H., S. Prasad,M.F.Walter and J. M. Mason, embedded in a euchromatic structure, because a 2005 Euchromatic and heterochromatic domains at Drosoph- ila telomeres. Biochem. Cell Biol. 83: 477–485. number of active genes transcribed from Pol II pro- Boivin, A., C. Gally,S.Netter,D.Anxolabehere and S. Ronsseray, moters are known to be located in centric heterochro- 2003 Telomeric-associated sequences of Drosophila recruit matin (Weiler and Wakimoto 1995). These promoters Polycomb-group proteins in vivo and can induce pairing-sensitive repression. Genetics 164: 195–208. appear well adapted to their heterochromatic environ- Cenci, G., L. Ciapponi and M. Gatti, 2005 The mechanism of telo- ment and display PEV when moved to euchromatic mere protection: a comparison between Drosophila and hu- locations. It has been proposed that the HeT-A promoter mans. Chromosoma 114: 135–145. ryderman orris iessmann lgin may belong to this category (Pardue and DeBaryshe C , D. E., E. J. M ,H.B ,S.C.R.E and L. L. Wallrath, 1999 Silencing at Drosophila telomeres: nu- 2000; George and Pardue 2003). However, our find- clear organization and chromatin structure play critical roles. ings suggest that the HeT-A promoter is more likely a EMBO J. 18: 3724–3735. anilevskaya rkhipova raverse euchromatic promoter, consistent with the observation D , O. N., I. R. A ,K.L.T and M. L. Pardue, 1997 Promoting in tandem: the promoter for telo- that it functions normally when moved to other euchro- mere transposon HeT-A and implications for the evolution of matic positions (George and Pardue 2003) and that retroviral LTRs. Cell 88: 647–655. orer enikoff HeT-A elements placed upstream of a telomeric white D , D. R., and S. H , 1994 Expansions of transgene re- olubovsky ason peats cause heterochromatin formation and gene silencing in (G et al. 2001; M et al. 2003b) or yellow Drosophila. Cell 77: 993–1002. (Kahn et al. 2000) gene have an activating, not a Ephrussi, B., and G. B. Beadle, 1936 Technique of transplantation repressing, influence on gene expression. for Drosophila. Amer. Naturalist 70: 218–226. Fanti, L., G. Giovinazzo,M.Berloco and S. Pimpinelli, 1998 The We thank Bob Levis for providing TART sequences and fly stocks. heterochromatin protein 1 prevents telomere fusions in Dro- Other stocks were provided by Pam Geyer, the Berkeley Drosophila sophila. Mol. Cell 2: 527–538. Genome Project, and the Bloomington Drosophila Stock Center. The FlyBase Consortium, 2003 The FlyBase database of the Drosoph- BDGP also provided P-element flanking sequences. We also thank Igor ila genome projects and community literature. Nucleic Acid Res. Zhimulev for discussions, Alfredo Villasante for unpublished infor- 31: 172–175. George, J. A., and M. L. Pardue, 2003 The promoter of the hetero- mation, and Janine Santos, Marilyn Diaz, and members of the Mason chromatic Drosophila telomeric retrotransposon, HeT-A, is ac- lab for critically reading the manuscript. Oscar Ramirez, Patrick tive when moved into euchromatic locations. Genetics 163: Williams, Diana Le, Jonathan Cheah, and Max Biessmann performed 625–635. excellent lab work. This project was supported by the U.S. Public Golubovsky, M. D., A. Y. Konev,M.F.Walter,H.Biessmann and Health Service grant GM-56729 to H.B. Work in Novosibirsk was J. M. Mason, 2001 Terminal retrotransposons activate a sub- supported by a grant from the program of the Russian Academy of telomeric white transgene at the 2L telomere in Drosophila. Sciences in Physico-Chemical Biology N 10.1. This research was Genetics 158: 1111–1123. supported, in part, by the Intramural Research Program of the Grewal, S. I., and S. C. Elgin, 2002 Heterochromatin: new possi- National Institutes of Health, National Institute of Environmental bilities for the inheritance of structure. Curr. Opin. Genet. Health Sciences. Dev. 12: 178–187. Harrison, D. A., D. A. Gdula,R.S.Coyne and V. G. Corces, 1993 A leucine zipper domain of the suppressor of Hairy-wing protein mediates its repressive effect on enhancer function. LITERATURE CITED Genes Dev. 7: 1966–1978. Kahn, T., M. Savitsky and P. Georgiev, 2000 Attachment of HeT-A Abad, J. P., B. de Pablos,K.Osoegawa,P.J.de Jong,A.Martin- sequences to chromosomal termini in Drosophila melanogaster Gallardo et al., 2004a Genomic analysis of Drosophila mela- may occur by different mechanisms. Mol. Cell. Biol. 20: 7634– nogaster telomeres: full-length copies of HeT-A and TART 7642. elements at telomeres. Mol. Biol. Evol. 21: 1613–1619. Karpen,G.H.,andA.C.Spradling, 1992 Analysis of subtelo- Abad, J. P., B. de Pablos,K.Osoegawa,P.J.de Jong,A.Martin- meric heterochromatin in the Drosophila minichromosome Gallardo et al., 2004b TAHRE, a novel telomeric retrotranspo- Dp1187 by single-P element insertional mutagenesis. Genetics son from Drosophila melanogaster, reveals the origin of Drosophila 132: 737–753. telomeres. Mol. Biol. Evol. 21: 1620–1624. Kurenova, E., L. Champion,H.Biessmann and J. M. Mason, Agudo, M., A. Losada,J.P.Abad,S.Pimpinelli,P.Ripoll et al., 1998 Directional gene silencing induced by a complex subtelo- 1999 Centromeres from telomeres? The centromeric region meric satellite from Drosophila. Chromosoma 107: 311–320. Domains in Drosophila Telomeres 1777

Levis, R. W., R. Ganesan,K.Houtchens,L.A.Tolar and F. M. telomere elongation in Drosophila melanogaster. Mol. Cell. Biol. Sheen, 1993 Transposons in place of telomeric repeats at a Dro- 22: 3204–3218. sophila telomere. Cell 75: 1083–1093. Scherer, G., C. Tschudi,J.Perera,H.Delius and V. Pirrotta, Liao, G. C., E. J. Rehm and G. M. Rubin, 2000 Insertion site pref- 1982 B104, a new dispersed repeated gene family in Drosophila erences of the P transposable element in Drosophila melanogaster. melanogaster and its analogies with retroviruses. J. Mol. Biol. 157: Proc. Natl. Acad. Sci. USA 97: 3347–3351. 435–451. Lindsley, D. L., and G. G. Zimm, 1992 The Genome of Drosophila mel- Semeshin, F., S. Belyaeva and F. Zhimulev, 2001 Electron micro- anogaster. Academic Press, San Diego. scope mapping of the pericentric and intercalary heterochro- Mason, J. M., and H. Biessmann, 1995 The unusual telomeres of matic regions of the polytene chromosomes of the mutant Drosophila. Trends Genet. 11: 58–62. Suppressor of underreplication in Drosophila melanogaster. Chromoso- Mason, J. M., A. Haoudi,A.Y.Konev,E.Kurenova,M.F.Walter ma 110: 487–500. et al., 2000 Control of telomere elongation and telomeric si- Semeshin, V. F., S. A. Demakov,M.Perez Alonso,E.S.Belyaeva, lencing in Drosophila melanogaster. Genetica 109: 61–70. J. J. Bonner et al., 1989 Electron microscopical analysis of Dro- Mason, J. M., A. Y. Konev and H. Biessmann, 2003a Telomeric po- sophila polytene chromosomes. V. Characteristics of structures sition effect in Drosophila melanogaster reflects a telomere length formed by transposed DNA segments of mobile elements. Chro- control mechanism. Genetica 117: 319–325. mosoma 97: 396–412. Mason, J. M., A. Y. Konev,M.D.Golubovsky and H. Biessmann, Shanower,G.A.,M.Muller,J.L.Blanton,V.Honti,H.Gyurkovics 2003b Cis- and trans-acting influences on telomeric position ef- et al., 2005 Characterization of the grappa gene, the Drosophila his- fect in Drosophila melanogaster detected with a subterminal trans- tone H3 lysine 79 methyltransferase. Genetics 169: 173–184. gene. Genetics 163: 917–930. Siriaco, G. M., G. Cenci,A.Haoudi,L.E.Champion,C.Zhou et al., Mason, J. M., J. Ransom and A. Y. Konev, 2004 A deficiency screen 2002 Telomere elongation (Tel), a new mutation in Drosophila mel- for dominant suppressors of telomeric silencing in Drosophila. anogaster that produces long telomeres. Genetics 160: 235–245. Genetics 168: 1353–1370. Tham, W. H., and V. A. Zakian, 2002 Transcriptional silencing at Mefford, H. C., and B. J. Trask, 2002 The complex structure and Saccharomyces telomeres: implications for other organisms. On- dynamic evolution of human subtelomeres. Nat. Rev. Genet. cogene 21: 512–521. 3: 91–102. Traverse, K. L., and M. L. Pardue, 1989 Studies of He-T DNA se- Pardue, M. L., and P. G. DeBaryshe, 2000 Drosophila telomere quences in the pericentric regions of Drosophila chromosomes. transposons: genetically active elements in heterochromatin. Chromosoma 97: 261–271. Genetica 109: 45–52. Wallrath, L. L., and S. C. R. Elgin, 1995 Position effect variega- Pardue, M. L., and P. G. DeBaryshe, 2003 Retrotransposons pro- tion in Drosophila is associated with an altered chromatin struc- vide an evolutionarily robust non-telomerase mechanism to ture. Genes Dev. 9: 1263–1277. maintain telomeres. Annu. Rev. Genet. 37: 485–511. Wallrath, L. L., V. P. Guntur,L.E.Rosman and S. C. R. Elgin, Parkhurst, S. M., D. A. Harrison,M.P.Remington,C.Spana,R.L. 1996 DNA representation of variegating heterochromatic Kelley et al., 1988 The Drosophila su(Hw) gene, which con- P-element inserts in diploid and polytene tissues of Drosophila trols the phenotypic effect of the gypsy transposable element, melanogaster. Chromosoma 104: 519–527. encodes a putative DNA-binding protein. Genes Dev. 2: 1205– Walter, M. F., C. Jang,B.Kasravi,J.Donath,B.M.Mechler et al., 1215. 1995 DNA organization and polymorphism of a wild-type Dro- Perrini, B., L. Piacentini,L.Fanti,F.Altieri,S.Chichiarelli et al., sophila telomere region. Chromosoma 104: 229–241. 2004 HP1 controls telomere capping, telomere elongation, and Weiler, K. S., and B. T. Wakimoto, 1995 Heterochromatin and telomere silencing by two different mechanisms in Drosophila. gene expression in Drosophila. Annu. Rev. Genet. 29: 577–605. Molecular Cell 15: 467–476. Wright,J.H.,D.E.Gottschling andV.A.Zakian, Pryde, F. E., H. C. Gorham and E. J. Louis, 1997 Chromosome 1992 Saccharomyces telomeres assume a non-nucleosomal ends: all the same under their caps. Curr. Opin. Genet. Dev. 7: chromatin structure. Genes Dev. 6: 197–210. 822–828. Young, B. S., A. Pession,K.L.Traverse,C.French and M. L. Pardue, Pryde, F. E., and E. J. Louis, 1999 Limitations of silencing at native 1983 Telomere regions in Drosophila share complex DNA se- yeast telomeres. EMBO J. 18: 2538–2550. quences with pericentric heterochromatin. Cell 34: 85–94. Roseman, R. R., E. A. Johnson,C.K.Rodesch,M.Bjerke,R.N. Zhang, P., and A. C. Spradling, 1995 The Drosophila salivary gland Nagoshi et al.,1995 AP element containing suppressor of hairy- chromocenter contains highly polytenized subdomains of mi- wing binding regions has novel properties for mutagenesis in totic heterochromatin. Genetics 139: 659–670. Drosophila melanogaster. Genetics 141: 1061–1074. Zhimulev, I. F., 1998 Polytene chromosomes, heterochromatin, Rubin, G. M., 1978 Isolation of a telomeric DNA sequence from Dro- and position effect variegation. Adv. Gen. 37: 1–555. sophila melanogaster. Cold Spring Harbor Symp. Quant. Biol. 42: Zhimulev, I. F., and E. S. Belyaeva, 2003 Intercalary heterochro- 1041–1046. matin and genetic silencing. BioEssays 25: 1040–1051. Savitsky, M., O. Kravchuk,L.Melnikova and P. Georgiev, 2002 Heterochromatin protein 1 is involved in control of Communicating editor: K. G. Golic